WorldWideScience

Sample records for cop operon required

  1. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  2. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  3. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

    2015-08-01

    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  4. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air Act...

  5. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  6. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  7. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from the...

  8. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  9. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  10. Streptococcus mutans copper chaperone, CopZ, is critical for biofilm formation and competitiveness.

    Science.gov (United States)

    Garcia, S S; Du, Q; Wu, H

    2016-12-01

    The oral cavity is a dynamic environment characterized by hundreds of bacterial species, saliva, and an influx of nutrients and metal ions such as copper. Although there is a physiologic level of copper in the saliva, the oral cavity is often challenged with an influx of copper ions. At high concentrations copper is toxic and must therefore be strictly regulated by pathogens for them to persist and cause disease. The cariogenic pathogen Streptococcus mutans manages excess copper using the copYAZ operon that encodes a negative DNA-binding repressor (CopY), the P1-ATPase copper exporter (CopA), and the copper chaperone (CopZ). These hypothetical roles of the copYAZ operon in regulation and copper transport to receptors led us to investigate their contribution to S. mutans virulence. Mutants defective in the copper chaperone CopZ, but not CopY or CopA, were impaired in biofilm formation and competitiveness against commensal streptococci. Characterization of the CopZ mutant biofilm revealed a decreased secretion of glucosyltransferases and reduced expression of mutacin genes. These data suggest that the function of copZ on biofilm and competitiveness is independent of copper resistance and CopZ is a global regulator for biofilm and other virulence factors. Further characterization of CopZ may lead to the identification of new biofilm pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  12. CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803

    Science.gov (United States)

    Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

    2015-01-01

    Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux–resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ∼3 × 10−16). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. PMID:25545960

  13. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  14. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  15. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    Science.gov (United States)

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  16. THE CALVIN CYCLE ENZYME PHOSPHOGLYCERATE KINASE OF XANTHOBACTER-FLAVUS REQUIRED FOR AUTOTROPHIC CO2 FIXATION IS NOT ENCODED BY THE CBB OPERON

    NARCIS (Netherlands)

    MEIJER, WG

    1994-01-01

    During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic

  17. Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

    Science.gov (United States)

    Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

    2017-07-17

    Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

  18. COP21: defense stakes

    International Nuclear Information System (INIS)

    Coldefy, Alain; Hulot, Nicolas; Aichi, Leila; Tertrais, Bruno; Paillard, Christophe-Alexandre; Piodi, Jerome; Regnier, Serge; Volpi, Jean-Luc; Descleves, Emmanuel; Garcin, Thierry; Granholm, Niklas; Wedin, Lars; Pouvreau, Ana; Henninger, Laurent

    2015-01-01

    The 21. Conference of the Parties (COP21) from the UN Framework Convention took place in Paris between November 30 and December 11, 2015. The challenge is to reach a universal agreement of fight against global warming and to control the carbon footprint of human activities. This topic is in the core of the Defense Ministry preoccupations. This special dossier takes stock of the question of defense issues linked with global warming. The dossier comprises 13 papers dealing with: 1 - COP21: defense stakes (Coldefy, A.); 2 - Warfare climate, a chance for peace (Hulot, N.); 3 - COP21 and defense (Aichi, L.); 4 - A war climate? (Tertrais, B.); 5 - Challenges the World has to face in the 21. century (Paillard, C.A.); 6 - Desertification: a time bomb in the heart of Sahel (Piodi, J.); 7 - The infrastructure department of defense in the fight against climate disturbance (Regnier, S.); 8 - Fight against global warming, a chance for the forces? (Volpi, J.L.); 9 - Sea and sustainable development (Descleves, E.); 10 - Rationales of Arctic's surrounding powers (Garcin, T.); 11 - Arctic: strategic stake (Granholm, N.; Wedin, L.); 12 - Strategic impact of Turkey's new energy choices (Pouvreau, A.); 13 - Climate and war: a brief historical outlook (Henninger, L.)

  19. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  20. 30 CFR 285.628 - How will MMS process my COP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my COP? 285.628 Section... Requirements Contents of the Construction and Operations Plan § 285.628 How will MMS process my COP? (a) The MMS will review your submitted COP, and the information provided pursuant to § 285.627, to determine...

  1. 30 CFR 285.620 - What is a Construction and Operations Plan (COP)?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Construction and Operations Plan (COP... Information Requirements Construction and Operations Plan for Commercial Leases § 285.620 What is a Construction and Operations Plan (COP)? The COP describes your construction, operations, and conceptual...

  2. Mapping the surface of MNKr2 and CopZ - identification of residues critical for metallotransfer

    International Nuclear Information System (INIS)

    Jones, C.E.; Cobine, P.A.; Dameron, C.T.

    2001-01-01

    Full text: Cells utilise a network of proteins that include CPx-type ATPases and metallochaperones to balance intracellular copper concentration. The Menkes ATPase has six N-terminal domains which bind Cu(I) and are critical for ATPase function. The NMR solution structure of the second domain (MNKr2) shows that the structure adopts an 'open-faced β-sandwich' fold, in which two α-helices lie over a single four stranded β-sheet. The global fold is identical to the bacterial copper chaperone CopZ MNKr2 is unable to substitute for CopZ in copper transfer to the cop operon represser, CopY. To investigate how structure affects function we have analysed the surface features of MNKr2 and CopZ Despite having the same global fold, MNKr2 and CopZ have contrasting electrostatic surfaces, which may partially explain the inability of MNKr2 to transfer copper to CopY

  3. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  4. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  5. The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

    Science.gov (United States)

    Henke, Sarah K; Cronan, John E

    2016-11-01

    Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

  6. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    Science.gov (United States)

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  7. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  8. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  9. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  10. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  11. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  12. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  13. COP21, The Force Awakens

    International Nuclear Information System (INIS)

    2015-01-01

    After four years of hard work, the COP21 has culminated in a climate agreement that was accepted by 195 countries. This agreement is the first to involve all world economies in the fight against climate change. Beyond the pledges made by the governments, the COP21 also aimed to highlight solutions that are backed by the private sector. A testimony to companies' determination to become a part of the movement, several initiatives were launched in a wide range of sectors over the course of the two conference weeks. Responding to these transformations, the financial sector also made several announcements, promising that it would divest from the most polluting energies, increase investments in clean technologies, stimulate financial innovation (green bonds, LDN) and measure carbon footprints. Investors have understood once and for all that they must adapt their investment strategies if they want to face up to the challenges of the current transition to a low carbon economy

  14. 78 FR 2692 - Agency Information Collection Activities; Proposed New Collection; Comments Requested: COPS...

    Science.gov (United States)

    2013-01-14

    ... Collection; Comments Requested: COPS Comparative Assessment of Cost Reduction by Agencies Survey ACTION: 30...; comments requested. (2) Title of the Form/Collection: COPS Comparative Assessment of Cost Reduction by...) Affected public who will be asked or required to respond, as well as a brief abstract: Law enforcement...

  15. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

  16. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  17. COP9 signalosome: a provider of DNA building blocks

    DEFF Research Database (Denmark)

    Nielsen, Olaf

    2003-01-01

    In fission yeast, the COP9 signalosome is required to activate ribonucleotide reductase for DNA synthesis. This is mediated via the ubiquitin ligase Pcu4, activation of which leads to degradation of the scaffold protein Spd1, which anchors the small ribonucleotide reductase subunit in the nucleus...

  18. Age, gender, and percentage of circulating osteoprogenitor (COP) cells: The COP Study.

    Science.gov (United States)

    Gunawardene, Piumali; Al Saedi, Ahmed; Singh, Lakshman; Bermeo, Sandra; Vogrin, Sara; Phu, Steven; Suriyaarachchi, Pushpa; Pignolo, Robert J; Duque, Gustavo

    2017-10-01

    Circulating osteoprogenitor (COP) cells are blood-borne cells which express a variety of osteoblastic markers and are able to form bone nodules in vivo. Whereas a high percentage of COP cells (%COP) is associated with vascular calcification, low %COP has been associated with disability and frailty. However, the reference range of %COP in age- and gender-matching populations, and the age-related changes in %COP remain unknown. A cross-sectional study was undertaken in 144 healthy volunteers in Western Sydney (20-90year-old, 10 male and 10 female subjects per decade). %COP was quantified by flow cytometry. A high inter-and intra-rater reliability was found. In average, in this healthy population average of %COP was 0.42. There was no significant difference in %COP among the age groups. Similarly, no significant difference was found in %COP with gender, weight, height or BMI. In addition, we identified a normal reference range of %COP of 0.1-3.8%. In conclusion, in addition to the identification of steady levels of COP cells with age, we also identified a normal reference range of %COP, which could be used in future studies looking at musculoskeletal diseases in older populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  1. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  2. From COP21 to COP22: Keeping up the Momentum

    International Nuclear Information System (INIS)

    Mathieu, Carole

    2016-10-01

    In December 2015, a new international climate agreement was adopted, paving the way for increased mitigation and adaptation efforts. Governments firmly expressed the need for rapid action and 2016 will put the credibility of their commitments to the test. This article argues that climate policies are actually becoming more widespread, but they are also adjusting to local constraints and needs, suggesting that the establishment of a global emission regulation model is unlikely in the near future. While the low-carbon transition is well under way, its pace and conditions still appear too uncertain to fully convince economic decision-makers of the value of carbon-free options. COP22, which will take place in Marrakech in November 2016, will be an opportunity to leave these hesitations behind by strengthening mutual oversight, by consolidating the principle of climate justice, and by furthering the discussion about the best ways to orchestrate the transition to carbon neutrality

  3. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  4. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  5. Climate change negotiations. COP-2 and beyond

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-09-01

    The Second Conference of the Parties to the UN Framework Convention on Climate Change (COP-2), which met in Geneva during July, 1996, was only a partial success when considered in relation to its avowed aims, gaining acceptance of the Second Assessment Report by IPCC (Intergovernmental Panel on Climate Change), producing an agreed Ministerial Declaration, making real advances towards a protocol, and agreeing Rules of Procedure. This paper describes the main aims of COP-2, consideration of and response to the IPCC`s Second Assessment Report, the COP-2 Ministerial Declaration, some significant statements by individual country delegations at COP-2, lack of progress on Rules of Procedure for the Conference, realization of returning the greenhouse gas emissions in industrialized countries based on the Montreal Protocol, differing views among countries to the Convention on a protocol, prospects for achieving agreement on a legally binding protocol at COP-3 planned for Kyoto, Japan in December, 1997, and recent scientific and technical findings.

  6. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  7. COP 21: the national contributions

    International Nuclear Information System (INIS)

    Jouette, Isabelle

    2015-01-01

    This article comments the content of the national contributions (the so-called Intended Nationally Determined Contributions or INDC) which every country should have transmitted to the UN before the COP 21. In fact, 148 contributions, i.e. 75 per cent of the expected ones, have been transmitted. The author recalls that the content of these contributions had to obey some principles which had been defined in Lima in 2014, and that each country must identify its objectives in terms of mitigation (reduction of greenhouse gas emissions) and adaptation (reduction of the vulnerability of natural and human systems). The author comments some specific commitments regarding climate, emission reduction, adaptation to climate change, and more particularly evokes the Ethiopian contribution which is considered as exemplary

  8. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  9. COP-21: the economic controversy

    International Nuclear Information System (INIS)

    Huet, Sylvestre

    2015-01-01

    This publication analyses and discusses the content of the so-called 'intended nationally determined contributions' (INDC) prepared by countries for the COP-21. It notably shows that the USA projected energy consumption is in total contradiction with the contribution. It outlines that some of these contributions sound too ambitious in terms of reduction of greenhouse gas emissions. In fact, these statements are important for poor countries to obtain financial support from rich countries. The perspective of temperature increase is not good, but it seems that everybody is now aware of the associated risks. The article outlines that commitments for actions remain far behind the objectives defined in Copenhagen. The fact that fossil energies are cheap favours their use, that which is a problem with respect to general commitments for climate. The limitations of present alternate solutions are discussed: green oil, hydraulic, electricity production based on wind and solar energy, use of geothermal for heat or electricity, nuclear fission, nuclear fusion

  10. COP 21: words... and acts?

    International Nuclear Information System (INIS)

    Combe, Matthieu

    2015-01-01

    Published shortly before the Paris COP 21, this set of articles first recalls what is this Conference of Parties, and what will be the objectives in Paris: an agreement for the struggle against climate change, a reduction of greenhouse emissions, how to adapt to climate change. It also indicates some quantitative measurements and objectives regarding global warming according to the IPCC. The author outlines commitments for countries which signed the United Nations Framework Convention on Climate Change (UNFCCC), presents and discusses the content of the first and second Kyoto protocols, and outlines that a ratification of the second Kyoto protocol would already be a strong message. A second article notices that the objective of a maximum of a 2 degree increase of the global temperature seems difficult to be met when considering the Intended Nationally Determined Contributions or INDCs issued by a large part of the involved countries. The author discusses the issue of CO 2 budget available per inhabitant. A third article addresses the 2009 Copenhagen commitment for developed countries to give 100 billions dollars by 2020 to developing countries to finance their adaptation policy and to promote low carbon technologies. He comments the present level of these climatic financing, wanders how the still missing billions will be found, and whether these 100 billions will be enough. The fourth and last article discusses the position of the main oil and gas companies regarding climate change, and outlines that a British NGO denounced the gap between their statements and their lobbying actions

  11. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  12. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  13. Improvement In The COP Of Thermoelectric Cooler

    Directory of Open Access Journals (Sweden)

    Jatin Patel

    2015-08-01

    Full Text Available This paper described the study for heat transfer through thermoelectric cooler TEC by use of multistage thermoelectric module. To satisfy the heat dissipation of modern electronic element thermal designers have to increase fin area and fan speed to improve its cooling capacity. However the increase of fin area is restricted by the space. Besides the increase of fan speed would induce noise which damages human health. So air cooling by fan is hardly to meet the requirement of modern electronic component. Recently thermoelectric cooler TEC is applied to electronic cooling with the advantages of small size quietness and reliability. A typical thermoelectric cooler consists of p-type and n-type semiconductor pellets connected electrically in series and sandwiched between two ceramic substrates. Whenever direct current passes through the circuit it causes temperature differential between TEC sides. As a result one face of TEC which is called cold side will be cooled while its opposite face which is called hot side is simultaneously heated. The main problem over the use of TEC is the limited COP and its thermal performance. But these can be eliminated by use of multistage thermoelectric cooler.

  14. COP 21: a diplomatic and... climatic success?

    International Nuclear Information System (INIS)

    Combe, Matthieu

    2016-09-01

    If the agreement signed at the end of the COP21 has been greeted as historical, compromises made for such a diplomatic success cast doubt on the constraining aspect of this treaty. This publication thus proposes comments on the content of the COP21 agreement by discussing the perspective and opportunities of a possible commitment of air transport in the struggle against climate change, by questioning the existence of a dynamics for world commitment in the development of renewable energies, for the emergence of more responsible companies and sustainable cities, by commenting the almost unanimous success of the COP21 acknowledged by all parties (except Nicaragua), by commenting the opinion of NGOs on the agreement. Other articles evoke and comment examples of mobilisation of civil society and companies in demonstrations during the COP21, other demonstrations organised in parallel with the COP21 (a citizen summit on climate in Montreuil, exhibition in the Grand Palais where large companies like Veolia, L'Oreal, Evian, BIC, Coca-Cola or Renault presented some initiatives)

  15. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  16. COP of heat pumps. From definition to sales promotion; Warmtepomp COP. Van definitie tot verkoopargument

    Energy Technology Data Exchange (ETDEWEB)

    Bartholomeus, T.M.C. [Grasso Products, Den Bosch (Netherlands)

    2006-10-15

    Due to new EU-regulations heat pumps are once more very much in demand. A negative side effect of this popularity is the incomplete and defective information overrunning the market. The COP (coefficient of performance) of a heat pump degenerates from a definition into a sales promotion. This article brings clearness in these COP matters. [Dutch] Het blijkt dat de markt voor warmtepompen wordt overspoeld met onvolledige informatie ten gunste van hogere verkoopcijfers. Het rendement van een warmtepomp, verpakt in het Engelse COP (coefficient of performance) verwordt van definitie tot verkoopargument. In principe is daar niets mis mee, maar weI als het te pas en onpas gebruikt wordt, zonder enige relatie met het gebruiksdoel, de toepassing en bedrijfsvoering. Dit artikel heeft als doel om appels en peren in de COP-communicatie te scheiden.

  17. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  18. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  19. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  20. 30 CFR 285.700 - What reports must I submit to MMS before installing facilities described in my approved SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... installing facilities described in my approved SAP, COP, or GAP? 285.700 Section 285.700 Mineral Resources... § 285.700 What reports must I submit to MMS before installing facilities described in my approved SAP... in your approved COP (§ 285.632(a)) and, when required by this part, your SAP (§ 285.614(b)) or GAP...

  1. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  2. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  3. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  4. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  5. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  6. Association with β-COP Regulates the Trafficking of the Newly Synthesized Na,K-ATPase*

    Science.gov (United States)

    Morton, Michael J.; Farr, Glen A.; Hull, Michael; Capendeguy, Oihana; Horisberger, Jean-Daniel; Caplan, Michael J.

    2010-01-01

    Plasma membrane expression of the Na,K-ATPase requires assembly of its α- and β-subunits. Using a novel labeling technique to identify Na,K-ATPase partner proteins, we detected an interaction between the Na,K-ATPase α-subunit and the coat protein, β-COP, a component of the COP-I complex. When expressed in the absence of the Na,K-ATPase β-subunit, the Na,K-ATPase α-subunit interacts with β-COP, is retained in the endoplasmic reticulum, and is targeted for degradation. In the presence of the Na,K-ATPase β-subunit, the α-subunit does not interact with β-COP and traffics to the plasma membrane. Pulse-chase experiments demonstrate that in cells expressing both the Na,K-ATPase α- and β-subunits, newly synthesized α-subunit associates with β-COP immediately after its synthesis but that this interaction does not constitute an obligate intermediate in the assembly of the α- and β-subunits to form the pump holoenzyme. The interaction with β-COP was reduced by mutating a dibasic motif at Lys54 in the Na,K-ATPase α-subunit. This mutant α-subunit is not retained in the endoplasmic reticulum and reaches the plasma membrane, even in the absence of Na,K-ATPase β-subunit expression. Although the Lys54 α-subunit reaches the cell surface without need for β-subunit assembly, it is only functional as an ion-transporting ATPase in the presence of the β-subunit. PMID:20801885

  7. DHU1 negatively regulates UV-B signaling via its direct interaction with COP1 and RUP1.

    Science.gov (United States)

    Kim, Sang-Hoon; Kim, Hani; Chung, Sunglan; Lee, Jae-Hoon

    2017-09-16

    Although DWD HYPERSENSITIVE TO UV-B 1 (DHU1) is reported to be a negative regulator in UV-B mediated cellular responses, its detailed role in UV-B signaling is still elusive. To further understand the action mechanism of DHU1 in UV-B response, physical and genetic interactions of DHU1 with various UV-B signaling components were investigated. Yeast two hybrid assay results suggested that DHU1 directly interacts with COP1 and RUP1, implying a functional connection with both COP1 and RUP1. In spite of the physical association between DHU1 and COP1, loss of DHU1 did not affect protein stability of COP1. Epistatic analysis showed that the functional loss of both DHU1 and UVR8 leads to alleviation of UV-B hypersensitivity displayed in dhu1-1. Moreover, phenotypic studies with dhu1-1 cop1-6 and dhu1-1 hy5-215 revealed that COP1 and HY5 are epistatic to DHU1, indicating that UV-B hypersensitivity of dhu1-1 requires both COP1 and HY5. In the case of dhu1-1 rup1-1, UV-B responsiveness was similar to that of both dhu1-1 and rup1-1, implying that DHU1 and RUP1 are required for each other's function. Collectively, these results show that the role of DHU1 as a negative regulator in UV-B response may be derived from its direct interaction with COP1 by sequestering COP1 from the active UVR8-COP1 complex, resulting in a decrease in the COP1 population that positively participates in UV-B signaling together with UVR8. Furthermore, this inhibitory role of DHU1 in UV-B signaling is likely to be functionally connected to RUP1. This study will serve as a platform to further understand more detailed action mechanism of DHU1 in UV-B response and DHU1-mediated core UV-B signaling in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. COP21. To change the energy model

    International Nuclear Information System (INIS)

    Dupin, Ludovic

    2015-01-01

    In this brief article, the author regrets that the final COP21 agreement mentioned only once the energy issue whereas energy is responsible of 66 per cent of CO 2 emissions. Commitments regarding financing are evoked as well as statements made by the US President and his Secretary of State. He briefly outlines evolutions noticed in Germany after the implementation of the new energy policy (Energiewende) and its possible influences in other countries, notably in France. The still important role of coal in some countries like China, India, and Africa is outlined. Saudi Arabia succeeded in avoiding any mention of fossil energies in the final agreement

  9. COP-6: Anatomy of a breakdown

    International Nuclear Information System (INIS)

    Carpenter, C.; Kellett, V.

    2000-01-01

    Failure of the sixth Conference of Parties (COP-6) meeting at the Hague, to reach agreement on translating the 1997 Kyoto Protocol into a detailed, enforceable treaty is discussed. Despite major efforts by the current President of COP the major negotiating blocs, namely the EU, the 'Umbrella group' (Canada, the U.S., Japan, Australia, New Zealand, Russia, Ukraine and Norway) and the G-77 and China ( a group of over 130 developing nations, including some OPEC countries) refused to depart from their long-standing positions, leading to sustained protests, occasional outbursts of violence and passport burnings by protesters. Despite the pessimism and mutual recriminations over the failure to reach agreement, leading to fears that the Kyoto Protocol might never be ratified, the second week of the conference, in fact, produced significant progress on some important issues. Optimists believe that the agreements reached might be sufficient to induce governments to address key unresolved issues, including how to account for carbon sinks (the most visible disagreement at COP-6, in which the EU accused Canada and the U.S. of trying to 'get something for nothing' by allowing countries with high forest and grassland cover to avoid real actions on climate change), use of the Kyoto Protocol's flexibility mechanisms (the Clean Development Mechanism, joint implementation and emissions credit trading, which would allow developed countries to carry out an emission reduction project in a developing country and claim the resulting credits against its own target), the compliance regime (which Parties to the Protocol will be governed by the regime; the consequences of non-compliance; who will decide when a party is not in compliance), and funding assistance for developing countries to encourage them to adapt to climate change (China and developing countries accused the industrialized nations of failing in their moral duty to provide money, technology and technical assistance to poorer

  10. COP-6: Anatomy of a breakdown

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, C.; Kellett, V. [International Institute for Sustainable Development, Ottawa, ON (Canada)

    2000-12-05

    Failure of the sixth Conference of Parties (COP-6) meeting at the Hague, to reach agreement on translating the 1997 Kyoto Protocol into a detailed, enforceable treaty is discussed. Despite major efforts by the current President of COP the major negotiating blocs, namely the EU, the 'Umbrella group' (Canada, the U.S., Japan, Australia, New Zealand, Russia, Ukraine and Norway) and the G-77 and China ( a group of over 130 developing nations, including some OPEC countries) refused to depart from their long-standing positions, leading to sustained protests, occasional outbursts of violence and passport burnings by protesters. Despite the pessimism and mutual recriminations over the failure to reach agreement, leading to fears that the Kyoto Protocol might never be ratified, the second week of the conference, in fact, produced significant progress on some important issues. Optimists believe that the agreements reached might be sufficient to induce governments to address key unresolved issues, including how to account for carbon sinks (the most visible disagreement at COP-6, in which the EU accused Canada and the U.S. of trying to 'get something for nothing' by allowing countries with high forest and grassland cover to avoid real actions on climate change), use of the Kyoto Protocol's flexibility mechanisms (the Clean Development Mechanism, joint implementation and emissions credit trading, which would allow developed countries to carry out an emission reduction project in a developing country and claim the resulting credits against its own target), the compliance regime (which Parties to the Protocol will be governed by the regime; the consequences of non-compliance; who will decide when a party is not in compliance), and funding assistance for developing countries to encourage them to adapt to climate change (China and developing countries accused the industrialized nations of failing in their moral duty to provide money, technology and

  11. COP 21: which role for the nuclear?

    International Nuclear Information System (INIS)

    Le Ngoc, Boris

    2015-01-01

    This publication discusses the opportunities and challenges of the 21. Conference of Parties (COP) or conference on climate change which will take place in France. It notably outlines how this conference could be successful, and the importance of the European Union for energy. It more precisely and deeply addresses the issues related to nuclear energy by outlining that this energy is part of the solution for the struggle against climate change, by outlining that Euratom could be an inspiring example for a European Union for energy, and by briefly proposing a way to finance nuclear energy. Some propositions made by an expert for the development of nuclear energy are reported

  12. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  13. COP 23: Gender Equality and Climate Change

    Directory of Open Access Journals (Sweden)

    Struck-Garbe, Marion

    2018-03-01

    Full Text Available The World Climate Conference 2017 (COP 23 yielded the adoption of the first United Nations Framework Convention on Climate Change Gender Action Plan (GAP. This is a positive shift towards an integration of gender justice and human rights in the context of the UN Climate Action Plan. GAP necessitates importance granted to gender-equal climate policy and therefore, must be integrated into national climate action plans (programs. The first progress assessment will be conducted at COP 25 towards the end of 2019. However, while GAP recognizes women’s roles and importance with regard to climate change, it does not reach out beyond this. For instance, development policy measures that likewise play an important role have been excluded. In the Asia-Pacific the specific role of women as livelihood providers has received minimal attention and resultantly there has been little implementation of concrete measures. There are still many steps to be taken before deeper and more fundamental changes are reached.

  14. CoPs Facing Rationalization: The Politics of Community Reproduction

    Science.gov (United States)

    Kilskar, Stine Skaufel; Ingvaldsen, Jonas A.; Valle, Nina

    2018-01-01

    Purpose: This paper aims to explore the relationship between the contemporary forms of manufacturing rationalization and the reproduction of communities of practice (CoPs) centred on tasks and craft. Building on critical literature highlighting the tensions between CoPs and rationalization, this paper aims to develop a nuanced account of how CoPs…

  15. 32 CFR 635.24 - Updating the COPS MPRS.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Updating the COPS MPRS. 635.24 Section 635.24 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) LAW ENFORCEMENT AND CRIMINAL INVESTIGATIONS LAW ENFORCEMENT REPORTING Offense Reporting § 635.24 Updating the COPS MPRS. Installation Provost Marshals/Directors of...

  16. COP 21/CMP11. Understanding the challenges

    International Nuclear Information System (INIS)

    2015-03-01

    By the end of 2015, France will host the 21. conference of parties (COP 21) of the United Nations Framework Convention on Climate Change. The goal is to reach an agreement between all countries in order to keep the global warming below 2 deg. C. In this perspective, French President Francois Hollande, urged France to be a role model at home, which is the prerequisite to convince and lead Europe and the rest of the world in this worldwide fight. This note explains what role France will have to play on the international scene, what is the position of France and Europe in the climate topic, and how electricity can contribute to the fight against global warming

  17. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  18. An Arabidopsis SUMO E3 Ligase, SIZ1, Negatively Regulates Photomorphogenesis by Promoting COP1 Activity

    KAUST Repository

    Lin, Xiao-Li

    2016-04-29

    COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants.

  19. An Arabidopsis SUMO E3 Ligase, SIZ1, Negatively Regulates Photomorphogenesis by Promoting COP1 Activity

    KAUST Repository

    Lin, Xiao-Li; Niu, De; Hu, Zi-Liang; Kim, Dae Heon; Jin, Yin Hua; Cai, Bin; Liu, Peng; Miura, Kenji; Yun, Dae-Jin; Kim, Woe-Yeon; Lin, Rongcheng; Jin, Jing Bo

    2016-01-01

    COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants.

  20. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  1. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Special COP 21 - Stakes and actors

    International Nuclear Information System (INIS)

    Chauveau, Loic; Dupain, Julien; Descamps, Olivier; Blosseville, Thomas; Connors, Anne; Canto, Albane; Robischon, Christian; Boedec, Morgan; Tubiana, Fabian; Bomstein, Dominique

    2015-01-01

    A first set of article comments and discusses the various stakes and challenges of the 21. Conference of Parties (COP 21): the negotiation process which resulted in a synthesis which is to be signed by 95 States in Paris, the elaboration of an Agenda of solutions with the commitment of enterprises and local authorities, the issue of international financing as some promises remained not kept for the support to adaptation of developing countries. A second set of articles addresses the involved actors and their technological or economic challenges: the needed evolution of energy (electricity, heat, gas, fuel) producers away from fossil energies to reduce greenhouse gas emissions, the strategy of the French company Engie in the field of photovoltaic, wind and more generally renewable energies, innovating trends of decentralisation of energy production (offshore wind energy, hydrogen, plasma torch, flexible photovoltaic arrays, the wind tree, the floating wind turbine, new technologies for solar arrays), the perspectives for industrial sectors concerned by energy transition (with the example of Schneider Electric), emerging technologies (oil lamp, new boilers, desalination equipment, storage of wind energy, co-generation), developments and perspectives in the transport sector (example of Renault, new technologies for hybrid propulsion, bio-refineries, reduction of fuel consumption, hybrid aircraft, and heat management in railways) and in the building sector (new standards and applications, new building materials). A last article outlines the threat that climate can be for profitability and the taking of the carbon risk into account by the insurance and financial sectors

  3. EER, COP, and the Second Law Efficiency for Air Conditioners

    Science.gov (United States)

    Leff, Harvey S.; Teeters, William D.

    1978-01-01

    Describes the relationship existing between coefficient of performance (COP) and energy efficiency ratio (EER) in air conditioning units and introduces new efficiency parameters measured relative to the energy extracted from the primary energy source. (SL)

  4. COPS model estimates of LLEA availability near selected reactor sites

    International Nuclear Information System (INIS)

    Berkbigler, K.P.

    1979-11-01

    The COPS computer model has been used to estimate local law enforcement agency (LLEA) officer availability in the neighborhood of selected nuclear reactor sites. The results of these analyses are presented both in graphic and tabular form in this report

  5. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  6. Breakdown conditioning of copper, CuZr and GlidCop® : effect of mechanical surface treatments

    CERN Document Server

    Ramsvik, T; Calatroni, S; Taborelli, M; CERN. Geneva. TS Department

    2007-01-01

    Motivated by the need of novel materials for the CLIC accelerating structures to resist mechanical fatigue, the copper based metals Copper Zirconium C15000 (CuZr) and GlidCop® Al-15 C15715 have been investigated by DC breakdown measurements, and compared with commercially pure Oxygen-free Copper C10100 (Cu-OFE). In all three cases the saturated breakdown fields (Esat) are similar, despite significant differences in their tensile strengths. In addition, the choice of mechanical surface preparation techniques influences the final breakdown characteristics. For both CuZr and GlidCop® immediate conditioning takes place when the surfaces are prepared by milling. For electro discharge machined (EDM) surfaces, however, several breakdown events are needed to obtain saturation. Specifically, for EDM treated CuZr and GlidCop®, ~50 and ~200 breakdown events are required to reach Esat.

  7. From COP21 to COP22: how to win the climate struggle?

    International Nuclear Information System (INIS)

    Mathieu, Carole

    2016-10-01

    In this publication, the author first proposes a discussion on climate policies after the relative success of the COP21 in Paris which opened the way to new commitments for mitigation of climate changes and adaptation to them. She outlines that these policies can be characterized by a declared voluntarism for some of them, but also by a lack of global consistency. She proposes an overview of the diversity of measures aimed at emission reduction, outlines the weight of the uncertainty due to elections in the USA, discusses the issue of climate compatibility of public decisions, and notices the still high tension between economic development and climate protection. In a second part, within the perspective of the COP22, she highlights and discusses the lack of commitment for low carbon solutions. She finally discusses perspectives for a better and more dynamic international cooperation through a mutual control, an attention given to the financing issue, and a common approach to the development of tools for a low-carbon transition

  8. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  10. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  11. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  12. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  13. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  14. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  15. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  17. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  18. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  19. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  20. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  1. People's Rebuplic of China's Performance in the UNFCCC : A Comparison of China's Position at COP15 Copenhagen to COP22 Marrakech

    OpenAIRE

    Sommerholt, Lovisa

    2017-01-01

    Since the US election in the fall of 2016, China have been looked towards to fill a leadership position in climate change negotiations. This essay focuses on determining China's efficiency in the COP15 and COP22 negotiations in establishing its ambitions and policy objectives. The results show that China was very effective in achieveing their policy aims both at COP15 and COP22 even if the negotiations had different aims. The overall performance of China has affected the COP outcomes and help...

  2. COP21: to save negotiations or to save the climate?

    International Nuclear Information System (INIS)

    Fremeaux, Alexis; Faure, Elisa; Guillou, Antoine

    2015-01-01

    This note proposes an overview of the main issues which could render an agreement possible at the end of the Paris COP21, and makes some proposals on principles which should be mentioned in the agreement to create a future strong foundation, as well as on tools and measures which could be implemented thereafter. The authors first discuss the content and results of the previous COPs, and comment the negotiation process between Copenhagen and Paris to outline the main challenges and stakes to reach of common agreement. They address the main issues of the COP21 negotiations: mobilisation of 100 billions dollars per year to help emerging countries in reaching a low carbon development mode and to adapt to climate change, how to urgently orient private investments towards a low carbon economy, to base on standards and transparency as two main action levers in case of absence of agreement on carbon price, and definition of needed more ambitious objectives

  3. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  4. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Science.gov (United States)

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  5. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  6. 50 CFR 23.86 - How can I obtain information on a CoP?

    Science.gov (United States)

    2010-10-01

    ... FAUNA AND FLORA (CITES) CITES Administration § 23.86 How can I obtain information on a CoP? As we receive information on an upcoming CoP from the CITES Secretariat, we will notify the public either...

  7. 7 CFR 457.126 - Popcorn cop isurance povisions.

    Science.gov (United States)

    2010-01-01

    ... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.126 Popcorn cop isurance... permit mechanical cultivation, unless otherwise provided by the Special Provisions, actuarial documents... policy unless the Special Provisions provide different price elections by type, in which case you may...

  8. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  9. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  10. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  11. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  12. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Study on Relative COP Changes with Increasing Heat Input Temperatures of Double Effect Steam Absorption Chillers

    Directory of Open Access Journals (Sweden)

    Abd Majid Mohd Amin

    2016-01-01

    Full Text Available Absorption chillers at cogeneration plants generate chilled water using steam supplied by heat recovery steam generators. The chillers are mainly of double effect type. The COP of double effect varies from 0.7 to 1.2 depending on operation and maintenance practices of the chillers. Heat input to the chillers during operations could have impact on the COP of the chillers. This study is on relative COP changes with increasing the heat input temperatures for a steam absorption chiller at a gas fueled cogeneration plant. Reversible COP analysis and zero order model were used for evaluating COP of the chiller for 118 days operation period. Results indicate increasing COP trends for both the reversible COP and zero model COP. Although the zero model COP are within the range of double effect absorption chiller, it is not so for the actual COP. The actual COP is below the range of normal double effect COP. It is recommended that economic replacement analysis to be undertaken to assess the feasibility either to repair or replace the existing absorption chiller.

  14. IRR (Inter-Rater Reliability) of a COP (Classroom Observation Protocol)--A Critical Appraisal

    Science.gov (United States)

    Rui, Ning; Feldman, Jill M.

    2012-01-01

    Notwithstanding broad utility of COPs (classroom observation protocols), there has been limited documentation of the psychometric properties of even the most popular COPs. This study attempted to fill this void by closely examining the item and domain-level IRR (inter-rater reliability) of a COP that was used in a federally funded striving readers…

  15. 77 FR 68149 - Agency Information Collection Activities; Proposed New Collection; Comments Requested: COPS...

    Science.gov (United States)

    2012-11-15

    ... Collection; Comments Requested: COPS Comparative Assessment of Cost Reduction by Agencies Survey ACTION: 60... Collection: Proposed new collection; comments requested. (2) Title of the Form/Collection: COPS Comparative... brief abstract: Law enforcement agencies and other public and private entities that apply for COPS...

  16. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  17. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  18. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  19. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Science.gov (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  20. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  1. SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

    Science.gov (United States)

    Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

    2017-12-18

    Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

  2. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  3. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  4. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  5. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Science.gov (United States)

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Report the Africa renewable energy initiative launched at COP21

    International Nuclear Information System (INIS)

    Royal, Segolene

    2016-09-01

    Segolene Royal, President of COP21, presents in this report the specific renewable energy projects to be embarked on in Africa without delay. On the basis of the COP21 President's visits to 17 African countries, her discussions with African leaders and analysis by groups of experts, a list of 240 projects accounting for more than 45 GW of renewable capacity is being made public: 13 geothermal energy projects: 7 GW; 58 hydroelectricity projects: 20 GW; 62 solar energy projects: 6 GW; 16 wind energy projects: 5 GW; 35 projects combining more than one technology: 1 GW; 4 national strategies (solar and wind energy): 8 GW. Launched by African heads of state on 1 December 2015 in the presence of French President Francois Hollande, the Africa Renewable Energy Initiative aims to increase the continent's installed capacity of renewable energy by 10 GW by 2020 and 300 GW by 2030. During COP21. To achieve this goal, Segolene Royal has pledged to facilitate the implementation of the initiative throughout the French COP21 presidency. The report proposes a review of the energy situation in Africa and sets out 10 recommendations to speed up the deployment of renewable energy on the continent: 1. To identify a list of priority projects to implement by 2020, and projects to begin before and during COP22; 2. To bring the partners together around each project to share out responsibilities; 3. To initiate dialogue with the private sector about the initiative and projects; 4. To strengthen participatory citizenship regarding energy; 5. To involve African women in renewable energy; 6. To draw on the International Solar Alliance, launched at COP21, and the Global Geothermal Alliance; 7. To put in place innovative financial instruments, such as loan-grant blending; 8. To allow for climate change in the projects; 9. To strengthen the independent body responsible for implementing the initiative, hosted and supported by the African Development Bank; 10. To finalize a map of existing

  7. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  8. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  9. Light and the E3 ubiquitin ligase COP1/SPA control the protein stability of the MYB transcription factors PAP1 and PAP2 involved in anthocyanin accumulation in Arabidopsis.

    Science.gov (United States)

    Maier, Alexander; Schrader, Andrea; Kokkelink, Leonie; Falke, Christian; Welter, Bastian; Iniesto, Elisa; Rubio, Vicente; Uhrig, Joachim F; Hülskamp, Martin; Hoecker, Ute

    2013-05-01

    Anthocyanins are natural pigments that accumulate only in light-grown and not in dark-grown Arabidopsis plants. Repression of anthocyanin accumulation in darkness requires the CONSTITUTIVELY PHOTOMORPHOGENIC1/SUPPRESSOR OF PHYA-105 (COP1/SPA) ubiquitin ligase, as cop1 and spa mutants produce anthocyanins also in the dark. Here, we show that COP1 and SPA proteins interact with the myeloblastosis (MYB) transcription factors PRODUCTION OF ANTHOCYANIN PIGMENT1 (PAP)1 and PAP2, two members of a small protein family that is required for anthocyanin accumulation and for the expression of structural genes in the anthocyanin biosynthesis pathway. The increased anthocyanin levels in cop1 mutants requires the PAP1 gene family, indicating that COP1 functions upstream of the PAP1 gene family. PAP1 and PAP2 proteins are degraded in the dark and this degradation is dependent on the proteasome and on COP1. Hence, the light requirement for anthocyanin biosynthesis results, at least in part, from the light-mediated stabilization of PAP1 and PAP2. Consistent with this conclusion, moderate overexpression of PAP1 leads to an increase in anthocyanin levels only in the light and not in darkness. Here we show that SPA genes are also required for reducing PAP1 and PAP2 transcript levels in dark-grown seedlings. Taken together, these results indicate that the COP1/SPA complex affects PAP1 and PAP2 both transcriptionally and post-translationally. Thus, our findings have identified mechanisms via which the COP1/SPA complex controls anthocyanin levels in Arabidopsis that may be useful for applications in biotechnology directed towards increasing anthocyanin content in plants. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  10. The game of cops and robbers on graphs

    CERN Document Server

    Bonato, Anthony

    2011-01-01

    This book is the first and only one of its kind on the topic of Cops and Robbers games, and more generally, on the field of vertex pursuit games on graphs. The book is written in a lively and highly readable fashion, which should appeal to both senior undergraduates and experts in the field (and everyone in between). One of the main goals of the book is to bring together the key results in the field; as such, it presents structural, probabilistic, and algorithmic results on Cops and Robbers games. Several recent and new results are discussed, along with a comprehensive set of references. The book is suitable for self-study or as a textbook, owing in part to the over 200 exercises. The reader will gain insight into all the main directions of research in the field and will be exposed to a number of open problems.

  11. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  12. How to distribute the carbon budget at the COP21?

    International Nuclear Information System (INIS)

    Laurent, Eloi

    2015-09-01

    This article reviews different fairness criteria for the measuring of CO 2 emissions by the main countries responsible of climate change in order to fairly distribute the carbon budget during the Paris negotiation of the COP21. It shows that it is possible to use reliable data to build up a relatively simple and fair climatic hybrid criterion which takes consumption emissions, historic responsibility, population, and economic development level into account

  13. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  14. Working Together but in Opposition: An Examination of the "Good-Cop/Bad-Cop" Negotiating Team Tactic.

    Science.gov (United States)

    Brodt; Tuchinsky

    2000-03-01

    Unlike solo negotiators, members of negotiating teams may for strategic reasons choose to play different roles; the familiar "good cop/bad cop" distributive bargaining tactic is one example of role differentiation designed to enhance a team's success at the bargaining table. In two empirical studies about a hypothetical three-person work group, we examined the cognitive processes underlying this tactic using a social-cognitive decision model (Brodt & Duncan, 1998) that conceptualizes the negotiators' decision tasks and persuasion processes. Results generally supported the model except for an intriguing asymmetry depending on a person's initial inclination (accepting, rejecting). This research extends findings on the tactic and on contrast effects (Cialdini, 1984) and supports the model's usefulness as an approximate representation of negotiator cognition. Copyright 2000 Academic Press.

  15. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  16. COP improvement of refrigerator/freezers, air-conditioners, and heat pumps using nonazeotropic refrigerant mixtures

    Science.gov (United States)

    Westra, Douglas G.

    1993-01-01

    With the February, 1992 announcement by President Bush to move the deadline for outlawing CFC (chloro-fluoro-carbon) refrigerants from the year 2000 to the year 1996, the refrigeration and air-conditioning industries have been accelerating their efforts to find alternative refrigerants. Many of the alternative refrigerants being evaluated require synthetic lubricants, are less efficient, and have toxicity problems. One option to developing new, alternative refrigerants is to combine existing non-CFC refrigerants to form a nonazeotropic mixture, with the concentration optimized for the given application so that system COP (Coefficient Of Performance) may be maintained or even improved. This paper will discuss the dilemma that industry is facing regarding CFC phase-out and the problems associated with CFC alternatives presently under development. A definition of nonazeotropic mixtures will be provided, and the characteristics and COP benefits of nonazeotropic refrigerant mixtures will be explained using thermodynamic principles. Limitations and disadvantages of nonazeotropic mixtures will be discussed, and example systems using such mixtures will be reviewed.

  17. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  18. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  20. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  1. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  2. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  3. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  4. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  5. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  6. Ademe et Vous. International Newsletter No. 35, December 2015. COP21: one objective, four pillars

    International Nuclear Information System (INIS)

    Martin, Valerie; Seguin-Jacques, Catherine; Tappero, Denis

    2015-12-01

    Content: - COP21: one objective, four pillars: With COP21 providing a platform for intergovernmental negotiations, ADEME is actively working alongside with non-state actors to foster an environment conducive to success. - ADEME, a stakeholder of COP21: ADEME has been particularly proactive when it comes to mobilising non-state actors in the context of COP21, and has made the most of its presence at Le Bourget to announce a number of new initiatives covering a number of the 12 themes that make up the Lima-Paris Action Agenda. - Innovation exhibited at COP21: Giving the public an opportunity to be within reach of the world of tomorrow: This is the aim of the Innov'Climat exhibition, initiated by ADEME back in July and developed for COP21

  7. CoP Sensing Framework on Web-Based Environment

    Science.gov (United States)

    Mustapha, S. M. F. D. Syed

    The Web technologies and Web applications have shown similar high growth rate in terms of daily usages and user acceptance. The Web applications have not only penetrated in the traditional domains such as education and business but have also encroached into areas such as politics, social, lifestyle, and culture. The emergence of Web technologies has enabled Web access even to the person on the move through PDAs or mobile phones that are connected using Wi-Fi, HSDPA, or other communication protocols. These two phenomena are the inducement factors toward the need of building Web-based systems as the supporting tools in fulfilling many mundane activities. In doing this, one of the many focuses in research has been to look at the implementation challenges in building Web-based support systems in different types of environment. This chapter describes the implementation issues in building the community learning framework that can be supported on the Web-based platform. The Community of Practice (CoP) has been chosen as the community learning theory to be the case study and analysis as it challenges the creativity of the architectural design of the Web system in order to capture the presence of learning activities. The details of this chapter describe the characteristics of the CoP to understand the inherent intricacies in modeling in the Web-based environment, the evidences of CoP that need to be traced automatically in a slick manner such that the evidence-capturing process is unobtrusive, and the technologies needed to embrace a full adoption of Web-based support system for the community learning framework.

  8. Ultrascalable Techniques Applied to the Global Intelligence Community Information Awareness Common Operating Picture (IA COP)

    National Research Council Canada - National Science Library

    Valdes, Alfonso; Kadte, Jim

    2005-01-01

    The focus of this research is to develop detection, correlation, and representation approaches to address the needs of the Intelligence Community Information Awareness Common Operating Picture (IA COP...

  9. Almost all k-cop-win graphs contain a dominating set of cardinality k

    OpenAIRE

    Pralat, Pawel

    2013-01-01

    We consider $k$-cop-win graphs in the binomial random graph $G(n,1/2).$ It is known that almost all cop-win graphs contain a universal vertex. We generalize this result and prove that for every $k \\in N$, almost all $k$-cop-win graphs contain a dominating set of cardinality $k$. From this it follows that the asymptotic number of labelled $k$-cop-win graphs of order $n$ is equal to $(1+o(1)) (1-2^{-k})^{-k} {n \\choose k} 2^{n^2/2 - (1/2-\\log_2(1-2^{-k})) n}$.

  10. The SafeCOP ECSEL Project: Safe Cooperating Cyber-Physical Systems Using Wireless Communication

    DEFF Research Database (Denmark)

    Pop, Paul; Scholle, Detlef; Hansson, Hans

    2016-01-01

    This paper presents an overview of the ECSEL project entitled "Safe Cooperating Cyber-Physical Systems using Wireless Communication" (SafeCOP), which runs during the period 2016 -- 2019. SafeCOP targets safety-related Cooperating Cyber-Physical Systems (CO-CPS) characterised by use of wireless...... detection of abnormal behaviour, triggering if needed a safe degraded mode. SafeCOP will also develop methods and tools, which will be used to produce safety assurance evidence needed to certify cooperative functions. SafeCOP will extend current wireless technologies to ensure safe and secure cooperation...

  11. CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

    Science.gov (United States)

    Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

    2015-02-27

    It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  13. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  14. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    Science.gov (United States)

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  15. The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

    Science.gov (United States)

    Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

    2017-08-15

    Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

  16. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  17. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  19. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  20. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  1. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  2. BIODEGRADACIÓN DE COMPUESTOS ORGÁNICOSPERSISTENTES (COP: I. EL CASO DE LOS BIFENILOSPOLICLORADOS (PCB

    Directory of Open Access Journals (Sweden)

    ZIV ARBELI

    2009-01-01

    Full Text Available RESUMEN Los contaminantes orgánicos persistentes poseen propiedades tóxicas, son resistentes a la degradación, se bioacumulan y son transportados por el aire, el agua y las especies migratorias a través de las fronteras internacionales; en consecuencia se depositan lejos del lugar de su liberación, acumulándose en ecosistemas terrestres y acuáticos. Para atender a esta problemática a nivel mundial se firmó el 23 de mayo de 2001 el Convenio de Estocolmo. Aunque por ahora los COP estan prohibidos en la mayoria de los países, todavía existen en el mundo muchos sitios contaminados con estas sustancias. La remediación de sitios que presentan contaminantes orgánicos persistentes requiere consideraciones distintas a las contempladas en la recupe-ración por contaminación de hidrocarburos. El siguiente texto revisa la literatura sobre la biodegradación anaeróbica y aeróbica de los bifeniles policlorados (PCB y las posibles estrategias para estimular dicha biodegradación. La degradación de los demás COP será descritas en textos adicionales. Palabras clave: contaminantes orgánicos persistentes (COP; bifeniles policlorados (PCB; biodegradación; biorremediación. ABSTRACT Persistent organic pollutants are chemicals that are toxic to humans and wildlife, remain intact in the environment for long periods, accumulate in living organisms and can become widely distributed geographically by air, water or migrating species. As a result, these contaminants have been found all over the world including in places, such as the Polar Regions, which are very far from their application site. The Stockholm Convention was signed in 23/5/01 in order to cope with this international environmental problem. Although POPs were banned by most countries, there are still a lot of sites contaminated with these substances. The remediation of these sites is problematic and requires distinct considerations from those which are established for hydrocarbon

  3. 76 FR 35683 - Medicare Program; Conditions of Participation (CoPs) for Community Mental Health Centers

    Science.gov (United States)

    2011-06-17

    ... Community Mental Health Centers; Proposed Rule #0;#0;Federal Register / Vol. 76 , No. 117 / Friday June 17... (CoPs) for Community Mental Health Centers AGENCY: Centers for Medicare & Medicaid Services (CMS), HHS... participation (CoPs) that community mental health centers (CMHCs) would have to meet in order to participate in...

  4. Impacts of CoP on Organizational Socialization in the Early Career

    Science.gov (United States)

    Chang, Joohee; Chang, Wonsup; Jacobs, Ronald L.

    2008-01-01

    This paper focuses on the relationship between participation in communities of practice (CoP) and outcomes of organizational socialization (learning and adjustment) early in the career. Results from responses of employees in a Korean IT company show that participation in CoP is more strongly related to adjustment (job satisfaction, organizational…

  5. 20 CFR 10.216 - How is the pay rate for COP calculated?

    Science.gov (United States)

    2010-04-01

    ... for COP purposes is equal to the employee's regular “weekly” pay (the average of the weekly pay over... occurred during the 45-day period are to be reflected in the weekly pay determination. (b) The weekly pay... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false How is the pay rate for COP calculated? 10...

  6. Investing for a low carbon economy. Special issue COP21

    International Nuclear Information System (INIS)

    Guez, Herve; Basselier, Clotilde; Bennani, Zineb; Coeslier, Manuel; Dufour, Mathilde; Dunand-Chatellet, Lea; Guez, Herve; Lauverjat Celine; Ostiari, Emmanuelle; Smia, Ladislas; Bonnin, Marguerite; Briand, Marc; Favier, Julien; Finidori, Esther; Wigley, Chris; Dobie, Jacqueline; Mary Ellis, Susannah; Kiernan, Shannon; Lefer, Elizabeth; Perrin, Elsa; Treadwell, Christopher; Zerner, Rachel

    2015-11-01

    Mirova, an asset management firm dedicated to responsible investment, has published today Investing in a low-carbon economy, a guide for investors to become COP21 compliant. Mirova's study provides an in-depth analysis highlighting the challenges of climate change and presents methods for investors to effectively measure their carbon footprint. Mirova offers a unique range of investment solutions promoting energy transition across all asset classes. COP21: mobilising private investors is a necessity To maintain the economy in a '2 degree' trajectory, it is vital to redirect savings towards companies and projects promoting energy transition. Philippe Zaouati, Head of Mirova explains: 'The energy transition can only succeed if we manage to mobilise private investors' savings. The success of COP21 therefore also depends on the ability of asset management firms to propose solutions in response to the climate challenge, whilst delivering the returns expected by investors'. Accurately measuring your carbon footprint. In response to growing demands on investors to make greener investments, Mirova, in partnership with the leading carbon strategy specialist consultant Carbone 4, has developed an innovative methodology to measure the carbon footprint of an investment portfolio. This decision-making tool assesses a company's contribution to the reduction of global greenhouse gas emissions (GGE). Measuring the overall impact of a business on the environment is an essential step towards acting against global warming. Assessing the carbon footprint is therefore an indispensable stage in the construction of portfolios contributing to energy transition. Low-carbon investments across all asset classes In order to redirect capital towards investments promoting energy transition, Mirova is proposing solutions involving all asset classes: - Renewable energy infrastructures: 100% low carbon allocation For more than 10 years now, Mirova has provided European institutions with access to

  7. Groundwater vulnerability assessment in karstic aquifers using COP method.

    Science.gov (United States)

    Bagherzadeh, Somayeh; Kalantari, Nasrollah; Nobandegani, Amir Fadaei; Derakhshan, Zahra; Conti, Gea Oliveri; Ferrante, Margherita; Malekahmadi, Roya

    2018-05-02

    Access to safe and reliable drinking water is amongst the important indicators of development in each society, and water scarcity is one of the challenges and limitations affecting development at national and regional levels and social life and economic activity areas. Generally, there are two types of drinking water sources: the first type is surface waters, including lakes, rivers, and streams and the second type is groundwaters existing in aquifers. Amongst aquifers, karst aquifers play an important role in supplying water sources of the world. Therefore, protecting these aquifers from pollution sources is of paramount importance. COP method is amongst the methods to investigate the intrinsic vulnerability of this type of aquifers, so that areas susceptible to contamination can be determined before being contaminated and these sources can be protected. In the present study, COP method was employed in order to spot the regions that are prone to contamination in the region. This method uses the properties of overlying geological layers above the water table (O factor), the concentration of flow (C factor), and precipitation (P factor) over the aquifer, as the parameters to assess the intrinsic vulnerability of groundwater resources. In this regard, geographical information system (GIS) and remote sensing (RS) were utilized to prepare the mentioned factors and the intrinsic vulnerability map was obtained. The results of COP method indicated that the northwest and the west of the region are highly and very vulnerable. This study indicated that regions with low vulnerability were observed in eastern areas, which accounted for 15.6% of the area. Moderate vulnerability was 40% and related to the northeast and southeast of the area. High vulnerability was 38.2% and related to western and southwestern regions. Very high vulnerability was 6.2% and related to the northwest of the area. By means of the analysis of sensitivity of the model, it was determined that the focus

  8. Multiscale GPS tomography during COPS: validation and applications

    Science.gov (United States)

    Champollion, Cédric; Flamant, Cyrille; Masson, Frédéric; Gégout, Pascal; Boniface, Karen; Richard, Evelyne

    2010-05-01

    Accurate 3D description of the water vapour field is of interest for process studies such as convection initiation. None of the current techniques (LIDAR, satellite, radio soundings, GPS) can provide an all weather continuous 3D field of moisture. The combination of GPS tomography with radio-soundings (and/or LIDAR) has been used for such process studies using both advantages of vertically resolved soundings and high temporal density of GPS measurements. GPS tomography has been used at short scale (10 km horizontal resolution but in a 50 km² area) for process studies such as the ESCOMPTE experiment (Bastin et al., 2005) and at larger scale (50 km horizontal resolution) during IHOP_2002. But no extensive statistical validation has been done so far. The overarching goal of the COPS field experiment is to advance the quality of forecasts of orographically induced convective precipitation by four-dimensional observations and modeling of its life cycle for identifying the physical and chemical processes responsible for deficiencies in QPF over low-mountain regions. During the COPS field experiment, a GPS network of about 100 GPS stations has been continuously operating during three months in an area of 500 km² in the East of France (Vosges Mountains) and West of Germany (Black Forest). If the mean spacing between the GPS is about 50 km, an East-West GPS profile with a density of about 10 km is dedicated to high resolution tomography. One major goal of the GPS COPS experiment is to validate the GPS tomography with different spatial resolutions. Validation is based on additional radio-soundings and airborne / ground-based LIDAR measurement. The number and the high quality of vertically resolved water vapor observations give an unique data set for GPS tomography validation. Numerous tests have been done on real data to show the type water vapor structures that can be imaging by GPS tomography depending of the assimilation of additional data (radio soundings), the

  9. Salt Stress and Ethylene Antagonistically Regulate Nucleocytoplasmic Partitioning of COP1 to Control Seed Germination.

    Science.gov (United States)

    Yu, Yanwen; Wang, Juan; Shi, Hui; Gu, Juntao; Dong, Jingao; Deng, Xing Wang; Huang, Rongfeng

    2016-04-01

    Seed germination, a critical stage initiating the life cycle of a plant, is severely affected by salt stress. However, the underlying mechanism of salt inhibition of seed germination (SSG) is unclear. Here, we report that the Arabidopsis (Arabidopsis thaliana) CONSTITUTIVE PHOTOMORPHOGENESIS1 (COP1) counteracts SSG Genetic assays provide evidence that SSG in loss of function of the COP1 mutant was stronger than this in the wild type. A GUS-COP1 fusion was constitutively localized to the nucleus in radicle cells. Salt treatment caused COP1 to be retained in the cytosol, but the addition of ethylene precursor 1-aminocyclopropane-1-carboxylate had the reverse effect on the translocation of COP1 to the nucleus, revealing that ethylene and salt exert opposite regulatory effects on the localization of COP1 in germinating seeds. However, loss of function of the ETHYLENE INSENSITIVE3 (EIN3) mutant impaired the ethylene-mediated rescue of the salt restriction of COP1 to the nucleus. Further research showed that the interaction between COP1 and LONG HYPOCOTYL5 (HY5) had a role in SSG Correspondingly, SSG in loss of function of HY5 was suppressed. Biochemical detection showed that salt promoted the stabilization of HY5, whereas ethylene restricted its accumulation. Furthermore, salt treatment stimulated and ethylene suppressed transcription of ABA INSENSITIVE5 (ABI5), which was directly transcriptionally regulated by HY5. Together, our results reveal that salt stress and ethylene antagonistically regulate nucleocytoplasmic partitioning of COP1, thereby controlling Arabidopsis seed germination via the COP1-mediated down-regulation of HY5 and ABI5. These findings enhance our understanding of the stress response and have great potential for application in agricultural production. © 2016 American Society of Plant Biologists. All Rights Reserved.

  10. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

    2011-01-01

    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  11. CSNAP Is a Stoichiometric Subunit of the COP9 Signalosome

    Directory of Open Access Journals (Sweden)

    Shelly Rozen

    2015-10-01

    Full Text Available The highly conserved COP9 signalosome (CSN complex is a key regulator of all cullin-RING-ubiquitin ligases (CRLs, the largest family of E3 ubiquitin ligases. Until now, it was accepted that the CSN is composed of eight canonical components. Here, we report the discovery of an additional integral and stoichiometric subunit that had thus far evaded detection, and we named it CSNAP (CSN acidic protein. We show that CSNAP binds CSN3, CSN5, and CSN6, and its incorporation into the CSN complex is mediated through the C-terminal region involving conserved aromatic residues. Moreover, depletion of this small protein leads to reduced proliferation and a flattened and enlarged morphology. Finally, on the basis of sequence and structural properties shared by both CSNAP and DSS1, a component of the related 19S lid proteasome complex, we propose that CSNAP, the ninth CSN subunit, is the missing paralogous subunit of DSS1.

  12. COP21 - A moment of truth for climate and sustainable development

    International Nuclear Information System (INIS)

    2015-01-01

    Time is running out to act on climate change, poverty eradication and sustainable development. These challenges cannot be met independently of each other. The task of COP21 is to send strong policy signals that determined climate action is needed and will not harm the economy. In fact, these actions will trigger multiple employment, health and human development benefits by aligning strengthened short-term economic growth with long-term sustainable development goals. It is challenging but possible to trigger the transformation toward low carbon futures and to increase the affordability of advanced technologies despite the current pressures on public budgets. The world is awash in liquidity. What is needed is to redirect the savings of households, pension funds, insurance schemes, and sovereign wealth funds towards long-term and low-carbon investments. Sound regulatory frameworks and innovative financial mechanisms must be established to reduce the risks attached to potentially profitable low-carbon projects that are blocked by a combination of high up front costs and an uncertain environment, so as to attract private savings and institutional investors. COP 21 can provide critical policy hooks for step changes in economic and financial inter-mediation based on public guarantees for low carbon investments; an agreed social value of carbon mitigation activities could be incorporated into diverse low-carbon financial initiatives supporting Intended Nationally Determined Contributions (INDCs); strong and enforceable requirements for Measuring, Reporting and Verification (MRV) can ensure the environmental integrity and sustainability of the resulting investments. Such a framework can secure the transparency of voluntary commitments by countries, clubs of countries and non-state actors. If it can achieve these goals, the Paris Agreement can unleash a wave of investments into low-carbon development that responds to short-term economic and social challenges while supporting

  13. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  14. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  15. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  16. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  17. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  18. Legionella dumoffii Tex-KL Mutated in an Operon Homologous to traC-traD is Defective in Epithelial Cell Invasion.

    Science.gov (United States)

    Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi

    2016-06-01

    To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  19. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  20. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  1. SMART-COP: a tool for predicting the need for intensive respiratory or vasopressor support in community-acquired pneumonia.

    Science.gov (United States)

    Charles, Patrick G P; Wolfe, Rory; Whitby, Michael; Fine, Michael J; Fuller, Andrew J; Stirling, Robert; Wright, Alistair A; Ramirez, Julio A; Christiansen, Keryn J; Waterer, Grant W; Pierce, Robert J; Armstrong, John G; Korman, Tony M; Holmes, Peter; Obrosky, D Scott; Peyrani, Paula; Johnson, Barbara; Hooy, Michelle; Grayson, M Lindsay

    2008-08-01

    Existing severity assessment tools, such as the pneumonia severity index (PSI) and CURB-65 (tool based on confusion, urea level, respiratory rate, blood pressure, and age >or=65 years), predict 30-day mortality in community-acquired pneumonia (CAP) and have limited ability to predict which patients will require intensive respiratory or vasopressor support (IRVS). The Australian CAP Study (ACAPS) was a prospective study of 882 episodes in which each patient had a detailed assessment of severity features, etiology, and treatment outcomes. Multivariate logistic regression was performed to identify features at initial assessment that were associated with receipt of IRVS. These results were converted into a simple points-based severity tool that was validated in 5 external databases, totaling 7464 patients. In ACAPS, 10.3% of patients received IRVS, and the 30-day mortality rate was 5.7%. The features statistically significantly associated with receipt of IRVS were low systolic blood pressure (2 points), multilobar chest radiography involvement (1 point), low albumin level (1 point), high respiratory rate (1 point), tachycardia (1 point), confusion (1 point), poor oxygenation (2 points), and low arterial pH (2 points): SMART-COP. A SMART-COP score of >or=3 points identified 92% of patients who received IRVS, including 84% of patients who did not need immediate admission to the intensive care unit. Accuracy was also high in the 5 validation databases. Sensitivities of PSI and CURB-65 for identifying the need for IRVS were 74% and 39%, respectively. SMART-COP is a simple, practical clinical tool for accurately predicting the need for IRVS that is likely to assist clinicians in determining CAP severity.

  2. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  3. Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

    Science.gov (United States)

    Frías, José E; Flores, Enrique

    2015-07-01

    Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

  4. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Science.gov (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  5. Solvent Bonding for Fabrication of PMMA and COP Microfluidic Devices.

    Science.gov (United States)

    Wan, Alwin M D; Moore, Thomas A; Young, Edmond W K

    2017-01-17

    Thermoplastic microfluidic devices offer many advantages over those made from silicone elastomers, but bonding procedures must be developed for each thermoplastic of interest. Solvent bonding is a simple and versatile method that can be used to fabricate devices from a variety of plastics. An appropriate solvent is added between two device layers to be bonded, and heat and pressure are applied to the device to facilitate the bonding. By using an appropriate combination of solvent, plastic, heat, and pressure, the device can be sealed with a high quality bond, characterized as having high bond coverage, bond strength, optical clarity, durability over time, and low deformation or damage to microfeature geometry. We describe the procedure for bonding devices made from two popular thermoplastics, poly(methyl-methacrylate) (PMMA), and cyclo-olefin polymer (COP), as well as a variety of methods to characterize the quality of the resulting bonds, and strategies to troubleshoot low quality bonds. These methods can be used to develop new solvent bonding protocols for other plastic-solvent systems.

  6. 028. Migratory pneumonia—cryptogenic organizing pneumonia (COP)

    Science.gov (United States)

    Lagoudi, Kalliopi; Ioannidou, Despoina; Papadaki, Elena; Organtzis, Ioannis; Kostanta, Soultana; Papaioannou, Antonis; Moumtzi, Despoina; Porpodis, Konstantinos; Fouka, Evaggelia

    2015-01-01

    In this study were presented the clinical and laboratory findings of eight patients with migratory pneumonia, who were hospitalised in our clinic. It is about eight women with average age of 58±13 years with fever, weakness, dry cough, shortness of breath and who already had received antibiotics. Crackles were the most frequent evidence by the auscultation. All patients showed consolidation in chest radiography which resolved completely from the initial area and migrated in different areas. The chest HRCT showed opacity with air bronchogram and ground glass in places. Regarding to the respiratory function, patients showed mild restriction disorder (average values ± SD: FEV1% 83±24, FVC% 86±21, TLC% 82±16, DLco% 74±15). The average price of pO2 was 68+7 mmHg. The findings of BAL were: macrophages 51%±20%, lymphocytes 33.5%±14%, neutrophils 7.5%±3%, eosinophils 7%±8%. From diagnosis, we excluded eosinophilic pneumonia, infectious causes, collagen diseases and vasculitis. The findings of physical examination, chest radiography and the results of the BAL of all of the patients argued for Bronchiolitis obliterans organizing pneumonia (BOOP), the cause of which was not found (cryptogenic organizing pneumonia-COP). All patients responded directly to corticosteroids.

  7. What prospects for soil carbon sequestration in the CDM? COP-6 and beyond

    International Nuclear Information System (INIS)

    Ringius, L.

    2001-01-01

    Although generally supported by international experts and the United Nations Intergovernmental Panel on Climate Change (IPCC), carbon (C) sequestration has long been a contentious and difficult issue in global climate negotiations. As the recent sixth Conference of the Parties (COP-6) held in The Hague in November 2000 demonstrated, the 'sinks' issue divides both the industrialized countries and the developing countries. To understand the background of the C sink controversy, and in order to assess the political acceptability of direct foreign investments in soil C sequestration in developing countries as an eligible climate policy measure, this paper briefly summarizes the main issues in the international policy debate on sinks. The paper finally analyzes the informal outcomes of COP-6 and attempts to predict the outcomes of the resumed COP-6 (COP-6 bis) to be held in July 2001. (author)

  8. Expression of a humanized viral 2A-mediated lux operon efficiently generates autonomous bioluminescence in human cells.

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity

  9. Three-Dimensional Sensor Common Operating Picture (3-D Sensor COP)

    Science.gov (United States)

    2017-01-01

    DEMs that have been computed from the point clouds . Additionally, Fusion3D can also display 3-D data created using photogrammetry software...Picture (3-D Sensor COP). To test the 3-D Sensor COP, we took advantage of a sensor network that had been deployed for the Enterprise Challenge 2016 at...took advantage of a sensor network that had been deployed for the Enterprise Challenge 2016 (EC16) at Fort Huachuca in Sierra Vista, Arizona. The

  10. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  11. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  12. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  13. Increase of COP for heat transformer in water purification systems. Part I - Increasing heat source temperature

    International Nuclear Information System (INIS)

    Siqueiros, J.; Romero, R.J.

    2007-01-01

    The integration of a water purification system in a heat transformer allows a fraction of heat obtained by the heat transformer to be recycled, increasing the heat source temperature. Consequently, the evaporator and generator temperatures are also increased. For any operating conditions, keeping the condenser and absorber temperatures and also the heat load to the evaporator and generator, a higher value of COP is obtained when only the evaporator and generator temperatures are increased. Simulation with proven software compares the performance of the modeling of an absorption heat transformer for water purification (AHTWP) operating with water/lithium bromide, as the working fluid-absorbent pair. Plots of enthalpy-based coefficients of performance (COP ET ) and the increase in the coefficient of performance (COP) are shown against absorber temperature for several thermodynamic operating conditions. The results showed that proposed (AHTWP) system is capable of increasing the original value of COP ET more than 120%, by recycling part of the energy from a water purification system. The proposed system allows to increase COP values from any experimental data for water purification or any other distillation system integrated to a heat transformer, regardless of the actual COP value and any working fluid-absorbent pair

  14. FACEBOOK for CoP of Researchers: Identifying the Needs and Evaluating the Compatibility

    Directory of Open Access Journals (Sweden)

    Sami Miniaoui

    2011-11-01

    Full Text Available Communities of practice (CoPs are increasingly capturing the interest of many fields such as business companies, education and organizations. Many CoPs were developed for people who have common interest in healthcare, agriculture and environment, and teaching. However, there is lack of COPs dedicated for researchers. This research aims to explore the appropriateness of Facebook (FB as a platform for serving a CoP of researchers. To achieve this goal, first we identify the needs of CoPs for researchers within UAE context. Consequently, we adopted qualitative research approach to elicit the needs. We applied the grounded theory method to analyze the data. The results of the analysis showed seven main needs: collaboration, debating, awareness/ notification, reference management, cross search, customization, tracking, and user orientation. Secondly, we evaluated the compatibility of FB features to the identified needs. Although we found that FB covers most of CoPs needs, there are few needs which are not met successfully so this raised some technical and practical issues, which have been highlighted in the paper.

  15. Jasmonate inhibits COP1 activity to suppress hypocotyl elongation and promote cotyledon opening in etiolated Arabidopsis seedlings.

    Science.gov (United States)

    Zheng, Yuyu; Cui, Xuefei; Su, Liang; Fang, Shuang; Chu, Jinfang; Gong, Qingqiu; Yang, Jianping; Zhu, Ziqiang

    2017-06-01

    A germinating seedling undergoes skotomorphogenesis to emerge from the soil and reach for light. During this phase, the cotyledons are closed, and the hypocotyl elongates. Upon exposure to light, the seedling rapidly switches to photomorphogenesis by opening its cotyledons and suppressing hypocotyl elongation. The E3 ubiquitin ligase CONSTITUTIVE PHOTOMORPHOGENIC 1 (COP1) is critical for maintaining skotomorphogenesis. Here, we report that jasmonate (JA) suppresses hypocotyl elongation and stimulates cotyledon opening in etiolated seedlings, partially phenocopying cop1 mutants in the dark. We also find that JA stabilizes several COP1-targeted transcription factors in a COP1-dependent manner. RNA-seq analysis further defines a JA-light co-modulated and cop1-dependent transcriptome, which is enriched for auxin-responsive genes and genes participating in cell wall modification. JA suppresses COP1 activity through at least two distinct mechanisms: decreasing COP1 protein accumulation in the nucleus; and reducing the physical interaction between COP1 and its activator, SUPPRESSOR OF PHYTOCHROME A-105 1 (SPA1). Our work reveals that JA suppresses COP1 activity to stabilize COP1 targets, thereby inhibiting hypocotyl elongation and stimulating cotyledon unfolding in etiolated Arabidopsis seedlings. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  16. Risk Management Capability Maturity and Performance of Complex Product and System (CoPS Projects with an Asian Perspective

    Directory of Open Access Journals (Sweden)

    Ren, Y.

    2014-07-01

    Full Text Available Complex Products and Systems (CoPS are high value, technology and engineering-intensive capital goods. The motivation of this study is the persistent high failure rate of CoPS projects, Asian CoPS provider’s weak capability and lack of specific research on CoPS risk management. This paper evaluates risk management maturity level of CoPS projects against a general CoPS risk management capability maturity model (RM-CMM developed by the authors. An Asian based survey was conducted to investigate the value of RM to project performance, and Asian (non-Japanese CoPS implementers’ perceived application of RM practices, their strengths and weaknesses. The survey result shows that higher RM maturity level leads to higher CoPS project performance. It also shows project complexity and uncertainty moderates the relationship between some RM practices and project performance, which implies that a contingency approach should be adopted to manage CoPS risks effectively. In addition, it shows that Asian CoPS implementers are weak in RM process and there are also rooms for improvement in the softer aspects of organizational capabilities and robustness.

  17. The Copper Homeostasis Transcription Factor CopR Is Involved in H2O2 Stress in Lactobacillus plantarum CAUH2

    Directory of Open Access Journals (Sweden)

    Yang Yang

    2017-10-01

    Full Text Available Transcriptional factors (TFs play important roles in the responses to oxidative, acid, and other environmental stresses in Gram-positive bacteria, but the regulatory mechanism of TFs involved in oxidative stress remains unknown in lactic acid bacteria. In the present work, homologous overexpression strains with 43 TFs were constructed in the Lactobacillus plantarum CAUH2 parent strain. The strain overexpressing CopR displayed the highest sensitivity and a 110-fold decrease in survival rate under H2O2 challenge. The importance of CopR in the response to H2O2 stress was further confirmed by a 10.8-fold increase in the survival of a copR insertion mutant. In silico analysis of the genes flanking copR revealed putative CopR-binding “cop box” sequences in the promoter region of the adjacent gene copB encoding a Cu2+-exporting ATPase. Electrophoretic mobility shift assay (EMSA analysis demonstrated the specific binding of CopR with copB in vitro, suggesting copB is a target gene of CopR in L. plantarum. The role of CopB involved in oxidative stress was verified by the significantly decreased survival in the copB mutant. Furthermore, a growth defect in copper-containing medium demonstrated that CopB functions as an export ATPase for copper ions. Furthermore, EMSAs revealed that CopR functions as a regulator that negatively regulates copB gene and Cu2+ serves as inducer of CopR to activate the expression of CopB in response to H2O2 stress in L. plantarum CAUH2. Our findings indicated that CopR plays an important role in enhancing oxidative resistance by regulating copB to modulate copper homeostasis.

  18. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  19. Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

    Science.gov (United States)

    2011-01-01

    Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

  20. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  1. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  2. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  3. Nanostructured CoP: An efficient catalyst for degradation of organic pollutants by activating peroxymonosulfate

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Rui; Liu, Chao; Li, Jiansheng, E-mail: lijsh@mail.njust.edu.cn; Wang, Jing; Hu, Xingru; Sun, Xiuyun; Shen, Jinyou; Han, Weiqing; Wang, Lianjun

    2017-05-05

    Highlights: • The CoP/PMS system was first presented for decomposition of pollutants. • CoP exhibited dramatic catalytic activity. • Broadened pH range and favorable anti-interference of anions were achieved. • A possible mechanism for activation of PMS by CoP was proposed. - Abstract: A new catalyst system of CoP/peroxymonosulfate (PMS) is presented, which achieved significant improvement in catalytic activity. Nanostructured CoP, obtained by a simple solid-state reaction, exhibited dramatic catalytic activity with 97.2% degradation of orange II of 100 ppm within 4 min. Moreover, the high efficiency could be reached for other phenolic pollutants, i.e., phenol and 4-chlorophenol. The reaction rate is much higher than the most reported catalysts. Effect of parameters on catalytic activity of the catalyst was studied in detail. Notably, initial pH of the solution had a slight negative effect on the catalytic performance over the pH range 4.07–10.92, suggesting that CoP has the great adaptability of pH. CoP/PMS demonstrated excellent anti-interference performance toward anions (Cl{sup −}, NO{sub 3}{sup −}, and HCO{sub 3}{sup −}). In addition, the pathway of degradation of orange II is proposed by analyzing its intermediates. Based on the XPS spectra of CoP, the identification of the reactive species (·OH and SO{sub 4}·{sup −}) by electron paramagnetic resonance (EPR) analysis and quenching tests, a possible mechanism for activation of PMS by CoP was proposed. Considering the dramatic catalytic activity, a wide range of pH catalyst suited, CoP is believed to provide robust support for the promising industrial application of AOPs.

  4. The COP9 signalosome converts temporal hormone signaling to spatial restriction on neural competence.

    Directory of Open Access Journals (Sweden)

    Yi-Chun Huang

    2014-11-01

    Full Text Available During development, neural competence is conferred and maintained by integrating spatial and temporal regulations. The Drosophila sensory bristles that detect mechanical and chemical stimulations are arranged in stereotypical positions. The anterior wing margin (AWM is arrayed with neuron-innervated sensory bristles, while posterior wing margin (PWM bristles are non-innervated. We found that the COP9 signalosome (CSN suppresses the neural competence of non-innervated bristles at the PWM. In CSN mutants, PWM bristles are transformed into neuron-innervated, which is attributed to sustained expression of the neural-determining factor Senseless (Sens. The CSN suppresses Sens through repression of the ecdysone signaling target gene broad (br that encodes the BR-Z1 transcription factor to activate sens expression. Strikingly, CSN suppression of BR-Z1 is initiated at the prepupa-to-pupa transition, leading to Sens downregulation, and termination of the neural competence of PWM bristles. The role of ecdysone signaling to repress br after the prepupa-to-pupa transition is distinct from its conventional role in activation, and requires CSN deneddylating activity and multiple cullins, the major substrates of deneddylation. Several CSN subunits physically associate with ecdysone receptors to represses br at the transcriptional level. We propose a model in which nuclear hormone receptors cooperate with the deneddylation machinery to temporally shutdown downstream target gene expression, conferring a spatial restriction on neural competence at the PWM.

  5. The COP9 signalosome controls jasmonic acid synthesis and plant responses to herbivory and pathogens.

    Science.gov (United States)

    Hind, Sarah R; Pulliam, Sarah E; Veronese, Paola; Shantharaj, Deepak; Nazir, Azka; Jacobs, Nekaiya S; Stratmann, Johannes W

    2011-02-01

    The COP9 signalosome (CSN) is a multi-protein complex that regulates the activities of cullin-RING E3 ubiquitin ligases (CRLs). CRLs ubiquitinate proteins in order to target them for proteasomal degradation. The CSN is required for proper plant development. Here we show that the CSN also has a profound effect on plant defense responses. Silencing of genes for CSN subunits in tomato plants resulted in a mild morphological phenotype and reduced expression of wound-responsive genes in response to mechanical wounding, attack by Manduca sexta larvae, and Prosystemin over-expression. In contrast, expression of pathogenesis-related genes was increased in a stimulus-independent manner in these plants. The reduced wound response in CSN-silenced plants corresponded with reduced synthesis of jasmonic acid (JA), but levels of salicylic acid (SA) were unaltered. As a consequence, these plants exhibited reduced resistance against herbivorous M. sexta larvae and the necrotrophic fungal pathogen Botrytis cinerea. In contrast, susceptibility to tobacco mosaic virus (TMV) was not altered in CSN-silenced plants. These data demonstrate that the CSN orchestrates not only plant development but also JA-dependent plant defense responses. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  6. KINGS Model: Achieving Sustainable Change in Nuclear Engineering Education for the Post-COP21 Era

    International Nuclear Information System (INIS)

    Oh, S.-K.

    2016-01-01

    Full text: In spite of the world nuclear community’s systematic and multilateral efforts during the COP21, most of the conference participants were reluctant to acknowledge the value of nuclear as a low-carbon energy source. In fact, the on-going aftermath of the Fukushima nuclear disaster has been overwhelming despite the evidence that there was neither any critical technical flaw nor fatal radiation casualties. This shows that advanced nuclear knowledge failed to resonate with public perception on nuclear energy. In this respect, it is now time to focus on achieving sustainable change in nuclear engineering education for the future. The KEPCO International Nuclear Graduate School (KINGS) was established to nurture leadership-level nuclear power professionals in the global standard. It affiliates with Korean nuclear industry to achieve three major goals that are also a universal prerequisite for higher education of engineering in the 21st century as follows: “a balance between education and training,” “harmony between engineering and managerial skills,” and “the application of systems engineering to nuclear power projects.” KINGS curriculum requires transdisciplinary coordination among engineering disciplines, engineering specialties, and socioeconomic methods. (author

  7. Point Climat no. 33 'International Climate Negotiations - COP 19: do not underestimate the MRV breakthrough'

    International Nuclear Information System (INIS)

    Dupont, Marion; Morel, Romain; Bellassen, Valentin; Deheza, Mariana

    2013-01-01

    Among the publications of CDC Climat Research, 'Climate Briefs' presents, in a few pages, hot topics in climate change policy. This issue addresses the following points: For those who expect 'binding' emission reductions targets in the future international climate agreement to be signed in Paris in 2015, the Warsaw Conference (November 11 to 23, 2013) yielded as much progress as it could. That means little beyond a timetable. However, for those who consider the UNFCCC as the depository of common tools on the monitoring, reporting and verification (MRV) of emissions, actions and financing, Warsaw represents a major breakthrough. For the first time, developing countries - at least those wishing to access climate finance for forests - will abide by MRV procedures similar to those governing the greenhouse gas inventories of industrialized countries. Forestry may be seen as a first sectoral NAMA, and it would be difficult to ignore the Warsaw decisions for the future definition of MRV procedures of NAMAs. In spite of the establishment of the Warsaw International Mechanism for Loss and Damage, low outputs on other issues show that achieving an agreement at COP 21 will require significant political progress during the next 15 months

  8. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

    Science.gov (United States)

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

    2017-11-01

    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

  9. Isolation of three B-box zinc finger proteins that interact with STF1 and COP1 defines a HY5/COP1 interaction network involved in light control of development in soybean

    International Nuclear Information System (INIS)

    Shin, Su Young; Kim, Seong Hee; Kim, Hye Jin; Jeon, Su Jeong; Sim, Soon Ae; Ryu, Gyeong Ryul; Yoo, Cheol Min; Cheong, Yong Hwa; Hong, Jong Chan

    2016-01-01

    LONG HYPOCOTYL5 (HY5) and STF1 (Soybean TGACG-motif binding Factor 1) are two related bZIP transcription factors that play a positive role in photomorphogenesis and hormonal signaling. In this study, we compared full length STF1 and truncated STF1 overexpression lines and found that the C-terminal 133 amino acids (194–306) possess all the HY5-like function in Arabidopsis. The STF1-DC1 mutant (1–306), with a 20 amino acid deletion at the carboxy terminus, failed to complement the hy5 mutant phenotype, which suggests an intact C-terminus is required for STF1 function. To understand the role of the C-terminal domain in photomorphogenesis we used a yeast two-hybrid screen to isolate proteins that bind to the STF1 C-terminus. We isolated three soybean cDNAs encoding the zinc-finger proteins GmSTO, GmSTH, and GmSTH2, which interact with STF1. These proteins belong to a family of B-box zinc finger proteins that include Arabidopsis SALT TOLERANCE (STO) and STO HOMOLOG (STH) and STH2, which play a role in light-dependent development and gene expression. The C-terminal 63 amino acids of STF1, containing a leucine zipper and the two N-terminal B-boxes, contains the domain involved in interactions between STF1 and GmSTO. In addition, we identified an interaction between soybean COP1 (GmCOP1) and GmSTO and GmSTH, as well as STF1, which strongly suggests the presence of a similar regulatory circuit for light signaling in soybean as in Arabidopsis. This study shows that photomorphogenic control requires complex molecular interactions among several different classes of transcription factors such as bZIP, B-box factors, and COP1, a ubiquitin ligase. - Highlights: • STF1 interact with GmSTO, GmSTH and GmSTH2. • The bZIP transcription factor STF1 requires an intact C-terminal domain for STF1 function. • STF1 and GmSTO are nuclear proteins.

  10. COP1 Controls Abiotic Stress Responses by Modulating AtSIZ1 Function Through its E3 Ubiquitin Ligase Activity

    Directory of Open Access Journals (Sweden)

    Joo Yong Kim

    2016-08-01

    Full Text Available Ubiquitination and sumoylation are essential post-translational modifications that regulate growth and development processes in plants, including control of hormone signaling mechanisms and responses to stress. This study showed that COP1 (Constitutive photomorphogenic 1 regulated the activity of Arabidopsis E3 SUMO (Small ubiquitin-related modifier ligase AtSIZ1 through its E3 ubiquitin ligase activity. Yeast two hybrid analysis demonstrated that COP1 and AtSIZ1 directly interacted with one another, and subcellular localization assays indicated that COP1 and AtSIZ1 co-localized in nuclear bodies. Analysis of ubiquitination showed that AtSIZ1 was polyubiquitinated by COP1. The AtSIZ1 level was higher in cop1-4 mutants than in wild-type seedlings under light or dark conditions, and overexpression of a dominant-negative (DN-COP1 mutant led to a substantial increase in AtSIZ1 accumulation. In addition, under drought, cold, and high salt conditions, SUMO-conjugate levels were elevated in DN-COP1-overexpressing plants and cop1-4 mutant plants compared to wild-type plants. Taken together, our results indicate that COP1 controls responses to abiotic stress by modulation of AtSIZ1 levels and activity.

  11. Fingerprinting and diversity of bacterial copA genes in response to soil types, soil organic status and copper contamination.

    Science.gov (United States)

    Lejon, David P H; Nowak, Virginie; Bouko, Sabrina; Pascault, Noémie; Mougel, Christophe; Martins, Jean M F; Ranjard, Lionel

    2007-09-01

    A molecular fingerprinting assay was developed to assess the diversity of copA genes, one of the genetic determinants involved in bacterial resistance to copper. Consensus primers of the copA genes were deduced from an alignment of sequences from proteobacterial strains. A PCR detection procedure was optimized for bacterial strains and allowed the description of a novel copA genetic determinant in Pseudomonas fluorescens. The copA DNA fingerprinting procedure was optimized for DNA directly extracted from soils differing in their physico-chemical characteristics and in their organic status (SOS). Particular copA genetic structures were obtained for each studied soil and a coinertia analysis with soil physico-chemical characteristics revealed the strong influence of pH, soil texture and the quality of soil organic matter. The molecular phylogeny of copA gene confirmed that specific copA genes clusters are specific for each SOS. Furthermore, this study demonstrates that this approach was sensitive to short-term responses of copA gene diversity to copper additions to soil samples, suggesting that community adaptation is preferentially controlled by the diversity of the innate copA genes rather than by the bioavailability of the metal.

  12. Synthesis of NiPS3 and CoPS and its hydrogen storage capacity

    International Nuclear Information System (INIS)

    Ismail, N.; Madian, M.; El-Meligi, A.A.

    2014-01-01

    Highlights: • Preparation of NiPS 3 and CoPS using solid state reaction. • Characterization of compounds using XRD, TEM, SEM and IR. • Measuring the compounds thermal stability. • Estimation of the hydrogen storage capacity. -- Abstract: Prepared CoPS and NiPS 3 are studied as new materials for hydrogen energy storage. Single phase of CoPS and NiPS 3 were grown separately in evacuated silicatube via solid state reaction at 650 °C with controlled heating rate 1 °C/min. X-ray diffraction patterns confirm the formation of the desired compounds. Both CoPS and NiPS 3 exhibited high thermal stability up to 700 °C and 630 °C, respectively. The morphology of the prepared samples was investigated using scanning electron microscopy and folded sheets appeared in the transmission electron microscopy. The samples were exposed to 20 bar applied hydrogen pressure at 80 K. Both compounds appear to have feasible hydrogen storage capacity. CoPS was capable to adsorb 1.7 wt% while NiPS 3 storage capacity reached 1.2 wt%

  13. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  14. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  16. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  17. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  18. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  20. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  3. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  4. Avances en la exposición contable de CoPs y memorias GRI = Advances in CoPs and GRI reports as accounting statements

    Directory of Open Access Journals (Sweden)

    Liliana Fernández Lorenzo

    2012-07-01

    Full Text Available Actualmente para lograr un desarrollo sustentable, la sociedad requiere que las organizaciones asuman su responsabilidad socio-ambiental y emitan información acerca de los impactos que su actividad genera en el medioambiente.Dicha información mayormente se presenta a través de las denominadas Memorias o Reportes de Sostenibilidad, que responden a distintas formas y contenidos. Cada vez son más los informes que se elaboran siguiendo los lineamientos del Pacto Mundial (PM y del Global Reporting Initiative (GRI.Consideramos que la información sobre la responsabilidad socio-ambiental debería reunir los requisitos que hacen a toda buena información contable, para incrementar su utilidad.Para comprobarlo, se realiza un estudio de casos a los fines de determinar las características generales de estos informes elaborados bajo pautas del PM y del GRI conjuntamente, concluyendo que la información presentada en las memorias analizadas no reúne los requisitos de una buena información contable.A fin de que la exposición de las CoPs y memorias de sostenibilidad GRI, pueda calificarse de contable, se expresan sintéticamente los indicadores analizados agregando su relación porcentual y se incorporan al Estado Contable Socio-ambiental realizado de acuerdo al modelo base de la FCE-UNLP, considerado como un estado contable (Fernández Lorenzo y Geba, 2008.Nowadays in order to achieve sustainable development, organizations are required to take on their social and environmental responsibility and give information about the impact of their activities in the environment.This information is usually presented through sustainability reports, which widely differ in content and layout. Many organizations worldwide have assumed their responsibility by implementing Global Reporting Initiative (GRI and United Nations Global Compact (GC guidelines.We consider that the information regarding socio-environmental responsibility, should meet the characteristics of the

  5. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  6. Low-grade heat and its definitions of Coefficient-of-Performance (COP)

    International Nuclear Information System (INIS)

    Wang, Lin-Shu; Ma, Peizheng

    2015-01-01

    Use of fire for low grade heat, still widely practiced today, is wasteful because it is based on the principle of heat production – which should have become an outmoded idea post-Carnot for low grade heat application as an exergy analysis will readily conclude. Instead of application of exergy analysis, a new thermodynamic analysis resulting from the unification of Kelvin's energy principle and the entropy principle, formulated recently (called the entropic theory of heat), is applied here to reexamine the problem of building heating. Other than improving envelope heat resistance, conventional building efficiency gain is predominantly obtained by improving HVAC efficiency (i.e., boiler efficiency); our finding shows that there is in fact large room in improving the building heating operation surpassing 100% boiler efficiency, as demonstrated by the large value of the Kelvin limit (the theoretical upper bound of Thermal COP). This theoretical possibility of generous amount of heat from fire suggests additional possibilities of heat from primary energy other than fire, and the disclosure of these possibilities by applying the triad framework in the entropic theory of heat in terms of alternative definitions of Coefficient of Performance (COP). Consideration of such alternative COPs suggests real possibility of efficiently and cost effectively obtaining low grade heat from primary energy. - Highlights: • Importance of thinking heat extraction for high energy efficiency in buildings. • The concept of Thermal COP and the determination of its (maximum) Kelvin limit. • Key to find the sweet spot of using heat pump is thinking general heat extraction. • triadCOP &eThermalCOP are measure of energy transformation in the triad framework

  7. Stability of CoP x Electrocatalysts in Continuous and Interrupted Acidic Electrolysis of Water.

    Science.gov (United States)

    Goryachev, Andrey; Gao, Lu; Zhang, Yue; Rohling, Roderigh Y; Vervuurt, René H J; Bol, Ageeth A; Hofmann, Jan P; Hensen, Emiel J M

    2018-04-11

    Cobalt phosphides are an emerging earth-abundant alternative to platinum-group-metal-based electrocatalysts for the hydrogen evolution reaction (HER). Yet, their stability is inferior to platinum and compromises the large-scale applicability of CoP x in water electrolyzers. In the present study, we employed flat, thin CoP x electrodes prepared through the thermal phosphidation (PH 3 ) of Co 3 O 4 films made by plasma-enhanced atomic layer deposition to evaluate their stability in acidic water electrolysis by using a multi-technique approach. The films were found to be composed of two phases: CoP in the bulk and a P-rich surface CoP x (P/Co>1). Their performance was evaluated in the HER and the exchange current density was determined to be j 0 =-8.9 ⋅ 10 -5  A/cm 2 . The apparent activation energy of HER on CoP x ( E a =81±15 kJ/mol) was determined for the first time. Dissolution of the material in 0.5 M H 2 SO 4 was observed, regardless of the constantly applied cathodic potential, pointing towards a chemical instead of an electrochemical origin of the observed cathodic instability. The current density and HER faradaic efficiency (FE) were found to be stable during chronoamperometric treatment, as the chemical composition of the HER-active phase remained unchanged. On the contrary, a dynamic potential change performed in a repeated way facilitated dissolution of the film, yielding its complete degradation within 5 h. There, the FE was also found to be changing. An oxidative route of CoP x dissolution has also been proposed.

  8. World Climate Conference - a play re-enacting the COPs

    Science.gov (United States)

    Vamborg, Freja S. E.; Klockmann, Marlene; Koch, Boris P.; Otto, Juliane; Rauser, Florian; Schemann, Vera; Sonntag, Sebastian; Haug, Helgard; Kaegi, Stefan; Wetzel, Daniel; Schipper, Imanuel; Bochow, Jörg

    2016-04-01

    Last December, Paris was the host city for the 21st Conference of the Parties (COP21) of the United Nations Framework Convention on Climate Change (UNFCCC). Representatives of 195 countries met to dispute a legally binding climate agreement - a highly complex process involving thousands of politicians, scientists and activists, that to date has taken over two decades. The director ensemble "Rimini Protokoll" re-enacted this mammoth-scale drama of diplomacy in the play "Weltklimakonferenz" (World Climate Conference) at the "Deutsches Schauspielhaus" theatre in Hamburg, Germany. Since the opening night (21st Nov. 2014), the play has been performed 16 times, reaching an audience of over 9000. All performers in the play were experts and scientists at different stages of their careers, including PhD students, journalists and professors. Each spectator took on the identity of a delegate of one of the 195 participating countries. We will present the project and the performance, thereby highlighting the role of and the interaction between the spectators and early career scientists. In a nutshell the play went as follows (https://vimeo.com/137817619); after an opening ceremony, the audience was divided up into seven groups, each of which was given advice by experts in several different briefings. These informed on country-specific challenges caused by the social and economic situation, possible future climatic changes and negotiating tactics. In addition, the delegations had bilateral meetings, enabling them to exchange views and experiences with one another. Towards the end of the play each delegation was asked to submit a national commitment to greenhouse gas reduction and a financial contribution to the Green Climate Fund. Based on these national commitments, the final plenum revealed whether or not the delegations had managed to submit reductions compatible with restricting global warming to 2°C compared to pre-industrial times. Due to their direct personal involvement

  9. The Young Generation at UNICEF COP6 ... and other flexibility mechanisms

    International Nuclear Information System (INIS)

    Meskens, Gaston; Avezou, Florence

    2001-01-01

    Climate change and long term energy strategies are world-scale common concerns, and decisions taken now will have an important impact on the quality of life of our future generations. As electricity production is one of the major CO 2 sources (next to transport and domestic use of energy), nuclear can play a role when it comes to agree on policies and measures to cut global warming - even with regard to sensitive topics such as joint implementation, clean development mechanisms and trading. The Sixth Conference of the Parties (COP6) on the UN Framework Convention on Climate Change met in The Hague (Netherlands) on November 13-24, 2000. It was expected that the final details on the implementation of the Kyoto Protocol would be determined during this conference, so that developed countries can start the process of ratification of the accords. It turned out different. For the nuclear industry, there is optimism. The conference was a success because no agreement is better than exclusion. The industry received a lot of attention, that was more negative than positive, but still, it is open for discussion. COP6 was very different from the previous COP's and SB's. There has never been a bigger difference in perception of nuclear between 'buzz in the corridors' (based on actual positive evolutions in some countries) on the one hand, and references in the official talks on the other hand. This also means that the negotiations are becoming more and more complicated and that a lot of diplomacy is necessary. Given the sensitiveness of the topic, the nuclear representatives decided to keep 'low profile' at COP6. For what the impact of the Young Generation (YG) contacts with the pressure group are concerned, we foresaw COP6 to be the turning point, and we were right. The surprise effect (COP3) is gone, the period of curiosity and 'sympathy' (COP4) and neglect (COP5) is passed and, now that the green groups see that our attendance has an effect, they start to take us seriously

  10. Police officers who commit suicide by cop: a clinical study with analysis.

    Science.gov (United States)

    Arias, Elizabeth A; Schlesinger, Louis B; Pinizzotto, Anthony J; Davis, Edward F; Fava, Joanna L; Dewey, Lauren M

    2008-11-01

    Suicide by cop has become a familiar topic among members of law enforcement, mental health professionals, and the general public. This paper presents two cases where police officers chose to commit suicide by getting other police officers to kill them. The two police officers studied, by examination of closed case files, were found to be similar to civilians who committed suicide by cop on several demographic (gender, age, history of mental illness, and suicide attempts), and situational (stress factors, trigger) variables. The cases help us to understand possible motives and management for individuals who choose to end their life in this manner.

  11. Les transitions énergétiques après les COP 21 et 22

    OpenAIRE

    Balibar , Sebastien

    2017-01-01

    International audience; How far are we in the urgent fight against the climate change? This article starts with a short analysis of the results of COP21 and COP22, the two “conferences of parties” where goals have been defined. Now, to define goals is one thing, but to reach these goals is another thing. In its second part, this article analyzes the energy transition that has been voted by France in 2015, and compares it to what is planned in other countries, especially in Germany.; Où en som...

  12. Toward High-Performance and Low-Cost Hydrogen Evolution Reaction Electrocatalysts: Nanostructuring Cobalt Phosphide (CoP) Particles on Carbon Fiber Paper.

    Science.gov (United States)

    Yu, Shu Hearn; Chua, Daniel H C

    2018-05-02

    In this communication, we facily fabricated nanostructured CoP particles (150 to 200 nm) on carbon fiber paper (CFP) for hydrogen evolution reaction (HER) by a simple two-step process via a green route. In the first step, crystalline Co 3 O 4 nanocubes (150-200 nm) were loaded on CFP through a hydrothermal process at low temperature (120 °C). Interestingly, crystalline Co 3 O 4 nanocubes with a size 150-200 nm exhibited different growth mechanisms in contrast to the crystalline Co 3 O 4 nanocubes with a size <100 nm reported earlier. In the second step, these crystalline Co 3 O 4 nanocubes were converted to catalytically active CoP particles through chemical vapor deposition (CVD) phosphorization (denoted as CoP/CFP-H). Remarkably, CoP/CFP-H exhibited a low Tafel slope of 49.7 mV/dec and only required overpotentials of 128.1, 144.4, and 190.8 mV to drive geometric current densities of -10, -20, and -100 mA cm -2 , respectively. Besides, the CoP/CFP-H also demonstrated an excellent durability in an acidic environment under 2000 sweeps at a high scan rate (100 mV s -1 ) and a 24 h chronopotentiometry testing. For comparison, CoP was also fabricated through the electrodeposition method, followed by CVD phosphorization (denoted as CoP/CFP-E). It was found that the latter had exhibited inferior activity compared to CoP/CFP-H. The good performances of CoP/CFP-H are essentially due to the rational designs of electrode: (i) the applications of highly HER active CoP electrocatalyst, (ii) the intimate contact of nanostructured CoP on carbon fibers, and (iii) the large electrochemical surface area at electrocatalyst/electrolyte interface due to the large retaining of particles features after phosphorization. Notably, the intermediate Co 3 O 4 /CFP can serve as a platform to develop other cobalt-based functional materials.

  13. Increase of COP for heat transformer in water purification systems. Part II - Without increasing heat source temperature

    International Nuclear Information System (INIS)

    Romero, R.J.; Siqueiros, J.; Huicochea, A.

    2007-01-01

    The integration of a water purification system allows a heat transformer to increase the actual coefficient of performance, by the reduction of the amount of heat supplied by unit of heat. A new defined COP called COP WP is proposed for the present system, which considers the fraction of heat recycled. Simulation with proven software compares the performance of the modeling of an absorption heat transformer for water purification (AHTWP) operating with water/lithium bromide, as working fluid-absorbent pair. Plots of enthalpy-based coefficients of performance (COP ET ) and water purification coefficient of performance (COP WP ) are shown against absorber temperature for several thermodynamic operating conditions. The results showed that the proposed (AHTWP) system is capable of increasing the original value of COP ET up to 1.6 times its original value by recycling energy from a water purification system. The proposed COP WP allows increments for COP values from any experimental data for water purification or for any other distillation system integrated to a heat transformer, regardless of actual COP A value or working fluid-absorbent pair

  14. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  15. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  16. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel

    2011-05-01

    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  17. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  18. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  19. CoP nanosheet assembly grown on carbon cloth: A highly efficient electrocatalyst for hydrogen generation

    KAUST Repository

    Yang, Xiulin

    2015-07-01

    There exists a strong demand to replace expensive noble metal catalysts with cheap metal sulfides or phosphides for hydrogen evolution reaction (HER). Recently metal phosphides such as NixP, FeP and CoP have been considered as promising candidates to replace Pt cathodes. Here we report that the nanocrystalline CoP nanosheet assembly on carbon cloth can be formed by a two-step process: electrochemical deposition of Co species followed by gas phase phosphidation. The CoP catalyst in this report exhibits a Tafel slope of 30.1mV/dec in 0.5M H2SO4 and 42.6mV/dec in 1M KOH. The high HER performance of our CoP catalysts is attributed to the rugae-like morphology which results in a high double-layer capacitance and high density of active sites, estimated as 7.77×1017sites/cm2. © 2015 Elsevier Ltd.

  20. HUBUNGAN TEGANGAN INPUT KOMPRESOR DAN TEKANAN REFRIGERAN TERHADAP COP MESIN PENDINGIN RUANGAN

    Directory of Open Access Journals (Sweden)

    Eko Budiyanto

    2014-06-01

    Full Text Available Listrik merupakan sumber energi utama pada peralatan elektronik terutama pada AC ( air conditioner,  sehingga besar kecilnya tegangan listrik sangat mempengaruhi kinerja mesin. Selain tegangan listrik, kerja mesin pendingin juga dipengaruhi oleh tekanan refrigeran. Penelitian ini bertujuan untuk mengetahui hubungan tegangan input kompresor dan tekanan refrigeran terhadap COP serta untuk mengetahui perubahan temperatur yang terjadi pada evaporator dan kondensor karena pengaruh tegangan input kompresor dan tekanan refrigeran. Penelitian dilakukan dengan cara melakukan pengambilan data pada AC split dengan tegangan input kompresor yang divariasikan 200V, 210V, 220V, dan 230V (tekanan refrigeran 70 Psi. Selain memvariasikan tegangan input kompresor juga memvariasikan pada tekanan refrigeran yaitu pada tekanan refrigeran 30 Psi, 50 Psi, dan 70 Psi (tegangan input kompresor 220V. Dari hasil perhitungan data diperoleh nilai COP pada tegangan input kompresor 200V, 210V, 220V, dan 230V masing-masing adalah 16,87; 17,855; 19,865; dan 18,23. COP pada tekanan refrigeran 30 Psi, 50 Psi, dan 70 Psi masing-masing adalah 14,980; 17,296; 19,865. Dari besarnya nilai COP pada beberapa varian percobaan didapatkan hasil bahwa tegangan input kompresor yang paling baik adalah 220V dan tekanan refrigeran yang paling baik adalah 70Psi.

  1. International climate change policy: background and significance of upcoming COP17 meeting for South Africa

    CSIR Research Space (South Africa)

    Thambiran, Tirusha

    2011-09-01

    Full Text Available COP17 is primarily a meeting about climate change and what can be done internationally to mitigate climate change. The overarching mitigation goal is to develop a legally binding agreement to control and limit the amount of GHGs that countries would...

  2. Tackling the climate targets set by the Paris Agreement (COP 21 ...

    African Journals Online (AJOL)

    Tackling the climate targets set by the Paris Agreement (COP 21): Green leadership empowers public hospitals to overcome obstacles and challenges in a ... To improve commitment from all involved roleplayers, political leadership, supportive government policies and financial funding is mandatory, or public hospitals will ...

  3. A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer.

    Science.gov (United States)

    Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V

    2016-05-13

    Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism.

    Science.gov (United States)

    Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul

    2017-07-15

    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

  5. Lightweight and Statistical Techniques for Petascale Debugging: Correctness on Petascale Systems (CoPS) Preliminry Report

    Energy Technology Data Exchange (ETDEWEB)

    de Supinski, B R; Miller, B P; Liblit, B

    2011-09-13

    years of the project, we have successfully extended STAT to determine the relative progress of different MPI processes. We have shown that the STAT, which is now included in the debugging tools distributed by Cray with their large-scale systems, substantially reduces the scale at which traditional debugging techniques are applied. We have extended CBI to large-scale systems and developed new compiler based analyses that reduce its instrumentation overhead. Our results demonstrate that CBI can identify the source of errors in large-scale applications. Finally, we have developed MPIecho, a new technique that will reduce the time required to perform key correctness analyses, such as the detection of writes to unallocated memory. Overall, our research results are the foundations for new debugging paradigms that will improve application scientist productivity by reducing the time to determine which package or module contains the root cause of a problem that arises at all scales of our high end systems. While we have made substantial progress in the first two years of CoPS research, significant work remains. While STAT provides scalable debugging assistance for incorrect application runs, we could apply its techniques to assertions in order to observe deviations from expected behavior. Further, we must continue to refine STAT's techniques to represent behavioral equivalence classes efficiently as we expect systems with millions of threads in the next year. We are exploring new CBI techniques that can assess the likelihood that execution deviations from past behavior are the source of erroneous execution. Finally, we must develop usable correctness analyses that apply the MPIecho parallelization strategy in order to locate coding errors. We expect to make substantial progress on these directions in the next year but anticipate that significant work will remain to provide usable, scalable debugging paradigms.

  6. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  7. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  8. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  9. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  10. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  11. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  12. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  13. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  14. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  15. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  16. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  17. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  18. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  19. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  1. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  2. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  3. Curli Fibers Are Highly Conserved between Salmonella typhimurium and Escherichia coli with Respect to Operon Structure and Regulation

    Science.gov (United States)

    Römling, Ute; Bian, Zhao; Hammar, Mårten; Sierralta, Walter D.; Normark, Staffan

    1998-01-01

    Mouse-virulent Salmonella typhimurium strains SR-11 and ATCC 14028-1s express curli fibers, thin aggregative fibers, at ambient temperature on plates as judged by Western blot analysis and electron microscopy. Concomitantly with curli expression, cells develop a rough and dry colony morphology and bind the dye Congo red (called the rdar morphotype). Cloning and characterization of the two divergently transcribed operons required for curli biogenesis, csgBA(C) and csgDEFG, from S. typhimurium SR-11 revealed the same gene order and flanking genes as in Escherichia coli. The divergence of the curli region between S. typhimurium and E. coli at the nucleotide level is above average (22.4%). However, a high level of conservation at the protein level, which ranged from 86% amino acid homology for the fiber subunit CsgA to 99% homology for the lipoprotein CsgG, implies functional constraints on the gene products. Consequently, S. typhimurium genes on low-copy-number plasmids were able to complement respective E. coli mutants, although not always to wild-type levels. rpoS and ompR are required for transcriptional activation of (at least) the csgD promoter. The high degree of conservation at the protein level and the identical regulation patterns in E. coli and S. typhimurium suggest similar roles of curli fibers in the same ecological niche in the two species. PMID:9457880

  4. AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration.

    Science.gov (United States)

    Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A

    2015-09-01

    Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Involvement of the Cra global regulatory protein in the expression of the iscRSUA operon, revealed during studies of tricarballylate catabolism in Salmonella enterica.

    Science.gov (United States)

    Lewis, Jeffrey A; Boyd, Jeffrey M; Downs, Diana M; Escalante-Semerena, Jorge C

    2009-04-01

    In Salmonella enterica, tricarballylate (Tcb) catabolism requires function of TcuB, a membrane-bound protein that contains [4Fe-4S] clusters and heme. TcuB transfers electrons from reduced flavin adenine dinucleotide in the Tcb dehydrogenase (TcuA) to electron acceptors in the membrane. We recently showed that functions needed to assemble [Fe-S] clusters (i.e., the iscRSUA-hscBA-fdx operon) compensate for the lack of ApbC during growth of an apbC strain on Tcb. ApbC had been linked to [Fe-S] cluster metabolism, and we showed that an apbC strain had decreased TcuB activity. Here we report findings that expand our understanding of the regulation of expression of the iscRSUA genes in Salmonella enterica. We investigated why low levels of glucose or other saccharides restored growth of an apbC strain on Tcb. Here we report the following findings. (i) A Cra. (iv) Putative Cra binding sites are present in the regulatory region of the iscRSUA operon. (v) Cra protein binds to all three sites in the iscRSUA promoter region in a concentration-dependent fashion. To our knowledge, this is the first report of the involvement of Cra in [Fe-S] cluster assembly.

  6. The COP22 in Africa. Is the African group of negotiators in tune?

    International Nuclear Information System (INIS)

    Maupin, Agathe

    2016-01-01

    As the COP22 is about to take place in an African country (Morocco), the author discusses how African countries deal with the fact that they belong to different negotiation groups, and which are the strategies adopted until now by the group of African negotiators to cope with the delicate combination of national requests and continental vision. Thus, the author recalls and comments the positions adopted since COP1 by the five groups of negotiators and their relationships with different international bodies. She discuses the posture and strategies of African countries, and how to gather them about topics of common interest such as adaptation, financing and transfer of capacities and technologies. She also comments the emergence of a new strategy regarding financing mechanisms

  7. COP21: a 1.5 deg. C or 2 deg. C target?

    International Nuclear Information System (INIS)

    Huet, Sylvestre

    2015-01-01

    This article discusses and somehow criticises the definition of a limitation for temperature increase to 1.5 degree rather than 2 degree. Even though this objective is grounded on a positive motivation, notably to support countries which are the most threatened by sea level rise, the article shows that this 1.5 degree objective cannot be met, and is even about to be already reached due to the level of already emitted greenhouse gases, notably CO 2 . Then it discusses the interest of COP21 debate and agreement as it defines an unreachable objective. This leads to the observation of an insufficiency of policies expressed at the COP21, with however the merit to admit the truth: the impossibility to define a route which would allow the 2 degree limit not to be overcome, as it is shown by various data of evolution of emissions

  8. Insect peptide CopA3-induced protein degradation of p27Kip1 stimulates proliferation and protects neuronal cells from apoptosis

    International Nuclear Information System (INIS)

    Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan; Seok, Heon; Lee, Dong Gun; Hwang, Jae Sam; Kim, Ho

    2013-01-01

    Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects

  9. Insect peptide CopA3-induced protein degradation of p27Kip1 stimulates proliferation and protects neuronal cells from apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of); Seok, Heon [Department of Biomedical Science, Jungwon University, Goesan, Chungcheongbukdo 367-700 (Korea, Republic of); Lee, Dong Gun [School of Life Sciences and Biotechnology, College of Natural Sciences, Kyungpook National University, Daegu 702-701 (Korea, Republic of); Hwang, Jae Sam [Department of Agricultural Biology, National Academy of Agricultural Science, RDA, Suwon 441-707 (Korea, Republic of); Kim, Ho, E-mail: hokim@daejin.ac.kr [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of)

    2013-07-19

    Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects.

  10. The Evolution of COP9 Signalosome in Unicellular and Multicellular Organisms.

    Science.gov (United States)

    Barth, Emanuel; Hübler, Ron; Baniahmad, Aria; Marz, Manja

    2016-05-02

    The COP9 signalosome (CSN) is a highly conserved protein complex, recently being crystallized for human. In mammals and plants the COP9 complex consists of nine subunits, CSN 1-8 and CSNAP. The CSN regulates the activity of culling ring E3 ubiquitin and plays central roles in pleiotropy, cell cycle, and defense of pathogens. Despite the interesting and essential functions, a thorough analysis of the CSN subunits in evolutionary comparative perspective is missing. Here we compared 61 eukaryotic genomes including plants, animals, and yeasts genomes and show that the most conserved subunits of eukaryotes among the nine subunits are CSN2 and CSN5. This may indicate a strong evolutionary selection for these two subunits. Despite the strong conservation of the protein sequence, the genomic structures of the intron/exon boundaries indicate no conservation at genomic level. This suggests that the gene structure is exposed to a much less selection compared with the protein sequence. We also show the conservation of important active domains, such as PCI (proteasome lid-CSN-initiation factor) and MPN (MPR1/PAD1 amino-terminal). We identified novel exons and alternative splicing variants for all CSN subunits. This indicates another level of complexity of the CSN. Notably, most COP9-subunits were identified in all multicellular and unicellular eukaryotic organisms analyzed, but not in prokaryotes or archaeas. Thus, genes encoding CSN subunits present in all analyzed eukaryotes indicate the invention of the signalosome at the root of eukaryotes. The identification of alternative splice variants indicates possible "mini-complexes" or COP9 complexes with independent subunits containing potentially novel and not yet identified functions. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Fait saillant : Le CRDI à la 21e Conférence des Parties (COP21 ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    13 avr. 2016 ... Le CRDI a assisté à la Conférence des Nations Unies sur les changements climatiques (COP21) du 30 novembre au 11 décembre 2015 à titre de membre de la délégation canadienne officielle. Plus de 20 de nos bénéficiaires de pays en développement ont fait part de leurs résultats de recherche lors ...

  12. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  13. Molecular characterization of a peanut variety and its derivatives based on SSR and COP analysis

    Institute of Scientific and Technical Information of China (English)

    Xiaoping REN; Boshou LIAO; Huifang JIANG; Zhongyuan YUAN; Yuning CHEN; Xiaojing ZHOU; Li HUANG; Jiaquan HUANG; Yong LEI; Liying YAN

    2016-01-01

    Despite the economic importance of the peanut,no studies have been carried out to determine the correlation between genetic distances based on molecular markers and on coefficient of parentage (COP) data.In this study,simple sequence repeat (SSR) and pedigree data were used to assess the genetic distance between the Fuhuasheng variety and its derivative cultivars.A total of 39 SSR polymorphism primers were used,and 151 bands were obtained,with an average of 2.04 bands in each primer.The genetic SSR-based distance (GD) values ranged from 0.02 to 0.81,while the COP-based GD ranged from 0.25 to 0.98.Certain Fuhuasheng loci displayed higher transmission rates.These loci or nearby chromosomal regions might be associated with desirable traits in Fuhuasheng variety,thus being frequently selected in breeding programs.Therefore,it can be suggested that COP analysis should be the preferred method for estimating genetic diversity invarieties with available complete pedigree information and parents.In this case,marker analysis would provide the best estimations.

  14. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  15. The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

    Science.gov (United States)

    Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

    2017-01-01

    The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

  16. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  17. Monodispersepoly[BMA-co-(COPS-I)] Particles by Soap-Free Emulsion Copolymerization and Its Optical Properties as Photonic Crystals.

    Science.gov (United States)

    Lee, Ki Chang; Choo, Hun Seung

    2015-10-01

    In order to study the surfactant-free emulsion copolymerization of benzyl methacrylate (BMA) with sodium 1-allyloxy-2-hydroxypropane sulfonate (COPS-I) and the resulting optical properties, a series of experiments was carried out at various reaction conditions such as the changes of BMA concentration, COPS-I concentration, BMA concentration under a fixed COPS-I amount, initiator and divinyl benzene (DVB) concentration. All the latices showed highly monodispersed spherical particles in the size range of 144~435 nm and the respective shiny structural colors from their colloidal photonic crystals. It is found that the changes in such polymerization factors greatly affect the number of particles and particle diameter, polymerization rate, molecular weight, zeta-potential, and refractive indices. The increase of number of particles led to the increased rate of polymerization and zeta-potential of the latices, on the other hand, to the decreased molecular weight. Refractive indices and the reflectivity increased with COPS-I concentration, on the other hand, and decreased with DVB concentration. Especially, refractive indices of the resulting poly[BMA-co-(COPS-I)] colloidal photonic crystals showed much higher values of 1.65~2.21 than that of polystyrene, due to the formation of core-shell shaped morphology. Monodisperse and high refractive index of poly[BMA-co-(COPS-I)] particles prepared in this work could be used for the study in photonic crystals and electrophoretic display.

  18. Inhibition of cholesterol oxidation products (COPs) formation in emulsified porcine patties by phenolic-rich avocado (Persea americana Mill.) extracts.

    Science.gov (United States)

    Rodríguez-Carpena, Javier-Germán; Morcuende, David; Petrón, María Jesus; Estévez, Mario

    2012-03-07

    The effect of phenolic-rich extracts from avocado peel on the formation of cholesterol oxidation products (COPs) in porcine patties subjected to cooking and chill storage was studied. Eight COPs (7α-hydroxycholesterol, 7β-hydroxycholesterol, 7-ketocholesterol, 20α-hydroxycholesterol, 25-hydroxycholesterol, cholestanetriol, 5,6β-epoxycholesterol, and 5,6α-epoxycholesterol) were identified and quantified by GC-MS. The addition of avocado extracts (∼600 GAE/kg patty) to patties significantly inhibited the formation of COPs during cooking. Cooked control (C) patties contained a larger variety and greater amounts of COPs than the avocado-treated (T) counterparts. COPs sharply increased in cooked patties during the subsequent chilled storage. This increase was significantly higher in C patties than in the T patties. Interestingly, the amount of COPs in cooked and chilled T patties was similar to those found in cooked C patties. The mechanisms implicated in cholesterol oxidation in a processed meat product, the protective effect of avocado phenolics, and the potential implication of lipid and protein oxidation are thoroughly described in the present paper.

  19. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  20. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  1. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  2. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  3. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  4. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  5. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  6. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  7. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  8. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  9. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  10. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  11. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  12. Assessing the genetic diversity of Cu resistance in mine tailings through high-throughput recovery of full-length copA genes

    Science.gov (United States)

    Li, Xiaofang; Zhu, Yong-Guan; Shaban, Babak; Bruxner, Timothy J. C.; Bond, Philip L.; Huang, Longbin

    2015-01-01

    Characterizing the genetic diversity of microbial copper (Cu) resistance at the community level remains challenging, mainly due to the polymorphism of the core functional gene copA. In this study, a local BLASTN method using a copA database built in this study was developed to recover full-length putative copA sequences from an assembled tailings metagenome; these sequences were then screened for potentially functioning CopA using conserved metal-binding motifs, inferred by evolutionary trace analysis of CopA sequences from known Cu resistant microorganisms. In total, 99 putative copA sequences were recovered from the tailings metagenome, out of which 70 were found with high potential to be functioning in Cu resistance. Phylogenetic analysis of selected copA sequences detected in the tailings metagenome showed that topology of the copA phylogeny is largely congruent with that of the 16S-based phylogeny of the tailings microbial community obtained in our previous study, indicating that the development of copA diversity in the tailings might be mainly through vertical descent with few lateral gene transfer events. The method established here can be used to explore copA (and potentially other metal resistance genes) diversity in any metagenome and has the potential to exhaust the full-length gene sequences for downstream analyses. PMID:26286020

  13. EseE of Edwardsiella tarda Augments Secretion of Translocon Protein EseC and Expression of the escC-eseE Operon.

    Science.gov (United States)

    Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia

    2016-08-01

    Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  14. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  15. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  16. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  17. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  18. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  19. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  20. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  1. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  2. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  3. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  4. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Science.gov (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  5. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  6. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  7. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  8. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Science.gov (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  9. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  10. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  11. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  12. CopA3 Peptide Prevents Ultraviolet-Induced Inhibition of Type-I Procollagen and Induction of Matrix Metalloproteinase-1 in Human Skin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Dong-Hee Kim

    2014-05-01

    Full Text Available Ultraviolet (UV exposure is well-known to induce premature aging, which is mediated by matrix metalloproteinase-1 (MMP-1 activity. A 9-mer peptide, CopA3 (CopA3 was synthesized from a natural peptide, coprisin, which is isolated from the dung beetle Copris tripartitus. As part of our continuing search for novel bioactive natural products, CopA3 was investigated for its in vitro anti-skin photoaging activity. UV-induced inhibition of type-I procollagen and induction of MMP-1 were partially prevented in human skin fibroblasts by CopA3 peptide in a dose-dependent manner. At a concentration of 25 μM, CopA3 nearly completely inhibited MMP-1 expression. These results suggest that CopA3, an insect peptide, is a potential candidate for the prevention and treatment of skin aging.

  13. Le CRDI à la COP23 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    En collaboration avec ses bénéficiaires et partenaires, le CRDI anime et participe à une série d'activités et d'événements durant la COP23, y compris des événements parallèles officiels de la CCNUCC et des groupes d'experts, des groupes de discussion, des ateliers et la 15e édition des Journées sur le développement et ...

  14. Electrodeposition of Nanocrystalline Co-P Coatings as a Hard Chrome Alternative (Briefing Charts)

    Science.gov (United States)

    2011-02-10

    chrome plating utilizes chromium in the hexavalent state (Cr6+) Cr6+ is a known carcinogen and poses a health risk to operators OSHA lowered the Cr6+ PEL...from 52 µg/m3 to 5 µg/m3 8 Apr 09, Memorandum, DoD Directive Hexavalent Chromium Management Policy NAVAIR Cr6+ Authorization Process Hard Chrome ...Aerospace & Defense February 10, 2011 Electrodeposition of Nanocrystalline Co-P Coatings as a Hard Chrome Alternative Jack Benfer Co-PI NAVAIR

  15. Heavy Metals Pollution of Alluvial Soil in the Copşa Mică Area

    OpenAIRE

    , D. Popa; , I.M. Prundeanu; , R. Lăcătuşu

    2011-01-01

    The objective of our study was to determine the concentrations of heavy metals (Cd, Cr, Co, Cu, Mn, Ni, Pb, Zn and Fe) from soil samples, which have been previously treated with HNO3 and concentrated HClO4. The study was performed on a series of 24 soil samples and one soil profile, collected from the alluvial soil in the Copşa Mică area. The concentrations of heavy metals were determined using Atomic Absorption Spectrometry. The pH was determined by using the potentiometric method in aqueous...

  16. Mapping of a Protective Epitope of the CopB Outer Membrane Protein of Moraxella catarrhalis

    OpenAIRE

    Aebi, Christoph; Cope, Leslie D.; Latimer, Jo L.; Thomas, Sharon E.; Slaughter, Clive A.; McCracken, George H.; Hansen, Eric J.

    1998-01-01

    A monoclonal antibody (MAb) (MAb 10F3) directed against the CopB outer membrane protein of Moraxella catarrhalis previously was found to enhance pulmonary clearance of M. catarrhalis in an animal model (M. Helminen, I. Maciver, J. L. Latimer, L. D. Cope, G. H. McCracken, Jr., and E. J. Hansen, Infect. Immun. 61:2003–2010, 1993). In the present study, this same MAb was shown to exert complement-dependent bactericidal activity against this pathogen in vitro. Nucleotide sequence analysis of the ...

  17. Law, Urban Violence and Order: Cop Shows as a Brazilian TV Genre

    OpenAIRE

    Luiza Lusvarghi

    2014-01-01

    A new type of Brazilian drama series has taken place on local  TV -  the cop shows. Although they are not popular as the telenovela (soap operas), definitively they came to stay.  International channels like Fox and HBO are benefited by Tax Benefits Rule which provides financial conditions for the production of those home market, and are now competing with the two greatest media Brazilian  groups – Record and Globo.  The worldwide success of “Cidade de Deus” (City of God, 2002, Fernando Meire...

  18. ClimasCOPe: Exploring the challenges behind the Paris Agreement - COP21

    International Nuclear Information System (INIS)

    Leguet, Benoit; Alberola, Emilie; Afriat, Marion; Vaidyula, Manasvini; Morel, Romain; Cochran, Ian; Deheza, Mariana; Shishlov, Igor; Leseur, Alexia; Depoues, Vivian; Bordier, Cecile; Bultheel, Clement; Bellassen, Valentin

    2015-04-01

    In the framework of the 21. Conference of the Parties (COP21) to the United Nations Framework Convention on Climate Change (UNFCCC), held in Paris from November 30 to December 11 2015, I4CE - Institute for Climate Economics, in partnership with ADEME, the French Environment and Energy Management Agency, attempts to shed some light on the challenges surrounding this Paris Climate Conference 2015. They explore what can be expected from the post-2020 climate agreement in Paris. They also discuss some keys success indicators of such an agreement. Over the course of six issues, ClimasCOPe provides analysis related to carbon pricing, climate finance, greenhouse gas (GHG) emissions' accounting, the role of sub-national actors, adaptation to climate change and the compatibility of government commitments with the scenario where in global mean temperatures would rise by no more than 2 deg. C. Issue 1 - Carbon pricing: a necessary tool on the agenda of solutions for climate funding (Putting a Price on Carbon, First submissions of intended Nationally Determined Contributions for Paris Agreement, 5 carbon pricing initiatives); Issue 2 - Financing the low-carbon transition: the need for coherence between regulations and ambition (Finance will be the cornerstone of the Paris accord, News, 5 initiatives for Climate Finance); Issue 3 - Three keys to effective GHG emissions monitoring for a broader climate agreement (MRV: how to hit the bull's eye when there is no silver bullet? First Climate Week and the Bonn negotiations, 3 MRV initiatives); Issue 4 - Non-state actors: pushing the climate action agenda forward (The role of cities and regions and their knock-on effects, G7 announcements and the process of adopting the SDGs, 4 non-state actor initiatives); Issue 5 - COP 21: a new approach and the launch of a process to address climate change adaptation (Adapting to climate change: taking ownership of the issues and removing barriers to implementation, First COP 21 draft

  19. Magnetic properties of CoP alloys electrodeposited at room temperature

    International Nuclear Information System (INIS)

    Lucas, I.; Perez, L.; Aroca, C.; Sanchez, P.; Lopez, E.; Sanchez, M.C.

    2005-01-01

    CoP alloys have been electrodeposited at room temperature from electrolytes with different pH values and their magnetic properties have been studied. Cracks and fractures appear when using stiff substrates, showing that high internal stresses, due to hydrogen evolution, are involved in the electrodeposition process. Samples electrodeposited onto flexible substrates do not show cracks on the surface. We also report an increment in the coercivity of the alloys when the pH of the electrolyte decreases, and therefore, the hydrogen evolution and the internal stresses increase

  20. COP15 for journalists: a guide to the UN climate change summit

    Energy Technology Data Exchange (ETDEWEB)

    Shanahan, Mike

    2009-11-15

    Governments gather in Denmark in December 2009 for what is perhaps the most important meeting since the end of the second world war. December is the deadline they have set themselves for agreeing on action to tackle climate change, and the COP15 conference in Copenhagen is where hopes are high that a new global deal can be struck. This briefing is a guide for journalists reporting on this event, its buildup and its aftermath. It explains key processes, major actions to be agreed and possible outcomes.

  1. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  2. New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

    Science.gov (United States)

    Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

    2017-09-07

    Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

  3. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  4. Experimental study of a thermoelectrically-driven liquid chiller in terms of COP and cooling down period

    International Nuclear Information System (INIS)

    Faraji, Amir Yadollah; Goldsmid, H.J.; Akbarzadeh, Aliakbar

    2014-01-01

    Highlights: • A COP of 0.8 is achievable for a thermoelectrically-driven water chiller. • With two market available TEC modules with ZT around 0.7 sub-zero temperatures became applicable. • Forced air convection heat exchangers have better COP and CDP compared with natural convection. • A PID controller has several advantages against on–off controller for controlling TEC module. - Abstract: To study COP and other cooling parameters of a thermoelectically-driven liquid chiller, a 430 ml capacity liquid chiller incorporating two commercially available thermoelectric modules as its active components, has been designed, built and assessed. The system can use natural or forced air convection in heat exchangers attached to the thermoelectric module surfaces. The coefficient of performance (COP) and cooling down period (CDP) of the system for different thermoelectric input voltages have been measured. The COP of the thermoelectric chiller was found to be in the range 0.2–1.4 for forced convection and 0.2–1 for natural convection at a cooled liquid temperature of 10 °C and an ambient temperature of 18 °C. For the chiller, heat pumping capacity, minimum achievable water temperature, and temperature difference across the thermoelectric surfaces were investigated for input voltages of 3 V, 5 V, 7 V, 10 V and 12 V. Furthermore, as a basis for reliable and convenient control of the chiller, a proportional integral derivative (PID) controller has been proposed

  5. Competing for space in an already crowded market: a mixed methods study of why an online community of practice (CoP) for alcohol harm reduction failed to generate interest amongst the group of public health professionals at which it was aimed.

    Science.gov (United States)

    Ponsford, Ruth; Ford, Jennifer; Korjonen, Helena; Hughes, Emma; Keswani, Asha; Pliakas, Triantafyllos; Egan, Matt

    2017-07-21

    Improving mechanisms for knowledge translation (KT) and connecting decision-makers to each other and the information and evidence they consider relevant to their work remains a priority for public health. Virtual communities of practices (CoPs) potentially offer an affordable and flexible means of encouraging connection and sharing of evidence, information and learning among the public health community in ways that transgress traditional geographical, professional, institutional and time boundaries. The suitability of online CoPs in public health, however, has rarely been tested. This paper explores the reasons why particular online CoP for alcohol harm reduction hosted by the UK Health Forum failed to generate sufficient interest from the group of public health professionals at which it was aimed. The study utilises online web-metrics demonstrating a lack of online activity on the CoP. One hundred and twenty seven responses to an online questionnaire were used to explore whether the lack of activity could be explained by the target audience's existing information and evidence practices and needs. Qualitative interviews with 10 members describe in more detail the factors that shape and inhibit use of the virtual CoP by those at which it was targeted. Quantitative and qualitative data confirm that the target audience had an interest in the kind of information and evidence the CoP was set up to share and generate discussion about, but also that participants considered themselves to already have relatively good access to the information and evidence they needed to inform their work. Qualitative data revealed that the main barriers to using the CoP were a proliferation of information sources meaning that participants preferred to utilise trusted sources that were already established within their daily routines and a lack of time to engage with new online tools that required any significant commitment. Specialist online CoPs are competing for space in an already crowded

  6. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  7. The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

    Science.gov (United States)

    Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

    2016-01-01

    Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

  8. Autogenous regulation and kinetics of induction of Pseudomonas aeruginosa recA transcription as analyzed with operon fusions

    International Nuclear Information System (INIS)

    Horn, J.M.; Ohman, D.E.

    1988-01-01

    A promoterless chloramphenicol acetyltransferase gene (cat) was used to construct recA-cat operon fusions to quantitatively examine the transcriptional regulation of the Pseudomonas aeruginosa recA gene in P. aeruginosa PAO. Wild-type P. aeruginosa containing the recA8-cat fusion was treated with methyl methanesulfonate (MMS) and showed immediate induction of chloramphenicol acetyltransferase (CAT) specific activity, whereas a recA::Tn501 mutant of P. aeruginosa containing recA8-cat showed no induction with MMS. This indicated that a functional copy of recA was required for derepression of recA transcription and that P. aeruginosa recA protein was a positive regulatory factor promoting its own expression. Compared with that in the wild type, the uninduced level of CAT in recA8-cat-containing cells was reduced by approximately one-half in the recA::Tn501 mutant, indicating that recA+-dependent spontaneous induction contributes to the uninduced levels of recA expression in P. aeruginosa. MMS (0.012%) caused recA-directed CAT synthesis to increase almost immediately, with maximum CAT activity, fourfold higher than uninduced levels, attained at 60 min postinduction. The kinetics of recA8-cat fusion activity were shown to be directly related to the MMS doses used. Another fusion called recAa1-cat, where cat was located between the two transcriptional terminators of the P. aeruginosa recA gene, also showed dose-dependent induction by MMS, but the CAT activity from recAa1-cat was only one-half of that obtained with recA8-cat under the same conditions. Treatment of recA+ P. aeruginosa containing recA8-cat with UV irradiation produced an immediate effect on recA8-cat transcription and showed little UV dose dependency at doses of 5 J/m2 or greater

  9. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  10. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  11. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  12. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  13. SmartCop: Enabling Smart Traffic Violations Ticketing in Vehicular Named Data Networks

    Directory of Open Access Journals (Sweden)

    Syed Hassan Ahmed

    2016-01-01

    Full Text Available Recently, various applications for Vehicular Ad hoc Networks (VANETs have been proposed and smart traffic violation ticketing is one of them. On the other hand, the new Information-Centric Networking (ICN architectures have emerged and been investigated into VANETs, such as Vehicular Named Data Networking (VNDN. However, the existing applications in VANETs are not suitable for VNDN paradigm due to the dependency on a “named content” instead of a current “host-centric” approach. Thus, we need to design the emerging and new architectures for VNDN applications. In this paper, we propose a smart traffic violation ticketing (TVT system for VNDN, named as SmartCop, that enables a cop vehicle (CV to issue tickets for traffic violation(s to the offender(s autonomously, once they are in the transmission range of that CV. The ticket issuing delay, messaging cost, and percentage of violations detected for varying number of vehicles, violators, CVs, and vehicles speeds are estimated through simulations. In addition, we provide a road map of future research directions for enabling safe driving experience in future cars aided with VNDN technology.

  14. Kyoto protocol and related issues; Chikyu ondanka boshi Kyoto kaigi (COP3) to sono kadai

    Energy Technology Data Exchange (ETDEWEB)

    Ninomiya, Y. [Global Industrial Social Progress Research Institute, Tokyo (Japan)

    1997-09-30

    The Third Session of the Conference of the Parties to the United Nations Framework Convention on Climate Change (COP3) will be held in Kyoto in December 1997. Described herein are the current status and issues of the convention. USA and Japan, which hold important keys to set up the abatement target, have issued no proposals concretely at the current AGBM (Ad-hoc Group Berlin Mandate) 7, and the conference for the concrete targets will be decided in the next AGBM 8 to be held in October. The final target will be set by the ministerial segment of COP3, because the negotiations for the treaty are political in nature. USA proposes reduction at a uniform, realistic rate, and Japan proposes reduction at a uniform rate or setting up the emission target per capita, each being different from reduction at a much higher uniform rate proposed by EU. Within EU, however, 10% out of 15% reduction rate it proposes is agreed by the member countries, and the remaining rate of % may not be agreed. It is necessary for the advanced parties to set up realistic and legally binding solutions, including ratification by USA, which can persuade the developing countries. tab.1

  15. Simulation of Organic Matter and Pollutant Evolution during Composting: The COP-Compost Model.

    Science.gov (United States)

    Lashermes, G; Zhang, Y; Houot, S; Steyer, J P; Patureau, D; Barriuso, E; Garnier, P

    2013-01-01

    Organic pollutants (OPs) are potentially present in composts and the assessment of their content and bioaccessibility in these composts is of paramount importance. In this work, we proposed a model to simulate the behavior of OPs and the dynamic of organic C during composting. This model, named COP-Compost, includes two modules. An existing organic C module is based on the biochemical composition of the initial waste mixture and simulates the organic matter transformation during composting. An additional OP module simulates OP mineralization and the evolution of its bioaccessibility. Coupling hypotheses were proposed to describe the interactions between organic C and OP modules. The organic C module, evaluated using experimental data obtained from 4-L composting pilots, was independently tested. The COP-Compost model was evaluated during composting experiments containing four OPs representative of the major pollutants detected in compost and targeted by current and future regulations. These OPs included a polycyclic aromatic hydrocarbon (fluoranthene), two surfactants (4--nonylphenol and a linear alkylbenzene sulfonate), and an herbicide (glyphosate). Residues of C-labeled OP with different bioaccessibility were characterized by sequential extraction and quantified as soluble, sorbed, and nonextractable fractions. The model was calibrated and coupling the organic C and OP modules improved the simulation of the OP behavior and bioaccessibility during composting. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  16. Friction Stir Welding of GR-Cop 84 for Combustion Chamber Liners

    Science.gov (United States)

    Russell, Carolyn K.; Carter, Robert; Ellis, David L.; Goudy, Richard

    2004-01-01

    GRCop-84 is a copper-chromium-niobium alloy developed by the Glenn Research Center for liquid rocket engine combustion chamber liners. GRCop-84 exhibits superior properties over conventional copper-base alloys in a liquid hydrogen-oxygen operating environment. The Next Generation Launch Technology program has funded a program to demonstrate scale-up production capabilities of GR-Cop 84 to levels suitable for main combustion chamber production for the prototype rocket engine. This paper describes a novel method of manufacturing the main combustion chamber liner. The process consists of several steps: extrude the GR-Cop 84 powder into billets, roll the billets into plates, bump form the plates into cylinder halves and friction stir weld the halves into a cylinder. The cylinder is then metal spun formed to near net liner dimensions followed by finish machining to the final configuration. This paper describes the friction stir weld process development including tooling and non-destructive inspection techniques, culminating in the successful production of a liner preform completed through spin forming.

  17. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  18. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Science.gov (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  19. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Science.gov (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  20. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  1. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  2. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  3. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  5. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  7. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  8. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  9. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  10. Discursos e vozes na cobertura jornalística das COP15 e 16

    Directory of Open Access Journals (Sweden)

    Ilza Maria Tourinho Girardi

    2013-12-01

    Full Text Available O texto apresenta um exercício de análise da cobertura das Conferências da ONU sobre Mudanças Climáticas, COP 15 e 16, em revistas brasileiras e portuguesas publicadas em 2009 e 2010. Examina como foi construído o discurso sobre sustentabilidade e quais foram as vozes acionadas. Por meio da leitura produzida, teórica e metodologicamente baseada na análise do discurso e das fontes, foi possível evidenciar a predominância de um discurso ecotecnocrático e a opção privilegiada por fontes dos campos político e econômico

  11. Copépodos parásitos en Genypterus blacodes (Osteichtes

    Directory of Open Access Journals (Sweden)

    Paulina Donoso.

    2017-01-01

    Full Text Available Los peces del género Genypterus son un recurso importante en la industria pesquera, y estos se encuentran expuestos a una serie de ectoparásitos, entre los se encuentran los copépodos los cuales pueden ser muy específicos en sus hospedederos. Una de las especies parásitas corresponde a Sphyrium laevigatum el cual parasita además tres especies de importancia económica en las pesquerías locales chilenas. Se discuten en el presente trabajo la situación de S. laevigatum en G. blacodes, así como aspectos ecológicos y biogeográficos.

  12. THE EFFECT OF HIGH OVERVOLTAGES AT ELECTROCRYSTALLIZATION ON THE CORROSION RESISTANCE OF THE FILMS CO-P

    Directory of Open Access Journals (Sweden)

    V. O. Zabludovskyi

    2009-03-01

    Full Text Available Electrochemical and gravimetric methods are used in order to research the influence of high overvoltages during electroplating on corrosive and electrochemical behavior of amorphous Co-P films, which were made using deposition from water solution of an electrolyte. It is obtained that alloys, which were plated using higher overvoltages on cathode, are more corrosion-resistant.

  13. Applications of RFID technology in dismounted soldier solution systems – study of mCOP system capabilities

    Directory of Open Access Journals (Sweden)

    Chmielewski Mariusz

    2016-01-01

    Full Text Available This paper discusses application of RFID technology in Dismounted Soldier Solutions gathered from the development and demonstration of mCOP platform. The software has been developed to elaborate Network Enabled Capabilities in tactical environments. Presented research was a part of demonstration prepared for the European Defence Agency. The main aim of the tool is the delivery of command support capabilities utilizing data fusion and integration mechanisms implemented in heterogeneous military mobile networks. Application of military integration standards such as JC3IEDM, NFFI and TSO supports interoperability with BMS class systems. Utilisation of RFID technology in mCOP software has several purposes, mainly used for process automation of authorisation and personal identification. Indirectly such functionalities can be used for implementation of UAV supported - Blue Force Tracking and IFF services. This research elaborates a set of implemented ideas for such solutions. Developed system serves as a multi-level and multi-platform command and control system supporting military and crisis operations. A crucial part of the system - mCOP, the handheld application for tactical level commanders, serves as personal toolkit for location monitoring and combat situation distribution and management. The tool delivers a set of tailored functionalities supporting commander’s situation awareness and decision making process. The mCOP hosting device equipped with RFID delivers also means of tactical , emergency, micro network communication.

  14. Gait COP trajectory of left side hip-dislocation and scoliotic patient using ankle-foot orthoses

    Science.gov (United States)

    Chong, Albert K.; Alrikabi, Redha; Milburn, Peter

    2017-07-01

    Plantar pressure-sensing mats and insole plantar sensor pads are ideal low-cost alternatives to force plates for capturing plantar COP excursion during gait. The acquired COP traces, in the form of pedobarographic images are favored by many clinicians and allied health professionals for evaluation of foot loading and balance in relation to foot biomechanics, foot injury, foot deformation, and foot ulceration. Researchers have recommended the use of COP trace for the biomechanical study of the deformed foot and lower-limb to improve orthosis design and testing. A correctly designed orthoses improves mobility and reduces pain in the foot, lower limb and lower spine region during gait. The research was carried out to evaluate the performance of two types of orthosis, namely: a custom-molded orthosis and an over-the-counter molded orthosis to determine the quality of gait of an adult scoliotic patient. COP trace patterns were compared with those of a healthy adult and showed the design of the custom-molded orthosis resulted in an improved quality of movements and provided enhanced stability for the deformed left foot during gait.

  15. The promiscuous phosphomonoestearase activity of Archaeoglobus fulgidus CopA, a thermophilic Cu+ transport ATPase.

    Science.gov (United States)

    Bredeston, Luis M; González Flecha, F Luis

    2016-07-01

    Membrane transport P-type ATPases display two characteristic enzymatic activities: a principal ATPase activity provides the driving force for ion transport across biological membranes, whereas a promiscuous secondary activity catalyzes the hydrolysis of phosphate monoesters. This last activity is usually denoted as the phosphatase activity of P-ATPases. In the present study, we characterize the phosphatase activity of the Cu(+)-transport ATPase from Archaeglobus fulgidus (Af-CopA) and compare it with the principal ATPase activity. Our results show that the phosphatase turnover number was 20 times higher than that corresponding to the ATPase activity, but it is compensated by a high value of Km, producing a less efficient catalysis for pNPP. This secondary activity is enhanced by Mg(2+) (essential activator) and phospholipids (non-essential activator), and inhibited by salts and Cu(+). Transition state analysis of the catalyzed and noncatalyzed hydrolysis of pNPP indicates that Af-CopA enhances the reaction rates by a factor of 10(5) (ΔΔG(‡)=38 kJ/mol) mainly by reducing the enthalpy of activation (ΔΔH(‡)=30 kJ/mol), whereas the entropy of activation is less negative on the enzyme than in solution. For the ATPase activity, the decrease in the enthalpic component of the barrier is higher (ΔΔH(‡)=39 kJ/mol) and the entropic component is small on both the enzyme and in solution. These results suggest that different mechanisms are involved in the transference of the phosphoryl group of p-nitrophenyl phosphate and ATP. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Actualizing Communities of Practice (COPs and Situated Learning for A Sustainable Eco-Village

    Directory of Open Access Journals (Sweden)

    Maria Victoria Pineda

    2016-05-01

    Full Text Available An eco-village as defined by Robert Gilman is a “human-scale, full-featured settlement where you feel you know the others, and human activities are integrated with natural, biological systems.” Roland Mayerl argued that this maybe ideal, but there are huge challenges. He claims the challenges are at different levels—there is the physical layer that constitutes food production, animals, water and wastewater treatment. Other layers will be the built environment, the economic system and the governance in the village.This paper argues that one of the challenging layers is the human layer that was excluded in the modeling of many eco-village works. While there are many good models of an eco-village, sustainability will primarily be laid on the shoulders of the members of the community or the village for that matter. Sustainability should be espoused by the members of the eco-village. But how can sustainability be attained? What sustainability approach or strategy can be employed?“Communities of practice (COP are formed by people who engage in a process of collective learning in a shared domain of human endeavor.“ (Wenger, 2004 COPs are concepts commonly applied in organizations and virtual communities. Using this approach together with periphery participation and situated learning, this paper presents a human-based model of a sustainable eco-village and some useful examples.The paper also argues that an eco-village necessitates the support of technology in enhancing and preserving the shared practices. Hence, use of social media deployed in the web is one of the recommended ways that also permit collective action among members of the eco-village.

  17. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  18. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  19. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  20. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Science.gov (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  3. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  4. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  5. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  6. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  7. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Science.gov (United States)

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  8. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Science.gov (United States)

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  9. Statistical analysis of dust signals observed by ROSINA/COPS onboard of the Rosetta spacecraft at comet 67P/Churyumov-Gerasimenko

    Science.gov (United States)

    Tzou, Chia-Yu; altwegg, kathrin; Bieler, Andre; Calmonte, Ursina; Gasc, Sébastien; Le Roy, Léna; Rubin, Martin

    2016-10-01

    ROSINA is the in situ Rosetta Orbiter Spectrometer for Ion and Neutral Analysis on board of Rosetta, one of the corner stone missions of the European Space Agency (ESA) to land and orbit the Jupiter family comet 67P/Churyumov-Gerasimenko (67P). ROSINA consists of two mass spectrometers and a pressure sensor. The Reflectron Time of Flight Spectrometer (RTOF) and the Double Focusing Mass Spectrometer (DFMS) complement each other in mass and time resolution.The Comet Pressure Sensor (COPS) provides density measurements of the neutral molecules in the cometary coma of 67P. COPS has two gauges, a nude gauge that measures the total neutral density and a ram gauge that measures the dynamic pressure from the comet. Combining the two COPS is also capable of providing gas dynamic information such as gas velocity and gas temperature of the coma.While Rosetta started orbiting around 67P in August 2014, COPS observed diurnal and seasonal variations of the neutral gas density in the coma. Surprisingly, additional to these major density variation patterns, COPS occasionally observed small spikes in the density that are associated with dust. These dust signals can be interpreted as a result of cometary dust releasing volatiles while heated up near COPS. A statistical analysis of dust signals detected by COPS will be presented.

  10. COPS5 (Jab1) protein increases β site processing of amyloid precursor protein and amyloid β peptide generation by stabilizing RanBP9 protein levels.

    Science.gov (United States)

    Wang, Hongjie; Dey, Debleena; Carrera, Ivan; Minond, Dmitriy; Bianchi, Elisabetta; Xu, Shaohua; Lakshmana, Madepalli K

    2013-09-13

    Increased processing of amyloid precursor protein (APP) and accumulation of neurotoxic amyloid β peptide (Aβ) in the brain is central to the pathogenesis of Alzheimer's disease (AD). Therefore, the identification of molecules that regulate Aβ generation is crucial for future therapeutic approaches for AD. We demonstrated previously that RanBP9 regulates Aβ generation in a number of cell lines and primary neuronal cultures by forming tripartite protein complexes with APP, low-density lipoprotein-related protein, and BACE1, consequently leading to increased amyloid plaque burden in the brain. RanBP9 is a scaffold protein that exists and functions in multiprotein complexes. To identify other proteins that may bind RanBP9 and regulate Aβ levels, we used a two-hybrid analysis against a human brain cDNA library and identified COPS5 as a novel RanBP9-interacting protein. This interaction was confirmed by coimmunoprecipitation experiments in both neuronal and non-neuronal cells and mouse brain. Colocalization of COPS5 and RanBP9 in the same subcellular compartments further supported the interaction of both proteins. Furthermore, like RanBP9, COPS5 robustly increased Aβ generation, followed by increased soluble APP-β (sAPP-β) and decreased soluble-APP-α (sAPP-α) levels. Most importantly, down-regulation of COPS5 by siRNAs reduced Aβ generation, implying that endogenous COPS5 regulates Aβ generation. Finally, COPS5 levels were increased significantly in AD brains and APΔE9 transgenic mice, and overexpression of COPS5 strongly increased RanBP9 protein levels by increasing its half-life. Taken together, these results suggest that COPS5 increases Aβ generation by increasing RanBP9 levels. Thus, COPS5 is a novel RanBP9-binding protein that increases APP processing and Aβ generation by stabilizing RanBP9 protein levels.

  11. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  12. COP 15 'Climate Change Conference Copenhagen and beyond'. Report of a NeVER meeting; COP 15 'Climate Change Conference Copenhagen and beyond'. Verslag bijeenkomst NeVER

    Energy Technology Data Exchange (ETDEWEB)

    Duindam, R.H.; Van EEuwen, M.P. [Cluster Energie en Vervoer, Juridische Dienst, Nederlandse Mededingingsautoriteit NMa, Den Haag (Netherlands)

    2010-08-15

    Report of a meeting of NeVER (the Dutch Energy Law Association) on 8 February 2010 at the Dutch Competition Authority in The Hague, the Netherlands. During this meeting, 2 speakers, who had also attended COP15 in Copenhagen, held speeches about their experiences with informative and stimulating issues in Copenhagen. Does the climate issue benefit from a global approach? How did the negotiations proceed behind the scenes? Are there any positive results worth mentioning as opposed to the critical notes. [Dutch] Verslag van een bijeenkomst van NeVER (Nederlandse Vereniging voor Energierecht) op 8 februari 2010 bij de NMa in Den Haag. Tijdens de bijeenkomst hebben 2 sprekers, die aanwezig waren bij de COP15 in Kopenhagen, voordrachten gehouden over hun ervaringen in Kopenhagen met wetenswaardige en prikkelende kwesties. Is het klimaatprobleem gebaat bij een mondiale aanpak? Hoe verliepen de onderhandelingen achter de schermen? Zijn naast de kritiek ook positieve resultaten te benoemen?.

  13. COP-compost: a software to study the degradation of organic pollutants in composts.

    Science.gov (United States)

    Zhang, Y; Lashermes, G; Houot, S; Zhu, Y-G; Barriuso, E; Garnier, P

    2014-02-01

    Composting has been demonstrated to be effective in degrading organic pollutants (OP) whose behaviour depends on the composting conditions, the microbial populations activated and interactions with organic matters. The fate of OP during composting involves complex mechanisms and models can be helpful tools for educational and scientific purposes, as well as for industrialists who want to optimise the composting process for OP elimination. A COP-Compost model, which couples an organic carbon (OC) module and an organic pollutant (OP) module and which simulates the changes of organic matter, organic pollutants and the microbial activities during the composting process, has been proposed and calibrated for a first set of OP in a previous study. The objectives of the present work were (1) to introduce the COP-Compost model from its convenient interface to a potential panel of users, (2) to show the variety of OP that could be simulated, including the possibility of choosing between degradation through co-metabolism or specific metabolism and (3) to show the effect of the initial characteristics of organic matter quality and its microbial biomass on the simulated results of the OP dynamic. In the model, we assumed that the pollutants can be adsorbed on organic matter according to the biochemical quality of the OC and that the microorganisms can degrade the pollutants at the same time as they degrade OC (by co-metabolism). A composting experiment describing two different (14)C-labelled organic pollutants, simazine and pyrene, were chosen from the literature because the four OP fractions simulated in the model were measured during the study (the mineralised, soluble, sorbed and non-extractable fractions). Except for the mineralised fraction of simazine, a good agreement was achieved between the simulated and experimental results describing the evolution of the different organic fractions. For simazine, a specific biomass had to be added. To assess the relative importance

  14. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  15. The responsibilities of the 'globalized capital' in the 'programmed failure' of the COP 21. After the COP 21: to stay mobilised

    International Nuclear Information System (INIS)

    Sindic, Paul; Verger, Daniel

    2016-03-01

    A first article proposes a critical assessment of the COP 21. He discusses the position and situation of the USA (notably the fact that the Congress may not ratify propositions made by President Obama on the reduction of CO 2 emissions), of China (the first CO 2 emitter and who still aims at becoming the first world power), and of the European Union (good results in terms of CO 2 reduction, but not so good when taking carbonated renewable energies like wood and biomass into account; definition of general objectives which are not distributed among countries like in the Kyoto protocol), and more general aspects (lack of sanction, no control of demographic growth, problems of poverty and refugees with negative social and societal impacts). The author then outlines, discusses and explains the discrepancies between recommendations made by the IPCC and decisions taken by UNFCCC members (United Nations Framework Convention on Climate Change). He concludes by questions related to the financing of the struggle against climate change, and to ideological difficulties to directly take on the globalized capital. The last article outlines that the mixed review of the COP 21, and briefly discusses the perspectives of the COP 22 in Morocco

  16. 30 CFR 285.601 - When am I required to submit my plans to MMS?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When am I required to submit my plans to MMS... Information Requirements § 285.601 When am I required to submit my plans to MMS? Your plan submission...) You must provide sufficient data and information with your COP for MMS to complete the needed reviews...

  17. Expression, purification and crystallization of a PCI domain from the COP9 signalosome subunit 7 (CSN7)

    International Nuclear Information System (INIS)

    Dessau, Moshe; Chamovitz, Daniel A.; Hirsch, Joel A.

    2006-01-01

    A core fragment of Arabidopsis thaliana COP9 signalosome (CSN) subunit 7 was expressed in Escherichia coli. The protein was purified to homogeneity and crystallized. A core fragment of Arabidopsis thaliana COP9 signalosome (CSN) subunit 7 was expressed in Escherichia coli. The protein was purified to homogeneity and screened for crystallization. Crystallization conditions were refined using the sitting-drop vapour-diffusion method. Crystals were obtained using polyethylene glycol 8000 as a precipitant and have a thick rod-like morphology. Their crystallographic symmetry is orthorhombic, space group C222 1 , with unit-cell parameters a = 57.2, b = 86.2, c = 72.6 Å and a diffraction limit of 2.06 Å

  18. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  19. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  20. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  2. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  4. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Science.gov (United States)

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  5. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  6. Nucleaire et Energies Nr 67 - December 2015. COP21: diplomatic success, a first step

    International Nuclear Information System (INIS)

    Lenail, Bernard; Ducroux, Guy; Salanave, Jean-Luc; Seyve, Claude; Simonnet, Jacques; Justin, Francois; Salanave, Jean-Luc; Darricau, Aime; Raisonnier, Daniele; Deleigne, Francoise; Lepine, Gerard; Witkowski, Didier; Knoche, Philippe

    2015-12-01

    After a first article which comments the results of the Paris Climate Conference (COP21), two articles address recent evolutions in the energy sector: an overview of recent evolutions (perspective for oil reserves, relationship between Gazprom and the EU, news about wind and solar energy in Europe, India, and in France with the most powerful European photovoltaic installation near Bordeaux, electricity prices, reduction of taxes on solar and wind energy foreseen for 2017), and a comparison between renewable energies and the EPR in terms of investment profitability. Three articles concern nuclear activities: recent events about reactors (IAEA forecast, situation and debates in France, Belgium, UK, Sweden, Romania, Slovenia, Russia, Ukraine, Iran, Emirates, Egypt, China, South Korea, Japan, and USA, cooperation between Argentina and China), about the back-end of the fuel cycle and decommissioning activities (activities and situation of different French facilities, activities and contracts in Japan, UK, USA, Taiwan, China, Finland, India and Spain), and the content of the IAEA report on the Fukushima accident. Articles comment issues concerning the relationship between nuclear and society: a comment about the use of the term 'green' and on what is green in nuclear, the recent evolutions negotiations on the issue of the Iranian nuclear industry with respect to non-proliferation, and a comment of the perception of climate change by French people as expressed by different surveys. A last article outlines that Areva will remain a world leader on the long term

  7. Climate and enterprises: from mobilisation to action. Seven proposals to prepare the after-COP21

    International Nuclear Information System (INIS)

    Ayme, Arnaud; Derumaux, Quentin; Authier, Marc-Antoine; Monterno, Alexia de; Piolot, Lucie

    2015-11-01

    Based on meetings with 30 representatives of enterprises and institutions, this report first outlines that the COP21 takes place within a context characterised by a momentum which is to be exploited as awareness grows quickly, as data published by the IPCC is a consensus. It outlines that national climate contributions represent a positive methodological evolution and discusses the importance of bilateral agreements (example and the China-USA agreement), and gives an overview of remaining obstacles (financing the struggle against climate change, level playing field for European enterprises, how to support the losers of energy transition). The mobilisation of enterprises is then described as a new lever in the struggle against climate change: strong signals are sent by the financial sector; enterprises are facing many challenges. This mobilisation is presented as an unavoidable stake in negotiations. A necessary action of public authorities is outlined. Some proposals are stated regarding public financing of the struggle against climate change, the focussing of regulatory constraints on this struggle, public commissioning as a lever for a successful environmental transition, and the role of public authorities as a mediator between civil society and enterprises

  8. Neurospora COP9 signalosome integrity plays major roles for hyphal growth, conidial development, and circadian function.

    Directory of Open Access Journals (Sweden)

    Zhipeng Zhou

    Full Text Available The COP9 signalosome (CSN is a highly conserved multifunctional complex that has two major biochemical roles: cleaving NEDD8 from cullin proteins and maintaining the stability of CRL components. We used mutation analysis to confirm that the JAMM domain of the CSN-5 subunit is responsible for NEDD8 cleavage from cullin proteins in Neurospora crassa. Point mutations of key residues in the metal-binding motif (EX(nHXHX(10D of the CSN-5 JAMM domain disrupted CSN deneddylation activity without interfering with assembly of the CSN complex or interactions between CSN and cullin proteins. Surprisingly, CSN-5 with a mutated JAMM domain partially rescued the phenotypic defects observed in a csn-5 mutant. We found that, even without its deneddylation activity, the CSN can partially maintain the stability of the SCF(FWD-1 complex and partially restore the degradation of the circadian clock protein FREQUENCY (FRQ in vivo. Furthermore, we showed that CSN containing mutant CSN-5 efficiently prevents degradation of the substrate receptors of CRLs. Finally, we found that deletion of the CAND1 ortholog in N. crassa had little effect on the conidiation circadian rhythm. Our results suggest that CSN integrity plays major roles in hyphal growth, conidial development, and circadian function in N. crassa.

  9. The COP9 signalosome interacts with SCF UFO and participates in Arabidopsis flower development.

    Science.gov (United States)

    Wang, Xiping; Feng, Suhua; Nakayama, Naomi; Crosby, W L; Irish, Vivian; Deng, Xing Wang; Wei, Ning

    2003-05-01

    The COP9 signalosome (CSN) is involved in multiple developmental processes. It interacts with SCF ubiquitin ligases and deconjugates Nedd8/Rub1 from cullins (deneddylation). CSN is highly expressed in Arabidopsis floral tissues. To investigate the role of CSN in flower development, we examined the expression pattern of CSN in developing flowers. We report here that two csn1 partially deficient Arabidopsis strains exhibit aberrant development of floral organs, decline of APETALA3 (AP3) expression, and low fertility in addition to defects in shoot and inflorescence meristems. We show that UNUSUAL FLORAL ORGANS (UFO) forms a SCF(UFO) complex, which is associated with CSN in vivo. Genetic interaction analysis indicates that CSN is necessary for the gain-of-function activity of the F-box protein UFO in AP3 activation and in floral organ transformation. Compared with the previously reported csn5 antisense and csn1 null mutants, partial deficiency of CSN1 causes a reduction in the level of CUL1 in the mutant flowers without an obvious defect in CUL1 deneddylation. We conclude that CSN is an essential regulator of Arabidopsis flower development and suggest that CSN regulates Arabidopsis flower development in part by modulating SCF(UFO)-mediated AP3 activation.

  10. Law, Urban Violence and Order: Cop Shows as a Brazilian TV Genre

    Directory of Open Access Journals (Sweden)

    Luiza Lusvarghi

    2014-04-01

    Full Text Available A new type of Brazilian drama series has taken place on local  TV -  the cop shows. Although they are not popular as the telenovela (soap operas, definitively they came to stay.  International channels like Fox and HBO are benefited by Tax Benefits Rule which provides financial conditions for the production of those home market, and are now competing with the two greatest media Brazilian  groups – Record and Globo.  The worldwide success of “Cidade de Deus” (City of God, 2002, Fernando Meirelles, released abroad like a gangster movie, and “Tropa de Elite” (Elite Squad, 2005, Jose Padilha, Berlin Golden Bear Award 2008, which sequel “Elit Squad: The Enemy Within” (2010 became the biggest box office record of Brazilian Cinema, could be partially contributed to motivate that new kind of production, which mix up social exclusion, urban violence with the very known old formulas of American serials, as the franchise “Law and Order” and its various spin-offs.

  11. Tamoxifen induces regression of estradiol-induced mammary cancer in ACI.COP-Ept2 rat model

    OpenAIRE

    Ruhlen, Rachel L.; Willbrand, Dana M.; Besch-Williford, Cynthia L.; Ma, Lixin; Shull, James D.; Sauter, Edward R.

    2008-01-01

    The ACI rat is a unique model of human breast cancer in that mammary cancers are induced by estrogen without carcinogens, irradiation, xenografts or transgenic manipulations. We sought to characterize mammary cancers in a congenic variant of the ACI rat, the ACI.COP-Ept2. All rats with estradiol implants developed mammary cancers in 5–7 months. Rats bearing estradiol-induced mammary cancers were treated with tamoxifen for three weeks. Tamoxifen reduced tumor mass, measured by magnetic resonan...

  12. In situ electrodeposition of CoP nanoparticles on carbon nanomaterial doped polyphenylene sulfide flexible electrode for electrochemical hydrogen evolution

    Science.gov (United States)

    Wang, Tingxia; Jiang, Yimin; Zhou, Yaxin; Du, Yongling; Wang, Chunming

    2018-06-01

    Active and durable electrocatalyst for hydrogen evolution reaction (HER) is pivotal to generate molecular hydrogen more energy-efficient, but directly grafting electrocatalyst on electrode material by a single-step method without compromising the catalytic activity and stability remains a challenge. Herein, an intriguing electrode, reduced graphene oxide modified carbon nanotube/reduced graphene oxide/polyphenylene sulfide (RGO-CNT/RGO/PPS) film, is used to replace conventional electrodes. In situ electrodeposition is proposed to fabricate CoP on the RGO-CNT/RGO/PPS (CoP-RGO-CNT/RGO/PPS) electrode and achieves a favorably electrical contact between CoP nanoparticles and RGO-CNT/RGO/PPS electrode due to without any polymer binder. Additionally, the coupling of different electrodeposition stages with scanning electron microscope (SEM) can investigate the nanostructure evolution of CoP nanoparticles, which gives valuable insights into the optimized electrodeposition cycles. The rational integration of RGO onto CNT/RGO/PPS film is an effective approach for enhancing its intrinsic electrical conductivity and favoring the formation of a high density of dispersive CoP nanoparticles. The CoP-RGO-CNT/RGO/PPS film has shown outstanding HER electrocatalytic behaviors performed a current density of 10 mA cm-2 at a relatively low overpotential of 160 mV with a Tafel slope of 60 mV dec-1 in acidic medium, which can be mainly attributed to the synergistic effect between optimized morphology and accelerated kinetics. Additionally, this film electrocatalyst exhibits a good HER activity and stability under both neutral and basic conditions.

  13. Analysis of the role of COP9 Signalosome (CSN subunits in K562; the first link between CSN and autophagy

    Directory of Open Access Journals (Sweden)

    Bunce Christopher M

    2009-04-01

    Full Text Available Abstract Background The COP9/signalosome (CSN is a highly conserved eight subunit complex that, by deneddylating cullins in cullin-based E3 ubiquitin ligases, regulates protein degradation. Although studied in model human cell lines such as HeLa, very little is known about the role of the CSN in haemopoietic cells. Results Greater than 95% knockdown of the non-catalytic subunit CSN2 and the deneddylating subunit CSN5 of the CSN was achieved in the human myeloid progenitor cell line K562. CSN2 knockdown led to a reduction of both CSN5 protein and mRNA whilst CSN5 knockdown had little effect on CSN2. Both knockdowns inhibited CSN deneddylase function as demonstrated by accumulation of neddylated Cul1. Furthermore, both knockdowns resulted in the sequential loss of Skp2, Cdc4 and β-TrCP F-box proteins. These proteins were rescued by the proteasome inhibitor MG132, indicating the autocatalytic degradation of F-box proteins upon loss of CSN2 or CSN5. Interestingly, altered F-box protein gene expression was also observed in CSN2 and CSN5 knockdowns, suggesting a potential role of the CSN in regulating F-box protein transcription. Loss of either CSN subunit dramatically reduced cell growth but resulted in distinct patterns of cell death. CSN5 knockdown caused mitotic defects, G2/M arrest and apoptotic cell death. CSN2 knockdown resulted in non-apoptotic cell death associated with accumulation of both the autophagy marker LC3-II and autophagic vacuoles. Treatment of vector control K562 cells with the autophagy inhibitors 3-methyladenine and bafilomycin A1 recapitulated the growth kinetics, vacuolar morphology and LC3-II accumulation of CSN2 knockdown cells indicating that the cellular phenotype of CSN2 cells arises from autophagy inhibition. Finally, loss of CSN2 was associated with the formation of a CSN5 containing subcomplex. Conclusion We conclude that CSN2 is required for CSN integrity and the stability of individual CSN subunits, and postulate

  14. Simulating the dynamics of polycyclic aromatic hydrocarbon (PAH) in contaminated soil through composting by COP-Compost model.

    Science.gov (United States)

    Zhang, Yuan; Guan, Yidong; Shi, Qi

    2015-02-01

    Organic pollutants (OPs) are potentially present in composts, and the assessment of their content and bioaccessibility in these composts is of paramount importance to minimize the risk of soil contamination and improve soil fertility. In this work, integration of the dynamics of organic carbon (OC) and OPs in an overall experimental framework is first proposed and adopted to validate the applicability of the COP-Compost model and to calibrate the model parameters on the basis of what has been achieved with the COP-Compost model. The COP-Compost model was evaluated via composting experiments containing 16 US Environmental Protection Agency (USEPA) polycyclic aromatic hydrocarbons (PAHs) and the sorption coefficient (Kd) values of two types of OP: fluorenthene (FLT) and pyrene (PHE). In our study, these compounds are used to characterize the sequential extraction and are quantified as soluble, sorbed, and non-extractable fractions. The model was calibrated, and coupling the OC and OP modules improved the simulation of the OP behavior and bioaccessibility during composting. The results show good agreement between the simulated and experimental results describing the evolution of different organic pollutants using the OP module, as well as the coupling module. However, no clear relationship is found between the Kd and the property of organic fractions. Further estimation of parameters is still necessary to modify the insufficiency of this present research.

  15. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  16. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  17. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

    Science.gov (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

    2016-10-01

    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  18. Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Bianca Schwartbeck

    2016-11-01

    Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

  19. Conferencia de Cambio Climático: resultados de la COP 20 en Perú

    Directory of Open Access Journals (Sweden)

    Wilfredo Bulege Gutiérrez

    2014-12-01

    Full Text Available El sentir ciudadano en defensa de la calidad de vida es ya de preocupación e indignación global. Siguiendo a Mónica Araya (1, podemos decir que a menor contaminación, más espacios verdes y mayor energía limpia, y a medida que estas aspiraciones entran en el imaginario ciudadano, van creándose condiciones favorables para el reclamo masivo y uso global de energía renovable. La reconocida economista costarricense y negociadora en cambio climático por su país, destaca que la petición en línea planteada por los ciudadanos este año ha exigido a los gobiernos optar por la energía limpia al cien por ciento, reclamo apoyado por 2,2 millones de personas en el mundo, y que la Marcha Popular por el Clima del 21 de septiembre de 2014 ha marcado un hito. Más de 400 000 ciudadanos caminaron pacíficamente por las calles de Manhattan apoyados por 3 000 actos que iban desde Bogotá hasta Sydney. Hubo marchas en 166 países con lúcidas expresiones ciudadanas a favor de una economía que no dañe la salud de las personas, que crezca a través del uso de energía renovable y sea justa (1. Según una encuesta del Banco Interamericano de Desarrollo (BID, al ciudadano latinoamericano le preocupa el cambio climático (2. Sabe que es un problema real y que puede llegar a impactar su entorno. Ya el 2 de noviembre oímos a la comunidad científica internacional a través del Panel Intergubernamental de Cambio Climático (IPCC, al publicar su Quinto Informe –el más reciente-, en el que la realidad y urgencia de atender el fenómeno del cambio climático es impostergable (1. Establecida en la Cumbre de Río en 1992, la Convención Marco de las Naciones Unidas sobre el Cambio Climático (CMNUCC entra en vigor en 1994 con el objetivo de reducir las concentraciones de gases de efecto invernadero (GEI en la atmósfera, y en 1995 impulsa la Conferencia de las Partes (COP, por sus siglas en inglés como órgano supremo de toma de decisiones. Los 195 pa

  20. [Offsets under the Kyoto Protocol : a perspective on COP 4 negotiations

    International Nuclear Information System (INIS)

    Kelly, E.

    1998-01-01

    The achievements of the Kyoto Protocol were highlighted. These achievements include recognition of the need for Annex 1 countries (developed countries) to define concrete emissions reduction targets to be accomplished by 2012; recognition of specific needs of developing countries; need for measures to anticipate, prevent or minimize the causes of climate change; recognition of the need that climate change policies and measures be cost effective; taking into account that economic development is essential for adopting measures to address climate change; recognition of the principle that corporations should promote a supportive and open international economic system leading to sustainable growth; and recognition that measures taken to combat climate change should not lead to unjustifiable discrimination in international trade. If the targets set at Kyoto are achieved, there will be an effective reduction in greenhouse gases of 5.2 per cent in relation to 1990 levels. The meeting in Buenos Aires should focus on strengthening the guidelines for actions agreed upon in Kyoto. Other major issues on the Buenos Aires Conference of Parties (COP 4) agenda should be to discuss ways and means to helping developing countries to deal with climate change issues within their own territories, agreement about definitive status of the Global Environmental Fund, arriving at a more precise definition of the Clean Development Mechanism, and first and foremost the development of credible national systems (i.e. Annex 1 countries) for the estimation of anthropogenic emission sources and removal by sinks of all greenhouse gases not controlled by the Montreal Protocol on the Ozone Layer, and shaping an adequate non-compliance system

  1. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

    1988-01-01

    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

  3. Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank

    1992-01-01

    We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

  4. Determinantes estructurales y su relación con el índice de COP en países de desarrollo alto, mediano y bajo

    Directory of Open Access Journals (Sweden)

    Luis Carlos García Rincón

    2015-01-01

    Full Text Available Objetivo: describir y analizar los determinantes estructurales y su relación con el índice de COP en países de desarrollo alto, mediano y bajo durante las últimas tres décadas. Materiales y métodos: estudio descriptivo realizado a partir de una revisión de la literatura internacional y nacional en bases de datos y páginas web. Resultados: se encontró un país con índice de COP elevado; un país con índice de COP moderado; 10 países con índice de COP bajo; y 10 países con índice de COP muy bajo. Los países de desarrollo alto y los países de desarrollo bajo se comportan de manera similar en tanto reportan índices de COP inferiores al promedio mundial sugerido por la OMS (2.4. Discusión y conclusiones: se concluye que los valores de COP están asociados fuertemente a factores macroeconómicos, como las políticas y servicios de cuidado de la salud disponibles para la población, más que a la clasificación de desarrollo del Banco Mundial. Los determinantes sociales están directamente relacionados con las políticas estructurales que afectan el bienestar social, la salud y la calidad de vida de la población.

  5. The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

    OpenAIRE

    Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

    2000-01-01

    In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

  6. Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

    NARCIS (Netherlands)

    Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

    The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

  7. Making the COP21 work. From international to national scope: the impact of climate negotiations on public action

    International Nuclear Information System (INIS)

    Lefebvre, Coline; Delory, Linda; Guibert, Geraud

    2015-12-01

    How to appreciate, when the time comes, the results of the COP21? What are the elements that can make it truly useful? La Fabrique Ecologique and CliMates, on the basis of an exclusive and meticulous international survey underline them: the important part of an efficient climate action does not always rely on what we believe. The most influential aspect will be the commitment to future objectives and steps, strong principles of transparency and the extent of real domestic commitments for a new development strategy. A few weeks ahead of the COP21, what can we really expect? It is very likely that, as for the previous COPs, there will be an agreement, but we still need to see if it will be satisfactory. Facing the extent of the climate challenge and the complex negotiation, it remains urgent to have a clear and precise vision of what this international conference could bring. To measure it, La Fabrique Ecologique and CliMates have led an exclusive survey on the impact in recent years of the annual meetings of the COPs on climate policies of 16 States and 5 local authorities. This survey shows several paradoxes: the legally binding character proved to be not so binding after all; the sense of failure sometimes hid real successes; the negotiation itself having a strong impact on its results. It enables to identify the most important factors which have already led to action: the creation of shared knowledge and transparency standards, the obligation of setting an example for countries willing to be included in the negotiation, the search of economic and social co-benefits of climate action with a view to a new development strategy, the emergence of a global climate civil society. Far too often, the COP21 is presented as a deadline, a final date to solve the most complex and global challenge Man has ever faced: climate deregulation. Presented as the umpteenth 'last-ditch conference', the Paris negotiation might generate many 'climate resigned people

  8. Effect of two Backpack Designs on Cop Displacement and Plantar Force Distribution in Children during Upright Stance

    Directory of Open Access Journals (Sweden)

    Mastalerz Andrzej

    2016-09-01

    Full Text Available Introduction. Many studies have compared different backpack designs and their influence on the carrier; however, no data referring to school students aged 7-8 years are currently available. Therefore, the aim of the research was to assess the influence of backpack design on centre of pressure (COP displacement and plantar force distribution in children during an upright stance. Material and methods. Nineteen school students (9 males and 10 females volunteered for the study. Two Polish backpacks intended for school use were evaluated: backpack A, which had two main compartments, and backpack B, which had one main compartment. The backpack load was composed of books, binders, and regular school equipment. During the measurements, the subjects were asked to look ahead with the head straight and arms at the sides in a comfortable position and to stand barefoot on the F-Scan® sensors (Tekscan, F-Scan® attached to the force platform (Kistler, carrying a load corresponding to 10% of their body mass. Results. The study found insignificant differences between the two backpack designs. Moreover, COP parameters increased significantly during an upright stance while carrying backpack B in comparison to the empty backpack condition. Additionally, we observed significantly higher values of plantar force distribution in the heel region for the condition without load and insignificantly higher ones for carrying backpack A. Conclusions. The results of the current study suggest that the differences between the two backpack designs are too marginal to be detected through COP displacement. Disturbances in plantar force distribution suggest a lack of posture control and a lower stability of the standing position with a backpack, but these disturbances were significant only when the backpack with one main compartment was used.

  9. The influence of light hypothenar contact during a reaching movement on the centre of pressure (COP forward displacement.

    Directory of Open Access Journals (Sweden)

    Darja Rugelj

    Full Text Available The purpose of this study was to evaluate the effect of additional light hand contact (F<1 N in the region of the hypothenar eminence on forward movement of the center of pressure (COP and dominant hand. Subjects sled their hypothenar eminence on a vertically-oriented pressure sensitive board while reaching forward beyond their arm length. In the two separate experiments forty nine healthy, college-aged volunteers participated in the study. Thirty subjects (mean age of 22.2±2.4 years, 6 male and 24 female participated in the experiment on level ground and nineteen subjects (22±2.6 years, 5 male and 14 female in the experiment on an elevated surface. The forward displacement of the COP was significantly larger (p = 0.002 when subjects were allowed to slide with the hand as compared to no contact when the activity occurred on level ground (84±10 mm and 79±11 mm, respectively, and on a one meter elevated surface (71±17 mm and 65±21 mm, respectively. The maximal forward reach of the dominant hand was significantly greater when subjects were allowed to slide with the hypothenar eminence as compared to the no contact condition on the level ground (336±35 mm and 344±38 mm, respectively, p<0.02, and on the one meter elevated surface (298±58 mm and 307±58 mm, respectively, p<0.01. This data indicate that subjects were able to use additional haptic information from the hypothenar region to bring their COP and dominant hand further forward while standing on level ground as well as on a one m elevated surface.

  10. Development of Internet algorithms and some calculations of power plant COP

    Science.gov (United States)

    Ustjuzhanin, E. E.; Ochkov, V. F.; Znamensky, V. E.

    2017-11-01

    sharing: a) SW that is used to design power plants, for an example, Code - GTP_1(Z,R,Y) and b) client functions those are aimed to determine R properties of the working fluid at fixed points of the thermodynamic cycle. The program let us calculate energy criteria, Z, including the internal coefficient of performance (COP) for a power plant. We have discussed OI resources, among them OI resource that includes Code - GTP_1(Z,R,Y) and connected with a complex power plant included: i) several gas turbines, i) several compressors etc.

  11. International climate policy leadership after COP23: the EU must resume its leading role, but cannot do so alone

    OpenAIRE

    Dröge, Susanne; Rattani, Vijeta

    2018-01-01

    The net outcome of the Bonn climate talks (23rd Conference of the Parties, COP23) in November was lukewarm at best. Many technical issues were brought forward and the political risks caused by the US announcement to pull out of the Paris Agreement were kept at bay. Yet, leadership to fill the void left by the US was lacking. Germany, who was co-hosting with the Fiji Islands, could not table ambitious solutions as in November 2017 it only had a caretaker government in place. The Fiji Presidenc...

  12. Situación de riesgo por la presencia de COP: evidencias del problema y escenarios de solución

    Directory of Open Access Journals (Sweden)

    Berenice Ochoa Nogales

    2012-01-01

    Full Text Available En este artículo se presentan resultados preliminares del proyecto de investigación titulado “Desarrollo de una metodología que permita llevar a cabo el inventario, caracterización y verificación de sitios potencialmente contaminados con Compuestos Orgánicos Persistentes (COP en las principales zonas agrícolas del estado de Sonora”. Primero, se destacan algunos planteamientos que emergen de la sociedad del riesgo respecto a la problemática ambiental en general y a la de los COP en particular. Después, se realiza una aproximación a la problemática por COP que dio pie al Convenio de Estocolmo, las evidencias de tal problema en México, en Sonora y las obligaciones que se asumen al suscribirse a tal convenio. A nivel nacional, el énfasis se coloca en el análisis de la normativa ambiental vinculada a tóxicos; y, a nivel estatal, en mostrar evidencias de la presencia de COP y su impacto en el ambiente y la salud humana. Para terminar, se reflexiona en torno a los retos y áreas de oportunidad que para México significa el atender la problemática por COP de seguirse los lineamientos internacionales, la normativa oficial y lo que sugiere el análisis desde la perspectiva del riesgo.

  13. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    Science.gov (United States)

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

  14. Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

    Directory of Open Access Journals (Sweden)

    Keyhani Nemat O

    2004-06-01

    Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

  15. The davDT operon of Pseudomonas putida, involved in lysine catabolism, is induced in response to the pathway intermediate delta-aminovaleric acid

    DEFF Research Database (Denmark)

    Revelles, O.; Espinosa-Urgel, M.; Molin, Søren

    2004-01-01

    -aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...

  16. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  17. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    NARCIS (Netherlands)

    Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

  18. recA mediated spontaneous deletions of the icaADBC operon of clinical Staphylococcus epidermidis isolates : a new mechanism of phenotypic variations

    NARCIS (Netherlands)

    Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.

    Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo

  19. Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

    DEFF Research Database (Denmark)

    Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

    1994-01-01

    specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

  20. An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

    Science.gov (United States)

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

    2014-10-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  2. The flagellar master operon flhDC is a pleiotropic regulator involved in motility and virulence of the fish pathogen Yersinia ruckeri

    Science.gov (United States)

    Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...

  3. Proteomic pleiotropy of OpgGH, an operon necessary for efficient growth of Salmonella enterica serovar Typhimurium under low-osmotic conditions

    Science.gov (United States)

    Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...

  4. Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

    1996-01-01

    Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

  5. Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

    Science.gov (United States)

    Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

    2015-10-01

    To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

  6. Analysis of gene order data supports vertical inheritance of the leukotoxin operon and genome rearrangements in the 5' flanking region in genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Kuhnert, Peter; Frey, Joachim

    2007-01-01

    subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...

  7. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deaner, Matthew; Holzman, Allison; Alper, Hal S

    2018-04-16

    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Spatio-temporal soil moisture variability in Southwest Germany observed with a new monitoring network within the COPS domain

    Energy Technology Data Exchange (ETDEWEB)

    Krauss, Liane; Kottmeier, Christoph [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Meteorology and Climate Research; Hauck, Christian [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. for Meteorology and Climate Research; Fribourg Univ. (Switzerland). Dept. of Geosciences

    2010-12-15

    Within the 'Convective and Orographically-induced Precipitation Study' (COPS) 2007 in Southwest Germany and Northeast France a soil moisture monitoring network was installed. The aim of the network is to identify the interaction between the temporal and spatial variability of the soil moisture field and its influence on the energy balance and the moisture availability in the planetary boundary layer. The network is comprised of a large number of newly developed low-cost soil moisture sensors based on the frequency-domain reflectometry method (FDR). In total 47 soil moisture stations within the COPS domain were each equipped with two to four sensors simultaneously measuring vertical profiles of soil moisture and soil temperature down to 50 cm depth. This contribution describes the soil moisture network, its installation procedure and the calibration of the sensor output signal. Furthermore we discuss the soil texture distribution within the study area and present first analyses of the spatio-temporal soil moisture variability during a 13 month period from June 2007 till June 2008 based on regional differences and site specific properties (altitude and soil texture). Results show that the altitude plays a key role for the overall soil moisture pattern relative to the area mean due to the direct linkage to precipitation patterns. Soil texture controls the vertical soil moisture gradient relative to the near surface soil moisture, as their properties control water storage and drainage characteristics. Both factors significantly influence regional soil moisture patterns in Southwest Germany. (orig.)

  9. COP21: success at 'the end of the beginning'. Climate Brief No.38

    International Nuclear Information System (INIS)

    Bultheel, Clement; Morel, Romain; Hainaut, Hadrien; Deheza, Mariana; Shishlov, Igor; Depoues, Vivian; Leguet, Benoit

    2015-01-01

    The Paris Agreement provides a clear signal and a solid framework for climate action. Balanced and ambitious in its objectives - including full decarbonization of the global economy before the end of the century - it has all the conditions to encourage everyone to do more. In establishing a new international climate change regime, the Agreement focuses on the essentials: guiding countries towards low-carbon and climate resilient economies. The main challenge resides not in the direct implementation of the decisions taken in Paris, but rather in the alignment of countries' national strategies with a decarbonization trajectory. COP21 marks the advent of a new regime of international cooperation rather than a 'utopian' and politically unpalatable system to punish or coerce States to take action. It confirms the desire to engage both State and non-State actors on climate action. In this respect, it is a real victory of multilateralism. Indeed, COP21 marks the 'end of the beginning' of a long negotiations process to shift to a permanent regime, completed by regular appointments to boost ambition. This victory, however, will become historical only if this cooperation leads to enhanced action and concrete results. And this is where the hard work begins

  10. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  11. Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

    Science.gov (United States)

    Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

    2015-01-01

    Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

  12. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    Science.gov (United States)

    Tadmor, Arbel

    2009-03-01

    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  13. The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

    Science.gov (United States)

    Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

    2014-01-01

    The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

  14. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

    Directory of Open Access Journals (Sweden)

    Uzma Qaisar

    Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

  16. Expression, crystallization and preliminary diffraction studies of the Pseudomonas putida cytochrome P450cam operon repressor CamR

    International Nuclear Information System (INIS)

    Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo

    2005-01-01

    The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory

  17. Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

    Directory of Open Access Journals (Sweden)

    Opsata Mona

    2010-08-01

    Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

  18. The status and prospects of the debate upon the nuclear power in the climate change talks: focused on the result of COP7

    International Nuclear Information System (INIS)

    Lee, C. Y.; Kim, S. S.

    2002-01-01

    Possible climate change caused by global warming becomes one of the most serious challenges that mankind shall tackle in 21 st century. Nuclear power, which doesn't emit any greenhouse gas during the generation of electricity, is a promising solution to mitigate the global warming. The agreement on this matter at COP7, however, resulted in an unfavorable conclusion that may shrink the role of nuclear power in the greenhouse gas abatement. This paper looks into the negotiation process at COP7 especially focused on the nuclear matters and then gives some implications of the agreement

  19. Estructura genética del copépodo Acartia lilljeborgii en la costa del estado de Yucatán, México

    OpenAIRE

    Jorge Tello-Cetina; Lucia Gómez-Victoria; Roberto Zamora-Bustillos; Gerardo Rivera-Muñoz; Sara Solis-Pereira; Herbert Loria-Sunza

    2013-01-01

    Se determinó la estructura genética poblacional y sus implicancias dentro de la cadena trófica del copépodo Acartia lilljeborgii en la costa de Yucatán, mediante el uso de isoenzimas y su posterior determinación por electroforesis. Nueve sistemas se expresaron con un máximo de 30 loci. El polimorfismo y heterocigosis de las poblaciones estudiadas, al ser comparados con otras especies de copépodos, resultaron ser bajos y de los cuatro loci que presentaron variación, solo los loci EST2 y PGM1 s...

  20. Estructura trófica de los copépodos pelágicos en el Océano Pacifico Oriental Tropical

    OpenAIRE

    López Ibarra, Gladis Angélica

    2008-01-01

    Gran parte de la productividad secundaria marina es aportada por los copépodos, estos destacan dentro del zooplancton marino por su diversidad y abundancia, puede llegar a constituir un 80 % de la biomasa zooplanctonica. Probablemente el principal papel ecológico de esta comunidad es la transferencia de energía entre los niveles tróficos primarios y los sucesivos en las redes tróficas. En este estudio se analizó la estructura trófica de la comunidad de copépodos pelágicos en el Océano Pacifi...

  1. The "good cop, bad cop" effect in the RT-based concealed information test: exploring the effect of emotional expressions displayed by a virtual investigator.

    Directory of Open Access Journals (Sweden)

    Mihai Varga

    Full Text Available Concealing the possession of relevant information represents a complex cognitive process, shaped by contextual demands and individual differences in cognitive and socio-emotional functioning. The Reaction Time-based Concealed Information Test (RT-CIT is used to detect concealed knowledge based on the difference in RTs between denying recognition of critical (probes and newly encountered (irrelevant information. Several research questions were addressed in this scenario implemented after a mock crime. First, we were interested whether the introduction of a social stimulus (facial identity simulating a virtual investigator would facilitate the process of deception detection. Next, we explored whether his emotional displays (friendly, hostile or neutral would have a differential impact on speed of responses to probe versus irrelevant items. We also compared the impact of introducing similar stimuli in a working memory (WM updating context without requirements to conceal information. Finally, we explored the association between deceptive behavior and individual differences in WM updating proficiency or in internalizing problems (state / trait anxiety and depression. Results indicated that the mere presence of a neutral virtual investigator slowed down participants' responses, but not the appended lie-specific time (difference between probes and irrelevants. Emotional expression was shown to differentially affect speed of responses to critical items, with positive displays from the virtual examiner enhancing lie-specific time, compared to negative facial expressions, which had an opposite impact. This valence-specific effect was not visible in the WM updating context. Higher levels of trait / state anxiety were related to faster responses to probes in the negative condition (hostile facial expression of the RT-CIT. These preliminary findings further emphasize the need to take into account motivational and emotional factors when considering the

  2. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Johanna Rintahaka

    Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

  3. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Science.gov (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  4. Tamoxifen induces regression of estradiol-induced mammary cancer in the ACI.COP-Ept2 rat model.

    Science.gov (United States)

    Ruhlen, Rachel L; Willbrand, Dana M; Besch-Williford, Cynthia L; Ma, Lixin; Shull, James D; Sauter, Edward R

    2009-10-01

    The ACI rat is a unique model of human breast cancer in that mammary cancers are induced by estrogen without carcinogens, irradiation, xenografts or transgenic manipulations. We sought to characterize mammary cancers in a congenic variant of the ACI rat, the ACI.COP-Ept2. All rats with estradiol implants developed mammary cancers in 5-7 months. Rats bearing estradiol-induced mammary cancers were treated with tamoxifen for three weeks. Tamoxifen reduced tumor mass, measured by magnetic resonance imaging, by 89%. Tumors expressed estrogen receptors (ER), progesterone receptor (PR), and Erbb2. ERalpha and PR were overexpressed in tumor compared to adjacent non-tumor mammary gland. Thus, this model is highly relevant to hormone responsive human breast cancers.

  5. A Policy Analysis and Quantitative Assessment of Key Issues Arising from Climate Change Negotiations Following COP 7

    Energy Technology Data Exchange (ETDEWEB)

    Sager, J. M

    2003-04-01

    This paper aims to assess the consequences of the amendments made to the Kyoto Protocol during COP 7 in Marrakech. Following a comprehensive policy analysis, the major issue of 'hot air' and CDM transaction costs is examined using the CERT model. This was done to show that primary supply regions, typically those with 'hot air' availability, might control the emissions reduction permit supply market and maximise net export revenues of permit supply by withholding 40 to 60% of available 'hot air' credits. The assumption that primary permit suppliers control permit price via a restriction of 'hot air' supply to the market will inadvertently leave a portion of the market share open to Non-Annex B CDM supply, despite potentially extreme variance in CDM transaction costs. A summary table of policy implications on the emissions reduction permit market is also included in the Appendix. (author)

  6. A Policy Analysis and Quantitative Assessment of Key Issues Arising from Climate Change Negotiations Following COP 7

    Energy Technology Data Exchange (ETDEWEB)

    Sager, J M

    2003-04-01

    This paper aims to assess the consequences of the amendments made to the Kyoto Protocol during COP 7 in Marrakech. Following a comprehensive policy analysis, the major issue of 'hot air' and CDM transaction costs is examined using the CERT model. This was done to show that primary supply regions, typically those with 'hot air' availability, might control the emissions reduction permit supply market and maximise net export revenues of permit supply by withholding 40 to 60% of available 'hot air' credits. The assumption that primary permit suppliers control permit price via a restriction of 'hot air' supply to the market will inadvertently leave a portion of the market share open to Non-Annex B CDM supply, despite potentially extreme variance in CDM transaction costs. A summary table of policy implications on the emissions reduction permit market is also included in the Appendix. (author)

  7. The devil is in the details: comparison between COP9 signalosome (CSN) and the LID of the 26S proteasome.

    Science.gov (United States)

    Meister, Cindy; Gulko, Miriam Kolog; Köhler, Anna M; Braus, Gerhard H

    2016-02-01

    The COP9 signalosome (CSN) and the proteasomal LID are conserved macromolecular complexes composed of at least eight subunits with molecular weights of approximately 350 kDa. CSN and LID are part of the ubiquitin–proteasome pathway and cleave isopeptide linkages of lysine side chains on target proteins. CSN cleaves the isopeptide bond of ubiquitin-like protein Nedd8 from cullins, whereas the LID cleaves ubiquitin from target proteins sentenced for degradation. CSN and LID are structurally and functionally similar but the order of the assembly pathway seems to be different. The assembly differs in at least the last subunit joining the pre-assembled subcomplex. This review addresses the similarities and differences in structure, function and assembly of CSN and LID.

  8. Contaminantes orgánicos persistentes (COPs en leche materna de centros urbanos de la provincia de Buenos Aires

    Directory of Open Access Journals (Sweden)

    Lara Sofia Della Ceca

    2013-01-01

    Full Text Available Los contaminantes orgánicos persistentes (COPs se acumulan en matrices ricas en materia grasa como la leche materna, que es un buen indicador de sus niveles en poblaciones humanas debido a su fácil y no invasiva extracción. Con el objeto de evaluar la exposición a COPs en la provincia de Buenos Aires y compararla con otras  áreas, se analizaron bifenilos policlorados (PCBs, diclorodifeniltricloroetano (DDT y sus metabolitos (DDT, TDE, hexaclorociclohexanos (?, ? y ?-HCH y clordanos (CHLDs: heptaclor y su epóxido, trans y cis clordanos y nonaclors en muestras de leche materna colectadas durante 2010 y 2011 en Punta Lara, Ensenada, Florencio Varela y Capital Federal.Las  muestras fueron colectadas con sacaleches manuales, centrifugadas para separar la crema que fue liofilizada y extraída con éter de petróleo y ultrasonido. Los extractos previamente tratados con ácido para eliminación parcial de lípidos, fueron purificados por cromatografía en gel de sílice y analizados por cromatografía gaseosa.Las concentraciones de COPs en ng.g-1 lípido decrecieron en el orden DDTs (76±91 ? PCBs (67±64 > HCHs (33±36 ³ CHLDs (22±24.  Los DDTs oscilaron entre 7.7-510 ng.g-1 lípido y  los PCBs entre 5-247 ng.g-1 lípido, estos valores son comparables al rango más bajo reportado en la literatura (DDTs Noruega: 39-292 ng.g-1 lípido; PCBs Vietnam: 26-210 ng.g-1, Japón: 23-370 ng.g-1. En cambio, las concentraciones de HCHs y CHLDs, que oscilaron entre 5.8-197 ng.g-1 lípido y  1.3-124 ng.g-1 lípido respectivamente, corresponden al rango medio reportado para otras áreas (HCHs Indonesia 1.6-120 ng.g-1; CHLDs 3.4-92 ng.g-1. La composición de residuos en la leche materna es relativamente conservativa para cada clase de COPs, así se observa uniforme predominancia de productos de degradación (p.ej. DDE: 90±17% de SDDTs; epóxido de heptaclor: 50±18% y t-nonaclordano: 34±13% de SCHLDs y los isómeros y congéneres más persistentes (?-HCH

  9. Les chemins infinis de la décarbonisation. Neuf questions clés pour la COP21

    OpenAIRE

    Berta, Nathalie

    2015-01-01

    Introduction L’ouvrage de Michel Damian offre une analyse fine, à la fois riche et synthétique, des négociations climatiques internationales depuis la Convention-Cadre des Nations Unies de Rio en 1992. Ce détour historique est nécessaire si l’on veut comprendre les enjeux de la COP21 de Paris. Il permet de souligner l’évolution des thèmes abordés lors des négociations — de la réduction des émissions à l’adaptation, de la compensation des dommages liés au changement climatique au maintien du c...

  10. COP 20 in Lima: a tense rehearsal dinner where everyone ended up eating at the same table. Climate Brief no. 37

    International Nuclear Information System (INIS)

    Morel, Romain; Deheza, Mariana; Cochran, Ian; Leguet, Benoit

    2014-12-01

    COP20 in Lima was expected to put the negotiations on track to get an ambitious global agreement in Paris in December 2015. As a 'rehearsal dinner' for Paris Climate 2015, COP20 managed to keep and strengthen the hopes for a 'wedding' of interests with all parties sharing a table. COP 20 achieved its two key objectives: defining a framework - even if only indicative - for the submission of the countries' Intended Nationally Determined Contributions (INDCs), and a preview of the components of the draft negotiating text that will be discussed throughout 2015 on the way to Paris. Perhaps the most valuable input may be COP20's treatment - or rather the absence - of the Annex I/non-Annex I differentiation. This marks a watershed moment in negotiations where all countries recognize the need to contribute to climate action. 2014 was a relatively productive year marked by Europe's engagement through the Energy Climate Package 2030, the US-China agreement and the capitalization of the Green Climate Fund. Nevertheless, many unsolved critical issues remain on the negotiator's plate to ensure the strong commitments necessary in Paris to reach the ambitious long-term 2 deg. C target. (authors)

  11. A Critical Review of the Use of Wenger's Community of Practice (CoP) Theoretical Framework in Online and Blended Learning Research, 2000-2014

    Science.gov (United States)

    Smith, Sedef Uzuner; Hayes, Suzanne; Shea, Peter

    2017-01-01

    After presenting a brief overview of the key elements that underpin Etienne Wenger's communities of practice (CoP) theoretical framework, one of the most widely cited and influential conceptions of social learning, this paper reviews extant empirical work grounded in this framework to investigate online/blended learning in higher education and in…

  12. Second-law-based analysis of vapor-compression refrigeration cycles: Analytical equations for COP and new insights into features of refrigerants

    International Nuclear Information System (INIS)

    Ma, Weiwu; Fang, Song; Su, Bo; Xue, Xinpei; Li, Min

    2017-01-01

    Highlights: • Second-law analysis leads to analytical COP formulas for refrigeration cycles. • Relative errors of the analytical equations are smaller than ±5.0%. • The analytical expressions characterize the influence of refrigerants. • Global entropy analysis elucidates the impact of cycle processes on COP. - Abstract: This article reports a second-law-based analysis of the vapor-compression refrigeration cycle, which leads to a set of explicit theoretical formulas for the coefficient of performance (COP). These analytical expressions provide a fast and accurate approach to computer simulations of the vapor-compression cycle without recourse to thermodynamic diagrams or equations of state. The second-law-based analysis yields specific expressions for the entropy generations of irreversible processes, enabling us to evaluate the thermodynamic features of the refrigerant and to elucidate the thermodynamic mechanisms behind the effects of the cycle processes, including superheat, subcooling, and throttling processes. In particular, these processes can interact, therefore this paper presents a global entropy generation analysis for evaluating the impact of the interacted processes on COP.

  13. C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein

    Science.gov (United States)

    Cloix, Catherine; Kaiserli, Eirini; Heilmann, Monika; Baxter, Katherine J.; Brown, Bobby A.; O’Hara, Andrew; Smith, Brian O.; Christie, John M.; Jenkins, Gareth I.

    2012-01-01

    UV-B light initiates photomorphogenic responses in plants. Arabidopsis UV RESISTANCE LOCUS8 (UVR8) specifically mediates these responses by functioning as a UV-B photoreceptor. UV-B exposure converts UVR8 from a dimer to a monomer, stimulates the rapid accumulation of UVR8 in the nucleus, where it binds to chromatin, and induces interaction of UVR8 with CONSTITUTIVELY PHOTOMORPHOGENIC1 (COP1), which functions with UVR8 to control photomorphogenic UV-B responses. Although the crystal structure of UVR8 reveals the basis of photoreception, it does not show how UVR8 initiates signaling through interaction with COP1. Here we report that a region of 27 amino acids from the C terminus of UVR8 (C27) mediates the interaction with COP1. The C27 region is necessary for UVR8 function in the regulation of gene expression and hypocotyl growth suppression in Arabidopsis. However, UVR8 lacking C27 still undergoes UV-B–induced monomerization in both yeast and plant protein extracts, accumulates in the nucleus in response to UV-B, and interacts with chromatin at the UVR8-regulated ELONGATED HYPOCOTYL5 (HY5) gene. The UV-B–dependent interaction of UVR8 and COP1 is reproduced in yeast cells and we show that C27 is both necessary and sufficient for the interaction of UVR8 with the WD40 domain of COP1. Furthermore, we show that C27 interacts in yeast with the REPRESSOR OF UV-B PHOTOMORPHOGENESIS proteins, RUP1 and RUP2, which are negative regulators of UVR8 function. Hence the C27 region has a key role in UVR8 function. PMID:22988111

  14. Prediction of DtxR regulon: Identification of binding sites and operons controlled by Diphtheria toxin repressor in Corynebacterium diphtheriae

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed

    2004-09-01

    Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase

  15. Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

    Science.gov (United States)

    Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

    2017-07-01

    Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

  16. Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

    DEFF Research Database (Denmark)

    Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

    1997-01-01

    A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

  17. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

    Science.gov (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

    2016-03-18

    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    Science.gov (United States)

    Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

  19. Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

    Science.gov (United States)

    Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

    2015-02-01

    Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

    Science.gov (United States)

    Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

    2015-12-29

    Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

  1. Mutation of a Broadly Conserved Operon (RL3499-RL3502) from Rhizobium leguminosarum Biovar viciae Causes Defects in Cell Morphology and Envelope Integrity▿†

    Science.gov (United States)

    Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.

    2011-01-01

    The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485

  2. Using fusions with luxAB from Vibrio harveyi MAV to quantify induction and catabolite repression of the xyl operon in Staphylococcus carnosus TM300.

    Science.gov (United States)

    Sizemore, C; Geissdörfer, W; Hillen, W

    1993-03-01

    The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.

  3. Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

    Science.gov (United States)

    Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

    2016-05-18

    Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

  4. Knockout of an outer membrane protein operon of anaplasma marginale by transposon mutagenesis

    Science.gov (United States)

    Large amounts of data generated by genomics, transcriptomics and proteomics technologies have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classic genetic mutation. One example is the def...

  5. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Haley R Pipkins

    Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

  6. Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

    Science.gov (United States)

    Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

    2016-05-25

    Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

  7. Mycobacterium tuberculosis co-operonic PE32/PPE65 proteins alter host immune responses by hampering Th1 response

    Directory of Open Access Journals (Sweden)

    Mohd eKhubaib

    2016-05-01

    Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.

  8. Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

    Science.gov (United States)

    Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

    2018-04-16

    Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

  9. 78 FR 2439 - Agency Information Collection Activities; Proposed New Collection; Comments Requested: COPS/“Not...

    Science.gov (United States)

    2013-01-11

    ... discussed in the different media such as: hate crimes, community relations for diversity, school collaborations with law enforcement, and community collaborations with law enforcement. These are one-time... will be asked or required to respond, as well as a brief abstract: Law enforcement agencies and other...

  10. Reducing emissions from deforestation and degradation in developing countries (REDD): insights from the UNFCCC COP-13 in Bali

    International Nuclear Information System (INIS)

    Wertz-Kanounnikoff, S.

    2007-01-01

    At the 10. anniversary of the Kyoto Protocol, the goal to reduce greenhouse gas (GHG) emissions that cause climate change remains of alarming importance. According to the Intergovernmental Panel on Climate Change, these emissions have grown by 70% since 1970; and in 2005 the concentration of the most important GHG, carbon dioxide (CO 2 ), peaked at its highest level for 650,000 years (IPCC 2007). The proposal to compensate reduced emissions from deforestation and degradation in developing countries (REDD), as an additional element in the international climate regime, was put forward to address the so far ignored up to 20% of global GHG emissions arising from forestry. Although excluded from the first commitment period of the Kyoto Protocol, the idea was submitted by Papua New Guinea and Costa Rica, on behalf of the Coalition of Rain forest Nations, at the 11. Conference of Parties (COP-11) to the UN Framework Convention on Climate Change in Montreal in 2005. The proposal has initiated a two year examination process, facilitated by the UNFCCC, and has attracted extremely high participation levels of the concerned stakeholders. As the examination process on REDD took place between 2005 and 2007, several points of agreement and disagreement were being revealed among the different country proposals. Points of agreement included inter alia: that REDD would need to play a role in future climate regimes; that there was a need to take into account national circumstances to successfully integrate developing countries; and capacity-building and pilot or demonstration activities (prior to 2012) are crucial to enable developing countries to effectively participate and benefit from REDD. Points of contention consisted in inter alia: the potential financing systems (market- or fund/ODA-based), the scope of activity (deforestation only or with forest degradation or with forest conservation), and the scale of implementation (national or project level). Decisive advance on the

  11. Survey report for fiscal 1998. Evaluation by industrial circles of the COP3 outcome and their future response (America); 1998 nendo chosa hokokusho. COP3 no kekka ni taisuru sangyokai no hyoka oyobi kongo no taio ni tsuite (Beikoku)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    Response in America to COP3 (Third Session of the Conference of the Parties to the United Nations Framework Convention on Climate Change) is investigated. Office of Energy Efficiency and Renewable Energy (EE) of America's Department of Energy conducts activities designed to protect environments and supports America's economic competitiveness. The scope of EE activities is quite wide, covering efforts at energy efficiency improvement and renewal energy utilization for all energy consuming sectors involving construction work and equipment for buildings, various industries and public utility works, and transportation. EE also supports and promotes the development of advanced industrial materials, electric vehicles, hybrid vehicles, fuel cells, etc. In the field of renewable energy, it deals with the exploitation of sunlight, biomass, wind force, water power, geothermal energy, etc. It also supports efficiency improvement efforts being undertaken through studies of advanced power transmission and distribution, high-temperature superconduction, energy storage, etc. The said supports are provided not only by Federal Government but also by state governments, and include financial aids. A number of programs are under way, worked out and promoted by the respective bureaus and departments. They are evaluated, protected, and implemented through the partnership of official and civilian organizations. (NEDO)

  12. Pentachlorophenol induction of the Pseudomonas aeruginosa mexAB-oprM efflux operon: involvement of repressors NalC and MexR and the antirepressor ArmR.

    Directory of Open Access Journals (Sweden)

    Lisa M Starr

    Full Text Available Pentachlorophenol (PCP induced expression of the NalC repressor-regulated PA3720-armR operon and the MexR repressor-controlled mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. PCP's induction of PA3720-armR resulted from its direct modulation of NalC, the repressor's binding to PA3720-armR promoter-containing DNA as seen in electromobility shift assays (EMSAs being obviated in the presence of this agent. The NalC binding site was localized to an inverted repeat (IR sequence upstream of PA3720-armR and overlapping a promoter region whose transcription start site was mapped. While modulation of MexR by the ArmR anti-repressor explains the upregulation of mexAB-oprM in nalC mutants hyperexpressing PA3720-armR, the induction of mexAB-oprM expression by PCP is not wholly explainable by PCP induction of PA3720-armR and subsequent ArmR modulation of MexR, inasmuch as armR deletion mutants still showed PCP-inducible mexAB-oprM expression. PCP failed, however, to induce mexAB-oprM in a mexR deletion strain, indicating that MexR was required for this, although PCP did not modulate MexR binding to mexAB-oprM promoter-containing DNA in vitro. One possibility is that MexR responds to PCP-generated in vivo effector molecules in controlling mexAB-oprM expression in response to PCP. PCP is an unlikely effector and substrate for NalC and MexAB-OprM--its impact on NalC binding to the PA3720-armR promoter DNA occurred only at high µM levels--suggesting that it mimics an intended phenolic effector/substrate(s. In this regard, plants are an abundant source of phenolic antimicrobial compounds and, so, MexAB-OprM may function to protect P. aeruginosa from plant antimicrobials that it encounters in nature.

  13. Comparative strength analysis and thermal fatigue testing of Be/CuCrZr and Be/GlidCop joints produced by fast brazing

    International Nuclear Information System (INIS)

    Gervash, A.; Mazul, I.; Yablokov, N.; Barabash, V.; Ganenko, A.

    2000-01-01

    Proposing beryllium as plasma facing armour this paper presents the recent results obtained in Russia in the frame of such activities. Last year testing of actively cooled mock-ups produced by fast brazing of Be onto Cu-alloy heat sink allows to consider mentioned Russian method as promising for both PH-copper like CuCrZr and DS-copper like GlidCop. Summarizing recent experimental results with their previous data authors attempt to comparatively investigate a behaviour of Be/CuCrZr and Be/GlidCop joints in ITER relevant conditions. Mechanical properties, brazing zone microstructure and thermal response were taken for comparison. The shear strength for both types of joints was found as 150-200 MPa and did not depend on testing temperature. The brazing zone morphology and microhardness are presented, the thermal fatigue behaviour of investigated joints is described. All main results as well as the nearest future plans are discussed. (orig.)

  14. A Engenharia de Sistemas e a Gestão de Cops como Ferramentas da Gestão de Projetos Complexos na Área de TI

    Directory of Open Access Journals (Sweden)

    José Eduardo de Figueiredo Freitas

    2008-04-01

    Full Text Available The present work deals with a case study, in order to validate the application of two theories – Complex Products and Systems (CoPS and Systems Engineering– as modern tools for complex projects management in the Information Technology (IT field. In particular, it is intended to show the use of those tools for the parameters definition of a big Communications Network, in the project phase. The project of the Brazilian Army Corporate Communications Network (EBNet has been chosen as the object for the mentioned case study; one of the biggest networks of this nature in the country, an admittedly complex project. The project of the EBNet has been analyzed by the view point of Complex Systems - CoPS - and Systems Engineering theories, and we conclude by analyzing the validity of these theories as modern tools for the manager of complex projects in the IT field.

  15. A quantitative study of valence electron transfer in the skutterudite compound CoP3 by combining x-ray induced Auger and photoelectron spectroscopy

    International Nuclear Information System (INIS)

    Diplas, S; Prytz, Oe; Karlsen, O B; Watts, J F; Taftoe, J

    2007-01-01

    We use the sum of the ionization and Auger energy, the so-called Auger parameter, measured from the x-ray photoelectron spectrum, to study the valence electron distribution in the skutterudite CoP 3 . The electron transfer between Co and P was estimated using models relating changes in Auger parameter values to charge transfer. It was found that each P atom gains 0.24 e - , and considering the unit formula CoP 3 this is equivalent to a donation of 0.72 e - per Co atom. This is in agreement with a recent electron energy-loss spectroscopy study, which indicates a charge transfer of 0.77 e - /atom from Co to P

  16. Modulation of fatty acid synthase degradation by concerted action of p38 MAP kinase, E3 ligase COP1, and SH2-tyrosine phosphatase Shp2.

    Science.gov (United States)

    Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng

    2013-02-08

    The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.

  17. Methodologically Sound: Evaluating the Psychometric Approach to the Assessment of Human Life History [Reply to Copping, Campbell, and Muncer, 2014

    Science.gov (United States)

    Cabeza de Baca, Tomás; Black, Candace Jasmine; García, Rafael Antonio; Fernandes, Heitor Barcellos Ferreira; Wolf, Pedro Sofio Abril; Woodley of Menie, Michael Anthony

    2016-01-01

    Copping, Campbell, and Muncer (2014) have recently published an article critical of the psychometric approach to the assessment of life history (LH) strategy. Their purported goal was testing for the convergent validation and examining the psychometric structure of the High-K Strategy Scale (HKSS). As much of the literature on the psychometrics of human LH during the past decade or so has emanated from our research laboratory and those of close collaborators, we have prepared this detailed response. Our response is organized into four main sections: (1) A review of psychometric methods for the assessment of human LH strategy, expounding upon the essence of our approach; (2) our theoretical/conceptual concerns regarding the critique, addressing the broader issues raised by the critique regarding the latent and hierarchical structure of LH strategy; (3) our statistical/methodological concerns regarding the critique, examining the validity and persuasiveness of the empirical case made specifically against the HKSS; and (4) our recommendations for future research that we think might be helpful in closing the gap between the psychometric and biometric approaches to measurement in this area. Clearly stating our theoretical positions, describing our existing body of work, and acknowledgintheir limitations should assist future researchers in planning and implementing more informed and prudent empirical research that will synthesize the psychometric approach to the assessment of LH strategy with complementary methods. PMID:25844774

  18. Methodologically Sound: Evaluating the Psychometric Approach to the Assessment of Human Life History [Reply to Copping, Campbell, and Muncer, 2014

    Directory of Open Access Journals (Sweden)

    Aurelio José Figueredo

    2015-04-01

    Full Text Available Copping, Campbell, and Muncer (2014 have recently published an article critical of the psychometric approach to the assessment of life history (LH strategy. Their purported goal was testing for the convergent validation and examining the psychometric structure of the High-K Strategy Scale (HKSS. As much of the literature on the psychometrics of human LH during the past decade or so has emanated from our research laboratory and those of close collaborators, we have prepared this detailed response. Our response is organized into four main sections: (1 A review of psychometric methods for the assessment of human LH strategy, expounding upon the essence of our approach; (2 our theoretical/conceptual concerns regarding the critique, addressing the broader issues raised by the critique regarding the latent and hierarchical structure of LH strategy; (3 our statistical/methodological concerns regarding the critique, examining the validity and persuasiveness of the empirical case made specifically against the HKSS; and (4 our recommendations for future research that we think might be helpful in closing the gap between the psychometric and biometric approaches to measurement in this area. Clearly stating our theoretical positions, describing our existing body of work, and acknowledging their limitations should assist future researchers in planning and implementing more informed and prudent empirical research that will synthesize the psychometric approach to the assessment of LH strategy with complementary methods.

  19. Inositol hexakisphosphate (IP6) generated by IP5K mediates cullin-COP9 signalosome interactions and CRL function.

    Science.gov (United States)

    Scherer, Paul C; Ding, Yan; Liu, Zhiqing; Xu, Jing; Mao, Haibin; Barrow, James C; Wei, Ning; Zheng, Ning; Snyder, Solomon H; Rao, Feng

    2016-03-29

    The family of cullin-RING E3 Ligases (CRLs) and the constitutive photomorphogenesis 9 (COP9) signalosome (CSN) form dynamic complexes that mediate ubiquitylation of 20% of the proteome, yet regulation of their assembly/disassembly remains poorly understood. Inositol polyphosphates are highly conserved signaling molecules implicated in diverse cellular processes. We now report that inositol hexakisphosphate (IP6) is a major physiologic determinant of the CRL-CSN interface, which includes a hitherto unidentified electrostatic interaction between the N-terminal acidic tail of CSN subunit 2 (CSN2) and a conserved basic canyon on cullins. IP6, with an EC50 of 20 nM, acts as an intermolecular "glue," increasing cullin-CSN2 binding affinity by 30-fold, thereby promoting assembly of the inactive CRL-CSN complexes. The IP6 synthase, Ins(1,3,4,5,6)P5 2-kinase (IPPK/IP5K) binds to cullins. Depleting IP5K increases the percentage of neddylated, active Cul1 and Cul4A, and decreases levels of the Cul1/4A substrates p27 and p21. Besides dysregulating CRL-mediated cell proliferation and UV-induced apoptosis, IP5K depletion potentiates by 28-fold the cytotoxic effect of the neddylation inhibitor MLN4924. Thus, IP5K and IP6 are evolutionarily conserved components of the CRL-CSN system and are potential targets for cancer therapy in conjunction with MLN4924.

  20. Nitrate Reductases Are Relocalized to the Nucleus by AtSIZ1 and Their Levels Are Negatively Regulated by COP1 and Ammonium

    Directory of Open Access Journals (Sweden)

    Joo Yong Kim

    2018-04-01

    Full Text Available Nitrate reductases (NRs catalyze the first step in the reduction of nitrate to ammonium. NR activity is regulated by sumoylation through the E3 ligase activity of AtSIZ1. However, it is not clear how NRs interact with AtSIZ1 in the cell, or how nitrogen sources affect NR levels and their cellular localization. Here, we show that the subcellular localization of NRs is modulated by the E3 SUMO (Small ubiquitin-related modifier ligase AtSIZ1 and that NR protein levels are regulated by nitrogen sources. Transient expression analysis of GFP fusion proteins in onion epidermal cells showed that the NRs NIA1 and NIA2 localize to the cytoplasmic membrane, and that AtSIZ1 localizes to the nucleoplasm, including nuclear bodies, when expressed separately, whereas NRs and AtSIZ1 localize to the nucleus when co-expressed. Nitrate did not affect the subcellular localization of the NRs, but it caused AtSIZ1 to move from the nucleus to the cytoplasm. NRs were not detected in ammonium-treated cells, whereas the localization of AtSIZ1 was not altered by ammonium treatment. NR protein levels increased in response to nitrate but decreased in response to ammonium. In addition, NR protein levels increased in response to a 26S proteasome inhibitor and in cop1-4 and DN-COP1-overexpressing transgenic plants. NR protein degradation occurred later in cop1-4 than in the wild-type, although the NR proteins did not interact with COP1. Therefore, AtSIZ1 controls nuclear localization of NR proteins, and ammonium negatively regulates their levels. The function and stability of NR proteins might be post-translationally modulated by ubiquitination.

  1. An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

    Science.gov (United States)

    Branny, P; de la Torre, F; Garel, J R

    1998-04-01

    The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

  2. Induction of bacteriocin production by coculture is widespread among plantaricin-producing Lactobacillus plantarum strains with different regulatory operons.

    Science.gov (United States)

    Maldonado-Barragán, Antonio; Caballero-Guerrero, Belén; Lucena-Padrós, Helena; Ruiz-Barba, José Luis

    2013-02-01

    We describe the bacteriocin-production phenotype in a group of eight singular bacteriocinogenic Lactobacillus plantarum strains with three distinct genotypes regarding the plantaricin locus. Genotyping of these strains revealed the existence of two different plantaricin-production regulatory operons, plNC8-plNC8HK-plnD or plnABCD, involving three-component systems controlled each of them by a specific autoinducer peptide (AIP), i.e. PLNC8IF or PlnA. While all of the strains produced antimicrobial activity when growing on solid medium, most of them halted this production when cultured in broth, thus reflecting the functionality of regulatory mechanisms. Antimicrobial activity in broth cultures was re-established or enhanced when the specific AIP was added to the culture or by coculturing with specific bacterial strains. The latter trait appeared to be widespread in bacteriocinogenic L. plantarum strains independently of the regulatory system used to regulate bacteriocin production or the specific bacteriocins produced. The induction spectrum through coculture, i.e. the pattern of bacterial strains able to induce bacteriocin production, was characteristic of each individual L. plantarum strain. Also, the ability of some bacteria to induce bacteriocin production in L. plantarum by coculture appeared to be strain specific. The fact that induction of bacteriocin production by coculturing appeared to be a common feature in L. plantarum can be exploited accordingly to enhance the viability of this species in food and feed fermentations, as well as to contribute to probiotic functionality when colonising the gastrointestinal tract. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. An L-Fucose Operon in the Probiotic Lactobacillus rhamnosus GG Is Involved in Adaptation to Gastrointestinal Conditions.

    Science.gov (United States)

    Becerra, Jimmy E; Yebra, María J; Monedero, Vicente

    2015-06-01

    L-Fucose is a sugar present in human secretions as part of human milk oligosaccharides, mucins, and other glycoconjugates in the intestinal epithelium. The genome of the probiotic Lactobacillus rhamnosus GG (LGG) carries a gene cluster encoding a putative L-fucose permease (fucP), L-fucose catabolic pathway (fucI, fucK, fucU, and fucA), and a transcriptional regulator (fucR). The metabolism of L-fucose in LGG results in 1,2-propanediol production, and their fucI and fucP mutants displayed a severe and mild growth defect on L-fucose, respectively. Transcriptional analysis revealed that the fuc genes are induced by L-fucose and subject to a strong carbon catabolite repression effect. This induction was triggered by FucR, which acted as a transcriptional activator necessary for growth on L-fucose. LGG utilized fucosyl-α1,3-N-acetylglucosamine and contrarily to other lactobacilli, the presence of fuc genes allowed this strain to use the L-fucose moiety. In fucI and fucR mutants, but not in fucP mutant, L-fucose was not metabolized and it was excreted to the medium during growth on fucosyl-α1,3-N-acetylglucosamine. The fuc genes were induced by this fucosyl-disaccharide in the wild type and the fucP mutant but not in a fucI mutant, showing that FucP does not participate in the regulation of fuc genes and that L-fucose metabolism is needed for FucR activation. The l-fucose operon characterized here constitutes a new example of the many factors found in LGG that allow this strain to adapt to the gastrointestinal conditions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum

    Science.gov (United States)

    2012-01-01

    Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621

  5. Characterization of the biotin uptake system encoded by the biotin-inducible bioYMN operon of Corynebacterium glutamicum.

    Science.gov (United States)

    Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F

    2012-01-13

    The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.

  6. The XMM Cluster Outskirts Project (X-COP): Thermodynamic properties of the intracluster medium out to R200 in Abell 2319

    Science.gov (United States)

    Ghirardini, V.; Ettori, S.; Eckert, D.; Molendi, S.; Gastaldello, F.; Pointecouteau, E.; Hurier, G.; Bourdin, H.

    2018-06-01

    Aims: We present the joint analysis of the X-ray and Sunyaev-Zel'dovich (SZ) signals in Abell 2319, the galaxy cluster with the highest signal-to-noise ratio in SZ Planck maps and that has been surveyed within our XMM-Newton Cluster Outskirts Project (X-COP), a very large program which aims to grasp the physical condition in 12 local (z 3 × 1014 M⊙) galaxy clusters out to R200 and beyond. Methods: We recover the profiles of the thermodynamic properties by the geometrical deprojection of the X-ray surface brightness, of the SZ Comptonization parameter, and accurate and robust spectroscopic measurements of the gas temperature out to 3.2 Mpc (1.6 R200), 4 Mpc (2 R200), and 1.6 Mpc (0.8 R200), respectively. We resolve the clumpiness of the gas density to be below 20% over the entire observed volume. We also demonstrate that most of this clumpiness originates from the ongoing merger and can be associated with large-scale inhomogeneities (the "residual" clumpiness). We estimate the total mass through the hydrostatic equilibrium equation. This analysis is done both in azimuthally averaged radial bins and in eight independent angular sectors, enabling us to study in detail the azimuthal variance of the recovered properties. Results: Given the exquisite quality of the X-ray and SZ datasets, their radial extension, and their complementarity, we constrain at R200 the total hydrostatic mass, modelled with a Navarro-Frenk-White profile at very high precision (M200 = 10.7 ± 0.5stat. ± 0.9syst. × 1014 M⊙). We identify the ongoing merger and how it is affecting differently the gas properties in the resolved azimuthal sectors. We have several indications that the merger has injected a high level of non-thermal pressure in this system: the clumping free density profile is above the average profile obtained by stacking Rosat/PSPC observations; the gas mass fraction recovered using our hydrostatic mass profile exceeds the expected cosmic gas fraction beyond R500; the pressure

  7. Development and psychometric testing of the childhood obesity perceptions (COP) survey among African American caregivers: A tool for obesity prevention program planning.

    Science.gov (United States)

    Alexander, Dayna S; Alfonso, Moya L; Cao, Chunhua

    2016-12-01

    Currently, public health practitioners are analyzing the role that caregivers play in childhood obesity efforts. Assessing African American caregiver's perceptions of childhood obesity in rural communities is an important prevention effort. This article's objective is to describe the development and psychometric testing of a survey tool to assess childhood obesity perceptions among African American caregivers in a rural setting, which can be used for obesity prevention program development or evaluation. The Childhood Obesity Perceptions (COP) survey was developed to reflect the multidimensional nature of childhood obesity including risk factors, health complications, weight status, built environment, and obesity prevention strategies. A 97-item survey was pretested and piloted with the priority population. After pretesting and piloting, the survey was reduced to 59-items and administered to 135 African American caregivers. An exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) was conducted to test how well the survey items represented the number of Social Cognitive Theory constructs. Twenty items were removed from the original 59-item survey and acceptable internal consistency of the six factors (α=0.70-0.85) was documented for all scales in the final COP instrument. CFA resulted in a less than adequate fit; however, a multivariate Lagrange multiplier test identified modifications to improve the model fit. The COP survey represents a promising approach as a potentially comprehensive assessment for implementation or evaluation of childhood obesity programs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Report on the survey in fiscal 1998. Evaluation by the industry on the result of COP3 and the future activities in relation with the result of COP3 (Canada); 1998 nendo chosa hokokusho. COP3 no kekka ni taisuru sangyokai no hyoka oyobi kongo no taio ni tsuite (Canada)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    A survey was carried out on activities in Canada in relation with COP3. The Office of Energy Efficiency is promoting the energy efficiency improvement and substituting energy plan applicable to housings, commercial and manufacturing industries, public organizations and transportation department. It is also implementing a comprehensive plan incorporating consumer information, national energy utilization data base, and energy technology innovation initiative. The energy technology innovation plus plan strengthens coordination with industrial societies in each sector, and makes finances for improvement of energy efficiency. There is also an institution to promote energy efficiency improvement in newly built houses. The manufacturing industry energy technology innovation initiative is an institution to present means to transfer pledges in each department into a company-wide activity. In the energy conservation encouragement plan for commercial buildings, an annual federal fund of ten million dollars is allotted, and incentive money is paid. The automotive fuel consumption enhancement plan provides purchasers with fuel consumption information, and encourages production of energy saving cars. The substituting transportation fuel market developing initiative promotes development and utilization of methanol, ethanol, hydrogen, and electric power. (NEDO)

  9. MdCOP1 Ubiquitin E3 Ligases Interact with MdMYB1 to Regulate Light-Induced Anthocyanin Biosynthesis and Red Fruit Coloration in Apple1[W][OA

    Science.gov (United States)

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2012-01-01

    MdMYB1 is a crucial regulator of light-induced anthocyanin biosynthesis and fruit coloration in apple (Malus domestica). In this study, it was found that MdMYB1 protein accumulated in the light but degraded via a ubiquitin-dependent pathway in the dark. Subsequently, the MdCOP1-1 and MdCOP1-2 genes were isolated from apple fruit peel and were functionally characterized in the Arabidopsis (Arabidopsis thaliana) cop1-4 mutant. Yeast (Saccharomyces cerevisiae) two-hybrid, bimolecular fluorescence complementation, and coimmunoprecipitation assays showed that MdMYB1 interacts with the MdCOP1 proteins. Furthermore, in vitro and in vivo experiments indicated that MdCOP1s are necessary for the ubiquitination and degradation of MdMYB1 protein in the dark and are therefore involved in the light-controlled stability of the MdMYB1 protein. Finally, a viral vector-based transformation approach demonstrated that MdCOP1s negatively regulate the peel coloration of apple fruits by modulating the degradation of the MdMYB1 protein. Our findings provide new insight into the mechanism by which light controls anthocyanin accumulation and red fruit coloration in apple and even other plant species. PMID:22855936

  10. Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

    Science.gov (United States)

    Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

    2014-11-01

    The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.