
Sample records for conventional tissue culture

  1. Plant tissue culture techniques

    Directory of Open Access Journals (Sweden)

    Rolf Dieter Illg


    Full Text Available Plant cell and tissue culture in a simple fashion refers to techniques which utilize either single plant cells, groups of unorganized cells (callus or organized tissues or organs put in culture, under controlled sterile conditions.

  2. Plant Tissue Culture

    Indian Academy of Sciences (India)


    Plant tissue culture is a technique of culturing plant cells, tissues and organs on ... working methods (Box 2) and discovery of the need for B vita- mins and auxins for ... Kotte (Germany) reported some success with growing isolated root tips.

  3. The plant tissue culture

    International Nuclear Information System (INIS)

    Crocomo, O.J.; Sharp, W.R.


    Progress in the field of plant tissue culture at the Plant Biochemistry Sector, Centro de Energia na Agricultura (CENA), Piracicaba, S.P., Brazil, pertains to the simplification of development in 'Phaseolus vulgaris' by dividing the organism into its component organs, tissues, and cells and the maintenance of these components on defined culture media 'in vitro'. This achievement has set the stage for probing the basis for the stability of the differentiated states and/or the reentry of mature differentiated cells into the mitotic cell cycle and their subsequent redifferentiation. Data from such studies at the cytological and biochemical level have been invaluable in the elucidation of the control mechanisms responsible for expression of the cellular phenotype. Unlimited possibilities exist for the application of tissue culture in the vegetative propagation of 'Phaseolus' and other important cultivars in providing genocopies or a large scale and/or readily obtaining plantlets from haploid cell lines or from protoplast (wall-less cells) hybridization products following genetic manipulation. These tools are being applied in this laboratory for the development and selection of high protein synthesizing 'Phaseolus' cultivars

  4. Culture: copying, compression, and conventionality. (United States)

    Tamariz, Mónica; Kirby, Simon


    Through cultural transmission, repeated learning by new individuals transforms cultural information, which tends to become increasingly compressible (Kirby, Cornish, & Smith, ; Smith, Tamariz, & Kirby, ). Existing diffusion chain studies include in their design two processes that could be responsible for this tendency: learning (storing patterns in memory) and reproducing (producing the patterns again). This paper manipulates the presence of learning in a simple iterated drawing design experiment. We find that learning seems to be the causal factor behind the increase in compressibility observed in the transmitted information, while reproducing is a source of random heritable innovations. Only a theory invoking these two aspects of cultural learning will be able to explain human culture's fundamental balance between stability and innovation. Copyright © 2014 Cognitive Science Society, Inc.

  5. Tissue culture of ornamental cacti

    Directory of Open Access Journals (Sweden)

    Eugenio Pérez-Molphe-Balch


    Full Text Available Cacti species are plants that are well adapted to growing in arid and semiarid regions where the main problem is water availability. Cacti have developed a series of adaptations to cope with water scarcity, such as reduced leaf surface via morphological modifications including spines, cereous cuticles, extended root systems and stem tissue modifications to increase water storage, and crassulacean acid metabolism to reduce transpiration and water loss. Furthermore, seeds of these plants very often exhibit dormancy, a phenomenon that helps to prevent germination when the availability of water is reduced. In general, cactus species exhibit a low growth rate that makes their rapid propagation difficult. Cacti are much appreciated as ornamental plants due to their great variety and diversity of forms and their beautiful short-life flowers; however, due to difficulties in propagating them rapidly to meet market demand, they are very often over-collected in their natural habitats, which leads to numerous species being threatened, endangered or becoming extinct. Therefore, plant tissue culture techniques may facilitate their propagation over a shorter time period than conventional techniques used for commercial purposes; or may help to recover populations of endangered or threatened species for their re-introduction in the wild; or may also be of value to the preservation and conservation of the genetic resources of this important family. Herein we present the state-of-the-art of tissue culture techniques used for ornamental cacti and selected suggestions for solving a number of the problems faced by members of the Cactaceae family.

  6. Culture of insect tissues

    International Nuclear Information System (INIS)

    Cestari, A.N.; Simoes, L.C.G.


    Several aspects are discussed related to the behavior of politenic chromosomes from Rhyncosciara salivary glands kept in culture during different periods of time, without interference of insect hormones. Nucleic acid-and protein synthesis in isolated nuclei and chromosomes are also investigated. Autoradiographic techniques and radioactive precursors for nucleic acids and proteins are used in the research. (M.A.) [pt

  7. Biotransformations with plant tissue cultures. (United States)

    Carew, D P; Bainbridge, T


    Suspension cultures of Catharanthus roseus, Apocynum cannabinum and Conium maculatum were examined for their capacity to transform aniline, anisole, acetanilide, benzoic acid and coumarin. None of the cultures transformed acetanilide but each produced acetanilide when fed aniline. All three cultures converted benzoic acid to its para-hydroxy derivative. Coumarin was selectively hydroxylated at the 7-position by Catharanthus and Conium and anisole was O-demethylated only by older Catharanthus tissue.

  8. Epigenetics in plant tissue culture

    NARCIS (Netherlands)

    Smulders, M.J.M.; Klerk, de G.J.M.


    Plants produced vegetatively in tissue culture may differ from the plants from which they have been derived. Two major classes of off-types occur: genetic ones and epigenetic ones. This review is about epigenetic aberrations. We discuss recent studies that have uncovered epigenetic modifications at

  9. Gastric tissue biopsy and culture (United States)

    ... symptoms may include: Loss of appetite or weight loss Nausea and vomiting Pain in the upper part of the belly Black stools Vomiting blood or coffee ground-like material A gastric tissue biopsy and culture can help detect: Cancer Infections, most commonly Helicobacter ...

  10. Laboratory Workflow Analysis of Culture of Periprosthetic Tissues in Blood Culture Bottles. (United States)

    Peel, Trisha N; Sedarski, John A; Dylla, Brenda L; Shannon, Samantha K; Amirahmadi, Fazlollaah; Hughes, John G; Cheng, Allen C; Patel, Robin


    Culture of periprosthetic tissue specimens in blood culture bottles is more sensitive than conventional techniques, but the impact on laboratory workflow has yet to be addressed. Herein, we examined the impact of culture of periprosthetic tissues in blood culture bottles on laboratory workflow and cost. The workflow was process mapped, decision tree models were constructed using probabilities of positive and negative cultures drawn from our published study (T. N. Peel, B. L. Dylla, J. G. Hughes, D. T. Lynch, K. E. Greenwood-Quaintance, A. C. Cheng, J. N. Mandrekar, and R. Patel, mBio 7:e01776-15, 2016,, and the processing times and resource costs from the laboratory staff time viewpoint were used to compare periprosthetic tissues culture processes using conventional techniques with culture in blood culture bottles. Sensitivity analysis was performed using various rates of positive cultures. Annualized labor savings were estimated based on salary costs from the U.S. Labor Bureau for Laboratory staff. The model demonstrated a 60.1% reduction in mean total staff time with the adoption of tissue inoculation into blood culture bottles compared to conventional techniques (mean ± standard deviation, 30.7 ± 27.6 versus 77.0 ± 35.3 h per month, respectively; P < 0.001). The estimated annualized labor cost savings of culture using blood culture bottles was $10,876.83 (±$337.16). Sensitivity analysis was performed using various rates of culture positivity (5 to 50%). Culture in blood culture bottles was cost-effective, based on the estimated labor cost savings of $2,132.71 for each percent increase in test accuracy. In conclusion, culture of periprosthetic tissue in blood culture bottles is not only more accurate than but is also cost-saving compared to conventional culture methods. Copyright © 2017 American Society for Microbiology.

  11. Walnut tissue culture: research and field applications (United States)


    Vitrotech Biotecnologia Vegetal began researching propagating Juglans regia (English walnut) and various Juglans hybrids by tissue culture in 1993 and has operated on a commercial scale since 1996. Since this time, more than one and a half million walnuts of different species have been propagated and field planted. Tissue cultured...

  12. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi


    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  13. Blood culture bottles are superior to conventional media for vitreous culture. (United States)

    Thariya, Patsuda; Yospaiboon, Yosanan; Sinawat, Suthasinee; Sanguansak, Thuss; Bhoomibunchoo, Chavakij; Laovirojjanakul, Wipada


    To compare blood culture bottles and conventional media for the vitreous culture in patients with clinically suspected infectious endophthalmitis. Retrospective comparative study at KKU Eye Center, Khon Kaen University. There were 342 patients with clinically suspected infectious endophthalmitis participated in the study. The vitreous specimens were inoculated in both blood culture bottles and on conventional culture media (blood agar, MacConkey agar, chocolate agar, Sabouraud dextrose agar and thioglycolate broth). The number of positive culture yields in both blood culture bottles and conventional media. Positive culture yields in both methods were found in 151 eyes (49.5%). There were 136 of 151 eyes (90.1%) with positive culture in blood culture bottles, whereas 99 of 151 eyes (65.6%) yielded positive cultures in conventional media. These findings were different with a statistical significance (P culture bottles and conventional media improved the yield. Blood culture bottles are superior to conventional media for vitreous culture in clinically suspected infectious endophthalmitis. Vitreous culture using blood culture bottles should be recommended as the primary method for microbiological diagnosis. A combination of both methods further improves the positive culture yield. © 2016 Royal Australian and New Zealand College of Ophthalmologists.

  14. Progress in planta transformation without tissue culture

    International Nuclear Information System (INIS)

    Gu Yunhong; Chinese Academy of Sciences, Hefei; Qin Guangyong; Huo Yuping; Yu Zengliang


    With the development of planta genetic engineering, more emphases have been laid on convenient and high efficient genetic transformation methods. And transformation without tissue culture is a prospective direction of it. In this paper, traditional transformation methods and the methods of non-tissue culture were summarized. With the exploration and application of Arabidopsis transformation mechanism, with the use of ion beam-mediated transformation invented by Chinese scientists and the development of other transformation methods, transformation methods without tissue culture and planta genetic engineering could be improved rapidly. (authors)

  15. Propagation of Aquilaria malaccensis seedlings through tissue culture techniques

    International Nuclear Information System (INIS)

    Salahbiah Abdul Majid; Zaiton Ahmad; Mohd Rafaie Abdul Salam; Nurhayati Irwan; Affrida Abu Hassan; Rusli Ibrahim


    Aquilaria malaccensis or karas is the principal source of gaharu resin, which is used in many cultures for incense, perfumes and traditional medicines. The species is mainly propagated conventionally through seeds, cuttings and graftings. Propagation by seeds is usually a reliable method for other forest species, but for karas, this technique is inadequate to meet the current demand of seedling supplies. This is principally due to its low seed viability, low germination rate, delayed rooting of seedlings, long life-cycle and rare seed production. Tissue culture has several advantages over conventional propagation, especially for obtaining large number of uniform and high-yielding plantlets or clones. This paper presents the current progress on mass-propagation of Aquilaria malaccensis seedlings through tissue culture technique at Nuclear Malaysia. (author)

  16. Yield improvement strategies for the production of secondary metabolites in plant tissue culture: silymarin from Silybum marianum tissue culture. (United States)

    AbouZid, S


    Plant cell culture can be a potential source for the production of important secondary metabolites. This technology bears many advantages over conventional agricultural methods. The main problem to arrive at a cost-effective process is the low productivity. This is mainly due to lack of differentiation in the cultured cells. Many approaches have been used to maximise the yield of secondary metabolites produced by cultured plant cells. Among these approaches: choosing a plant with a high biosynthetic capacity, obtaining efficient cell line for growth and production of metabolite of interest, manipulating culture conditions, elicitation, metabolic engineering and organ culture. This article gives an overview of the various approaches used to maximise the production of pharmaceutically important secondary metabolites in plant cell cultures. Examples of using these different approaches are shown for the production of silymarin from Silybum marianum tissue culture.

  17. Mitigating the Cultural Challenges of SOF/Conventional Force Interdependence (United States)


    Cultural Challenges of SOF / Conventional Force Interdependence 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...January 16, 2013. 31 Daniel French , “Integration of General Purpose Forces and Army Special Operations,” 1. 32 Edward L. Cardon , “Recognizing

  18. Study on tissue culture for Gelidium seedling (United States)

    Pei, Lu-Qing; Luo, Qi-Jun; Fei, Zhi-Qing; Ma, Bin


    As seedling culture is a crucial factor for successful cultivation of Gelidium, the authors researched tissue culture technology for producing seedlings. The morphogeny and experimental ecology were observed and studied fully in 2 5 mm isolated tissue fragments. Regeneration, appearance of branching creepers and attaching structure and new erect seedlings production and development were studied. Fragments were sown on bamboo slice and vinylon rope. The seedlings were cultured 20 30 days indoor, then cultured in the sea, where the density of erect seedlings was 3 19 seedlings/cm2, growth rate was 3.84% day. The frond arising from seedlings directly was up to 10 cm per year. The ecological conditions for regenerated seedlings are similar to the natural ones. The regenerated seedlings are suitable for raft culture in various sea areas.

  19. Adult soft tissue sarcomas: conventional therapies and molecularly targeted approaches. (United States)

    Mocellin, Simone; Rossi, Carlo R; Brandes, Alba; Nitti, Donato


    The therapeutic approach to soft tissue sarcomas (STS) has evolved over the past two decades based on the results from randomized controlled trials, which are guiding physicians in the treatment decision-making process. Despite significant improvements in the control of local disease, a significant number of patients ultimately die of recurrent/metastatic disease following radical surgery due to a lack of effective adjuvant treatments. In addition, the characteristic chemoresistance of STS has compromised the therapeutic value of conventional antineoplastic agents in cases of unresectable advanced/metastatic disease. Therefore, novel therapeutic strategies are urgently needed to improve the prognosis of patients with STS. Recent advances in STS biology are paving the way to the development of molecularly targeted therapeutic strategies, the efficacy of which relies not only on the knowledge of the molecular mechanisms underlying cancer development/progression but also on the personalization of the therapeutic regimen according to the molecular features of individual tumours. In this work, we review the state-of-the-art of conventional treatments for STS and summarize the most promising findings in the development of molecularly targeted therapeutic approaches.

  20. The autologus graft of epithelial tissue culture

    Directory of Open Access Journals (Sweden)

    Minaee B


    Full Text Available With the intention of research about culture and autologus graft of epithelial tissue we used 4 french Albino Rabbits with an average age of 2 months. After reproduction on the support in EMEM (Eagle's Minimum Essential Medium we used this for graft after 4 weeks. This region which grafted total replaced. After fixation of this sample and passing them through various process, histological sections were prepared. These sections were stained with H & E and masson's trichrome and studied by light microscope. We succeeded in graft. We hope in the near future by using the method of epithelium tissue culture improving to treat burned patients.

  1. Substituted Indoleacetic Acids Tested in Tissue Cultures

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen


    Monochloro substituted IAA inhibited shoot induction in tobacco tissue cultures about as much as IAA. Dichloro substituted IAA inhibited shoot formation less. Other substituted IAA except 5-fluoro- and 5-bromoindole-3-acetic acid were less active than IAA. Callus growth was quite variable...

  2. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...

  3. Shortening of culture time in conventional cytogenetic dosimetry

    International Nuclear Information System (INIS)

    Lamadrid, Ana I.; Gonzalez, Jorge E.; Romero, Ivonne; Garcia, Omar; Roy, Laurence


    Conventional cytogenetic dosimetry based on chromosome aberration in metaphases is a 'gold standard' of bio-dosimetry techniques for radiation dose assessment. This method is laborious and time consuming, the culturing process requires about 48 hours to obtain a satisfactory number of lymphocytes in mitosis. The current approach to reduce the dose estimation time by cytogenetic dosimetry is the preliminary estimation of dose counting only 50 metaphases. Another possibility is to reduce the culture time. The possibility of reduce the culture time under 48 hours adding Calyculin A has been suggested recently. In the present study we tested shorter times using Calyculin A and considering the G2/M-PCC index as culture quality indicator. Peripheral blood from healthy individuals was irradiated and then maintained at 37 C degrees for 2 hours allowing to act the cellular reparation mechanisms, lymphocytes were culture in RPMI 1640 supplemented with foetal calf serum and phytohemagglutinin. Colcemid was added 24 hours after cultures started and Calyculin A was added for the last hour. The cells were collected by centrifugation between 30 to 48 hours. The cells were treated with a hypotonic solution and the fixed cells dropped onto slides. The slides were stained with Giemsa. The incidence of metaphases with chromosomes well defined was scored. Two operators participated to the scoring according the same criteria. The results were analyzed to comparing the G2/M-PCC index relatives to achieve the shortest culture duration. The culture time reduction to 40 hours gives enough G2/M-PCC cells for dose estimation analysis. Lower culture times produced very low G2/M-PCC index. (author)

  4. Improved Diagnosis of Prosthetic Joint Infection by Culturing Periprosthetic Tissue Specimens in Blood Culture Bottles

    Directory of Open Access Journals (Sweden)

    Trisha N. Peel


    Full Text Available Despite known low sensitivity, culture of periprosthetic tissue specimens on agars and in broths is routine. Culture of periprosthetic tissue samples in blood culture bottles (BCBs is potentially more convenient, but it has been evaluated in a limited way and has not been widely adopted. The aim of this study was to compare the sensitivity and specificity of inoculation of periprosthetic tissue specimens into blood culture bottles with standard agar and thioglycolate broth culture, applying Bayesian latent class modeling (LCM in addition to applying the Infectious Diseases Society of America (IDSA criteria for prosthetic joint infection. This prospective cohort study was conducted over a 9-month period (August 2013 to April 2014 at the Mayo Clinic, Rochester, MN, and included all consecutive patients undergoing revision arthroplasty. Overall, 369 subjects were studied; 117 (32% met IDSA criteria for prosthetic joint infection, and 82% had late chronic infection. Applying LCM, inoculation of tissues into BCBs was associated with a 47% improvement in sensitivity compared to the sensitivity of conventional agar and broth cultures (92.1 versus 62.6%, respectively; this magnitude of change was similar when IDSA criteria were applied (60.7 versus 44.4%, respectively; P = 0.003. The time to microorganism detection was shorter with BCBs than with standard media (P < 0.0001, with aerobic and anaerobic BCBs yielding positive results within a median of 21 and 23 h, respectively. Results of our study demonstrate that the semiautomated method of periprosthetic tissue culture in blood culture bottles is more sensitive than and as specific as agar and thioglycolate broth cultures and yields results faster.

  5. Tissue culture as a plant production technique for horticultural crops ...

    African Journals Online (AJOL)

    Over 100 years ago, Haberlandt envisioned the concept of plant tissue culture and provided the groundwork for the cultivation of plant cells, tissues and organs in culture. Initially plant tissue cultures arose as a research tool and focused on attempts to culture and study the development of small, isolated cells and segments ...

  6. Gastrointestinal Epithelial Organoid Cultures from Postsurgical Tissues. (United States)

    Hahn, Soojung; Yoo, Jongman


    An organoid is a cellular structure three-dimensionally (3D) cultured from self-organizing stem cells in vitro, which has a cell population, architectures, and organ specific functions like the originating organs. Recent advances in the 3D culture of isolated intestinal crypts or gastric glands have enabled the generation of human gastrointestinal epithelial organoids. Gastrointestinal organoids recapitulate the human in vivo physiology because of all the intestinal epithelial cell types that differentiated and proliferated from tissue resident stem cells. Thus far, gastrointestinal organoids have been extensively used for generating gastrointestinal disease models. This protocol describes the method of isolating a gland or crypt using stomach or colon tissue after surgery and establishing them into gastroids or colonoids.

  7. Tissue culture of surgically prepared temporalis fascia. (United States)

    Walby, A P; Kerr, A G; Nevin, N C; Woods, G


    Temporalis fascia which is used to graft the tympanic membrane has been shown to be viable in tissue culture by a previous pilot study. This present study reports the effect on the viability of the fascia by scraping loose connective tissue from it and allowing it to dry. Pieces of fascia from 30 patients were each divided in 4 and prepared to give explants, fresh, fresh and scraped, dried, and dried and scraped. The fascia grew from 17 patients when cultured fresh, 5 when fresh and scraped, 1 when dried, and none when dried and scraped. These results are significantly different and show that the fascia is devitilized when prepared by the normal method for use in tympanoplasty.

  8. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma. (United States)

    Palmini, Gaia; Zonefrati, Roberto; Mavilia, Carmelo; Aldinucci, Alessandra; Luzi, Ettore; Marini, Francesca; Franchi, Alessandro; Capanna, Rodolfo; Tanini, Annalisa; Brandi, Maria Luisa


    The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

  9. Disability, culture and the U.N. convention. (United States)

    Bickenbach, Jerome E


    Is the universality of human rights, such as those set out in the United Nations Convention on the Rights of Persons with Disabilities, incompatible with therapeutic strategies of respecting cultural differences? I show that universalism is essential to the notion of human rights, as well as the rarely explained, political slogan of 'the rights approach to disability'. Similarly, culture responsiveness is commonly defended by therapists. I argue that the conflict between universalism of rights and cultural sensitivity exist only if these positions are expressed in extreme form: rights absolutism and cultural relativity. If more sensibly spelled out--in the form of progressive realisation of rights and situational sensitivity of difference--there is no conflict at all. Indeed, these more reasonable positions are mutually supportive. I conclude that, given resource and other constraints, the realisation of human rights will always be a matter of political negotiation, and that a social commitment to equality demands that we ensure that only transparent, fully-informed and fully-participatory procedures, respectful of difference [are employed]. These principles should guide us when we have to make hard choices in the implementation of human rights.

  10. Improved Diagnosis of Prosthetic Joint Infection by Culturing Periprosthetic Tissue Specimens in Blood Culture Bottles. (United States)

    Peel, Trisha N; Dylla, Brenda L; Hughes, John G; Lynch, David T; Greenwood-Quaintance, Kerryl E; Cheng, Allen C; Mandrekar, Jayawant N; Patel, Robin


    Despite known low sensitivity, culture of periprosthetic tissue specimens on agars and in broths is routine. Culture of periprosthetic tissue samples in blood culture bottles (BCBs) is potentially more convenient, but it has been evaluated in a limited way and has not been widely adopted. The aim of this study was to compare the sensitivity and specificity of inoculation of periprosthetic tissue specimens into blood culture bottles with standard agar and thioglycolate broth culture, applying Bayesian latent class modeling (LCM) in addition to applying the Infectious Diseases Society of America (IDSA) criteria for prosthetic joint infection. This prospective cohort study was conducted over a 9-month period (August 2013 to April 2014) at the Mayo Clinic, Rochester, MN, and included all consecutive patients undergoing revision arthroplasty. Overall, 369 subjects were studied; 117 (32%) met IDSA criteria for prosthetic joint infection, and 82% had late chronic infection. Applying LCM, inoculation of tissues into BCBs was associated with a 47% improvement in sensitivity compared to the sensitivity of conventional agar and broth cultures (92.1 versus 62.6%, respectively); this magnitude of change was similar when IDSA criteria were applied (60.7 versus 44.4%, respectively; P = 0.003). The time to microorganism detection was shorter with BCBs than with standard media (P Prosthetic joint infections are a devastating complication of arthroplasty surgery. Despite this, current microbiological techniques to detect and diagnose infections are imperfect. This study examined a new approach to diagnosing infections, through the inoculation of tissue samples from around the prosthetic joint into blood culture bottles. This study demonstrated that, compared to current laboratory practices, this new technique increased the detection of infection. These findings are important for patient care to allow timely and accurate diagnosis of infection. Copyright © 2016 Peel et al.

  11. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha


    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  12. Smallholder adoption and economic impacts of tissue culture ...

    African Journals Online (AJOL)

    This study was conducted with an objective of determining the correlates of adoption of tissue culture banana technology and its impacts on household incomes in Kenya. The results show that while some households have opted not to adopt tissue culture banana biotechnology, almost all the adopters are growing tissue ...

  13. Citrus tissue culture employing vegetative explants. (United States)

    Chaturvedi, H C; Singh, S K; Sharma, A K; Agnihotri, S


    Citrus being a number one fruit of the world due to its high nutritional value, huge production of fruits and fruit products, the citrus industry may be considered a major fruit industry. Though citrus orchard area in India is comparable to USA, the produce is far less, while its export is nil. Biotechnology has played an outstanding role in boosting the citrus industry, e.g., in Spain, which is now the biggest exporter of citrus fruit with the application of micrografting. Amongst the fruit trees, perhaps the maximum tissue culture research has been done in citrus during the past four decades, however, the results of practical value are meagre. The shortfalls in citrus tissue culture research and some advancements made in this direction along with bright prospects are highlighted, restricting the review to vegetative explants only. Whilst utilization of nucellar embryogenesis is limited to rootstocks, the other aspects, like, regeneration and proliferation of shoot meristems measuring 200 microm in length--a global breakthrough--of two commercially important scion species, Citrus aurantifolia and C. sinensis and an important rootstock, C. limonia, improvement of micrografting technique, cloning of the same two scion species as well as some Indian rootstock species, employing nodal stem segments of mature trees, of immense practical value have been elaborated. A rare phenomenon of shift in the morphogenetic pattern of differentiation from shoot bud differentiation to embryoid formation occurred during the long-term culture of stem callus of C. grandis. Stem callus-regenerated plants of C. aurantifolia, C. sinensis and C. grandis showed variation in their ploidy levels and a somaclonal variant of C. sinensis, which produced seedless fruits was isolated. Tailoring of rooting in microshoots to a tap root-like system by changing the inorganic salt composition of the rooting medium, resulting in 100% transplant success, and germplasm preservation through normal growth

  14. [Chromosome variability in the tissue culture of rare Gentiana species]. (United States)

    Tvardovs'ka, M O; Strashniuk, N M; Mel'nyk, V M; Adonin, V I; Kunakh, V A


    Cytogenetic analysis of plants and tissue culture of Gentiana lutea, G. punctata, G. acaulis has been carried out. Culturing in vitro was found to result in the changes of chromosome number in the calluses of the species involved. Species specificity for variation of the cultured cell genomes was shown. Contribution of the original plant genotypes to the cytogenetic structure of the tissue culture was established. Gentiana callus tissues (except for in vitro culture of G. punctata, derived from plant of Breskul'ska population) were found to exhibit modal class with the cells of diploid and nearly diploid chromosome sets.

  15. Versatile electrochemial sensor for tissue culturing and sample handling

    DEFF Research Database (Denmark)

    Bakmand, Tanya; Kwasny, Dorota; Al Atraktchi, Fatima Al-Zahraa


    Culturing of organtypic brain tissues is a routine procedure in neural research. The visual inspection of the medium is the only way of determining the state of the tissue. At the end of culturing, post-processing techniques such as HPLC can be used to measure the concentration of the secreted...

  16. Cost-effective nutrient sources for tissue culture of cassava ( Manihot ...

    African Journals Online (AJOL)

    Application of tissue culture technology is constrained by high costs making seedlings unaffordable. The objective of this study was to evaluate the possibility of using locally available fertilizers as alternative nutrient sources for cassava micropropagation. A Low Cost Medium (LCM) whereby the conventional sources of four ...

  17. Effect of lunar materials on plant tissue culture. (United States)

    Walkinshaw, C. H.; Venketeswaran, S.; Baur, P. S.; Croley, T. E.; Scholes, V. E.; Weete, J. D.; Halliwell, R. S.; Hall, R. H.


    Lunar material collected during the Apollo 11, 12, 14, and 15 missions has been used to treat 12 species of higher plant tissue cultures. Biochemical and morphological studies have been conducted on several of these species. Tobacco tissue cultures treated with 0.22 g of lunar material exhibited increased greening more complex chloroplasts, less cytoplasmic vacuolation and greater vesiculation. Pine tissue cultures reacted to treatment by an increased deposition of tannin-like materials. The percentage of dry weight and soluble protein was increased in cultures treated with either lunar or terrestrial rock materials.

  18. The study of cultural objects by nuclear and conventional techniques

    International Nuclear Information System (INIS)

    Palacios, Tulio A.


    A survey is given of the techniques that are used at the National Atomic Energy Commission of Argentina for the characterization and study of cultural and archaeological specimens. A short history of these activities is also given. (author)

  19. Application of Hanging Drop Technique for Kidney Tissue Culture. (United States)

    Wang, Shaohui; Wang, Ximing; Boone, Jasmine; Wie, Jin; Yip, Kay-Pong; Zhang, Jie; Wang, Lei; Liu, Ruisheng


    The hanging drop technique is a well-established method used in culture of animal tissues. However, this method has not been used in adult kidney tissue culture yet. This study was to explore the feasibility of using this technique for culturing adult kidney cortex to study the time course of RNA viability in the tubules and vasculature, as well as the tissue structural integrity. In each Petri dish with the plate covered with sterile buffer, a section of mouse renal cortex was cultured within a drop of DMEM culture medium on the inner surface of the lip facing downward. The tissue were then harvested at each specific time points for Real-time PCR analysis and histological studies. The results showed that the mRNA level of most Na+ related transporters and cotransporters were stably maintained within 6 hours in culture, and that the mRNA level of most receptors found in the vasculature and glomeruli were stably maintained for up to 9 days in culture. Paraffin sections of the cultured renal cortex indicated that the tubules began to lose tubular integrity after 6 hours, but the glomeruli and vasculatures were still recognizable up to 9 days in culture. We concluded that adult kidney tissue culture by hanging drop method can be used to study gene expressions in vasculature and glomeruli. © 2017 The Author(s). Published by S. Karger AG, Basel.

  20. Application of Hanging Drop Technique for Kidney Tissue Culture

    Directory of Open Access Journals (Sweden)

    Shaohui Wang


    Full Text Available Background/Aims: The hanging drop technique is a well-established method used in culture of animal tissues. However, this method has not been used in adult kidney tissue culture yet. This study was to explore the feasibility of using this technique for culturing adult kidney cortex to study the time course of RNA viability in the tubules and vasculature, as well as the tissue structural integrity. Methods: In each Petri dish with the plate covered with sterile buffer, a section of mouse renal cortex was cultured within a drop of DMEM culture medium on the inner surface of the lip facing downward. The tissue were then harvested at each specific time points for Real-time PCR analysis and histological studies. Results: The results showed that the mRNA level of most Na+ related transporters and cotransporters were stably maintained within 6 hours in culture, and that the mRNA level of most receptors found in the vasculature and glomeruli were stably maintained for up to 9 days in culture. Paraffin sections of the cultured renal cortex indicated that the tubules began to lose tubular integrity after 6 hours, but the glomeruli and vasculatures were still recognizable up to 9 days in culture. Conclusions: We concluded that adult kidney tissue culture by hanging drop method can be used to study gene expressions in vasculature and glomeruli.

  1. Ex vivo culture of patient tissue & examination of gene delivery.

    LENUS (Irish Health Repository)

    Rajendran, Simon


    This video describes the use of patient tissue as an ex vivo model for the study of gene delivery. Fresh patient tissue obtained at the time of surgery is sliced and maintained in culture. The ex vivo model system allows for the physical delivery of genes into intact patient tissue and gene expression is analysed by bioluminescence imaging using the IVIS detection system. The bioluminescent detection system demonstrates rapid and accurate quantification of gene expression within individual slices without the need for tissue sacrifice. This slice tissue culture system may be used in a variety of tissue types including normal and malignant tissue and allows us to study the effects of the heterogeneous nature of intact tissue and the high degree of variability between individual patients. This model system could be used in certain situations as an alternative to animal models and as a complementary preclinical mode prior to entering clinical trial.

  2. Comparing the 810nm diode laser with conventional surgery in orthodontic soft tissue procedures. (United States)

    Ize-Iyamu, I N; Saheeb, B D; Edetanlen, B E


    To compare the use of the 810nm diode laser with conventional surgery in the management of soft tissue mucogingival problems associated with orthodontic treatment. Orthodontic patients requiring different soft tissue surgical procedures were randomly assigned to receive conventional surgery or soft tissue diode laser, (wavelength 810 nm). Parameters documented include the type of anaesthesia used, intra and post operative pain, bleeding, the use of scalpel and sutures. The chi-squared test was used to test for significance at 95% confidence level. Probability values (p-values) less than 0.05 were regarded as significant. Only 2(16.7%) of the procedures carried out with the soft tissue laser required infiltration anaesthesia compared to 10 (90.9%) with conventional surgery and this was significant (Pdiode laser (Pdiode laser. No sutures were used in all soft tissue cases managed with the diode laser and this was significant (Plaser compared with conventional surgery. Orthodontic patients treated with the diode laser required less infiltration anaesthesia, had reduced bleeding during and after surgery, rapid postoperative haemostasis, elimination of the need for sutures and an improved postoperative comfort and healing.

  3. Tissue culture and micropropagation for forest biomass production

    Energy Technology Data Exchange (ETDEWEB)

    Mason, E.; Maine, F.W.


    An increase in forest production will be necessary in the future when wood becomes a major renewable source of energy and chemicals along with its traditional role of fibre source. This increase could eventually by achieved be proper selection and breeding of trees. Clonal forestry by vegetative propagation of cuttings is becoming a viable alternative to a seedling-based forestry with many advantages, and cutting could be used to quickly propagate large numbers of clones of control-pollinated seedlings. Most forest trees are propagated sexually and seed orchards were started in the US and Canada in the last 40-50 years for breeding purposes. Forests could ultimately be established with improved seedlings instead of from seed with unknown genetic potential, or by natural regeneration. Micropropagation is the term used to refer to the propagation of plants raised by tissue culture methods rather than from seeds or cuttings. Many clonal plantlets could be regenerated asexually in the laboratory and eventually transplanted to permanent sites. In addition the technology could be developed to produce new variants from somatic cells. Tissue culture is a technique which may be useful for plant propagation where conventional methods are inadequate or unsuitable. However, traditional studies of field planting observed over long periods of time would still be necessary. This document has the object of informing those who may wish to know more about these techniques in relation to practical application, and require a general overview rather than experimental details, which are given in an annotated bilbiography. 274 refs., 2 figs., 1 tab.

  4. Effects of ionizing radiation on plant tissue cultures

    International Nuclear Information System (INIS)

    Hell, K.G.


    A short review is done of the biological effects of ionizing radiations on plant tissues kept in culture, from the work of Gladys King, in 1949, with X-ray irradiated tobacco. The role of plant hormones is discussed in the processes of growth inhibition and growth restoration of irradiated tissues, as well as morphogenesis. Radioresistance of cells kept in culture and the use of ionizing radiations as mutagens are also commented. Some aspects of the biological effects of ionizing radiations that need to be investigated are discussed, and the problem of genome instability of plant tissues kept in culture is pointed out. (M.A.) [pt

  5. Ireland and the UNESCO Convention on the Protection of the Underwater Cultural Heritage (United States)

    Kirwan, Seán


    Ratification by Ireland of the 2001 UNESCO Convention on the Protection of the Underwater Cultural Heritage will not be able to take place until after enactment of additional domestic legislation. The reasons for this are examined in the context of Ireland's legal system. Since 1987 Ireland has had extensive legal protection for underwater cultural heritage, but the jurisdictional aspects of the Convention are key to understanding why additional legislation is necessary. Issues relating to salvage law are also considered. The 2001 Convention is placed in the context of development of Irish policy on underwater cultural heritage.

  6. Self-Condensation Culture Enables Vascularization of Tissue Fragments for Efficient Therapeutic Transplantation

    Directory of Open Access Journals (Sweden)

    Yoshinobu Takahashi


    Full Text Available Summary: Clinical transplantation of tissue fragments, including islets, faces a critical challenge because of a lack of effective strategies that ensure efficient engraftment through the timely integration of vascular networks. We recently developed a complex organoid engineering method by “self-condensation” culture based on mesenchymal cell-dependent contraction, thereby enabling dissociated heterotypic lineages including endothelial cells to self-organize in a spatiotemporal manner. Here, we report the successful adaptation of this method for generating complex tissues from diverse tissue fragments derived from various organs, including pancreatic islets. The self-condensation of human and mouse islets with endothelial cells not only promoted functionalization in culture but also massively improved post-transplant engraftment. Therapeutically, fulminant diabetic mice were more efficiently treated by a vascularized islet transplant compared with the conventional approach. Given the general limitations of post-transplant vascularization associated with 3D tissue-based therapy, our approach offers a promising means of enhancing efficacy in the context of therapeutic tissue transplantation. : Takahashi et al. report on generating vascularized islet tissue from humans and mice. After transplantation, vascularized islets significantly improve survival of diabetic mice, demonstrating the quick normalization of blood glucose compared with conventional islet transplantation. Keywords: tissue engineering, tissue-based therapy, vascularization, islet transplantation, organoid

  7. Banana Musa tissue culture plants enhanced by endophytic fungi

    African Journals Online (AJOL)


    Merging biotechnology with biological control: Banana Musa tissue culture plants enhanced by endophytic .... While working in the laminar flow cabinet, sterile filter papers were placed in ..... University of Bonn, Bonn, Germany. Niere, B., 2001.

  8. Low technology tissue culture materials for initiation and ...

    African Journals Online (AJOL)

    Low technology tissue culture materials for initiation and multiplication of banana plants. ... African Crop Science Journal ... locally available macronutrients, micronutrients, sugar, equipment and facility reduced the cost of consumable material

  9. Co-culture in cartilage tissue engineering.

    NARCIS (Netherlands)

    Hendriks, J.A.A.; Riesle, J.U.; van Blitterswijk, Clemens


    For biotechnological research in vitro in general and tissue engineering specifically, it is essential to mimic the natural conditions of the cellular environment as much as possible. In choosing a model system for in vitro experiments, the investigator always has to balance between being able to

  10. Human meniscal proteoglycan metabolism in long-term tissue culture

    NARCIS (Netherlands)

    Verbruggen, G.; Verdonk, R.; Veys, E. M.; van Daele, P.; de Smet, P.; van den Abbeele, K.; Claus, B.; Baeten, D.


    For the purpose of human meniscal allografting, menisci have been maintained viable in in vitro culture. The influence of long-term tissue culture on the extracellular matrix metabolism of the meniscus has been studied. Fetal calf serum (FCS) was used as a supplement for the growth factors necessary

  11. Mass micropropagation of pineapple tissue culture using bioreactor technology

    International Nuclear Information System (INIS)

    Irwan Syafri; Amir Hamzah Harun; Rusli Ibrahim


    Pineapple (ananas comosus) is the most important fruit in terms of revenue earner in this country. The export of the canned pineapple is about 2 million standard cases annually valued at RM 60 million, while the export of fresh pineapple is about 40,000 tonnes worth about RM 10 million. The industry for canning is however, an ailing industry with production on the decline since the 70s. Scaling up the pineapple propagation using in vitro methods seems to be possible solutions for the lack of planting material. Temporary immersion system (TIS) has been described by Teisson and Alvard (1995) for plant tissue culture propagation. This system, also known as RITA, has been successfully used with embryogenic tissues of banana (Alvard et al 1993), coffee (Berthouly 1991), rubber (Etienne et al 1993) and sugarcane (Lorenzo et al 1998). In this study, the system has been set up with a potential capacity of 3 manifolds with 10 RITA each, to multiply meristem explants at different immersion periods. The system was compared with the conventional micropropagation system on solid medium. Both systems were treated with MS media containing 2.5 mg/l BAP and 0.1 NAA. In TIS the shoots were able to multiplied faster in comparison with solid media. The multiplication rates were increased up to 1:3 to 1:5 compared to normal propagation on solid media. The results show that TIS not only increase the propagation rates of pineapple but could also be adapted to reduce implementation costs to establish low-cost propagation systems. (Author)

  12. Metabolic Profile of Pancreatic Acinar and Islet Tissue in Culture (United States)

    Suszynski, Thomas M.; Mueller, Kathryn; Gruessner, Angelika C.; Papas, Klearchos K.


    The amount and condition of exocrine impurities may affect the quality of islet preparations especially during culture. In this study, the objective was to determine the oxygen demandand viability of islet and acinar tissue post-isolation and whether they change disproportionately while in culture. We compare the OCR normalized to DNA (OCR/DNA, a measure of fractional viability in units nmol/min/mg DNA), and percent change in OCR and DNA recoveries between adult porcine islet and acinar tissue from the same preparation (paired) over a 6-9 days of standard culture. Paired comparisons were done to quantify differences in OCR/DNA between islet and acinar tissue from the same preparation, at specified time points during culture; the mean (± standard error) OCR/DNA was 74.0 (±11.7) units higher for acinar (vs. islet) tissue on the day of isolation (n=16, p<0.0001), but 25.7 (±9.4) units lower after 1 day (n=8, p=0.03), 56.6 (±11.5) units lower after 2 days (n=12, p=0.0004), and 65.9 (±28.7) units lower after 8 days (n=4, p=0.2) in culture. DNA and OCR recoveries decreased at different rates for acinar versus islet tissue over 6-9 days in culture (n=6). DNA recovery decreased to 24±7% for acinar and 75±8% for islets (p=0.002). Similarly, OCR recovery decreased to 16±3% for acinar and remained virtually constant for islets (p=0.005). Differences in the metabolic profile of acinarand islet tissue should be considered when culturing impure islet preparations. OCR-based measurements may help optimize pre-IT culture protocols. PMID:25131082

  13. Clonal propagation of eucalyptus by tissue culture

    Energy Technology Data Exchange (ETDEWEB)

    Mehra-Palta, A.


    Multiple adventitious buds were induced on cotyledons, shoot tips and nodal stem segments of Eucalyptus species cultured on a defined nutrient medium supplemented with the cytokinin zeatin and the auxin indole-3-butyric acid (IBA). The adventitious buds could be recycled on cytokinin medium to produce more buds thus providing the possibility of producing large clones from selected genotypes. The adventitious shoots were rooted in auxin medium and some of the resulting propagules were outplanted in the field. These techniques have the potential for use in the genetic improvement of Eucalyptus. (Refs. 15).

  14. Development of a vinasse culture medium for plant tissue culture

    International Nuclear Information System (INIS)

    Silva, A.L.L.D.; Gollo, L.


    Vinasse is the main pollutant (effluent) obtained from the distillation of sugarcane in the production of fuel alcohol. However, this residue is rich in nutrients that are required by plants. We developed a new culture medium using vinasse for the In vitro propagation of an orchid. The vinasse was treated (decanted and filtered), and the nutrients were determined and quantified. Different formulations using vinasse were tested for an In vitro culture. The vinasse dilutions demonstrated a good buffering effect. The ideal vinasse dilution for media formulation was 2.5%. The best KC formulations with vinasse were KCV1 and KCV5. Compared to KC medium, these formulations demonstrated similar results for In vitro multiplication, with the exception of protocorm-like body number, which was inferior in the vinasse formulations. Conversely, for In vitro elongation and rooting, these vinasse media were superior to KC medium. KC medium promotes a low rooting rate (8%) compared to 68 and 100% obtained by KCV1 and KCV5, respectively. Moreover, plantlets cultured on KC medium become protocorm-like body clusters, which impeded the acclimatization of these explants. Plantlets elongated and rooted on KCV1 and KCV5 were successfully acclimatized with a 91% survival rate for both KC vinasse formulations. This study shows the great potential of this technology as a rational alternative to vinasse disposal and adds value to what is currently considered a waste product. (author)

  15. Chemical modification of conventional cancer radiotherapy. Tumor sensitization combined with normal tissue protection

    International Nuclear Information System (INIS)

    Kagiya, Tsutomu


    Nitrotriazole radiosensitizer, Sanazole (AK-2123, N-(2'-methoxyethyl)-2-(3''-nitro-1''-triazolyl) acetamide) developed by Kyoto University group was studied by 18 groups of 7 countries on fundamental aspects and clinical studies by 30 groups of 12 countries, and reported its effects on tumor sensitization of conventional cancer radiotherapy. On the other hand, the glucosides of vitamin C (Ascorbic acid glucoside, (AsAG) and water soluble derivative of vitamin-E (α-tocopherol glucoside, TMG) developed by Kyoto University group were studied fundamentally by 4 groups of 4 countries and clinically by 2 groups of 2 countries, and reported their effects on normal tissue protection in cancer treatments. These two studies of tumor sensitization and normal tissue protection were proposed as an advanced strategy of conventional cancer radiotherapy. (author)

  16. Evaluation of conventional castaneda and lysis centrifugation blood culture techniques for diagnosis of human brucellosis. (United States)

    Mantur, Basappa G; Mangalgi, Smita S


    We investigated the role of the lysis centrifugation blood culture technique over the conventional Castaneda technique for the diagnosis of human brucellosis. The lysis centrifugation technique has been found to be more sensitive in both acute (20% higher sensitivity; P centrifugation was in the mean detection time, which was only 2.4 days in acute and 2.7 days in chronic cases, with 103 out of 110 (93.6%) and 17 out of 20 (85%) cultures from acute and chronic brucellosis, respectively, detected before the conventional culture was positive. Our results confirmed the potential usefulness of the lysis technique in diagnosis and institution of appropriate antibiotic therapy.

  17. Soft tissue masses with myxoid stroma: Can conventional magnetic resonance imaging differentiate benign from malignant tumors?

    Energy Technology Data Exchange (ETDEWEB)

    Crombe, A., E-mail: [Department of Radiology, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France); Alberti, N. [Department of Radiology, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France); Stoeckle, E. [Department of Surgery, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France); Brouste, V. [Clinical and Epidemiological Research Unit, Institut Bergonié, 33000 Bordeaux (France); Buy, X. [Department of Radiology, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France); Coindre, J-M. [Department of Pathology, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France); Kind, M. [Department of Radiology, Institut Bergonié, 229 cours de l’Argonne, 33076 Bordeaux Cedex (France)


    Objectives: To retrospectively evaluate the diagnostic performance of morphological signs observed on conventional magnetic resonance (MR) imaging to differentiate benign from malignant peripheral solid tumors of soft tissue with myxoid stroma. Methods: MR images from 95 consecutive histopathologically proven tumors (26 benign and 69 malignant) of soft tissues with myxoid components were evaluated in our tertiary referral center. Two radiologists, blind to pathology results, independently reviewed conventional MR sequences including at least a) one T2-weighted sequence with or without fat suppression; b) one T1-weighted sequence without fat suppression; and c) one T1-weighted sequence with gadolinium-complex contrast enhancement and fat suppression. Multiple criteria were defined to analyze morphology, margins, architecture and tumor periphery and evaluated for each lesion. Intra- and inter-observer reproducibility and Odds ratios were calculated for each criterion. Results: The most relevant and reproducible criteria to significantly predict malignancy were: (1) ill-defined tumor margins, (2) a hemorrhagic component, (3) intra-tumoral fat, (4) fibrosis and (5) the “tail sign”. A lesion is classified as malignant if any of these 5 criteria is present, and benign if none of them are observed. Therefore, this combination provides a sensitivity of 92.9% and a specificity of 93.3%. Conclusion: Conventional MR imaging provides reproducible criteria that can be combined to differentiate between benign and malignant solid tumors of soft tissue with myxoid stroma.

  18. Fatty acid composition of muscle and adipose tissues of organic and conventional Blanca Andaluza suckling kids

    Directory of Open Access Journals (Sweden)

    F. De la Vega


    Full Text Available Interest in the preservation of autochthonous breeds such as the Blanca Andaluza goat (meat breed, raised under grazing-based management, has recently increased among Spanish farmers. A study of the possibilities of transformation to organic production needs to analyze the quality of their products. The aim of this study was to evaluate the fatty acid (FA composition of muscle and adipose tissues of Blanca Andaluza goat kids under organic and conventional grazing–based management system. Twenty-four twin kids (12 males, 12 females were selected from each system. The FA profile was determined in the longissimus thoracis muscle, kidney and pelvic fat. The percentages of C17:0, C17:1, C20:1, C20:4 n-6, C22:2 and several n-3 FAs were higher in organic meat; C12:0, C18:1 trans-11, CLA and C20:5 n-3 were lower in organic meat. The fat depots from the conventional kids showed lower percentages of C12:0, C14:0, C15:0, C17:0, C17:1, C18:3 n-3 and atherogenicity index, and higher percentage of C18:0. In the pelvic fat, the conventional kids displayed lower percentages of C16:0, C18:2 n-6 cis, PUFA, n-3 and n-6 FAs, and greater percentages of C18:1 n-9 cis and MUFA. The conventional kids displayed a major n6:n3 ratio in the kidney fat. No gender differences were observed. Significant differences were found only in some FA percentages of muscle and adipose tissues of suckling kids raised in organic and conventional livestock production systems, and due to this reason conventional grazing–based management farms could easily be transformed into organic production.

  19. Oxygen and tissue culture affect placental gene expression. (United States)

    Brew, O; Sullivan, M H F


    Placental explant culture is an important model for studying placental development and functions. We investigated the differences in placental gene expression in response to tissue culture, atmospheric and physiologic oxygen concentrations. Placental explants were collected from normal term (38-39 weeks of gestation) placentae with no previous uterine contractile activity. Placental transcriptomic expressions were evaluated with GeneChip ® Human Genome U133 Plus 2.0 arrays (Affymetrix). We uncovered sub-sets of genes that regulate response to stress, induction of apoptosis programmed cell death, mis-regulation of cell growth, proliferation, cell morphogenesis, tissue viability, and protection from apoptosis in cultured placental explants. We also identified a sub-set of genes with highly unstable pattern of expression after exposure to tissue culture. Tissue culture irrespective of oxygen concentration induced dichotomous increase in significant gene expression and increased enrichment of significant pathways and transcription factor targets (TFTs) including HIF1A. The effect was exacerbated by culture at atmospheric oxygen concentration, where further up-regulation of TFTs including PPARA, CEBPD, HOXA9 and down-regulated TFTs such as JUND/FOS suggest intrinsic heightened key biological and metabolic mechanisms such as glucose use, lipid biosynthesis, protein metabolism; apoptosis, inflammatory responses; and diminished trophoblast proliferation, differentiation, invasion, regeneration, and viability. These findings demonstrate that gene expression patterns differ between pre-culture and cultured explants, and the gene expression of explants cultured at atmospheric oxygen concentration favours stressed, pro-inflammatory and increased apoptotic transcriptomic response. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC


    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  1. Identification of Stevioside Using Tissue Culture-Derived Stevia () Leaves


    Ziaul Karim Md.; Daisuke Uesugi; Noriyuki Nakayama; M. Monzur Hossain; Kohji Ishihara; Hiroki Hamada


    Stevioside is a natural sweetener from Stevia leaf, which is 300 times sweeter than sugar. It helps to reduce blood sugar levels dramatically and thus can be of benefit to diabetic people. Tissue culture is a very potential modern technology that can be used in large-scale disease-free stevia production throughout the year. We successfully produced stevia plant through in vitro culture for identification of stevioside in this experiment. The present study describes a potential method for iden...

  2. Bridging the gap between cell culture and live tissue

    Directory of Open Access Journals (Sweden)

    Stefan Przyborski


    Full Text Available Traditional in vitro two-dimensional (2-D culture systems only partly imitate the physiological and biochemical features of cells in their original tissue. In vivo, in organs and tissues, cells are surrounded by a three-dimensional (3-D organization of supporting matrix and neighbouring cells, and a gradient of chemical and mechanical signals. Furthermore, the presence of blood flow and mechanical movement provides a dynamic environment (Jong et al., 2011. In contrast, traditional in vitro culture, carried out on 2-D plastic or glass substrates, typically provides a static environment, which, however is the base of the present understanding of many biological processes, tissue homeostasis as well as disease. It is clear that this is not an exact representation of what is happening in vivo and the microenvironment provided by in vitro cell culture models are significantly different and can cause deviations in cell response and behaviour from those distinctive of in vivo tissues. In order to translate the present basic knowledge in cell control, cell repair and regeneration from the laboratory bench to the clinical application, we need a better understanding of the cell and tissue interactions. This implies a detailed comprehension of the natural tissue environment, with its organization and local signals, in order to more closely mimic what happens in vivo, developing more physiological models for efficient in vitro systems. In particular, it is imperative to understand the role of the environmental cues which can be mainly divided into those of a chemical and mechanical nature.

  3. The use of animal tissues alongside human tissue: Cultural and ethical considerations. (United States)

    Kaw, Anu; Jones, D Gareth; Zhang, Ming


    Teaching and research facilities often use cadaveric material alongside animal tissues, although there appear to be differences in the way we handle, treat, and dispose of human cadaveric material compared to animal tissue. This study sought to analyze cultural and ethical considerations and provides policy recommendations on the use of animal tissues alongside human tissue. The status of human and animal remains and the respect because of human and animal tissues were compared and analyzed from ethical, legal, and cultural perspectives. The use of animal organs and tissues is carried out within the context of understanding human anatomy and function. Consequently, the interests of human donors are to be pre-eminent in any policies that are enunciated, so that if any donors find the presence of animal remains unacceptable, the latter should not be employed. The major differences appear to lie in differences in our perceptions of their respective intrinsic and instrumental values. Animals are considered to have lesser intrinsic value and greater instrumental value than humans. These differences stem from the role played by culture and ethical considerations, and are manifested in the resulting legal frameworks. In light of this discussion, six policy recommendations are proposed, encompassing the nature of consent, respect for animal tissues as well as human remains, and appropriate separation of both sets of tissues in preparation and display. © 2015 Wiley Periodicals, Inc.

  4. Cultural rights in the Convention on the Diversity of Cultural Expressions: included or ignored?

    NARCIS (Netherlands)

    Donders, Y.M.; Kono, T.; Van Uytsel, S.


    In 2001, the Universal Declaration on Cultural Diversity was adopted by the Member States of UNESCO. In this Declaration, cultural human rights were commended as an enabling environment for cultural diversity. After the Declaration, the Member States wished to adopt a legally binding instrument on

  5. A Method to Preclude Moisture Condensation in Plated Tissue Cultures (United States)

    Alex M. Diner


    Excessive condensate normally accumulates in in vitro-illuminated petri dishes containing plant tissue cultures, causing avariety of problems. A dark-colored rubber net-mesh placed over the petri dishes prevented such condensation, even when charcoal-supplemented media are used under high light intensity in a growth chamber.

  6. Smallholder adoption and economic impacts of tissue culture ...

    African Journals Online (AJOL)



    Dec 1, 2009 ... ISSN 1684–5315 © 2009 Academic Journals. Full Length ... Key words: Biotechnology, adoption, tissue culture bananas, Kenya. INTRODUCTION ... Recent studies about the agronomic and economic impacts of biotech- ..... accused scientist for 'playing God', others have supported biotechnologies.

  7. Mathematical modelling of tissue formation in chondrocyte filter cultures. (United States)

    Catt, C J; Schuurman, W; Sengers, B G; van Weeren, P R; Dhert, W J A; Please, C P; Malda, J


    In the field of cartilage tissue engineering, filter cultures are a frequently used three-dimensional differentiation model. However, understanding of the governing processes of in vitro growth and development of tissue in these models is limited. Therefore, this study aimed to further characterise these processes by means of an approach combining both experimental and applied mathematical methods. A mathematical model was constructed, consisting of partial differential equations predicting the distribution of cells and glycosaminoglycans (GAGs), as well as the overall thickness of the tissue. Experimental data was collected to allow comparison with the predictions of the simulation and refinement of the initial models. Healthy mature equine chondrocytes were expanded and subsequently seeded on collagen-coated filters and cultured for up to 7 weeks. Resulting samples were characterised biochemically, as well as histologically. The simulations showed a good representation of the experimentally obtained cell and matrix distribution within the cultures. The mathematical results indicate that the experimental GAG and cell distribution is critically dependent on the rate at which the cell differentiation process takes place, which has important implications for interpreting experimental results. This study demonstrates that large regions of the tissue are inactive in terms of proliferation and growth of the layer. In particular, this would imply that higher seeding densities will not significantly affect the growth rate. A simple mathematical model was developed to predict the observed experimental data and enable interpretation of the principal underlying mechanisms controlling growth-related changes in tissue composition.

  8. Mass Spectrometry-Based Proteomics in Molecular Diagnostics: Discovery of Cancer Biomarkers Using Tissue Culture (United States)

    Paul, Debasish; Kumar, Avinash; Gajbhiye, Akshada; Santra, Manas K.; Srikanth, Rapole


    Accurate diagnosis and proper monitoring of cancer patients remain a key obstacle for successful cancer treatment and prevention. Therein comes the need for biomarker discovery, which is crucial to the current oncological and other clinical practices having the potential to impact the diagnosis and prognosis. In fact, most of the biomarkers have been discovered utilizing the proteomics-based approaches. Although high-throughput mass spectrometry-based proteomic approaches like SILAC, 2D-DIGE, and iTRAQ are filling up the pitfalls of the conventional techniques, still serum proteomics importunately poses hurdle in overcoming a wide range of protein concentrations, and also the availability of patient tissue samples is a limitation for the biomarker discovery. Thus, researchers have looked for alternatives, and profiling of candidate biomarkers through tissue culture of tumor cell lines comes up as a promising option. It is a rich source of tumor cell-derived proteins, thereby, representing a wide array of potential biomarkers. Interestingly, most of the clinical biomarkers in use today (CA 125, CA 15.3, CA 19.9, and PSA) were discovered through tissue culture-based system and tissue extracts. This paper tries to emphasize the tissue culture-based discovery of candidate biomarkers through various mass spectrometry-based proteomic approaches. PMID:23586059

  9. Mass Spectrometry-Based Proteomics in Molecular Diagnostics: Discovery of Cancer Biomarkers Using Tissue Culture

    Directory of Open Access Journals (Sweden)

    Debasish Paul


    Full Text Available Accurate diagnosis and proper monitoring of cancer patients remain a key obstacle for successful cancer treatment and prevention. Therein comes the need for biomarker discovery, which is crucial to the current oncological and other clinical practices having the potential to impact the diagnosis and prognosis. In fact, most of the biomarkers have been discovered utilizing the proteomics-based approaches. Although high-throughput mass spectrometry-based proteomic approaches like SILAC, 2D-DIGE, and iTRAQ are filling up the pitfalls of the conventional techniques, still serum proteomics importunately poses hurdle in overcoming a wide range of protein concentrations, and also the availability of patient tissue samples is a limitation for the biomarker discovery. Thus, researchers have looked for alternatives, and profiling of candidate biomarkers through tissue culture of tumor cell lines comes up as a promising option. It is a rich source of tumor cell-derived proteins, thereby, representing a wide array of potential biomarkers. Interestingly, most of the clinical biomarkers in use today (CA 125, CA 15.3, CA 19.9, and PSA were discovered through tissue culture-based system and tissue extracts. This paper tries to emphasize the tissue culture-based discovery of candidate biomarkers through various mass spectrometry-based proteomic approaches.

  10. The role of activated charcoal in plant tissue culture. (United States)

    Thomas, T Dennis


    Activated charcoal has a very fine network of pores with large inner surface area on which many substances can be adsorbed. Activated charcoal is often used in tissue culture to improve cell growth and development. It plays a critical role in micropropagation, orchid seed germination, somatic embryogenesis, anther culture, synthetic seed production, protoplast culture, rooting, stem elongation, bulb formation etc. The promotary effects of AC on morphogenesis may be mainly due to its irreversible adsorption of inhibitory compounds in the culture medium and substancially decreasing the toxic metabolites, phenolic exudation and brown exudate accumulation. In addition to this activated charcoal is involved in a number of stimulatory and inhibitory activities including the release of substances naturally present in AC which promote growth, alteration and darkening of culture media, and adsorption of vitamins, metal ions and plant growth regulators, including abscisic acid and gaseous ethylene. The effect of AC on growth regulator uptake is still unclear but some workers believe that AC may gradually release certain adsorbed products, such as nutrients and growth regulators which become available to plants. This review focuses on the various roles of activated charcoal in plant tissue culture and the recent developments in this area.

  11. Variations on metabolic activities of legume tissues through radiation in tissue culture

    International Nuclear Information System (INIS)

    Batra, Amla


    Cell cultures from Arachis hypogaea L. cultivated in a modified medium developed by Murashige and Skoog (1962) showed vigorous qrowth after radiation treatment. Investigations on the effect of various sugars on the chlorophyll formation and growth of the irradiated tissues showed that sucrose was superior to maltose, glucose or fructose as a carbon source. Lactose and mannitol supported growth and development of chlorophyll to a less degree. On prolonging the cultures on a sugar free medium, the tissues failed to regain either growth or chlorophyll content. (author)

  12. Variations on metabolic activities of legume tissues through radiation in tissue culture

    Energy Technology Data Exchange (ETDEWEB)

    Batra, A [Rajasthan Univ., Jaipur (India). Dept. of Botany


    Cell cultures from Arachis hypogaea L. cultivated in a modified medium developed by Murashige and Skoog (1962) showed vigorous qrowth after radiation treatment. Investigations on the effect of various sugars on the chlorophyll formation and growth of the irradiated tissues showed that sucrose was superior to maltose, glucose or fructose as a carbon source. Lactose and mannitol supported growth and development of chlorophyll to a less degree. On prolonging the cultures on a sugar free medium, the tissues failed to regain either growth or chlorophyll content.

  13. A microfluidic-based lid device for conventional cell culture dishes to automatically control oxygen level. (United States)

    Lee, Seung Yeob; Yang, Sung


    Most conventional hypoxic cell culture systems undergo reoxygenation during experimental manipulations, resulting in undesirable effects including the reduction of cell viability. A lid device was developed herein for conventional cell culture dishes to resolve this limitation. The integration of multilayered microfluidic channels inside a thin membrane was designed to prevent the reoxygenation caused by reagent infusion and automatically control the oxygen level. The experimental data clearly show the reducibility of the dissolved oxygen in the infusing reagent and the controllability of the oxygen level inside the dish. The feasibility of the device for hypoxia studies was confirmed by HIF-1α experiments. Therefore, the device could be used as a compact and convenient hypoxic cell culture system to prevent reoxygenation-related issues.

  14. 4D super-resolution microscopy with conventional fluorophores and single wavelength excitation in optically thick cells and tissues.

    Directory of Open Access Journals (Sweden)

    David Baddeley

    Full Text Available BACKGROUND: Optical super-resolution imaging of fluorescently stained biological samples is rapidly becoming an important tool to investigate protein distribution at the molecular scale. It is therefore important to develop practical super-resolution methods that allow capturing the full three-dimensional nature of biological systems and also can visualize multiple protein species in the same sample. METHODOLOGY/PRINCIPAL FINDINGS: We show that the use of a combination of conventional near-infrared dyes, such as Alexa 647, Alexa 680 and Alexa 750, all excited with a 671 nm diode laser, enables 3D multi-colour super-resolution imaging of complex biological samples. Optically thick samples, including human tissue sections, cardiac rat myocytes and densely grown neuronal cultures were imaged with lateral resolutions of ∼15 nm (std. dev. while reducing marker cross-talk to <1%. Using astigmatism an axial resolution of ∼65 nm (std. dev. was routinely achieved. The number of marker species that can be distinguished depends on the mean photon number of single molecule events. With the typical photon yields from Alexa 680 of ∼2000 up to 5 markers may in principle be resolved with <2% crosstalk. CONCLUSIONS/SIGNIFICANCE: Our approach is based entirely on the use of conventional, commercially available markers and requires only a single laser. It provides a very straightforward way to investigate biological samples at the nanometre scale and should help establish practical 4D super-resolution microscopy as a routine research tool in many laboratories.

  15. Exploring plant tissue culture in Withania somnifera (L.) Dunal: in vitro propagation and secondary metabolite production. (United States)

    Shasmita; Rai, Manoj K; Naik, Soumendra K


    Withania somnifera (L.) Dunal (family: Solanaceae), commonly known as "Indian Ginseng", is a medicinally and industrially important plant of the Indian subcontinent and other warmer parts of the world. The plant has multi-use medicinal potential and has been listed among 36 important cultivated medicinal plants of India that are in high demand for trade due to its pharmaceutical uses. The medicinal importance of this plant is mainly due to the presence of different types of steroidal lactones- withanolides in the roots and leaves. Owing to low seed viability and poor germination, the conventional propagation of W. somnifera falls short to cater its commercial demands particularly for secondary metabolite production. Therefore, there is a great need to develop different biotechnological approaches through tissue and organ culture for seasonal independent production of plants in large scale which will provide sufficient raw materials of uniform quality for pharmaceutical purposes. During past years, a number of in vitro plant regeneration protocols via organogenesis and somatic embryogenesis and in vitro conservation through synthetic seed based encapsulation technology have been developed for W. somnifera. Several attempts have also been made to standardize the protocol of secondary metabolite production via tissue/organ cultures, cell suspension cultures, and Agrobacterium rhizogenes-mediated transformed hairy root cultures. Employment of plant tissue culture based techniques would provide means for rapid propagation and conservation of this plant species and also provide scope for enhanced production of different bioactive secondary metabolites. The present review provides a comprehensive report on research activities conducted in the area of tissue culture and secondary metabolite production in W. somnifera during the past years. It also discusses the unexplored areas which might be taken into consideration for future research so that the medicinal properties and

  16. Lemongrass-Incorporated Tissue Conditioner Against Candida albicans Culture (United States)

    Amornvit, Pokpong; Srithavaj, Theerathavaj


    Background: Tissue conditioner is applied popularly with dental prosthesis during wound healing process but it becomes a reservoir of oral microbiota, especially Candida species after long-term usage. Several antifungal drugs have been mixed with this material to control fungal level. In this study, lemongrass essential oil was added into COE-COMFORT tissue conditioner before being determined for anti-Candida efficacy. Materials and Methods: Lemongrass (Cymbopogon citratus) essential oil was primarily determined for antifungal activity against C. albicans American type culture collection (ATCC) 10231 and MIC (minimum inhibitory concentration) value by agar disk diffusion and broth microdilution methods, respectively. COE-COMFORT tissue conditioner was prepared as recommended by the manufacturer after a fixed volume of the oil at its MIC or higher concentrations were mixed thoroughly in its liquid part. Antifungal efficacy of the tissue conditioner with/without herb was finally analyzed. Results: Lemongrass essential oil displayed potent antifungal activity against C. albicans ATCC 10231and its MIC value was 0.06% (v/v). Dissimilarly, the tissue conditioner containing the oil at MIC level did not cease the growth of the tested fungus. Both reference and clinical isolates of C. albicans were completely inhibited after exposed to the tissue conditioner containing at least 0.25% (v/v) of the oil (approximately 4-time MIC). The tissue conditioner without herb or with nystatin was employed as negative or positive control, respectively. Conclusion: COE-COMFORT tissue conditioner supplemented with lemongrass essential oil obviously demonstrated another desirable property as in vitro anti-Candida efficacy to minimize the risk of getting Candidal infection. PMID:25177638

  17. Classification of trace elements in tissues from organic and conventional French pig production. (United States)

    Parinet, Julien; Royer, Eric; Saint-Hilaire, Mailie; Chafey, Claude; Noël, Laurent; Minvielle, Brice; Dervilly-Pinel, Gaud; Engel, Erwan; Guérin, Thierry


    This study assesses the impact of the farming system on the levels of copper, zinc, arsenic, cadmium, lead and mercury in pig tissues from three types of production (Organic (n = 28), Label Rouge (n = 12) and Conventional (n = 30)) randomly sampled in different slaughterhouses. All the concentrations were below regulatory limits. In muscles, Cu, Zn and As were measured at slightly higher levels in organic samples but no differences between organic and Label Rouge was observed. Livers from conventional and Label Rouge pig farms exhibited higher Zn and Cd contents than the organic ones, probably due to different practice in zinc or phytase supplementation of fattening diets. Principal component analysis indicated a correlation between Cu and As concentrations in liver and carcass weight, and between Zn and Cd liver levels and lean meat percentage. The linear discriminant analysis succeeded in predicting the farming process on the basis of the lean meat percentage and the liver Cd level. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Tissue culture of three species of Laurencia complex (United States)

    Shen, Songdong; Wu, Xunjian; Yan, Binlun; He, Lihong


    To establish a micropropagation system of three Laurencia complex species ( Laurencia okamurai, Laurencia tristicha, and Chondrophycus undulatus) by tissue culture techniques, we studied the regeneration characteristics and optimal culture conditions of axenic algal fragments cultured on solid medium and in liquid medium. Regeneration structures were observed and counted regularly under a reverse microscope to investigate the regeneration process, polarity and optimal illumination, and temperature and salinity levels. The results show that in most cultures of the three species, we obtained bud regeneration on solidified medium with 0.5% agar and in liquid medium. Rhizoid-like regeneration was filamentous and developed from the lower cut surface of fragments in L. okamurai, but was discoid and developed from the apical back side of bud regeneration in L. tristicha and C. undulatus. Regeneration polarity was localized to the apical part of algal fronds in all three species, and on fragments cut from the basal part of algae buds could develop from both the upper and the lower cut surfaces. Buds could develop from both the medullary and the cortical portions in L. okamurai and C. undulatus, while in L. tristicha, buds only emerged from the cortex. The optimal culture conditions for L. okamurai were 4 500 lx, 20°C and 35 (salinity); for C. undulatus, 4 500 lx, 20°C and 30; and for L. tristicha, 4 500 lx, 25°C and 30.


    Directory of Open Access Journals (Sweden)

    A. V. Ratkin


    Full Text Available Objective. Investigation of hypolipidemic effect of sesquiterpene γ-lactone Arglabin in hepatoma tissue culture (HTC.Materials and methods. In this study we’ve evaluated the effect of sesquiterpene γ-lactone Arglabin and gemfibrozil (reference drug on the lipid content in the hepatoma tissue culture (HTC which were incubated with a fat emulsion “Lipofundin” by fluorescent method with vital dye Nile Red. The cell viability was investigated using the MTT-test and staining by Trypan blue.Results. Cultivation of cell cultures of rat’s hepatoma cell line HTC with Arglabin and gemfibrozil in concentrations from 10 to 50 μmol and from 0.25 to 0.5 mmol, respectively, had no cytotoxic effect. HTC cell viability did not change compared with the corresponding rate in the control culture. Experimental hyperlipidemia in hepatoma culture was induced by the addition in the incubation medium of fat emulsion “Lipofundin” in a final concentration of 0.05 %. The fluorescence intensity of Nile Red in the cells was increased 4-fold (p < 0.05, which indicates a significant accumulation of lipids in the cytosol of cells. In these steady-state Arglabin and gemfibrozil at concentrations 75–100 μM and 0.25–1.0 mM, respectively, reduced the content of lipid in cells. Conclusion. In the model of hyperlipidemia induced by lipofundin, sesquiterpene γ-lactone Arglabin prevents the accumulation of lipids in the HTC cell line, as evidenced by a decrease in Nile Red fluorescence. However hypolipidemic effect of Arglabin is associated with cytotoxic effects, which is typical for anticancer drugs.

  20. Advanced cell culture technology for generation of in vivo-like tissue models

    Directory of Open Access Journals (Sweden)

    Stefan Przyborski


    Full Text Available Human tissues are mostly composed of different cell types, that are often highly organised in relation to each other. Often cells are arranged in distinct layers that enable signalling and cell-to-cell interactions. Here we describe the application of scaffold-based technology, that can be used to create advanced organotypic 3D models of various tissue types that more closely resemble in vivo-like conditions (Knight et al., 2011. The scaffold comprises a highly porous polystyrene material, engineered into a 200 micron thick membrane that is presented in various ways including multi-welled plates and well inserts, for use with conventional culture plasticware and medium perfusion systems. This technology has been applied to generate numerous unique types of co-culture model. For example: 1 a full thickness human skin construct comprising dermal fibroblasts and keratinocytes, raised to the air-liquid interface to induce cornification of the upper layers (Fig.1 (Hill et al., 2015; 2 a neuron-glial co-culture to enable the study of neurite outgrowth interacting with astroglial cells to model and investigate the glial scar found in spinal cord injury (Clarke et al., 2016; 3 formation of a sub-mucosa consisting of a polarised simple epithelium, layer of ECM proteins simulating the basement membrane, and underlying stromal tissues (e.g. intestinal mucosa. These organotypic models demonstrate the versatility of scaffold membranes and the creation of advanced in vivo-like tissue models. Creating a layered arrangement more closely simulates the true anatomy and organisation of cells within many tissue types. The addition of different cell types in a temporal and spatial fashion can be used to study inter-cellular relationships and create more physiologically relevant in vivo-like cell-based assays. Methods that are relatively straightforward to use and that recreate the organised structure of real tissues will become valuable research tools for use in

  1. The comparison of pyrosequencing molecular Gram stain, culture, and conventional Gram stain for diagnosing orthopaedic infections. (United States)

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W


    We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.

  2. Addressing the instability of DNA nanostructures in tissue culture. (United States)

    Hahn, Jaeseung; Wickham, Shelley F J; Shih, William M; Perrault, Steven D


    DNA nanotechnology is an advanced technique that could contribute diagnostic, therapeutic, and biomedical research devices to nanomedicine. Although such devices are often developed and demonstrated using in vitro tissue culture models, these conditions may not be compatible with DNA nanostructure integrity and function. The purpose of this study was to characterize the sensitivity of 3D DNA nanostructures produced via the origami method to the in vitro tissue culture environment and identify solutions to prevent loss of nanostructure integrity. We examined whether the physiological cation concentrations of cell culture medium and the nucleases present in fetal bovine serum (FBS) used as a medium supplement result in denaturation and digestion, respectively. DNA nanostructure denaturation due to cation depletion was design- and time-dependent, with one of four tested designs remaining intact after 24 h at 37 °C. Adjustment of medium by addition of MgSO4 prevented denaturation. Digestion of nanostructures by FBS nucleases in Mg(2+)-adjusted medium did not appear design-dependent and became significant within 24 h and when medium was supplemented with greater than 5% FBS. We estimated that medium supplemented with 10% FBS contains greater than 256 U/L equivalent of DNase I activity in digestion of DNA nanostructures. Heat inactivation at 75 °C and inclusion of actin protein in medium inactivated and inhibited nuclease activity, respectively. We examined the impact of medium adjustments on cell growth, viability, and phenotype. Adjustment of Mg(2+) to 6 mM did not appear to have a detrimental impact on cells. Heat inactivation was found to be incompatible with in vitro tissue culture, whereas inclusion of actin had no observable effect on growth and viability. In two in vitro assays, immune cell activation and nanoparticle endocytosis, we show that using conditions compatible with cell phenotype and nanostructure integrity is critical for obtaining reliable

  3. Comparison of tumour age response to radiation for cells derived from tissue culture or solid tumours

    International Nuclear Information System (INIS)

    Keng, P.C.; Siemann, D.W.; Rochester Univ., NY; Rochester Univ., NY; Wheeler, K.T.


    Direct comparison of the cell age response of 9L and KHT tumour cells derived either from tissue culture or solid tumours was achieved. Cells from dissociated KHT and 9L tumours (the latter implanted either subcutaneously or intracerebrally) and cells from tissue culture were separated into homogenous sized populations by centrifugal elutriation. In both tumour models these homogeneous sized populations correspond to populations enriched at different stages of the cell cycle. The survival of these elutriated cell populations was measured after a single dose of Cs-137 gamma rays. For cells isolated from 9L solid tumours, there was little variation in radiosensitivity throughout the cell cycle; however, a very small but significant increase in resistance was found in late G 1 cells. This lack of a large variation in radiosensitivity through the cell cycle for 9L cells from solid tumours also was seen in 9L cells growing in monolayer tissue culture. When similar experiments were performed using the KHT sarcoma tumour model, the results showed that KHT cells in vitro exhibited a fairly conventional increase in radioresistance in both mid G 1 and late S. However, the cell age response of KHT cells from solid tumours was different; particularly in the late S and G 2 + M phases. (author)

  4. Growth inhibitory factors in bovine faeces impairs detection of Salmonella Dublin by conventional culture procedure

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Nielsen, L.R.; Sørensen, Gitte


    Aims: To analyse the relative importance of different biological and technical factors on the analytical sensitivity of conventional culture methods for detection of Salmonella Dublin in cattle faeces. Methods and Results: Faeces samples collected from six adult bovines from different salmonella...... novobiocin, followed by combinations of culture media (three types) and selective media (two types). The sensitivity of each combination and sources of variation in detection were determined by a generalized linear mixed model using a split-plot design. Conclusions: Biological factors, such as faecal origin...... and S. Dublin strain influenced the sensitivity more than technical factors. Overall, the modified semisolid Rappaport Vassiliadis (MSRV)-culture medium had the most reliable detection capability, whereas detection with selenite cystine broth and Mueller Kauffman tetrathionate broth combinations varied...

  5. Comparison study among conventional, tissue harmonic and pulse inversion harmonic images to evaluate pleural effusion and ascites

    International Nuclear Information System (INIS)

    Chung, Hwan Hoon; Kim, Yun Hwan; Kang, Chang Ho; Park, Bum Jin; Chung, Kyoo Byung; Suh, Won Hyuck


    To determine the most useful sonographic technique to evaluate pleural effusion and ascites by comparing conventional, tissue harmonic and pulse inversion harmonic images. 12 patients having pleural effusion and 14 patients having ascites were included in this study. 18 patients were male and 8 patients were female. Average age was 54.8 yrs (25-77). We compared images which had been taken at the same section with 3 above mentioned sonographic techniques. Evaluation was done by 3 radiologists in consensus and grades were given to 3 techniques from 1 to 3. Evaluating points were 1) normal structures that border the fluid such as liver, peritoneal lining, pleura, 2) septation in fluid, 3) debris floating in fluid, and 4) artifacts. Pulse inversion harmonic image was the best in image quality for normal structures, followed by tissue harmonic and conventional image (p<0.05). Pulse inversion harmonic image was better than conventional image to evaluate septation in fluid (p<0.05), but there were no statistically significant difference between pulse inversion and tissue harmonic images, and tissue harmonic and conventional images. Tissue harmonic image was better than pulse inversion harmonic and conventional images to evaluate debris floating in fluid (p<0.05) but there was no statistically significant difference between these two latter techniques. Artifacts were most prominent on conventional image followed by tissue harmonic and pulse inversion harmonic image (p<0.05). Pulse inversion harmonic image was the best sonographic technique to evaluate pleural effusion or ascites, However, Tissue harmonic image was the best for evaluation of debris.

  6. Comparison study among conventional, tissue harmonic and pulse inversion harmonic images to evaluate pleural effusion and ascites

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Hwan Hoon; Kim, Yun Hwan; Kang, Chang Ho; Park, Bum Jin; Chung, Kyoo Byung; Suh, Won Hyuck [Korea University College of Medicine, Seoul (Korea, Republic of)


    To determine the most useful sonographic technique to evaluate pleural effusion and ascites by comparing conventional, tissue harmonic and pulse inversion harmonic images. 12 patients having pleural effusion and 14 patients having ascites were included in this study. 18 patients were male and 8 patients were female. Average age was 54.8 yrs (25-77). We compared images which had been taken at the same section with 3 above mentioned sonographic techniques. Evaluation was done by 3 radiologists in consensus and grades were given to 3 techniques from 1 to 3. Evaluating points were 1) normal structures that border the fluid such as liver, peritoneal lining, pleura, 2) septation in fluid, 3) debris floating in fluid, and 4) artifacts. Pulse inversion harmonic image was the best in image quality for normal structures, followed by tissue harmonic and conventional image (p<0.05). Pulse inversion harmonic image was better than conventional image to evaluate septation in fluid (p<0.05), but there were no statistically significant difference between pulse inversion and tissue harmonic images, and tissue harmonic and conventional images. Tissue harmonic image was better than pulse inversion harmonic and conventional images to evaluate debris floating in fluid (p<0.05) but there was no statistically significant difference between these two latter techniques. Artifacts were most prominent on conventional image followed by tissue harmonic and pulse inversion harmonic image (p<0.05). Pulse inversion harmonic image was the best sonographic technique to evaluate pleural effusion or ascites, However, Tissue harmonic image was the best for evaluation of debris.

  7. Long-term culture of human liver tissue with advanced hepatic functions. (United States)

    Ng, Soon Seng; Xiong, Anming; Nguyen, Khanh; Masek, Marilyn; No, Da Yoon; Elazar, Menashe; Shteyer, Eyal; Winters, Mark A; Voedisch, Amy; Shaw, Kate; Rashid, Sheikh Tamir; Frank, Curtis W; Cho, Nam Joon; Glenn, Jeffrey S


    A major challenge for studying authentic liver cell function and cell replacement therapies is that primary human hepatocytes rapidly lose their advanced function in conventional, 2-dimensional culture platforms. Here, we describe the fabrication of 3-dimensional hexagonally arrayed lobular human liver tissues inspired by the liver's natural architecture. The engineered liver tissues exhibit key features of advanced differentiation, such as human-specific cytochrome P450-mediated drug metabolism and the ability to support efficient infection with patient-derived inoculums of hepatitis C virus. The tissues permit the assessment of antiviral agents and maintain their advanced functions for over 5 months in culture. This extended functionality enabled the prediction of a fatal human-specific hepatotoxicity caused by fialuridine (FIAU), which had escaped detection by preclinical models and short-term clinical studies. The results obtained with the engineered human liver tissue in this study provide proof-of-concept determination of human-specific drug metabolism, demonstrate the ability to support infection with human hepatitis virus derived from an infected patient and subsequent antiviral drug testing against said infection, and facilitate detection of human-specific drug hepatotoxicity associated with late-onset liver failure. Looking forward, the scalability and biocompatibility of the scaffold are also ideal for future cell replacement therapeutic strategies.

  8. Plant cell tissue culture: A potential source of chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Scott, C.D.; Dougall, D.K.


    Higher plants produce many industrially important products. Among these are drugs and medicinal chemicals, essential oils and flavors, vegetable oils and fats, fine and specialty chemicals, and even some commodity chemicals. Although, currently, whole-plant extraction is the primary means of harvesting these materials, the advent of plant cell tissue culture could be a much more effective method of producing many types of phytochemicals. The use of immobilized plant cells in an advanced bioreactor configuration with excretion of the product into the reactor medium may represent the most straightforward way of commercializing such techniques for lower-value chemicals. Important research and development opportunities in this area include screening for plant cultures for nonmedical, lower-value chemicals; understanding and controlling plant cell physiology and biochemistry; optimizing effective immobilization methods; developing more efficient bioreactor concepts; and perfecting product extraction and purification techniques. 62 refs., 2 figs.

  9. Anaerobic Cultures from Preserved Tissues of Baby Mammoth (United States)

    Pikuta, Elena V.; Hoover, Richard B.; Fisher, Daniel


    Microbiological analysis of several cold-preserved tissue samples from the Siberian baby mammoth known as Lyuba revealed a number of culturable bacterial strains that were grown on anaerobic media at 4 C. Lactic acid produced by LAB (lactic acid bacteria) group, usually by members of the genera Carnobacterium and Lactosphera, appears to be a wonderful preservative that prevents other bacteria from over-dominating a system. Permafrost and lactic acid preserved the body of this one-month old baby mammoth and kept it in exceptionally good condition, resulting in this mammoth being the most complete such specimen ever recovered. The diversity of novel anaerobic isolates was expressed on morphological, physiological and phylogenetic levels. Here we discuss the specifics of the isolation of new strains, differentiation from trivial contamination, and preliminary results for the characterization of cultures.

  10. Isolation of Lysosomes from Mammalian Tissues and Cultured Cells. (United States)

    Aguado, Carmen; Pérez-Jiménez, Eva; Lahuerta, Marcos; Knecht, Erwin


    Lysosomes participate within the cells in the degradation of organelles, macromolecules, and a wide variety of substrates. In any study on specific roles of lysosomes, both under physiological and pathological conditions, it is advisable to include methods that allow their reproducible and reliable isolation. However, purification of lysosomes is a difficult task, particularly in the case of cultured cells. This is mainly because of the heterogeneity of these organelles, along with their low number and high fragility. Also, isolation methods, while disrupting plasma membranes, have to preserve the integrity of lysosomes, as the breakdown of their membranes releases enzymes that could damage all cell organelles, including themselves. The protocols described below have been routinely used in our laboratory for the specific isolation of lysosomes from rat liver, NIH/3T3, and other cultured cells, but can be adapted to other mammalian tissues or cell lines.


    Directory of Open Access Journals (Sweden)



    Full Text Available The study premises and objectives: The idea found at the basis of the discovery of a real value of cultural goods is underlined by the knowledge of their origins and history and of an environmental frame in which these have been produced. This theory could also be applied in regulations provided with certain newly introduced elements as: the absolute interdiction of thefts; the interdiction of destruction and execution of enemy property; the warning of before a terrestrial bombing with naval forces of ports, cities, villages, buildings or houses which are not defended The purpose on this paper is based on the following question: “Which of the gaps of humanitarian international law regarding cultural goods are surfacing?” The research models used are: the interpretative method, the structuralist-systematic method necessary for the knowledge of rules of organization and functioning of law as a system of social organization; the epistemological method, with an important role in the verification of an authentic meaning, fully manifesting the exigency regarding the protection of cultural property. The result of the study is obtained by offering an answer which as argued in this paper, concluding on one side that the discrepancies appeared between provisions (or dispositions of the Hague Convention of 1907 and the events of the First World War have led to an improved idea and to a completion of these norms. Conclusions: The preoccupation for the protection of cultural goods, of the people’s cultural patrimony, thus continues, even if, despite all acts adopted, we observe that certain states destroy willingly the treasures of other peoples. We have thus reached the conclusion that more drastic measures must be adopted more severe sanctions must be applied to states that neglect the norms of humanitarian international law and the existent gaps must be eliminated. For this reason the Second Protocol of The Hague Convention of 1954 has been promoted

  12. Organ and plantlet regeneration of Menyanthes trifoliata through tissue culture

    Directory of Open Access Journals (Sweden)

    Urszula Adamczyk-Rogozińska


    Full Text Available The conditions for the regeneration of plants through organogenesis from callus tissues of Menyanthes trifoliata are described. The shoot multiplication rate was affected by basal culture media, the type and concentration of cytokinin and subculture number. The best response was obtained when caulogenic calli were cultured on the modified Schenk and Hildebrandt medium (SH-M containing indole-3-acetic acid (IAA 0,5 mg/l and 6-benzyladenine (BA 1 mg/l or zeatin (2 mg/l. Under these conditions ca 7 shoots (mostly 1 cm or more in length per culture in the 5th and 6th passages could be developed. In older cultures (after 11-12 passages there was a trend for more numerous but shorter shoot formation. All regenerated shoots could be rooted on the SH-M medium supplemented with 0.5 mg/l IAA within 6 weeks; 80% of in vitro rooted plantlets survived their transfer to soil.

  13. Media Compositions for Three-Dimensional Mammalian Tissue Growth under Microgravity Culture Conditions (United States)

    Goodwin, Thomas J. (Inventor)


    Normal mammalian tissue and the culturing process has been developed for the three groups of organ, structural and blood tissue.The cells are grown in vitro under microgravity culture conditions and form three dimensional cells aggregates with normal cell function. The microgravity culture conditions may be microgravity or simulated microgravity created in a horizontal rotating wall culture vessel.

  14. Media Compositions for Three Dimensional Mammalian Tissue Growth Under Microgravity Culture Conditions (United States)

    Goodwin, Thomas J. (Inventor)


    Normal mammalian tissue and the culturing process has been developed for the three groups of organ, structural and blood tissue. The cells are grown in vitro under microgravity culture conditions and form three dimensional cells aggregates with normal cell function. The microgravity culture conditions may be microgravity or simulated microgravity created in a horizontal rotating wall culture vessel.

  15. Micro fluidic System for Culturing and Monitoring of Neuronal Cells and Tissue

    DEFF Research Database (Denmark)

    Bakmand, Tanya; Waagepetersen, Helle S.

    The aim of this Ph.D. project was to combine experience within cell and tissue culturing, electrochemistry and microfabrication in order to develop an in vivo-like fluidic culturing platform, challenging the traditional culturing methods. The first goal was to develope a fluidic system for cultur...... with mass production. The last part of this thesis also includes perspectives on how to expand the latest designed device to facilitate culturing of tissue and co-culturing of cells....

  16. Tobacco clones derived from tissue culture with supersensitivity to ozone

    International Nuclear Information System (INIS)

    Sun, E.J.; Kang, H.W.


    New tobacco clones supersensitive to ozone were obtained from tissue culture. - At least two supersensitive tobacco somaclones were obtained from tissue culture (TC) , when this approach was used to asexually propagate Bel-W3 tobacco indicator plants. These somaclones can detect as low as 30 ppb ozone for a 4-h exposure duration both within CSTR exposure chambers and in ambient air. Comparison of the injury index and their coefficient of variance showed that the TC plantlets usually have more uniform performance in response to ozone in addition to their higher sensitivity. A quick regeneration procedure was established to preserve the supersensitive germplasm immediately when it was found. The TC plantlets will flower and produce seed similar to seed-grown tobacco. The TC approach proved to be a better propagation system for valuable indicator plant species. The mechanism that causes the variation and the possible difference in their genome from seed-grown tobacco is still unknown. Further studies are needed in the future to determine if factors in the TC system may be responsible for the sensitivity difference

  17. Comparison of soft tissue effects of conventional ionic, low osmolar ionic and nonionic iodine containing contrast material in experimental animals

    International Nuclear Information System (INIS)

    McAlister, W.H.; Kissane, J.M.


    Conventional, low osmolar, and non-ionic iodine containing contrast media and saline controls were placed in the paws, muscles, and subcutaneous tissues of Sprague-Dawley rat thighs. The paw injections were observed and photographed, while the thighs were examined histologically. Results showed that although the low osmolar and non-ionic agents did produce inflammatory reactions and focal necrosis in the soft tissues, they were much better tolerated than were the conventional ionic agents. A non-ionic or low osmolar ionic contrast agent should be strongly considered when a possibility for extravasation exists. (orig.)

  18. Biomaterials and Culture Technologies for Regenerative Therapy of Liver Tissue. (United States)

    Perez, Roman A; Jung, Cho-Rok; Kim, Hae-Won


    Regenerative approach has emerged to substitute the current extracorporeal technologies for the treatment of diseased and damaged liver tissue. This is based on the use of biomaterials that modulate the responses of hepatic cells through the unique matrix properties tuned to recapitulate regenerative functions. Cells in liver preserve their phenotype or differentiate through the interactions with extracellular matrix molecules. Therefore, the intrinsic properties of the engineered biomaterials, such as stiffness and surface topography, need to be tailored to induce appropriate cellular functions. The matrix physical stimuli can be combined with biochemical cues, such as immobilized functional groups or the delivered actions of signaling molecules. Furthermore, the external modulation of cells, through cocultures with nonparenchymal cells (e.g., endothelial cells) that can signal bioactive molecules, is another promising avenue to regenerate liver tissue. This review disseminates the recent approaches of regenerating liver tissue, with a focus on the development of biomaterials and the related culture technologies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    Hay, R.J.; Phillips, T.; Thompson, A.; Vilner, L.; Cleland, M.; Tchaw-ren Chen; Zabrenetzky, V.


    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  20. Dynamic Culturing of Cartilage Tissue: The Significance of Hydrostatic Pressure (United States)

    Pereira, Ana L.; Duarte, Ana R.C.; Frias, Ana M.; Pedro, Adriano J.; Oliveira, João T.; Sousa, Rui A.; Reis, Rui L.


    Human articular cartilage functions under a wide range of mechanical loads in synovial joints, where hydrostatic pressure (HP) is the prevalent actuating force. We hypothesized that the formation of engineered cartilage can be augmented by applying such physiologic stimuli to chondrogenic cells or stem cells, cultured in hydrogels, using custom-designed HP bioreactors. To test this hypothesis, we investigated the effects of distinct HP regimens on cartilage formation in vitro by either human nasal chondrocytes (HNCs) or human adipose stem cells (hASCs) encapsulated in gellan gum (GG) hydrogels. To this end, we varied the frequency of low HP, by applying pulsatile hydrostatic pressure or a steady hydrostatic pressure load to HNC-GG constructs over a period of 3 weeks, and evaluated their effects on cartilage tissue-engineering outcomes. HNCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 3 weeks: (1) 0.4 MPa Pulsatile HP; (2) 0.4 MPa Steady HP; and (3) Static. Subsequently, we applied the pulsatile regimen to hASC-GG constructs and varied the amplitude of loading, by generating both low (0.4 MPa) and physiologic (5 MPa) HP levels. hASCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 4 weeks: (1) 0.4 MPa Pulsatile HP; (2) 5 MPa Pulsatile HP; and (3) Static. In the HNC study, the best tissue development was achieved by the pulsatile HP regimen, whereas in the hASC study, greater chondrogenic differentiation and matrix deposition were obtained for physiologic loading, as evidenced by gene expression of aggrecan, collagen type II, and sox-9; metachromatic staining of cartilage extracellular matrix; and immunolocalization of collagens. We thus propose that both HNCs and hASCs detect and respond to physical forces, thus resembling joint loading, by enhancing cartilage tissue development in a frequency- and

  1. Comparison of lysis-centrifugation with lysis-filtration and a conventional unvented bottle for blood cultures.


    Gill, V J; Zierdt, C H; Wu, T C; Stock, F; Pizzo, P A; MacLowry, J D


    Evaluation of a commercially available lysis-centrifugation blood culture system (Isolator, DuPont Co., Wilmington, Del.) and a lysis-filtration blood culture system for 3,111 cultures showed that both methods had comparable recoveries (73 and 68%, respectively) of significant aerobic and facultatively anaerobic isolates. The unvented conventional blood culture bottle had a recovery rate of 59%. Although the lysis-centrifugation and lysis-filtration systems had comparable recoveries of pathog...

  2. Antibiotic effects against periodontal bacteria in organ cultured tissue. (United States)

    Takeshita, Masaaki; Haraguchi, Akira; Miura, Mayumi; Hamachi, Takafumi; Fukuda, Takao; Sanui, Terukazu; Takano, Aiko; Nishimura, Fusanori


    Mechanical reduction of infectious bacteria by using physical instruments is considered the principal therapeutic strategy for periodontal disease; addition of antibiotics is adjunctive. However, local antibiotic treatment, combined with conventional mechanical debridement, has recently been shown to be more effective in periodontitis subjects with type 2 diabetes. This suggests that some bacteria may invade the inflamed inner gingival epithelium, and mechanical debridement alone will be unable to reduce these bacteria completely. Therefore, we tried to establish infected organ culture models that mimic the inner gingival epithelium and aimed to see the effects of antibiotics in these established models. Mouse dorsal skin epithelia were isolated, and periodontal bacteria were injected into the epithelia. Infected epithelia were incubated with test antibiotics, and colony-forming ability was evaluated. Results indicated that effective antibiotics differed according to injected bacteria and the bacterial combinations tested. Overall, in organ culture model, the combination of amoxicillin or cefdinir and metronidazole compensate for the effects of less effective bacterial combinations on each other. This in vitro study would suggest effective periodontal treatment regimens, especially for severe periodontitis.

  3. A new test phantom with different breast tissue compositions for image quality assessment in conventional and digital mammography

    International Nuclear Information System (INIS)

    Pachoud, Marc; Lepori, D; Valley, Jean-Francois; Verdun, Francis R


    Our objective is to describe a new test phantom that permits the objective assessment of image quality in conventional and digital mammography for different types of breast tissue. A test phantom, designed to represent a compressed breast, was made from tissue equivalent materials. Three separate regions, with different breast tissue compositions, are used to evaluate low and high contrast resolution, spatial resolution and image noise. The phantom was imaged over a range of kV using a Contour 2000 (Bennett) mammography unit with a Kodak MinR 2190-MinR L screen-film combination and a Senograph 2000D (General Electric) digital mammography unit. Objective image quality assessments for different breast tissue compositions were performed using the phantom for conventional and digital mammography. For a similar mean glandular dose (MGD), the digital system gives a significantly higher contrast-to-noise ratio (CNR) than the screen-film system for 100% glandular tissue. In conclusion, in mammography, a range of exposure conditions is used for imaging because of the different breast tissue compositions encountered clinically. Ideally, the patient dose-image quality relationship should be optimized over the range of exposure conditions. The test phantom presented in this work permits image quality parameters to be evaluated objectively for three different types of breast tissue. Thus, it is a useful tool for optimizing the patient dose-image quality relationship

  4. Micropropagation and maintenance of phytoplasmas in tissue culture. (United States)

    Bertaccini, Assunta; Paltrinieri, Samanta; Martini, Marta; Tedeschi, Mara; Contaldo, Nicoletta


    Maintenance of phytoplasma strains in tissue culture is achievable for all strains transmitted to periwinkle (Catharanthus roseus), and also for other naturally infected plant host species. Shoots of 1-3 cm length are grown in a solid medium containing Murashige and Skoog (MS) micro- and macroelements and 0.12 mg/L benzylaminopurine. The continued presence of phytoplasmas in infected shoots of periwinkle that have been maintained in micropropagation for up to 20 years can be shown by diagnostic methods such as nested PCR tests using the 16S rDNA gene (see Chapters 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,and 26 for phytoplasma diagnostic methods).

  5. Organotypic culture of human bone marrow adipose tissue. (United States)

    Uchihashi, Kazuyoshi; Aoki, Shigehisa; Shigematsu, Masamori; Kamochi, Noriyuki; Sonoda, Emiko; Soejima, Hidenobu; Fukudome, Kenji; Sugihara, Hajime; Hotokebuchi, Takao; Toda, Shuji


    The precise role of bone marrow adipose tissue (BMAT) in the marrow remains unknown. The purpose of the present study was therefore to describe a novel method for studying BMAT using 3-D collagen gel culture of BMAT fragments, immunohistochemistry, ELISA and real-time reverse transcription-polymerase chain reaction. Mature adipocytes and CD45+ leukocytes were retained for >3 weeks. Bone marrow stromal cells (BMSC) including a small number of lipid-laden preadipocytes and CD44+/CD105+ mesenchymal stem cell (MSC)-like cells, developed from BMAT. Dexamethasone (10 micromol/L), but not insulin (20 mU/mL), significantly increased the number of preadipocytes. Dexamethasone and insulin also promoted leptin production and gene expression in BMAT. Adiponectin production by BMAT was BMAT, in which adiponectin protein secretion is normally very low, and that BMAT may exhibit a different phenotype from that of the visceral and subcutaneous adipose tissues. BMAT-osteoblast interactions were also examined, and it was found that osteoblasts inhibited the development of BMSC and reduced leptin production, while BMAT inhibited the growth and differentiation of osteoblasts. The present novel method proved to be useful for the study of BMAT biology.

  6. Tissue culture of black pepper (piper nigrum l.) in Pakistan

    International Nuclear Information System (INIS)

    Hussain, A.; Naz, S.; Nazir, H.; Shinwari, Z.K.


    Black pepper (Piper nigrum L.) the 'King of Spices' is a universal table condiment. It is extensively used in Pakistani cuisines and herbal medicines and imported in bulk from neighboring countries. The black pepper vine is generally cultivated by seed because other vegetative propagation methods are slow and time consuming. Therefore the tissue culture technique is considered more efficient and reliable method for rapid and mass propagation of this economically important plant. The present study was initiated to develop protocol for micro-propagation of black pepper vine. The stem, leaf and shoot tip explants from mature vine were cultured on MS medium supplemented with different concentrations of plant growth regulators (2,4-D, BA, IBA). Best callus was produced on MS medium with 1.5 mg/l BA by shoot tip explant. Shoot regeneration was excellent on MS medium with 0.5 mg/l BA. The plantlets formed were rooted best on 1.5 mg/l IBA. The rooted plants were transplanted in soil medium and acclimatized in growth room. The plants raised were test planted under the local conditions of Hattar. (author)

  7. Comparison of radiometric and conventional culture systems in detecting Haemophilus influenzae type b bacteremia in rats

    International Nuclear Information System (INIS)

    Mitchell, M.J.; Zwahlen, A.; Elliott, H.L.; Ford, N.K.; Charache, F.P.; Moxon, E.R.


    To compare the efficiency of detecting Haemophilus influenzae type b bacteremia by the BACTEC radiometric system and a conventional Trypticase soy broth blood culture system, the authors developed an in vivo model of bacteremia in rats. After intravenous injection of 50 to 200 CFU into adult rats, there was a linear logarithmic increase in CFU per milliliter of rat blood during the first 10 h (r = 0.98), allowing accurate prediction of the level of bacteremia with time. Culture bottles were inoculated with 0.5 ml of blood obtained by cardiac puncture and processed as clinical samples in the microbiology laboratory with RS and conventional protocols. They found the following. (i) The first detection of bacteremia by RS was similar to that by TSB if a Gram stain of the TSB was done on day 1 and was superior if that smear was omitted (P less than 0.01). (ii) The detection times in both systems were comparable at different magnitudes of bacteremia (10(1) to 10(4) CFU/ml). (iii) Supplementation of inoculated bottles with 2 ml of sterile rat blood interfered with Gram stain detection in TSB but resulted in increased 14 CO 2 production in RS. (iv) No difference in detection time was found between RS and TSB for four different clinical isolates. These studies show that, in a biologically relevant model, the detection of positive blood cultures for H. influenzae type b by RS was comparable to or better than detection by TSB when blood was processed analogously to clinical specimens

  8. The use of tissue culture techniques to detect irradiated vegetables

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Sharabi, N.E.; Nabulsi, I


    the ability of two tissue culture methods, callus and vegetable growth induction, to detect irradiated vegetables was evaluated. Potato tubers, carrot roots, garlic cloves and onion bulbs were subjected to various gamma radiation doses (0, 25, 100, 150, 250, 500, 750, and 1000 Gy). Irradiated vegetables were cultured in vitro and in vivo (pots). Gamma irradiation significantly reduced callus-forming ability especially in carrot and potato where no callus was observed in doses higher than 50 Gy. Length of shoots and roots growing from irradiated garlic and onion explants was considerably reduced starting from the 25 Gy dose. No roots were formed on garlic explants at any irradiation dose. Garlic leaves growing from irradiated explants were spotted with purple to brown spots. The intensity of these spots increased as gamma ray dosage increased. In the pot experiment, potato plant appeared in the control only. On the contrary, a complete sprouting of garlic and onion was seen in all irradiation treatments. It was not possible to distinguish between the various irradiation treatments and the control 3 days after planting in pots. The two in vitro techniques, tested in our study, may effectively be used to detect irradiated vegetables and estimate the range of doses used. The callus formation method is more useful for potato and carrot, since regeneration of shoots in vitro from these two plants takes along time, making this method unpractical. The other technique is very useful in the case of onion and garlic since it is rapid. The two techniques can be used with most of the vegetables that can be cultured in vitro. (Author)

  9. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression


    Lou Yongli; Guo Dewei; Zhang Hui; Song Laijun


    In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs) cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI) brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were adminis...

  10. Cells in human postmortem brain tissue slices remain alive for several weeks in culture

    NARCIS (Netherlands)

    Verwer, Ronald W. H.; Hermens, Wim T. J. M. C.; Dijkhuizen, PaulaA; ter Brake, Olivier; Baker, Robert E.; Salehi, Ahmad; Sluiter, Arja A.; Kok, Marloes J. M.; Muller, Linda J.; Verhaagen, Joost; Swaab, Dick F.


    Animal models for human neurological and psychiatric diseases only partially mimic the underlying pathogenic processes. Therefore, we investigated the potential use of cultured postmortem brain tissue from adult neurological patients and controls. The present study shows that human brain tissue

  11. Tumor tissue slice cultures as a platform for analyzing tissue-penetration and biological activities of nanoparticles. (United States)

    Merz, Lea; Höbel, Sabrina; Kallendrusch, Sonja; Ewe, Alexander; Bechmann, Ingo; Franke, Heike; Merz, Felicitas; Aigner, Achim


    The success of therapeutic nanoparticles depends, among others, on their ability to penetrate a tissue for actually reaching the target cells, and their efficient cellular uptake in the context of intact tissue and stroma. Various nanoparticle modifications have been implemented for altering physicochemical and biological properties. Their analysis, however, so far mainly relies on cell culture experiments which only poorly reflect the in vivo situation, or is based on in vivo experiments that are often complicated by whole-body pharmacokinetics and are rather tedious especially when analyzing larger nanoparticle sets. For the more precise analysis of nanoparticle properties at their desired site of action, efficient ex vivo systems closely mimicking in vivo tissue properties are needed. In this paper, we describe the setup of organotypic tumor tissue slice cultures for the analysis of tissue-penetrating properties and biological activities of nanoparticles. As a model system, we employ 350μm thick slice cultures from different tumor xenograft tissues, and analyze modified or non-modified polyethylenimine (PEI) complexes as well as their lipopolyplex derivatives for siRNA delivery. The described conditions for tissue slice preparation and culture ensure excellent tissue preservation for at least 14days, thus allowing for prolonged experimentation and analysis. When using fluorescently labeled siRNA for complex visualization, fluorescence microscopy of cryo-sectioned tissue slices reveals different degrees of nanoparticle tissue penetration, dependent on their surface charge. More importantly, the determination of siRNA-mediated knockdown efficacies of an endogenous target gene, the oncogenic survival factor Survivin, reveals the possibility to accurately assess biological nanoparticle activities in situ, i.e. in living cells in their original environment. Taken together, we establish tumor (xenograft) tissue slices for the accurate and facile ex vivo assessment of

  12. A comparative study of tissue glue and vicryl suture for conjunctival and scleral closure in conventional 20-gauge vitrectomy. (United States)

    Batman, C; Ozdamar, Y; Mutevelli, S; Sonmez, K; Zilelioglu, G; Karakaya, J


    To describe the use of tissue glue to close scleral and conjunctival wounds, and to compare the clinical outcomes using tissue glue and vicryl suture for closing these areas in conventional 20-gauge (G) vitrectomy. Thirty eyes of 30 patients were included in this study. The indications for vitreoretinal surgery were diabetic vitreous haemorrhage with severe vitreoretinal traction in 10 eyes, retinal detachment and proliferative vitreoretinopathy in 14 eyes, and vitreous opacity in 6 eyes. Tissue glue (Tisseel, Baxter AG Industries, Vienna, Austria) was used to attach scleral and conjunctival wounds in 15 eyes and vicryl sutures in 15 eyes. The patients were allotted into two subgroups as tissue glue group (TG) and vicryl suture group (VG). The sclerotomy sites were evaluated with ultrasound biomicroscopy (UBM) postoperatively in TG. Follow-up period was 2 months. The groups were statistically compared for ocular signs and symptoms by Mann-Whitney U-test. No scleral wound leakage and conjunctival reattachment were observed at the end of the surgical procedure and during the follow-up period. No adverse effects were seen in TG. Abnormal fibrous ingrowth was not detected at the sclerotomy sites by means of UBM in TG. Patient comfort was significantly higher in TG than VG (P<0.05). Tissue glue has no adverse effects on ocular tissue and can be used as a substitute for suture materials, and the use of tissue glue decreases patient symptoms during the postoperative period after 20-G vitrectomy. Tissue glue can enable to perform sutureless surgery in the conventional 20-G vitrectomy.

  13. Effects of Apollo 12 lunar material on lipid levels of tobacco tissue and slash pine cultures (United States)

    Weete, J. D.


    Investigations of the lipid components of pine tissues (Pinus elloitii) are discussed, emphasizing fatty acids and steroids. The response by slash pine tissue cultures to growth in contact with Apollo lunar soil, earth basalt, and Iowa soil is studied. Tissue cultures of tobacco grown for 12 weeks in contact with lunar material from Apollo 12 flight contained 21 to 35 percent more total pigment than control tissues. No differences were noted in the fresh or dry weight of the experimental and control samples.

  14. NMR-based metabolomics of mammalian cell and tissue cultures

    International Nuclear Information System (INIS)

    Aranibar, Nelly; Borys, Michael; Mackin, Nancy A.; Ly, Van; Abu-Absi, Nicholas; Abu-Absi, Susan; Niemitz, Matthias; Schilling, Bernhard; Li, Zheng Jian; Brock, Barry; Russell, Reb J.; Tymiak, Adrienne; Reily, Michael D.


    NMR spectroscopy was used to evaluate growth media and the cellular metabolome in two systems of interest to biomedical research. The first of these was a Chinese hamster ovary cell line engineered to express a recombinant protein. Here, NMR spectroscopy and a quantum mechanical total line shape analysis were utilized to quantify 30 metabolites such as amino acids, Krebs cycle intermediates, activated sugars, cofactors, and others in both media and cell extracts. The impact of bioreactor scale and addition of anti-apoptotic agents to the media on the extracellular and intracellular metabolome indicated changes in metabolic pathways of energy utilization. These results shed light into culture parameters that can be manipulated to optimize growth and protein production. Second, metabolomic analysis was performed on the superfusion media in a common model used for drug metabolism and toxicology studies, in vitro liver slices. In this study, it is demonstrated that two of the 48 standard media components, choline and histidine are depleted at a faster rate than many other nutrients. Augmenting the starting media with extra choline and histidine improves the long-term liver slice viability as measured by higher tissues levels of lactate dehydrogenase (LDH), glutathione and ATP, as well as lower LDH levels in the media at time points out to 94 h after initiation of incubation. In both models, media components and cellular metabolites are measured over time and correlated with currently accepted endpoint measures.

  15. Flowering of Woody Bamboo in Tissue Culture Systems

    Directory of Open Access Journals (Sweden)

    Jin-Ling Yuan


    Full Text Available Flowering and subsequent seed set are not only normal activities in the life of most plants, but constitute the very reason for their existence. Woody bamboos can take a long time to flower, even over 100 years. This makes it difficult to breed bamboo, since flowering time cannot be predicted and passing through each generation takes too long. Another unique characteristic of woody bamboo is that a bamboo stand will often flower synchronously, both disrupting the supply chain within the bamboo industry and affecting local ecology. Therefore, an understanding of the mechanism that initiates bamboo flowering is important not only for biology research, but also for the bamboo industry. Induction of flowering in vitro is an effective way to both shorten the flowering period and control the flowering time, and has been shown for several species of bamboo. The use of controlled tissue culture systems allows investigation into the mechanism of bamboo flowering and facilitates selective breeding. Here, after a brief introduction of flowering in bamboo, we review the research on in vitro flowering of bamboo, including our current understanding of the effects of plant growth regulators and medium components on flower induction and how in vitro bamboo flowers can be used in research.

  16. NMR-based metabolomics of mammalian cell and tissue cultures

    Energy Technology Data Exchange (ETDEWEB)

    Aranibar, Nelly; Borys, Michael; Mackin, Nancy A.; Ly, Van; Abu-Absi, Nicholas; Abu-Absi, Susan [Bristol-Myers Squibb Company (United States); Niemitz, Matthias [PERCH Solutions Ltd. (Finland); Schilling, Bernhard; Li, Zheng Jian; Brock, Barry; Russell, Reb J.; Tymiak, Adrienne; Reily, Michael D., E-mail: [Bristol-Myers Squibb Company (United States)


    NMR spectroscopy was used to evaluate growth media and the cellular metabolome in two systems of interest to biomedical research. The first of these was a Chinese hamster ovary cell line engineered to express a recombinant protein. Here, NMR spectroscopy and a quantum mechanical total line shape analysis were utilized to quantify 30 metabolites such as amino acids, Krebs cycle intermediates, activated sugars, cofactors, and others in both media and cell extracts. The impact of bioreactor scale and addition of anti-apoptotic agents to the media on the extracellular and intracellular metabolome indicated changes in metabolic pathways of energy utilization. These results shed light into culture parameters that can be manipulated to optimize growth and protein production. Second, metabolomic analysis was performed on the superfusion media in a common model used for drug metabolism and toxicology studies, in vitro liver slices. In this study, it is demonstrated that two of the 48 standard media components, choline and histidine are depleted at a faster rate than many other nutrients. Augmenting the starting media with extra choline and histidine improves the long-term liver slice viability as measured by higher tissues levels of lactate dehydrogenase (LDH), glutathione and ATP, as well as lower LDH levels in the media at time points out to 94 h after initiation of incubation. In both models, media components and cellular metabolites are measured over time and correlated with currently accepted endpoint measures.

  17. Products of cells from gliomas: VIII. Multiple-well immunoperoxidase assay of immunoreactivity of primary hybridoma supernatants with human glioma and brain tissue and cultured glioma cells. (United States)

    McKeever, P E; Wahl, R L; Shakui, P; Jackson, G A; Letica, L H; Liebert, M; Taren, J A; Beierwaltes, W H; Hoff, J T


    To test the feasibility of primary screening of hybridoma supernatants against human glioma tissue, over 5000 combinations of hybridoma supernatants with glioma tissue, cultured glioma cells, and normal central neural tissue were screened with a new multiple-well (M-well) screening system. This is an immunoperoxidase assay system with visual endpoints for screening 20-30 hybridoma supernatants per single microscope slide. There were extensive differences between specificities to tissue and to cultured glioma cells when both were screened with M-wells and when cultured cells were screened with standard semi-automated fluorescence. Primary M-well screening with glioma tissue detected seven hybridoma supernatants that specifically identified parenchymal cells of glioma tissue and that were not detected with cultured cells. Immunoreactivities of individual supernatants for vascular components (nine supernatants), necrosis (five supernatants), and nuclei (three supernatants) were detected. Other supernatants bound multiple sites on glioma tissue and/or subpopulations of neurons and glia of normal tissue. The results show that primary screening with glioma tissue detects a number of different specificities of hybridoma supernatants to gliomas not detected by conventional screening with cultured cells. These are potentially applicable to diagnosis and therapy.

  18. 21 CFR 864.2240 - Cell and tissue culture supplies and equipment. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cell and tissue culture supplies and equipment. 864.2240 Section 864.2240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Cell And Tissue Culture Products...

  19. 21 CFR 864.2220 - Synthetic cell and tissue culture media and components. (United States)


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Synthetic cell and tissue culture media and components. 864.2220 Section 864.2220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Cell And Tissue Culture...

  20. Advances in tissue engineering through stem cell-based co-culture. (United States)

    Paschos, Nikolaos K; Brown, Wendy E; Eswaramoorthy, Rajalakshmanan; Hu, Jerry C; Athanasiou, Kyriacos A


    Stem cells are the future in tissue engineering and regeneration. In a co-culture, stem cells not only provide a target cell source with multipotent differentiation capacity, but can also act as assisting cells that promote tissue homeostasis, metabolism, growth and repair. Their incorporation into co-culture systems seems to be important in the creation of complex tissues or organs. In this review, critical aspects of stem cell use in co-culture systems are discussed. Direct and indirect co-culture methodologies used in tissue engineering are described, along with various characteristics of cellular interactions in these systems. Direct cell-cell contact, cell-extracellular matrix interaction and signalling via soluble factors are presented. The advantages of stem cell co-culture strategies and their applications in tissue engineering and regenerative medicine are portrayed through specific examples for several tissues, including orthopaedic soft tissues, bone, heart, vasculature, lung, kidney, liver and nerve. A concise review of the progress and the lessons learned are provided, with a focus on recent developments and their implications. It is hoped that knowledge developed from one tissue can be translated to other tissues. Finally, we address challenges in tissue engineering and regenerative medicine that can potentially be overcome via employing strategies for stem cell co-culture use. Copyright © 2014 John Wiley & Sons, Ltd.

  1. Differences in gene expression of cells growing in conventional 2D versus 3D cell culture

    International Nuclear Information System (INIS)

    Zschenker, Oliver; Cordes, Nils; Streichert, Thomas


    Full text: Telomeres are DNA protein complexes on the ends of chromosomes that distinguish the ends of chromosomes from double strand breaks and prevent degradation or fusion by nonhomologous end-joining. The loss of telomeres is associated with a loss of heterochromatic features leading to a less compact chromatin structure which allows e.g. DNA repair proteins to get better access to the site of the DNA damage and facilitate chromosome fusions. Telomerase is an enzyme that can counteract the loss of telomeres by adding telomeric repeats on the ends of chromosomes. Since telomerase is active in most tumor cells, telomerase is suggested to be the reason for the unlimited number of cell divisions of cancer cells. TRF2 is one of the most important proteins of the Shelterin complex protecting the telomeres from shortening by inhibiting ATM which is up-stream of the DNA repair mechanisms. Thus, we are concentrating on TRF2 and telomerase to investigate the differences in DNA repair in telomeric (heterochromatic) versus euchromatic regions. Human cancer cells with differences in status of p53 and telomerase like A549, UT-SCC15 and FaDu cells are used. Without any treatment, FaDu cells express high levels of telomerase and TRF2 in conventional 2D cell culture which is in contrast to e.g. A549. We found that telomerase is even higher expressed in 3D than in 2D cell culture. To connect telomere associated processes to both repair of radiogenic DNA damage/lesions and to cell-extracellular matrix interactions, we performed whole genome microarray analysis. By comparing the differential expression of genes associated with these three cell functions, we intend to yield new molecular insight into radiotherapy relevant tumor characteristics, particularly radioresistance and DNA damage response network processing. (author)

  2. Mouse embryonic stem cell culture for generation of three-dimensional retinal and cortical tissues. (United States)

    Eiraku, Mototsugu; Sasai, Yoshiki


    Generation of compound tissues with complex structures is a major challenge in cell biology. In this article, we describe a protocol for mouse embryonic stem cell (ESC) culture for in vitro generation of three-dimensional retinal tissue, comparing it with the culture protocol for cortical tissue generation. Dissociated ESCs are reaggregated in a 96-well plate with reduced cell-plate adhesion and cultured as floating aggregates. Retinal epithelium is efficiently generated when ESC aggregates are cultured in serum-free medium containing extracellular matrix proteins, spontaneously forming hemispherical vesicles and then progressively transforming into a shape reminiscent of the embryonic optic cup in 9-10 d. In long-term culture, the ESC-derived optic cup generates a fully stratified retinal tissue consisting of all major neural retinal components. In contrast, the cortical differentiation culture can be started without exogenous extracellular matrix proteins, and it generates stratified cortical epithelia consisting of four distinct layers in 13 d.

  3. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens


    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  4. Research progress in plant mutation by combining ion beam irradiations and tissue culture

    International Nuclear Information System (INIS)

    Zhou Linbin; Li Wenjian; Qu Ying; Li Ping


    About a new mutation breeding method which combines plant tissue culture technique with heavy ion beam irradiations were discussed in this paper with the principles, operation steps, molecular mechanisms, etc. The mutation method developed a few advantages coming from plant tissue culture, which can produce offspring by asexual ways. Meanwhile, using this method, the study of biological effects of high energy particles with different linear energy transfer values on plant tissues or cells can be explored and optimized in theory or practice. (authors)

  5. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression

    Directory of Open Access Journals (Sweden)

    Lou Yongli


    Full Text Available In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were administered intranasally to nine day old mice, and analyzed by MRI at day 28. Results indicate that the MSCs, especially the hanging drop cultured MSCs, significantly improved the mice’s cerebellar damage repair. MSCs derived from the hanging drop culture were smaller than those from the conventional culture. The gene expression levels were significantly increased for the MSCs derived from the hanging drop culture. The mechanism might relate to the fact that the hanging drop cultured MSCs can be kept in an undifferentiated state, resulting in its higher expression level of migration receptor of CXCR4.

  6. Rapid detection of bacterial contamination in cell or tissue cultures based on Raman spectroscopy (United States)

    Bolwien, Carsten; Sulz, Gerd; Becker, Sebastian; Thielecke, Hagen; Mertsching, Heike; Koch, Steffen


    Monitoring the sterility of cell or tissue cultures is an essential task, particularly in the fields of regenerative medicine and tissue engineering when implanting cells into the human body. We present a system based on a commercially available microscope equipped with a microfluidic cell that prepares the particles found in the solution for analysis, a Raman-spectrometer attachment optimized for non-destructive, rapid recording of Raman spectra, and a data acquisition and analysis tool for identification of the particles. In contrast to conventional sterility testing in which samples are incubated over weeks, our system is able to analyze milliliters of supernatant or cell suspension within hours by filtering relevant particles and placing them on a Raman-friendly substrate in the microfluidic cell. Identification of critical particles via microscopic imaging and subsequent image analysis is carried out before micro-Raman analysis of those particles is then carried out with an excitation wavelength of 785 nm. The potential of this setup is demonstrated by results of artificial contamination of samples with a pool of bacteria, fungi, and spores: single-channel spectra of the critical particles are automatically baseline-corrected without using background data and classified via hierarchical cluster analysis, showing great promise for accurate and rapid detection and identification of contaminants.

  7. Combined antibacterial effects of tissue-tolerable plasma and a modern conventional liquid antiseptic on chronic wound treatment. (United States)

    Klebes, Martin; Ulrich, Christin; Kluschke, Franziska; Patzelt, Alexa; Vandersee, Staffan; Richter, Heike; Bob, Adrienne; von Hutten, Johanna; Krediet, Jorien T; Kramer, Axel; Lademann, Jürgen; Lange-Asschenfeld, Bernhard


    Potential antimicrobial effects of sequential applications of tissue-tolerable plasma (TTP) and the conventional liquid antiseptic octenidine dihydrochloride (ODC) were investigated. 34 patients with chronic leg ulcers were treated with TTP, ODC or a combination of both. The bacterial colonization was measured semi-quantitatively before and immediately after treatment and changes in the microbial strains' compositions before and after antiseptic treatments were analyzed. All antiseptic procedures reduced the bacterial counts significantly. The sequential application of TTP and ODC displayed the highest antimicrobial efficacy. Me combined use of TTP and conventional antiseptics might represent the most efficient strategy for antiseptic treatment of chronic wounds. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Revision washout decreases implant capsule tissue culture positivity: a multicenter study. (United States)

    Henry, Gerard D; Carson, Culley C; Wilson, Steven K; Wiygul, Jeremy; Tornehl, Chris; Cleves, Mario A; Simmons, Caroline J; Donatucci, Craig F


    Positive cultures, visible biofilm and confocal micrography confirm bacterial presence on clinically uninfected inflatable penile prostheses at revision surgery. Salvage irrigation has been proved to rescue patients with clinically infected inflatable penile prostheses. Similar washout at revision for noninfectious reasons significantly lowers subsequent infection rates. We investigated a larger series of patients for positive culture rates and evaluated implant capsule tissue culture rates before and after revision washout. At 4 institutions a total of 148 patients with inflatable penile prostheses underwent revision surgery for noninfectious reasons between June 2001 and September 2005. Swab cultures of the fluid around the pump and visible biofilm were obtained. Also, in 65 patients a wedge of tissue from the capsule that forms around the pump was cultured. After implant removal revision washout of the implant spaces was performed and a second wedge of tissue was cultured. Of the 148 patients 97 (66%) had positive bacterial swab cultures of the fluid around the pump or biofilm. A total of 124 isolates were cultured. Of the 65 implant capsule tissue cultures obtained before washout 28 (43%) were positive for bacteria, while 16 (25%) obtained after revision washout were positive. Positive cultures and visible bacterial biofilm are present on clinically uninfected inflatable penile prostheses at revision surgery in most patients. Revision washout appears to decrease the bacterial load on implant capsule tissue at revision surgery of inflatable penile prostheses for noninfectious reasons.

  9. Propagation of jarrah (Eucalyptus marginata) by organ and tissue culture

    Energy Technology Data Exchange (ETDEWEB)

    Bennett, M.J.; McComb, J.A.


    Micropropagation methods are described for the production of clonal lines from Eucalyptus marginata (jarrah) seedlings. Nodal explants from mature trees can also yield shoot cultures, but a high frequency of contamination occurs among such explants. Uncontaminated callus cultures can be produced from mature trees by culturing stamen filaments and shoots can subsequently be regenerated from this callus. The rooting percentage of shoot cultures from either nodes or stamen callus of mature trees is low compared with that from seedling explants. Considerable variation was observed between trees in the ability of stamen callus to regenerate shoots and in the frequency of rooting. (Refs. 27)

  10. Culture-Independent Identification of Mycobacterium avium Subspecies paratuberculosis in Ovine Tissues: Comparison with Bacterial Culture and Histopathological Lesions

    Directory of Open Access Journals (Sweden)

    Kamal R. Acharya


    Full Text Available Johne’s disease is a chronic debilitating enteropathy of ruminants caused by Mycobacterium avium subspecies paratuberculosis (MAP. Current abattoir surveillance programs detect disease via examination of gross lesions and confirmation by histopathological and/or tissue culture, which is time-consuming and has relatively low sensitivity. This study aimed to investigate whether a high-throughput quantitative PCR (qPCR test is a viable alternative for tissue testing. Intestine and mesenteric lymph nodes were sourced from sheep experimentally infected with MAP and the DNA extracted using a protocol developed for tissues, comprised enzymatic digestion of the tissue homogenate, chemical and mechanical lysis, and magnetic bead-based DNA purification. The extracted DNA was tested by adapting a previously validated qPCR for fecal samples, and the results were compared with culture and histopathology results of the corresponding tissues. The MAP tissue qPCR confirmed infection in the majority of sheep with gross lesions on postmortem (37/38. Likewise, almost all tissue culture (61/64 or histopathology (52/58 positives were detected with good to moderate agreement (Cohen’s kappa statistic and no significant difference to the reference tests (McNemar’s Chi-square test. Higher MAP DNA quantities corresponded to animals with more severe histopathology (odds ratio: 1.82; 95% confidence interval: 1.60, 2.07. Culture-independent strain typing on tissue DNA was successfully performed. This MAP tissue qPCR method had a sensitivity equivalent to the reference tests and is thus a viable replacement for gross- and histopathological examination of tissue samples in abattoirs. In addition, the test could be validated for testing tissue samples intended for human consumption.

  11. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR). (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M


    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  12. Biomaterials in co-culture systems: towards optimizing tissue integration and cell signaling within scaffolds. (United States)

    Battiston, Kyle G; Cheung, Jane W C; Jain, Devika; Santerre, J Paul


    Most natural tissues consist of multi-cellular systems made up of two or more cell types. However, some of these tissues may not regenerate themselves following tissue injury or disease without some form of intervention, such as from the use of tissue engineered constructs. Recent studies have increasingly used co-cultures in tissue engineering applications as these systems better model the natural tissues, both physically and biologically. This review aims to identify the challenges of using co-culture systems and to highlight different approaches with respect to the use of biomaterials in the use of such systems. The application of co-culture systems to stimulate a desired biological response and examples of studies within particular tissue engineering disciplines are summarized. A description of different analytical co-culture systems is also discussed and the role of biomaterials in the future of co-culture research are elaborated on. Understanding the complex cell-cell and cell-biomaterial interactions involved in co-culture systems will ultimately lead the field towards biomaterial concepts and designs with specific biochemical, electrical, and mechanical characteristics that are tailored towards the needs of distinct co-culture systems. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Performance of non-conventional yeasts in co-culture with brewers’ yeast for steering ethanol and aroma production

    NARCIS (Netherlands)

    Rijswijck, van Irma M.H.; Wolkers - Rooijackers, Judith C.M.; Abee, Tjakko; Smid, Eddy J.


    Increasing interest in new beer types has stimulated the search for approaches to extend the metabolic variation of brewers’ yeast. Therefore, we tested two approaches using non-conventional yeast to create a beer with lower ethanol content and a complex aroma bouquet. First, the mono-culture

  14. Demonstration of the economic feasibility of plant tissue culture for jojoba (Simmondsia chinensis) and Euphorbia spp

    Energy Technology Data Exchange (ETDEWEB)

    Sluis, C.


    The economic feasibility of plant tissue culture was demonstrated as applied to two plants: jojoba (Simmondsia chinensis) and Euphorbia spp. The gopher weed (Euphorbia lathyris) was selected as the species of Euphorbia to research due to the interest in this plant as a potential source of hydrocarbon-like compounds. High yield female selections of jojoba were chosen from native stands and were researched to determine the economic feasibility of mass producing these plants via a tissue culture micropropagation program. The female jojoba selection was successfully mass produced through tissue culture. Modifications in initiation techniques, as well as in multiplication media and rooting parameters, were necessary to apply the tissue culture system, which had been developed for juvenile seedling tissue, to mature jojobas. Since prior attempts at transfer of tissue cultured plantlets were unsuccessful, transfer research was a major part of the project and has resulted in a system for transfer of rooted jojoba plantlets to soil. Euphorbia lathyris was successfully cultured using shoot tip cultures. Media and procedures were established for culture initiation, multiplication of shoots, callus induction and growth, and root initiation. Well-developed root systems were not attained and root initiation percentages should be increased if the system is to become commercially feasible.

  15. Application of tissue culture to cashew ( Anacardium occidentale L ...

    African Journals Online (AJOL)

    Summary of the previous works on the in vitro culture of cashew is highlighted with emphasis on the critical factors that influence the explants response and plantlet regeneration. The recalcitrant nature of cashew has been attributed to the limited success recorded so far in the in vitro culture of the crop and abnormal ...


    Directory of Open Access Journals (Sweden)



    Full Text Available Since 1980/1981, the government of Indonesia through the Ministry of Forestry has started to reforest logged-over, alang-alang, unproductive areas and to convert them to Forest Industry Plantation. The target is 300 000 ha per year. It means, 750 million seedlings should be provided per year (planting distance 2 m x 2 m. The tree species to be planted in forest industry plantation should have shorter life cycle (8 - 10 years, good stem-form, good rooting system, and should be fast growing. Acacia mangium has been selected as one of the important tree species for forest industry plantation due to its growth, quality of fiber wood (pulp and paper industry and rooting system (produce a lot of secondary root and nitrogen fixater (Soebardjo 1986. The reforestation of logged-over Dipterocarp forests in Malaysia with A. mangium has also been considered (Appanah and Weinland 1989. Generally, reforestation with A. mangium is done with seedlings obtained by seed germination. A. mangium produce a lot of seeds but its production is still limited by the season, while the conventional method of vegetative propagation through cuttings gave very low percentage of rooted-cuttings (1% (Umboh and Syamsul Yani 1989. The micropropagation of A. mangium through tissue culture is a promising method. The production of A. mangium plantlets through that method has been done at the Forest Genetic Laboratory, Tropical Forest Biology, SEAMEO BIOTROP (Situmorang 1988, Umboh 1988, Umboh et al. 1989, 1990. These rooted-plantlets (plantlings were first put in the green house (acclimatization before planting in the field. Field tests of some agricultural plants have been done but information on forest trees species is still lacking because the production of plantlings through tissue culture is still limited as there are still problems of their rooting. In fact, the progress of reproducing woody plants by tissue culture has been much slower than with herbaceous plants. The major

  17. Equine ovarian tissue viability after cryopreservation and in vitro culture (United States)

    The efficiency of several cryoprotective agents were compared using both slow-freezing and vitrification methods. Results indicate that the viability of ovarian tissue cells increases when DMSO (slow-freezing) and ethylene glycol (vitrification) are used....

  18. [18S-25S rDNA variation in tissue culture of some Gentiana L. species]. (United States)

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A


    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  19. A method for establishing human primary gastric epithelial cell culture from fresh surgical gastric tissues. (United States)

    Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu


    At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.

  20. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso


    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  1. Comparative carcass and tissue nutrient composition of transgenic Yorkshire pigs expressing phytase in the saliva and conventional Yorkshire pigs. (United States)

    Forsberg, C W; Meidinger, R G; Ajakaiye, A; Murray, D; Fan, M Z; Mandell, I B; Phillips, J P


    A transgenic line of Yorkshire (YK) pigs named the Cassie (CA) line was produced with a low copy number phytase transgene inserted in the genome. The transgenic line efficiently digests P, Ca, and other major minerals of plant dietary origin. The objectives of this study were to 1) compare carcass and tissue nutrient composition and meat quality traits for third generation hemizygous CA line market BW finisher pigs (n = 24) with age-matched conventional YK finisher pigs (n = 24) and 2) examine effects of outbreeding with high-index conventional YK boars on modifying carcass leanness from the third to sixth generations in CA line finisher boars (n = 73) and gilts (n = 103). Cassie boars (n = 12) and CA gilts (n = 12) were fed diets without supplemental P and comparable numbers of age-matched YK boars and gilts fed diets containing supplement P were raised throughout the finisher phase. The pigs were slaughtered and then fabricated into commercial pork primals before meat composition and quality evaluation. Proximate and major micronutrient composition was determined on tissues including fat, kidney, lean, liver, and skin. The main difference observed was greater (P = 0.033) crude fat content in CA boar carcasses and increased (P phytase action rather than to insertion of the transgene. However, from a meat composition perspective, transgenic expression of phytase in the CA line of YK pigs had little overall effect on meat composition. Outbreeding of high-index CA gilts with high-index commercial YK boars linearly reduced (P = 0.002) back fat thickness with a corresponding linear increase (P = 0.001) in lean yield in finisher CA gilts, although no change in these parameters was observed in CA finisher boars. The increase in lean yield in CA gilts by selective breeding without affecting the level of salivary phytase activity documents the value of conventional genetic selection in conjunction with genetic modification.

  2. Mary Jane Hogue (1883-1962): A pioneer in human brain tissue culture. (United States)

    Zottoli, Steven J; Seyfarth, Ernst-August


    The ability to maintain human brain explants in tissue culture was a critical step in the use of these cells for the study of central nervous system disorders. Ross G. Harrison (1870-1959) was the first to successfully maintain frog medullary tissue in culture in 1907, but it took another 38 years before successful culture of human brain tissue was accomplished. One of the pioneers in this achievement was Mary Jane Hogue (1883-1962). Hogue was born into a Quaker family in 1883 in West Chester, Pennsylvania, and received her undergraduate degree from Goucher College in Baltimore, Maryland. Research with the developmental biologist Theodor Boveri (1862-1915) in Würzburg, Germany, resulted in her Ph.D. (1909). Hogue transitioned from studying protozoa to the culture of human brain tissue in the 1940s and 1950s, when she was one of the first to culture cells from human fetal, infant, and adult brain explants. We review Hogue's pioneering contributions to the study of human brain cells in culture, her putative identification of progenitor neuroblast and/or glioblast cells, and her use of the cultures to study the cytopathogenic effects of poliovirus. We also put Hogue's work in perspective by discussing how other women pioneers in tissue culture influenced Hogue and her research.

  3. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.


    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  4. The effect of plant growth regulators on optimization of tissue culture ...

    African Journals Online (AJOL)



    Apr 5, 2010 ... ISSN 1684–5315 © 2010 Academic Journals ... tissue culture system in Malaysian upland rice ... Scientists believe that using new cultivars which have potential ..... providing the financial support and to Firouzeh Ashjazadeh ...

  5. How-To-Do-It: Using Cauliflower to Demonstrate Plant Tissue Culture. (United States)

    Haldeman, Janice H.; Ellis, Jane P.


    Presents techniques used for disinfestation of plant material, preparation of equipment and media, and laboratory procedures for tissue culture using cauliflower. Details methods for preparing solutions and plant propagation by cloning. (CW)

  6. Influence of postmortem time on the outcome of blood cultures among cadaveric tissue donors. (United States)

    Saegeman, V; Verhaegen, J; Lismont, D; Verduyckt, B; De Rijdt, T; Ectors, N


    Tissue banks provide tissues of human cadaver donors for transplantation. The maximal time limit for tissue retrieval has been set at 24 h postmortem. This study aimed at evaluating the evidence for this limit from a microbiological point of view. The delay of growth in postmortem blood cultures, the identification of the species isolated and clinical/environmental factors were investigated among 100 potential tissue donors. No significant difference was found in the rate of donors with grown blood cultures within (25/65=38%) compared with after (24/65=37%) 24 h of death. Coagulase-negative staphylococci and gastro-intestinal microorganisms were isolated within and after 24 h of death. Two factors--antimicrobial therapy and "delay before body cooling"--were significantly inversely related with donors' blood culture results. From a microbiological point of view, there is no evidence for avoiding tissue retrieval among donors after 24 h of death.

  7. Efficacy of Exclusive Lingual Nerve Block versus Conventional Inferior Alveolar Nerve Block in Achieving Lingual Soft-tissue Anesthesia. (United States)

    Balasubramanian, Sasikala; Paneerselvam, Elavenil; Guruprasad, T; Pathumai, M; Abraham, Simin; Krishnakumar Raja, V B


    The aim of this randomized clinical trial was to assess the efficacy of exclusive lingual nerve block (LNB) in achieving selective lingual soft-tissue anesthesia in comparison with conventional inferior alveolar nerve block (IANB). A total of 200 patients indicated for the extraction of lower premolars were recruited for the study. The samples were allocated by randomization into control and study groups. Lingual soft-tissue anesthesia was achieved by IANB and exclusive LNB in the control and study group, respectively. The primary outcome variable studied was anesthesia of ipsilateral lingual mucoperiosteum, floor of mouth and tongue. The secondary variables assessed were (1) taste sensation immediately following administration of local anesthesia and (2) mouth opening and lingual nerve paresthesia on the first postoperative day. Data analysis for descriptive and inferential statistics was performed using SPSS (IBM SPSS Statistics for Windows, Version 22.0, Armonk, NY: IBM Corp. Released 2013) and a P nerve block in achieving selective anesthesia of lingual soft tissues. It is technically simple and associated with minimal complications as compared to IAN block.

  8. INFECTIOUS DISEASES ARE SLEEPING MONSTERS: Conventional and culturally adapted new metaphors in a corpus of abstracts on immunology

    Directory of Open Access Journals (Sweden)

    Laura Hidalgo Downing


    Full Text Available In this paper we examine the role played by metaphor in a corpus of sixty abstracts on immunology from Scientific American. We focus on the distinction between conventional metaphors and culturally adapted new metaphors and discuss the role played by metaphor choice in the communicative purposes of the abstracts and their register features. We argue that one of the main strategies used to attract the reader‘s attention is the combination of highly conventionalized metaphors, which occur more frequently in the corpus, together with what we call “culturally adapted new metaphors”, which display different degrees of creativity and are less frequent in the corpus. Conventional metaphors typically reinforce the world view shared by the scientific community and introduce basic ideas on the subject of immunology. Culturally adapted new metaphors include a cline from slightly new perspectives of conventional models, to highly creative uses of metaphor. Culturally adapted new metaphors appeal primarily to a general readership and not to the scientific community, as they tap human emotions and mythic constructions. These play a crucial role in the abstracts, as they contribute to persuasive and didactic communicative functions in the text.

  9. Canine osteosarcoma karyotypes from an original tumor, its metastasis, and tumor cells in tissue culture

    International Nuclear Information System (INIS)

    Taylor, N.; Shifrine, M.; Wolf, H.G.; Trommershausen-Smith, A.


    Radiation-induced osteosarcoma, its metastasis, and cells grown in tissue culture were karyotyped. Both hypodiploid and hyperdiploid stem lines were observed. The hypodiploid line contained 45-55 chromosomes with 10 to 15 abnormal metacentric and submetacentric chromosomes and one subtelocentric marker. The hyperdiploid line contained 90 to 105 chromosomes with 20 to 30 abnormal metacentric and submetacentric chromosomes with two subtelocentric markers. Karyotypic analysis can be used to monitor osteosarcomas maintained in tissue culture

  10. Substrate specific hydrolysis of aromatic and aromatic-aliphatic esters in orchid tissue cultures

    Directory of Open Access Journals (Sweden)

    Agnieszka Mironowicz


    Full Text Available We found that tissue cultures of higher plants were able, similarly as microorganisms, to transform low-molecular-weight chemical compounds. In tissue cultures of orchids (Cymbidium 'Saint Pierre' and Dendrobium phalaenopsis acetates of phenols and aromatic-aliphatic alcohols were hydrolyzed, whereas methyl esters of aromatic and aromatic-aliphatic acids did not undergo this reaction. Acetates of racemic aromatic-aliphatic alcohols were hydrolyzed with distinct enantiospecificity.

  11. Comparison of BacT/Alert FAN and FAN Plus Bottles with Conventional Medium for Culturing Cerebrospinal Fluid. (United States)

    Yoo, In Young; Chun, Sejong; Song, Dong Joon; Huh, Hee Jae; Lee, Nam Yong


    We compared the BacT/Alert system FAN and FAN Plus media to conventional media for culturing cerebrospinal fluid (CSF) with 2,545 samples. FAN/FAN Plus bottles showed better performance for isolating microorganisms in CSF than conventional media (positive rate, 7.2% [182/2,545] versus 3.1% [80/2,545]). The incremental recovery rate of Cryptococcus neoformans from FAN Plus bottles was higher than that from FAN bottles. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Cloning higher plants from aseptically cultured tissues and cells (United States)

    Krikorian, A. D.


    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  13. Apollo 12 lunar material - Effects on lipid levels of tobacco tissue cultures. (United States)

    Weete, J. D.; Walkinshaw, C. H.; Laseter, J. L.


    Tobacco tissue cultures grown in contact with lunar material from Apollo 12, for a 12-week period, resulted in fluctuations of both the relative and absolute concentrations of endogenous sterols and fatty acids. The experimental tissues contained higher concentrations of sterols than the controls did. The ratio of campesterol to stigmasterol was greater than 1 in control tissues, but less than 1 in the experimental tissues after 3 weeks. High relative concentrations (17.1 to 22.2 per cent) of an unidentified compound or compounds were found only in control tissues that were 3 to 9 weeks of age.

  14. Relationship between conventional culture and flow cytometry for the diagnosis of urinary tract infection. (United States)

    García-Coca, Marta; Gadea, Ignacio; Esteban, Jaime


    Urine culture is the gold standard for the diagnosis of urinary tract infections (UTI). The use of flow cytometry analyzers (FCA) prior to culture allows for the quantification and recognition of cell components in urine to be automated and makes it possible to relate these data to the urine pathogens subsequently identified in cultures. Urine samples were assessed with the Sysmex UF-1000i analyzer. Those that met the criteria for culture (> 25 leukocytes/μL or > 385 bacteria/μL) were subjected to quantitative urine culture on chromogenic agar. Counts of red blood cells (RBC), white blood cells (WBC), epithelial cells (EC), and the kind of microorganisms identified in cultures were evaluated. A total of 17,483 samples were processed by FCA. Of these, 9057 met the criteria for culture. Urine cultures were reduced by 48.2%. The most common urine pathogen was Escherichia coli (60.3%). Negative urine cultures were significantly (p flow cytometer for screening urine samples allows for a reduction in the number of urine cultures. WBC values correlate well with the main urine pathogens related to UTI. The results observed for Enterococcus spp. suggest a low impact of these pathogens as a cause of UTI.

  15. [Research progress of co-culture system for constructing vascularized tissue engineered bone]. (United States)

    Fu, Weili; Xiang, Zhou


    To review the research progress of the co-culture system for constructing vascularized tissue engineered bone. The recent literature concerning the co-culture system for constructing vascularized tissue engineered bone was reviewed, including the selection of osteogenic and endothelial lineages, the design and surface modification of scaffolds, the models and dimensions of the co-culture system, the mechanism, the culture conditions, and their application progress. The construction of vascularized tissue engineered bone is the prerequisite for their survival and further clinical application in vivo. Mesenchymal stem cells (owning the excellent osteogenic potential) and endothelial progenitor cells (capable of directional differentiation into endothelial cell) are considered as attractive cell types for the co-culture system to construct vascularized tissue engineered bone. The culture conditions need to be further optimized. Furthermore, how to achieve the clinical goals of minimal invasion and autologous transplantation also need to be further studied. The strategy of the co-culture system for constructing vascularized tissue engineered bone would have a very broad prospects for clinical application in future.

  16. Cultural diversity and recognition in the communication and culture policies frame in Brazil: challenges and prospects for the implementation of the 2005 Unesco Convention

    Directory of Open Access Journals (Sweden)

    Sayonara Leal


    Full Text Available This paper discusses the mismatch between the communication and cultural policies regarding broadcasting in Brazil, notably television and audiovisual (movies, with the principle of cultural diversity mentioned in UNESCO’S Convention on the Protection and Promotion of the Diversity of Cultural Expressions of 2005. We start by reflecting on cultural diversity as a built-in problem of the multicultural societies in which demands for recognition operate from the idea of self-esteem and mutual respect as much as from that of social justice, resulting in permanent social struggles in individuals daily lives. Following, we take a glimpse at the problem of cultural diversity in scenarios of broad-range media monopolies, e.g. Brazil’s case, where elements of the democratic ethics, such as freedom of expression, find resistance due to the presence of hegemonic cultural model of production and commercialization of culture and communication. In this respect, we advocate that the fulfillment of the democratizing principles of UNESCO’s 2005 Convention requires reforms in our legal framework for Communications which must be based on the tripod of citizenship, recognition and cultural diversity. The emergence of a cosmopolitan symbolic space that gives visibility to universal and particular narratives and aesthetic forms that inhabit our cultural diversity depends on institutional support and routinization of the “normative recognition” as a norm within our inter-subjective action in the life-world.

  17. Plant Regeneration Through Tissue Culture Of Pear Millet ...

    African Journals Online (AJOL)

    1. 1. 2,5), MS(5) and N6(1.100.25) culture media, calli embryogenic potential and fertile plants regeneration were conserved for more than 12 months. Characteristics of regenerated plants were similar to control. It appears that dissected shoot ...

  18. Organoid culture systems for prostate epithelial and cancer tissue

    NARCIS (Netherlands)

    Drost, Jarno; Karthaus, Wouter R; Gao, Dong; Driehuis, Else; Sawyers, Charles L; Chen, Yu; Clevers, Hans

    This protocol describes a strategy for the generation of 3D prostate organoid cultures from healthy mouse and human prostate cells (either bulk or FACS-sorted single luminal and basal cells), metastatic prostate cancer lesions and circulating tumor cells. Organoids derived from healthy material

  19. Tissue culture as a plant production technique for horticultural crops

    African Journals Online (AJOL)



    Aug 18, 2009 ... Recovery of regenerants from transformed cells. - Cell culture .... methods. Micropropagation techniques. Micropropagation is a simple concept. The basic pro- tocols were well established by the 1960s and a whole research field and ... the environment are naturally contaminated on their sur- faces (and ...

  20. Rat fetal ventral mesencephalon grown as solid tissue cultures

    DEFF Research Database (Denmark)

    Höglinger, G U; Sautter, J; Meyer, Morten


    in vitro (DIV) in the presence or absence (controls) of BDNF [100 ng/ml]. The dopamine content in the culture medium, analyzed by HPLC, was significantly higher (4-5 fold) in the BDNF group at DIV 8 and DIV 12 compared to the corresponding control levels (40 pg/ml). The number of tyrosine hydroxylase...

  1. Co-culture systems-based strategies for articular cartilage tissue engineering. (United States)

    Zhang, Yu; Guo, Weimin; Wang, Mingjie; Hao, Chunxiang; Lu, Liang; Gao, Shuang; Zhang, Xueliang; Li, Xu; Chen, Mingxue; Li, Penghao; Jiang, Peng; Lu, Shibi; Liu, Shuyun; Guo, Quanyi


    Cartilage engineering facilitates repair and regeneration of damaged cartilage using engineered tissue that restores the functional properties of the impaired joint. The seed cells used most frequently in tissue engineering, are chondrocytes and mesenchymal stem cells. Seed cells activity plays a key role in the regeneration of functional cartilage tissue. However, seed cells undergo undesirable changes after in vitro processing procedures, such as degeneration of cartilage cells and induced hypertrophy of mesenchymal stem cells, which hinder cartilage tissue engineering. Compared to monoculture, which does not mimic the in vivo cellular environment, co-culture technology provides a more realistic microenvironment in terms of various physical, chemical, and biological factors. Co-culture technology is used in cartilage tissue engineering to overcome obstacles related to the degeneration of seed cells, and shows promise for cartilage regeneration and repair. In this review, we focus first on existing co-culture systems for cartilage tissue engineering and related fields, and discuss the conditions and mechanisms thereof. This is followed by methods for optimizing seed cell co-culture conditions to generate functional neo-cartilage tissue, which will lead to a new era in cartilage tissue engineering. © 2017 Wiley Periodicals, Inc.

  2. Sociocultural Conventions in Avatar-Mediated Nonverbal Communication: A Cross-Cultural Analysis of Virtual Proxemics


    Hasler B.S.; Friedman D.A.


    We examined whether virtual worlds in which participants interact as avatars could be used as a novel instrument for cross cultural and intercultural communication research. We explored differences between Asian and European cultures regarding their social spatial behavior (i.e. proxemics) in dyadic avatar interactions. Asian dyads interacted at larger distances than European dyads which is consistent with the cross cultural differences typically observed in face to face interactions. Mixed c...

  3. Ultrasound evaluation of normal and abnormal fetuses: comparison of conventional, tissue harmonic, and pulse- inversion harmonic imaging techniques

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bohyun; Kim, Sooah; Yang, Soon Ha; Choi, Moon Hae; Ahn, Hyeong Sik


    To determine the usefulness of tissue harmonic imaging (THI) and pulse-inversion harmonic imaging (PIHI) in the evaluation of normal and abnormal fetuses. Forty-one pregnant women who bore a total of 31 normal and ten abnormal fetuses underwent conventional ultrasonography (CUS), and then THI and PIHI. US images of six organ systems, namely the brain, spine, heart, abdomen, extremities and face were compared between the three techniques in terms of overall conspicuity and the definition of borders and internal structures. For the brain, heart, abdomen and face, overall conspicuity at THI and PIHI was significantly better than at CUS (p < 0.05). There was, though, no significant difference between THI and PIHI. Affected organs in abnormal fetuses were more clearly depicted at THI and PIHI than at CUS. Both THI and PIHI appear to be superior to CUS for the evaluation of normal or abnormal structures, particularly the brain, heart, abdomen and face

  4. [Effective productions of plant secondary metabolites having antitumor activity by plant cell and tissue cultures]. (United States)

    Taniguchi, Shoko


    Methods for the effective production of plant secondary metabolites with antitumor activity using plant cell and tissue cultures were developed. The factors in tannin productivity were investigated using culture strains producing different types of hydrolyzable tannins, i.e., gallotannins (mixture of galloylglucoses), ellagi-, and dehydroellagitannins. Production of ellagi- and dehydroellagitannins was affected by the concentrations and ratio of nitrogen sources in the medium. The formation of oligomeric ellagitannins in shoots of Oenothera tetraptera was correlated with the differentiation of tissues. Cultured cells of Eriobotrya japonica producing ursane- and oleanane-type triterpenes with antitumor activities were also established.

  5. Moving Beyond Conventional Wisdom: Advancements in Cross-Cultural Theories of Leadership, Conflict, and Teams. (United States)

    Gibson, Cristina B; McDaniel, Dana M


    In this article, we discuss the importance of a cross-cultural approach to organizational behavior. To do so, we illustrate how cross-cultural research in the past two decades has enabled us to reconceptualize constructs, revise models, and extend boundary conditions in traditional organizational behavior theories. We focus on three domains-teams, leadership, and conflict-and review cross-cultural empirical evidence that has extended several theories in each of these domains. We support the claim that even well-established organizational behavior theories vary in the extent to which they may be applied unilaterally across cultures, thus identifying the critical need to advance these theories via a cross-cultural research agenda. © The Author(s) 2010.

  6. Culture methods of allograft musculoskeletal tissue samples in Australian bacteriology laboratories. (United States)

    Varettas, Kerry


    Samples of allograft musculoskeletal tissue are cultured by bacteriology laboratories to determine the presence of bacteria and fungi. In Australia, this testing is performed by 6 TGA-licensed clinical bacteriology laboratories with samples received from 10 tissue banks. Culture methods of swab and tissue samples employ a combination of solid agar and/or broth media to enhance micro-organism growth and maximise recovery. All six Australian laboratories receive Amies transport swabs and, except for one laboratory, a corresponding biopsy sample for testing. Three of the 6 laboratories culture at least one allograft sample directly onto solid agar. Only one laboratory did not use a broth culture for any sample received. An international literature review found that a similar combination of musculoskeletal tissue samples were cultured onto solid agar and/or broth media. Although variations of allograft musculoskeletal tissue samples, culture media and methods are used in Australian and international bacteriology laboratories, validation studies and method evaluations have challenged and supported their use in recovering fungi and aerobic and anaerobic bacteria.

  7. The basic design and requirement for plant tissue culture laboratory in MINT

    International Nuclear Information System (INIS)

    Azraf Azman; Rosli Darmawan; Rusli Ibrahim; Mohd Nazir Basiran; Azhar Mohamad; Mohamed Najli Mohamed Yasin; Shuhaimi Shamsuddin


    The production of multiple species plantlets involves a relatively complex process and it is a highly specialized operation. Tissue culture technology is rapidly becoming a commercialized method for propagating new cultivars, rare species and difficult-to-propagate plant. Not only are skills and knowledge essential but the laboratory itself also plays an important role to ensure the successful growth of the plantlets. To produce quality plantlets, plant tissue culture laboratories should fulfill the basic requirements. The laboratory should have proper building and layout which comprise of media preparation and washing room, sterilization or autoclave room, transfer room and culture or growth room. The scope of this paper is to compare these fundamental requirements with the plant tissue culture laboratory in MINT. All the basic needs and differences will be discussed and the proposal for corrective actions will be presented. (Author)

  8. Tissue-resident natural killer (NK) cells are cell lineages distinct from thymic and conventional splenic NK cells (United States)

    Sojka, Dorothy K; Plougastel-Douglas, Beatrice; Yang, Liping; Pak-Wittel, Melissa A; Artyomov, Maxim N; Ivanova, Yulia; Zhong, Chao; Chase, Julie M; Rothman, Paul B; Yu, Jenny; Riley, Joan K; Zhu, Jinfang; Tian, Zhigang; Yokoyama, Wayne M


    Natural killer (NK) cells belong to the innate immune system; they can control virus infections and developing tumors by cytotoxicity and producing inflammatory cytokines. Most studies of mouse NK cells, however, have focused on conventional NK (cNK) cells in the spleen. Recently, we described two populations of liver NK cells, tissue-resident NK (trNK) cells and those resembling splenic cNK cells. However, their lineage relationship was unclear; trNK cells could be developing cNK cells, related to thymic NK cells, or a lineage distinct from both cNK and thymic NK cells. Herein we used detailed transcriptomic, flow cytometric, and functional analysis and transcription factor-deficient mice to determine that liver trNK cells form a distinct lineage from cNK and thymic NK cells. Taken together with analysis of trNK cells in other tissues, there are at least four distinct lineages of NK cells: cNK, thymic, liver (and skin) trNK, and uterine trNK cells. DOI: PMID:24714492

  9. TCUP: A novel hAT transposon active in maize tissue culture

    Directory of Open Access Journals (Sweden)

    Alan eSmith


    Full Text Available Transposable elements are capable of inducing heritable de novo genetic variation. The sequences capable of reactivation, and environmental factors that induce mobilization, remain poorly defined even in well-studied genomes such as maize. We treated maize tissue culture with the demethylating agent 5-aza-2-deoxcytidine and examined long-term tissue culture lines to discover silenced transposable elements that have the potential to induce heritable genetic variation. Through these screens we have identified a novel low copy number hAT transposon, Tissue Culture Up-Regulated (TCUP, which is transcribed at high levels in long-term maize Black Mexican Sweet (BMS tissue culture and up-regulated in response to treatment with 5-aza-2-deoxycytidine. Analysis of the TIGR Maize Gene Index revealed that this element is the most frequently represented EST from the BMS cell culture library and is not represented in other tissue libraries, which is the basis for its name. A full-length sequence was assembled in inbred B73 that contains the putative functional motifs required for autonomous movement of a hAT transposon. Transposon display detected movement of TCUP in two long-term tissue cultured cell lines of the genotype Hi-II AxB and BMS. This research implicates TCUP as a transposon that is capable of reactivation and which may also be particularly sensitive to the stress of the tissue culture environment. Our findings are consistent with the hypothesis that epigenetic alterations potentiate genomic responses to stress during clonal propagation of plants.

  10. Tissue culture regeneration and radiation induced mutagenesis in banana

    International Nuclear Information System (INIS)

    Kulkarni, V.M.; Ganapathi, T.R.


    Radiation induced mutagenesis is an important tool for banana genetic improvement. At BARC, protocols for shoo-tip multiplication of commercial banana varieties have been developed and transferred to user agencies for commercial production. Excellent embryogenic cell suspensions were established in banana cvs. Rasthali and Rajeli, and were maintained at low temperatures for long-term storage. Normal plantlets were successfully regenerated from these cell suspensions. The cell suspensions and shoot-tip cultures were gamma-irradiated for mutagenesis. The mutagenized populations were field screened and a few interesting mutants have been isolated. The existence of genetic variation was confirmed using DNA markers. Further evaluation of these mutants is in progress. (author)

  11. Renal cell carcinoma primary cultures maintain genomic and phenotypic profile of parental tumor tissues. (United States)

    Cifola, Ingrid; Bianchi, Cristina; Mangano, Eleonora; Bombelli, Silvia; Frascati, Fabio; Fasoli, Ester; Ferrero, Stefano; Di Stefano, Vitalba; Zipeto, Maria A; Magni, Fulvio; Signorini, Stefano; Battaglia, Cristina; Perego, Roberto A


    Clear cell renal cell carcinoma (ccRCC) is characterized by recurrent copy number alterations (CNAs) and loss of heterozygosity (LOH), which may have potential diagnostic and prognostic applications. Here, we explored whether ccRCC primary cultures, established from surgical tumor specimens, maintain the DNA profile of parental tumor tissues allowing a more confident CNAs and LOH discrimination with respect to the original tissues. We established a collection of 9 phenotypically well-characterized ccRCC primary cell cultures. Using the Affymetrix SNP array technology, we performed the genome-wide copy number (CN) profiling of both cultures and corresponding tumor tissues. Global concordance for each culture/tissue pair was assayed evaluating the correlations between whole-genome CN profiles and SNP allelic calls. CN analysis was performed using the two CNAG v3.0 and Partek software, and comparing results returned by two different algorithms (Hidden Markov Model and Genomic Segmentation). A very good overlap between the CNAs of each culture and corresponding tissue was observed. The finding, reinforced by high whole-genome CN correlations and SNP call concordances, provided evidence that each culture was derived from its corresponding tissue and maintained the genomic alterations of parental tumor. In addition, primary culture DNA profile remained stable for at least 3 weeks, till to third passage. These cultures showed a greater cell homogeneity and enrichment in tumor component than original tissues, thus enabling a better discrimination of CNAs and LOH. Especially for hemizygous deletions, primary cultures presented more evident CN losses, typically accompanied by LOH; differently, in original tissues the intensity of these deletions was weaken by normal cell contamination and LOH calls were missed. ccRCC primary cultures are a reliable in vitro model, well-reproducing original tumor genetics and phenotype, potentially useful for future functional approaches

  12. Renal cell carcinoma primary cultures maintain genomic and phenotypic profile of parental tumor tissues

    International Nuclear Information System (INIS)

    Cifola, Ingrid; Magni, Fulvio; Signorini, Stefano; Battaglia, Cristina; Perego, Roberto A; Bianchi, Cristina; Mangano, Eleonora; Bombelli, Silvia; Frascati, Fabio; Fasoli, Ester; Ferrero, Stefano; Di Stefano, Vitalba; Zipeto, Maria A


    Clear cell renal cell carcinoma (ccRCC) is characterized by recurrent copy number alterations (CNAs) and loss of heterozygosity (LOH), which may have potential diagnostic and prognostic applications. Here, we explored whether ccRCC primary cultures, established from surgical tumor specimens, maintain the DNA profile of parental tumor tissues allowing a more confident CNAs and LOH discrimination with respect to the original tissues. We established a collection of 9 phenotypically well-characterized ccRCC primary cell cultures. Using the Affymetrix SNP array technology, we performed the genome-wide copy number (CN) profiling of both cultures and corresponding tumor tissues. Global concordance for each culture/tissue pair was assayed evaluating the correlations between whole-genome CN profiles and SNP allelic calls. CN analysis was performed using the two CNAG v3.0 and Partek software, and comparing results returned by two different algorithms (Hidden Markov Model and Genomic Segmentation). A very good overlap between the CNAs of each culture and corresponding tissue was observed. The finding, reinforced by high whole-genome CN correlations and SNP call concordances, provided evidence that each culture was derived from its corresponding tissue and maintained the genomic alterations of parental tumor. In addition, primary culture DNA profile remained stable for at least 3 weeks, till to third passage. These cultures showed a greater cell homogeneity and enrichment in tumor component than original tissues, thus enabling a better discrimination of CNAs and LOH. Especially for hemizygous deletions, primary cultures presented more evident CN losses, typically accompanied by LOH; differently, in original tissues the intensity of these deletions was weaken by normal cell contamination and LOH calls were missed. ccRCC primary cultures are a reliable in vitro model, well-reproducing original tumor genetics and phenotype, potentially useful for future functional approaches

  13. Single molecule microscopy in 3D cell cultures and tissues. (United States)

    Lauer, Florian M; Kaemmerer, Elke; Meckel, Tobias


    From the onset of the first microscopic visualization of single fluorescent molecules in living cells at the beginning of this century, to the present, almost routine application of single molecule microscopy, the method has well-proven its ability to contribute unmatched detailed insight into the heterogeneous and dynamic molecular world life is composed of. Except for investigations on bacteria and yeast, almost the entire story of success is based on studies on adherent mammalian 2D cell cultures. However, despite this continuous progress, the technique was not able to keep pace with the move of the cell biology community to adapt 3D cell culture models for basic research, regenerative medicine, or drug development and screening. In this review, we will summarize the progress, which only recently allowed for the application of single molecule microscopy to 3D cell systems and give an overview of the technical advances that led to it. While initially posing a challenge, we finally conclude that relevant 3D cell models will become an integral part of the on-going success of single molecule microscopy. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests. (United States)

    Cassells, Alan C


    The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

  15. Micropropagation of Dalbergia sissoo Roxb. through tissue culture technique. (United States)

    Sahu, Jyoti; Khan, Shagufta; Sahu, Ram Kumar; Roy, Amit


    Multiple shoots of Dalbergia sissoo Roxb. (Sissoo) were incited from seeds through indirect somatic embryogenesis method. Seeds were inoculated in Murashige and Skoog's medium without any growth hormone. Than cotyledonary leaves were struck and used for callus induction on MS medium amplified with 2, 4-dichlorophenoxyacetic acid (0.5 to 4 mg mL(-1)). After 3 to 4 weeks the embryogenic callus clumps was transferred to medium supplemented with cytokinin (BAP 1 to 5 mg L(-1), kinetin 1-5.0 mg L(-1)) for embryo maturation and germination. The high-frequency shoot proliferation (82%) and maximum number of shoots per explants were recorded in MS medium containing NAA (0.5)+BAP (0.5). The findings of recent investigations have shown that, it is possible to induce indirect somatic embryogenesis in Dalbergia sissoo and plant regeneration from callus cultures derived from cotyledonary leaves as explants.

  16. Micropropagation of six Paulownia genotypes through tissue culture

    Directory of Open Access Journals (Sweden)

    Lydia Shtereva


    Full Text Available We investigated the effect of genotype and culture medium on the in vitro germination and development of plantlets from seeds of 6 different Paulownia genotypes (P. tomentosa, hybrid lines P. tomentosa P. fortunei (Mega, Ganter and Caroline, P. elongata and hybrid line P. elongata P. fortunei. Nodal and shoot tip explants were used for micropropagation of Paulownia genotypes by manipulating plant growth regulators. The highest germination percentage for all genotypes was obtained for seeds inoculated on medium supplemented with 50 mg*L GA3 (MSG2. On Thidiazuron containing media, the explants of hybrid line P. elongata P. fortunei exhibited the highest frequency of axillary shoot proliferation following by P. tomentosa P. fortunei. The results are discussed with the perspective of applying an improved protocol for in vitro seed germination and plantlet formation in several economically valuable Paulownia genotypes.

  17. Effect of induced mutagenesis in rice tissue culture

    International Nuclear Information System (INIS)

    Maddumage, R.


    The influence of chemical mutagens and ionising radiation on growth, regenerative capacity of rice callus culture and the effect o9f mutagens on frequency and spectrum of mutant regenerants, derived from calli and determination of approximate semi-lethal dose of each mutagen on rice calli was studied. Intact mature de-husked grains and pieces of primordial particles of four varieties were used as explants in the experiment. Organogenesis was induced using MS media supplemented with agar. After thirty days calluses were subjected to varying concentrations/dosage of mutagens. The effect of mutagens on growth of callus was stimulative in low concentration/doses at short exposure, but in higher concentration/doses at longer exposure it was oppressive. In x-radiation treatment all the studied doses showed only stimulative effect on growth. The effect of mutagenic treatment on regenerative capacity was negative. No specificity was found even between two chemical mutagens of their action on studied characters

  18. Human colon tissue in organ culture: calcium and multi-mineral-induced mucosal differentiation. (United States)

    Dame, Michael K; Veerapaneni, Indiradevi; Bhagavathula, Narasimharao; Naik, Madhav; Varani, James


    We have recently shown that a multi-mineral extract from the marine red algae, Lithothamnion calcareum, suppresses colon polyp formation and inflammation in mice. In the present study, we used intact human colon tissue in organ culture to compare responses initiated by Ca(2+) supplementation versus the multi-mineral extract. Normal human colon tissue was treated for 2 d in culture with various concentrations of calcium or the mineral-rich extract. The tissue was then prepared for histology/immunohistochemistry, and the culture supernatants were assayed for levels of type I procollagen and type I collagen. At higher Ca(2+) concentrations or with the mineral-rich extract, proliferation of epithelial cells at the base and walls of the mucosal crypts was suppressed, as visualized by reduced Ki67 staining. E-cadherin, a marker of differentiation, was more strongly expressed at the upper third of the crypt and at the luminal surface. Treatment with Ca(2+) or with the multi-mineral extract influenced collagen turnover, with decreased procollagen and increased type I collagen. These data suggest that calcium or mineral-rich extract has the capacity to (1) promote differentiation in human colon tissue in organ culture and (2) modulate stromal function as assessed by increased levels of type I collagen. Taken together, these data suggest that human colon tissue in organ culture (supporting in vivo finding in mice) will provide a valuable model for the preclinical assessment of agents that regulate growth and differentiation in the colonic mucosa.

  19. Data showing non-conventional HLA-B27 expression in axial joints and gut tissue from B27 transgenic rats, and in frozen and paraffin-fixed synovial SpA tissue

    NARCIS (Netherlands)

    Rysnik, Oliwia; McHugh, Kirsty; van Duivenvoorde, Leonie; van Tok, Melissa; Taurog, Joel; Kollnberger, Simon; Baeten, Dominique; Bowness, Paul


    Data is presented showing expression of non-conventional (NC) heavy chain forms of B27 in synovial tissues from SpA patients. Data is presented showing the expression patterns of NC-B27 in joint, gastrointestinal and lymphoid tissues from B27 transgenic (TG(1)) rats with M. tuberculosis-induced SpA.

  20. Glioma tissue obtained by modern ultrasonic aspiration with a simple sterile suction trap for primary cell culture and pathological evaluation. (United States)

    Schroeteler, Juliane; Reeker, Ralf; Suero Molina, Eric; Brokinkel, Benjamin; Holling, Markus; Grauer, Oliver M; Senner, Volker; Stummer, Walter; Ewelt, Christian


    Ultrasonic aspiration is widely used in the resection of brain tumors. Nevertheless, tumor tissue fragments obtained by ultrasonic aspiration are usually discarded. In this study, we demonstrate that these fragments are possible sources of material for histopathological study and tissue culture and compare their microscopic features and viability in tissue culture of cavitron ultrasonic surgical aspirator tissue fragments. Brain tumor tissue collected by ultrasonic aspiration (CUSA EXcel®; Integra Radionics Inc.) in a simple sterile suction trap during resection was processed for primary cell culture. Cell viability and immunohistological markers were measured by the WST-1 test, microscopy and immunofluorescent evaluation. Six gliomas are presented to demonstrate that these tissue fragments show good preservation of histological detail and tissue viability in culture. Utilization of this material may facilitate pathological interpretation by providing a more representative sample of tumor histology as well as an adequate and sterile biosource of material for tissue culture studies.

  1. Project on production of mutants by irradiation of in vitro cultured tissues of coconut and banana and their mass propagation by the tissue culture technique

    International Nuclear Information System (INIS)

    Guzman, E.V. de


    Fruit pulp tissue, ovary segments with or without ovules and sections from shoot tips of banana were used for studies on growth stimulating or morphogenetic effects of irradiation. Irradiation at 0.1-1.0 kR tended to induce faster callus growth in the otherwise slow-growing cultures. The physical condition and composition of the culture media especially with respect to growth regulators were studied, as were techniques to overcome discoloration of explants, the best choice of plant tissue for explant, and radiation effects on growth and morphogenesis. Due to the difficulty of callus induction with coconut, only the effects of irradiation on embryos cultured in vitro were studied. They were irradiated at various stages of development, i.e. during the early and final stage of liquid culture, and several days after transfer to a solid medium. Adverse effects of irradiation became evident only during the subsequent growth in solid, during the latter stage of which morphological changes were observed. Whereas irradiation of the liquid as well as solid media up to 50 kR had no adverse effect; survival and development became adversely affected at a dose of 1 kR

  2. Heritage under siege: military implementation of the 1954 Convention for the Protection of Cultural Property

    NARCIS (Netherlands)

    Kila, J.D.


    Heritage under Siege is the result of a five year long multidisciplinary research focusing on military implementation of protecting and safeguarding Cultural Heritage in the event of conflict. The subject necessitated to involve legal obligations and implications. The main juridical framework in

  3. Identification of Stevioside Using Tissue Culture-Derived Stevia (Stevia rebaudiana) Leaves (United States)

    Karim, Md. Ziaul; Uesugi, Daisuke; Nakayama, Noriyuki; Hossain, M. Monzur; Ishihara, Kohji; Hamada, Hiroki


    Stevioside is a natural sweetener from Stevia leaf, which is 300 times sweeter than sugar. It helps to reduce blood sugar levels dramatically and thus can be of benefit to diabetic people. Tissue culture is a very potential modern technology that can be used in large-scale disease-free stevia production throughout the year. We successfully produced stevia plant through in vitro culture for identification of stevioside in this experiment. The present study describes a potential method for identification of stevioside from tissue culture-derived stevia leaf. Stevioside in the sample was identified using HPLC by measuring the retention time. The percentage of stevioside content in the leaf samples was found to be 9.6%. This identification method can be used for commercial production and industrialization of stevia through in vitro culture across the world. PMID:28008268

  4. Microfluidic 3D cell culture: potential application for tissue-based bioassays (United States)

    Li, XiuJun (James); Valadez, Alejandra V.; Zuo, Peng; Nie, Zhihong


    Current fundamental investigations of human biology and the development of therapeutic drugs, commonly rely on two-dimensional (2D) monolayer cell culture systems. However, 2D cell culture systems do not accurately recapitulate the structure, function, physiology of living tissues, as well as highly complex and dynamic three-dimensional (3D) environments in vivo. The microfluidic technology can provide micro-scale complex structures and well-controlled parameters to mimic the in vivo environment of cells. The combination of microfluidic technology with 3D cell culture offers great potential for in vivo-like tissue-based applications, such as the emerging organ-on-a-chip system. This article will review recent advances in microfluidic technology for 3D cell culture and their biological applications. PMID:22793034

  5. Usefulness of fibroblast culture for testing of cattle tissues polluted with heavy metals

    International Nuclear Information System (INIS)

    Weglarz, L.; Drozdz, M.Wa.; Wardas, M.; Kula, B.; Pawlaczyk-Szpilowa, M.


    Cattle tissues (liver, kidney, brain, and lung) that had been polluted with heavy metals were tested for their ability to alter fibroblast culture growth, cellular protein and DNA content, and fibroblast DNA synthesis. At 72 hr of incubation a significant increase in cellular DNA and [14C]thymidine incorporation was noted in the primary cultures as well as in the subcultures compared to controls. Fibroblast cultures also displayed growth inhibition and reduction in protein content. The measurement of basic biochemical parameters of the fibroblast culture may represent a sensitive means of assessing rapidly the activity of heavy metals deposited in the tissues of cattle as a result of their grazing on polluted soil

  6. Current status and future prospects for cultured limbal tissue transplants in Australia and New Zealand. (United States)

    Harkin, Damien G; Apel, Andrew J; Di Girolamo, Nick; Watson, Stephanie; Brown, Karl; Daniell, Mark D; McGhee, J Jane; McGhee, Charles N J


    Cultured limbal tissue transplants have become widely used over the last decade as a treatment for limbal stem cell deficiency (LSCD). While the number of patients afflicted with LSCD in Australia and New Zealand is considered to be relatively low, the impact of this disease on quality of life is so severe that the potential efficacy of cultured transplants has necessitated investigation. We presently review the basic biology and experimental strategies associated with the use of cultured limbal tissue transplants in Australia and New Zealand. In doing so, we aim to encourage informed discussion on the issues required to advance the use of cultured limbal transplants in Australia and New Zealand. Moreover, we propose that a collaborative network could be established to maintain access to the technology in conjunction with a number of other existing and emerging treatments for eye diseases. © 2012 The Authors. Clinical and Experimental Ophthalmology © 2012 Royal Australian and New Zealand College of Ophthalmologists.

  7. Host DNA synthesis-suppressing factor in culture fluid of tissue cultures infected with measles virus

    International Nuclear Information System (INIS)

    Minagawa, T.; Nakaya, C.; Iida, H.


    Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)

  8. Production of immunoglobulins in gingival tissue explant cultures from juvenile periodontitis patients

    International Nuclear Information System (INIS)

    Hall, E.R.; Falkler, W.A. Jr.; Suzuki, J.B.


    B lymphocytes and plasma cells are histologically observed in granulomatous periodontal tissues of juvenile periodontitis (JP) patients. Local immune processes may participate in protective or immunopathologic roles in the pathogenesis of this disease. An in vitro explant culture system was utilized to demonstrate the production of immunoglobulins by diseased JP tissues. Immunodiffusion studies using goat anti-human gamma, alpha, or mu chain serum revealed IgG to be the major immunoglobulin present in 92% of the day 1 supernatant fluids (SF) of the 47 JP gingival tissue explant cultures. IgA was present in 15% of the SF; however, no IgM was detected. Staph Protein A isolated 14C-labeled IgG from the SF, when allowed to react with goat anti-human gamma chain serum, formed lines of precipitation. Positive autoradiographs confirmed the biosynthesis of IgG by the explant cultures. The in vitro gingival tissue explant culture system described provides a useful model for the study of localized immunoglobulins produced by diseased tissues of JP patients

  9. Structure and component alteration of rabbit Achilles tendon in tissue culture. (United States)

    Hosaka, Yoshinao; Ueda, Hiromi; Yamasaki, Tadatsugu; Suzuki, Daisuke; Matsuda, Naoya; Takehana, Kazushige


    The aim of this study was to investigate alterations of cultured tendon tissues to determine whether tissue culture is a useful method for biological analyses of the tendon. Tendon tissues for tissue culture were isolated from Achilles tendons of rabbits. The tendon segments were placed one segment per well and incubated in growth medium consisting of Dullbecco's modified Eagle's medium supplemented with 5% fetal bovine serum at 37 degrees C in a humidified atmosphere with 5% CO(2) for various periods. The alignment of collagen fibrils was preserved for 48 h, but tendon structure has disintegrated at 96 h. Alcian blue staining and gelatine zymography revealed that proteoglycan markedly diminished and that matrix metalloproteinase (MMPs) activity was upregulated sharply at 72 and 96 h. The ratio of collagen fibrils with large diameter had increased and the mean diameter and mass average diameter value had reached maximum at 48 h. The values then decreased and mean diameters at 72 and 96 h were significantly different from that at 48 h. At 96 h, the ratio of collagen fibrils with small diameters had increased and collagen fibrils with large diameters had disappeared. These findings indicate that structural alteration is possible to be induced by disintegration of collagen fibrils and disappearance of glycosaminoglycans from extracellular matrix (ECM), subsequent of upregulation of MMPs activity. Although the study period is limited, the tissue culture method is available for investigating cell-ECM interaction in tendons.

  10. Production of immunoglobulins in gingival tissue explant cultures from juvenile periodontitis patients

    Energy Technology Data Exchange (ETDEWEB)

    Hall, E.R.; Falkler, W.A. Jr.; Suzuki, J.B. (Univ. of Maryland Dental School, Baltimore (USA))


    B lymphocytes and plasma cells are histologically observed in granulomatous periodontal tissues of juvenile periodontitis (JP) patients. Local immune processes may participate in protective or immunopathologic roles in the pathogenesis of this disease. An in vitro explant culture system was utilized to demonstrate the production of immunoglobulins by diseased JP tissues. Immunodiffusion studies using goat anti-human gamma, alpha, or mu chain serum revealed IgG to be the major immunoglobulin present in 92% of the day 1 supernatant fluids (SF) of the 47 JP gingival tissue explant cultures. IgA was present in 15% of the SF; however, no IgM was detected. Staph Protein A isolated 14C-labeled IgG from the SF, when allowed to react with goat anti-human gamma chain serum, formed lines of precipitation. Positive autoradiographs confirmed the biosynthesis of IgG by the explant cultures. The in vitro gingival tissue explant culture system described provides a useful model for the study of localized immunoglobulins produced by diseased tissues of JP patients.

  11. Solid tissue culture for cytogenetic analysis: a collaborative survey for the Association of Clinical Cytogeneticists. (United States)

    Rodgers, C S; Creasy, M R; Fitchett, M; Maliszewska, C T; Pratt, N R; Waters, J J


    AIMS: To survey the diagnostic service provided by UK laboratories for the culture of solid tissue samples (excluding tumours) and in particular to examine the variation in culture success rates and the problems of maternal cell overgrowth. METHODS: Twenty seven laboratories took part in a collaborative survey during 1992. Each laboratory submitted data on up to a maximum of 60 consecutive specimens (n = 1361) over a six month period. RESULTS: Skin specimens, the largest category received (n = 520), were the most problematic (51% success rate). Culture success rates were significantly lower (43%) when skin specimens (n = 140) were transported dry to the laboratory. Success rates for skin specimens also varied, depending on the origin of the specimen, from 18% for intra-uterine deaths (IUD) (n = 94) to 85% for neonatal deaths (n = 33) and 83% for live patients (n = 54). Culture of selected extra-fetal tissues from IUD, stillbirths and following elective termination of pregnancy (TOP) gave comparable success rates to those achieved for skin samples from neonatal deaths and live births. Skewed sex ratios, female > male, were identified for products of conception (POC) (n = 298) and placental biopsy specimens (n = 97). CONCLUSIONS: By appropriate selection, transport and processing of tissues, and in particular by avoiding relying solely on skin samples from IUD, stillbirths and TOP, an increase in culture success rates for solid tissue samples submitted for cytogenetic analysis could be achieved. The high risk of maternal cell contamination from POC and placental biopsy specimens was also identified in this survey. PMID:8881913

  12. Culture of three-dimensional tissue model and its application in bystander-effect research

    International Nuclear Information System (INIS)

    Wu Ruqun; Xu An; Wu Lijun; Hu Burong


    Compared with the cultured monolayer (2D) cells, three-dimensional (3D) tissue could be more similar to the environment in vivo including the physical support, chemical factors, cell-cell and cell-matrix interaction and so on. With the development of three-dimensional cell culture techniques (TDCC), 3D tissue is widely used in the areas of bystander effect research. This review focuses on introducing the TDCC method and its application in bystander-effect research. First, the development process of 3D tissue culture method was introduced. Secondly, the induction of radiation induced bystander effects both in 2D cell and 3D tissue and its mechanisms were reviewed. Finally, because heavy ion (carbon ion beam) has been developed as a useful tool to cure solid cancer, and the 3D tissue model is an ideal material to study the damages on body after being irradiated and to understand the underlying mechanisms, future study about heavy ion radiation inducing bystander effect in 3D tissue was discussed. (authors)

  13. Mass spectrometric characterization of elements and molecules in cell cultures and tissues

    International Nuclear Information System (INIS)

    Arlinghaus, H.F.; Kriegeskotte, C.; Fartmann, M.; Wittig, A.; Sauerwein, W.; Lipinsky, D.


    Time-of-flight secondary ion mass spectrometry (ToF-SIMS) and laser post-ionization secondary neutral mass spectrometry (laser-SNMS) have been used to image and quantify targeted compounds, intrinsic elements and molecules with subcellular resolution in single cells of both cell cultures and tissues. Special preparation procedures for analyzing cell cultures and tissue materials were developed. Cancer cells type MeWo, incubated with boronated compounds, were sandwiched between two substrates, cryofixed, freeze-fractured and freeze-dried. Also, after injection with boronated compounds, different types of mouse tissues were extracted, prepared on a special specimen carrier and plunged with high velocity into LN 2 -cooled propane for cryofixation. After trimming, these tissue blocks were freeze-dried. The measurements of the K/Na ratio demonstrated that for both cell cultures and tissue materials the special preparation techniques used were appropriate for preserving the chemical and structural integrity of the living cell. The boron images show inter- and intracellular boron signals with different intensities. Molecular images show distinct features partly correlated with the cell structure. A comparison between laser-SNMS and ToF-SIMS showed that especially laser-SNMS is particularly well-suited for identifying specific cell structures and imaging ultratrace element concentrations in tissues





    The study premises and objectives: The idea found at the basis of the discovery of a real value of cultural goods is underlined by the knowledge of their origins and history and of an environmental frame in which these have been produced. This theory could also be applied in regulations provided with certain newly introduced elements as: the absolute interdiction of thefts; the interdiction of destruction and execution of enemy property; the warning of before a terrestrial bombing with nav...

  15. Cryopreservation of testicular tissue before long-term testicular cell culture does not alter in vitro cell dynamics

    NARCIS (Netherlands)

    Baert, Yoni; Braye, Aude; Struijk, Robin B.; van Pelt, Ans M. M.; Goossens, Ellen


    To assess whether testicular cell dynamics are altered during long-term culture after testicular tissue cryopreservation. Experimental basic science study. Reproductive biology laboratory. Testicular tissue with normal spermatogenesis was obtained from six donors. None. Detection and comparison of

  16. Metabolic aspects of growth in HU-treated crown-gall tissue cultures. II. Helianthus annuus

    Directory of Open Access Journals (Sweden)

    Aldona Rennert


    Full Text Available The dynamics of growth and changes in nucleic acid and protein contents in sunflower calluses and tumours cultured in hydroxyurea (HU containing media were examined. HU-induced changes in healthy tissues ran in parallel always in the same direction, in tumourous ones however an uncoupling between DNA synthesis and tissue growth on one hand and RNA and protein synthesis on the other took place. A detailed analysis of the results allows to suppose that the specific activity of HU on tumourous tissue could be an index of: 1 quantitative disturbances in its genes function (2 degree of the lass of sensitivity to the factors of regulation.

  17. Development of human nervous tissue upon differentiation of embryonic stem cells in three-dimensional culture. (United States)

    Preynat-Seauve, Olivier; Suter, David M; Tirefort, Diderik; Turchi, Laurent; Virolle, Thierry; Chneiweiss, Herve; Foti, Michelangelo; Lobrinus, Johannes-Alexander; Stoppini, Luc; Feki, Anis; Dubois-Dauphin, Michel; Krause, Karl Heinz


    Researches on neural differentiation using embryonic stem cells (ESC) require analysis of neurogenesis in conditions mimicking physiological cellular interactions as closely as possible. In this study, we report an air-liquid interface-based culture of human ESC. This culture system allows three-dimensional cell expansion and neural differentiation in the absence of added growth factors. Over a 3-month period, a macroscopically visible, compact tissue developed. Histological coloration revealed a dense neural-like neural tissue including immature tubular structures. Electron microscopy, immunochemistry, and electrophysiological recordings demonstrated a dense network of neurons, astrocytes, and oligodendrocytes able to propagate signals. Within this tissue, tubular structures were niches of cells resembling germinal layers of human fetal brain. Indeed, the tissue contained abundant proliferating cells expressing markers of neural progenitors. Finally, the capacity to generate neural tissues on air-liquid interface differed for different ESC lines, confirming variations of their neurogenic potential. In conclusion, this study demonstrates in vitro engineering of a human neural-like tissue with an organization that bears resemblance to early developing brain. As opposed to previously described methods, this differentiation (a) allows three-dimensional organization, (b) yields dense interconnected neural tissue with structurally and functionally distinct areas, and (c) is spontaneously guided by endogenous developmental cues.

  18. Participation of cob tissue in the transport of medium components into maize kernels cultured in vitro

    International Nuclear Information System (INIS)

    Felker, F.C.


    Maize (Zea mays L.) kernels cultured in vitro while still attached to cob pieces have been used as a model system to study the physiology of kernel development. In this study, the role of the cob tissue in uptake of medium components into kernels was examined. Cob tissue was essential for in vitro kernel growth, and better growth occurred with larger cob/kernel ratios. A symplastically transported fluorescent dye readily permeated the endosperm when supplied in the medium, while an apoplastic dye did not. Slicing the cob tissue to disrupt vascular connections, but not apoplastic continuity, greatly reduced [ 14 C]sucrose uptake into kernels. [ 14 C]Sucrose uptake by cob and kernel tissue was reduced 31% and 68%, respectively, by 5 mM PCMBS. L-[ 14 C]glucose was absorbed much more slowly than D-[ 14 C]glucose. These and other results indicate that phloem loading of sugars occurs in the cob tissue. Passage of medium components through the symplast cob tissue may be a prerequisite for uptake into the kernel. Simple diffusion from the medium to the kernels is unlikely. Therefore, the ability of substances to be transported into cob tissue cells should be considered in formulating culture medium

  19. Assessment of three types of spaceflight hardware for tissue culture studies: Comparison of skeletal tissue growth and differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Klement, B.J. [Space Medicine and Life Sciences Research Center Department of Anatomy Morehouse School of Medicine 720 Westview Dr. SW Atlanta, Georgia30310-1495 (United States); Spooner, B.S. [NASA Specialized Center of Research and Training Division of Biology Ackert Hall Kansas State University Manhattan, Kansas66506 (United States)


    Three different types of spaceflight hardware, the BioProcessing Module (BPM), the Materials Dispersion Apparatus (MDA), and the Fluid Processing Apparatus (FPA), were assessed for their ability to support pre-metatarsal growth and differentiation in experiments conducted on five space shuttle flights. BPM-cultured pre-metatarsal tissue showed no difference in flight and ground control lengths. Flight and ground controls cultured in the MDA grew 135 {mu}m and 141 {mu}m, respectively, in an 11 day experiment. Only five control rods and three flight rods mineralized. In another MDA experiment, pre-metatarsals were cultured at 4{degree}C (277K) or 20{degree}C (293K) for the 16 day mission, then cultured an additional 16 days in laboratory dishes at 37{degree}C (310K). The 20{degree}C (293K) cultures died post-flight. The 4{degree}C (277K) flight pre-metatarsals grew 417 {mu}m more than the 4{degree}C (277K) ground controls post-flight. In 5 and 6 day experiments done in FPAs, flight rods grew longer than ground control rods. In a 14 day experiment, ground control and flight rods also expanded in length, but there was no difference between them. The pre-metatarsals cultured in the FPAs did not mineralize, or terminally differentiate. These experiments demonstrate, that while supporting pre-metatarsal growth in length, the three types of hardware are not suitable to support routine differentiation. {copyright} {ital 1997 American Institute of Physics.}

  20. Metabolic aspects of growth in HU-treated crown-gall tissue cultures. I. Nicotiana tabacum

    Directory of Open Access Journals (Sweden)

    Aldona Rennert


    Full Text Available An influence of hydroxyurea (HU on the growth, DNA and RNA contents and protein synthesis in the tobacco tumour tissue culture was studied in comparison with a homologous callus tissue. In conformity with expectations considerable decrease of DNA level in both tissues is a primary effect of HU activity. This results in the growth inhibition and in the secondary metabolic effects; these effects depend not only on the concentration of inhibitor but also on the age of tissue. In spite of some common features the character of these changes shows a distinct differentiation depending on the tissue type. TMs points to specific modifications of the biochemical regulation of growth in a tumour.

  1. Introgression of genetic material from Zea mays ssp. Mexicana into cultivated maize was facilitated by tissue culture

    International Nuclear Information System (INIS)

    Wang, L.; Gu, X.; Qu, M.; Luan, J.; Zhang, J.


    Zea mays ssp. mexicana, a wild relative of cultivated maize (Z. mays ssp. mays), is a useful gene resource for maize breeding. In this study, two populations were generated by conventional breeding scheme (population I) or tissue culture regime (population II), respectively, to introgress genetic material of Z. mays ssp. mexicana into maize. Karyotype analysis showed that the arm ratios of 10 pairs of chromosomes in parent maize Ye515 and derivative lines from 2 different populations with 26% and 38% chromosome variation frequencies, respectively. Alien chromatin was detected in the root tip cells of progeny plants through genomic in situ hybridization (GISH). There were 3.3 chromosomes carrying alien chromatin on average in population I and 6.5 in population II. The hybridization signals were located mainly at the terminal or sub terminal regions of the chromosomes and the sizes were notably variant among lines. Based on those results, it is concluded that the introgression of genetic material from Z. mays ssp. mexicana into cultivated maize was facilitated by tissue culture, and subsequently some excellent materials for maize breeding were created. (author)

  2. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital. (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M


    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  3. Survey and Recording Technologies in Italian Underwater Cultural Heritage: Research and Public Access Within the Framework of the 2001 UNESCO Convention (United States)

    Secci, Massimiliano


    The 2001 UNESCO Convention on the Protection of the Underwater Cultural Heritage is slowly but peremptorily becoming a standard reference tool for underwater archaeology and underwater cultural heritage management. The many provisions included within the Convention touch on many aspects that are key to an effective protection and promotion of the underwater cultural heritage. Within the web of these provisions many aspects are gaining consideration and driving research in underwater archaeology worldwide. These provisions, when seen within a wider frame of social, economical and technological dynamics, pinpoint many aspects requiring further scrutiny from the disciplinary circle. In the framework of the 2001 UNESCO Convention, this article will analyze the path traveled in technological acquisition in the practice of Italian underwater archaeology and how this has affected the approach to underwater cultural heritage management, particularly highlighting how this process has been further influenced by the adoption in 2001 of the Convention and Italy's ratification of it in 2010.

  4. Tissue culture media supplemented with 10% fetal calf serum contains a castrate level of testosterone.

    NARCIS (Netherlands)

    Sedelaar, J.P.M.; Isaacs, J.T.


    BACKGROUND: Human prostate cancer cells are routinely maintained in media supplemented with 10% Fetal Calf Serum (FCS) to provide androgen. In the present study, total and free testosterone levels in 10%FCS supplemented tissue culture media were determined and compared to levels in intact and

  5. Potato transformation and potato cyst nematode infection on potato plantlets in tissue culture (United States)

    These two protocols describe the methods for generating transgenic potato plants and for evaluating potato cyst nematode (Globodera rostochiensis and G. pallida) infection on potato plantlets in tissue culture. These methods are useful tools that can be used in the study of the interactions between ...

  6. Tissue culture-induced alteration in cytosine methylation in new rice ...

    African Journals Online (AJOL)

    Zizania DNA introgression could induce a large number of genetic and epigenetic changes of the new rice recombinant inbred lines genome. In this present study, we employed inter-simple sequence repeat (ISSR) to further study the genetic and epigenetic changes that are induced by tissue culture. Changes induced by ...

  7. Simple and high yielding method for preparing tissue specific extracellular matrix coatings for cell culture. (United States)

    DeQuach, Jessica A; Mezzano, Valeria; Miglani, Amar; Lange, Stephan; Keller, Gordon M; Sheikh, Farah; Christman, Karen L


    The native extracellular matrix (ECM) consists of a highly complex, tissue-specific network of proteins and polysaccharides, which help regulate many cellular functions. Despite the complex nature of the ECM, in vitro cell-based studies traditionally assess cell behavior on single ECM component substrates, which do not adequately mimic the in vivo extracellular milieu. We present a simple approach for developing naturally derived ECM coatings for cell culture that provide important tissue-specific cues unlike traditional cell culture coatings, thereby enabling the maturation of committed C2C12 skeletal myoblast progenitors and human embryonic stem cells differentiated into cardiomyocytes. Here we show that natural muscle-specific coatings can (i) be derived from decellularized, solubilized adult porcine muscle, (ii) contain a complex mixture of ECM components including polysaccharides, (iii) adsorb onto tissue culture plastic and (iv) promote cell maturation of committed muscle progenitor and stem cells. This versatile method can create tissue-specific ECM coatings, which offer a promising platform for cell culture to more closely mimic the mature in vivo ECM microenvironment.

  8. Altered Loyalties of Neuronal Markers in Cultured Slices of Resected Human Brain Tissue

    NARCIS (Netherlands)

    Verwer, Ronald W. H.; Sluiter, Arja A.; Balesar, Rawien A.; Baayen, Johannes C.; Speijer, Dave; Idema, Sander; Swaab, Dick F.


    Organotypic cultures from normal neocortical tissue obtained at epilepsy surgery show a severe injury response. This response involves both neuronal degeneration and the proliferation of reactive cells. A salient feature of the reactive cells is the co-expression of microglial and astrocytic

  9. [Comparative study on alkaloids of tissue-culture seedling and wild plant of Dendrobium huoshanense ]. (United States)

    Chen, Nai-dong; Gao, Feng; Lin, Xin; Jin, Hui


    To compare the composition and content of alkaloid of Dendrobium huoshanense tissue-culture seedling and wild plant. A comparative evaluation on the quality was carried out by HPLC and TLC methods including the composition and the content of alkaloids. Remarkable variation existed in the two kinds of Dendrobium huoshanense. For the tissue-culture plant, only two alkaloids were checked out by both HPLC and TLC while four alkaloids were observed in the wild plant. The alkaloid content of tissue-culture seedling and wild plant was(0. 29 ± 0. 11)%o and(0. 43 ± 0. 15) %o,respectively. Distinguished difference is observed in both composition and content of alkaloids from the annual shoots of different provenances of Dendrobium huoshanense. It suggested that the quality of tissue-culture seedling of Dendrobium huoshanense might be inconsistent with the wild plant. Furthermore, the established alkaloids-knock-out HPLC method would provide a new research tool on quality control of Chinese medicinal materials which contain unknown alkaloids.

  10. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias]. (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda


    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  11. Distribution of phospholipase C isozymes in various rat tissues and cultured cells

    International Nuclear Information System (INIS)

    Suh, P.G.; Ryu, S.H.; Choi, W.C.; Lee, K.Y.; Rhee, S.G.


    Monoclonal antibodies prepared against PLC-I or PLC-II enzyme did not cross-react with the other. Using a pair of antibodies which recognizes 2 different antigenic sites on the same molecule, radioimmunoassays were developed for the quantitation of PLC-I and PLC-II in homogenates of various tissues and cultured cells, prepared by homogenization in a 2 M KCl buffer. The contents of PLC enzymes were measured in 19 rat tissues, in human platelets and in 17 cultured cells. Results indicate that the concentration of PLC-I and PLC-II is very high in brain, PLC-I is localized mainly in brain and partly in seminal vesicles, PLC-II is found in most tissues and cells. PLC-I is highly localized even in brain: 5 different neuroblastoma did not contain PLC-I while 2 glioma and 1 astrocytoma contained significant amounts

  12. Impact of Organic and Conventional Systems of Coffee Farming on Soil Properties and Culturable Microbial Diversity. (United States)

    Velmourougane, Kulandaivelu


    A study was undertaken with an objective of evaluating the long-term impacts of organic (ORG) and conventional (CON) methods of coffee farming on soil physical, chemical, biological, and microbial diversity. Electrical conductivity and bulk density were found to increase by 34% and 21%, respectively, in CON compared to ORG system, while water holding capacity was found decreased in both the systems. Significant increase in organic carbon was observed in ORG system. Major nutrients, nitrogen and potassium, levels showed inclination in both ORG and CON system, but the trend was much more pronounced in CON system. Phosphorus was found to increase in both ORG and CON system, but its availability was found to be more with CON system. In biological attributes, higher soil respiration and fluorescein diacetate activity were recorded in ORG system compared to CON system. Higher soil urease activity was observed in CON system, while dehydrogenase activity does not show significant differences between ORG and CON systems. ORG system was found to have higher macrofauna (31.4%), microbial population (34%), and microbial diversity indices compared to CON system. From the present study, it is accomplished that coffee soil under long-term ORG system has better soil properties compared to CON system.

  13. Whole genome characterization of non-tissue culture adapted HRSV strains in severely infected children

    Directory of Open Access Journals (Sweden)

    Kumaria Rajni


    Full Text Available Abstract Background Human respiratory syncytial virus (HRSV is the most important virus causing lower respiratory infection in young children. The complete genetic characterization of RSV clinical strains is a prerequisite for understanding HRSV infection in the clinical context. Current information about the genetic structure of the HRSV genome has largely been obtained using tissue culture adapted viruses. During tissue culture adaptation genetic changes can be introduced into the virus genome, which may obscure subtle variations in the genetic structure of different RSV strains. Methods In this study we describe a novel Sanger sequencing strategy which allowed the complete genetic characterisation of 14 clinical HRSV strains. The viruses were sequenced directly in the nasal washes of severely hospitalized children, and without prior passage of the viruses in tissue culture. Results The analysis of nucleotide sequences suggested that vRNA length is a variable factor among primary strains, while the phylogenetic analysis suggests selective pressure for change. The G gene showed the greatest sequence variation (2-6.4%, while small hydrophobic protein and matrix genes were completely conserved across all clinical strains studied. A number of sequence changes in the F, L, M2-1 and M2-2 genes were observed that have not been described in laboratory isolates. The gene junction regions showed more sequence variability, and in particular the intergenic regions showed a highest level of sequence variation. Although the clinical strains grew slower than the HRSVA2 virus isolate in tissue culture, the HRSVA2 isolate and clinical strains formed similar virus structures such as virus filaments and inclusion bodies in infected cells; supporting the clinical relevance of these virus structures. Conclusion This is the first report to describe the complete genetic characterization of HRSV clinical strains that have been sequenced directly from clinical

  14. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau


    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  15. Metabolomics reveals the heterogeneous secretome of two entomopathogenic fungi to ex vivo cultured insect tissues.

    Directory of Open Access Journals (Sweden)

    Charissa de Bekker

    Full Text Available Fungal entomopathogens rely on cellular heterogeneity during the different stages of insect host infection. Their pathogenicity is exhibited through the secretion of secondary metabolites, which implies that the infection life history of this group of environmentally important fungi can be revealed using metabolomics. Here metabolomic analysis in combination with ex vivo insect tissue culturing shows that two generalist isolates of the genus Metarhizium and Beauveria, commonly used as biological pesticides, employ significantly different arrays of secondary metabolites during infectious and saprophytic growth. It also reveals that both fungi exhibit tissue specific strategies by a distinguishable metabolite secretion on the insect tissues tested in this study. In addition to showing the important heterogeneous nature of these two entomopathogens, this study also resulted in the discovery of several novel destruxins and beauverolides that have not been described before, most likely because previous surveys did not use insect tissues as a culturing system. While Beauveria secreted these cyclic depsipeptides when encountering live insect tissues, Metarhizium employed them primarily on dead tissue. This implies that, while these fungi employ comparable strategies when it comes to entomopathogenesis, there are most certainly significant differences at the molecular level that deserve to be studied.

  16. The effect of aspirin nanoemulsion on TNFα and iNOS in gastric tissue in comparison with conventional aspirin

    Directory of Open Access Journals (Sweden)

    Mahmoud FA


    Full Text Available Fatma Abd Elhalim Mahmoud,1,2 Khalid S Hashem,3 Asmaa Mohammed M Hussein Elkelawy21Medical Pharmacology Department, Faculty of Medicine, Cairo University, Giza, 2Clinical Pharmacology Department, Faculty of Medicine, 3Biochemistry Department, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, EgyptBackground: No dose of aspirin is free of bleeding risk. Even at a dose as low as 75 mg/day, the risk of upper gastrointestinal bleeding is twice as high as among nonusers. Nanoemulsions (NEs are emulsion systems with droplet size in nanometer scale in which oil or water droplets are finely dispersed in the opposite phase with the help of a suitable surfactant to stabilize the system.Objectives: The objective of this study was to determine the effect of aspirin NE in comparison to conventional aspirin.Materials and methods: A total of 24 male rats were used in the study and arbitrarily assigned to four groups. Group 1 was the control group, and was given saline. Group 2 was given blank NE 1.5 mL/kg orally. Group 3 was given aspirin 30 mg/kg body weight orally. Group 4 was given aspirin NE 30 mg/kg body weight orally. Rats were killed, and gastric tissue was quickly excised after dissection of the animals. The tissues were divided into three pieces. The first one was kept in formalin 10% for pathological investigation. The second piece was kept in liquid nitrogen for molecular investigation. The third piece was homogenized in ten volumes of ice-cold phosphate-buffered saline (pH 7 using a Teflon homogenizer until a uniform suspension was obtained. The homogenate was centrifuged at 4,000 rpm for 30 minutes at 4°C to separate the supernatant from cellular debris. The supernatant was then used for the estimation of biochemical assays.Results: The present study shows that aspirin has a toxic effect on the stomach as a result of inducing marked oxidative damage and the release of reactive oxygen species. This was shown by the significant

  17. Three-Dimensional Culture Model of Skeletal Muscle Tissue with Atrophy Induced by Dexamethasone. (United States)

    Shimizu, Kazunori; Genma, Riho; Gotou, Yuuki; Nagasaka, Sumire; Honda, Hiroyuki


    Drug screening systems for muscle atrophy based on the contractile force of cultured skeletal muscle tissues are required for the development of preventive or therapeutic drugs for atrophy. This study aims to develop a muscle atrophy model by inducing atrophy in normal muscle tissues constructed on microdevices capable of measuring the contractile force and to verify if this model is suitable for drug screening using the contractile force as an index. Tissue engineered skeletal muscles containing striated myotubes were prepared on the microdevices for the study. The addition of 100 µM dexamethasone (Dex), which is used as a muscle atrophy inducer, for 24 h reduced the contractile force significantly. An increase in the expression of Atrogin-1 and MuRF-1 in the tissues treated with Dex was established. A decrease in the number of striated myotubes was also observed in the tissues treated with Dex. Treatment with 8 ng/mL Insulin-like Growth Factor (IGF-I) for 24 h significantly increased the contractile force of the Dex-induced atrophic tissues. The same treatment, though, had no impact on the force of the normal tissues. Thus, it is envisaged that the atrophic skeletal muscle tissues induced by Dex can be used for drug screening against atrophy.

  18. Comparing culture and molecular methods for the identification of microorganisms involved in necrotizing soft tissue infections

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan


    BACKGROUND: Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold...... to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also...... that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially...

  19. Prevention of pink-pigmented methylotrophic bacteria (Methylohacterium mesophilicum) contamination of plant tissue cultures. (United States)

    Chanprame, S; Todd, J J; Widholm, J M


    Pink-pigmented facultative methylotrophic bacteria (PPFMs) have been found on the surfaces of leaves of most plants tested. We found PPFMs on the leaf surfaces of all 40 plants (38 species) tested and on soybean pods by pressing onto AMS medium with methanol as the sole carbon source. The abundance ranged from 0.5 colony forming unit (cfu) /cm(2) to 69.4 cfu/cm(2) on the leaf surfaces. PPFMs were found in homogenized leaf tissues of only 4 of the species after surface disinfestation with 1.05% sodium hypochlorite and were rarely found in cultures initiated from surface disinfested Datura innoxia leaves or inside surface disinfested soybean pods. Of 20 antibiotics tested for PPFM growth inhibition, rifampicin was the most effective and of seven others which also inhibited PPFM growth, cefotaxime should be the most useful due to the expected low plant cell toxicity. These antibiotics could be used in concert with common surface sterilization procedures to prevent the introduction or to eliminate PPFM bacteria in tissue cultures. Thus, while PPFMs are present on the surfaces of most plant tissues, surface disinfestation alone can effectively remove them so that uncontaminated tissue cultures can be initiated in most cases.

  20. Studies on the reaction in tissue culture of tomato genotypes under biotic stress

    Directory of Open Access Journals (Sweden)

    Ewa Hanus-Fajerska


    Full Text Available Plant regeneration in vitro from virus-infected somatic tomato (Lycopersicon sp. tissue was performed. Regeneration experiments were started after the determination of virus presence, using enzyme-linked immunosorbent assay, in leaves used as a source of explants. Leaf explants infected with selected strains of tomato mosaic Tobamovirus or cucumber mosaic Cucumovirus respectively, were cultured on a standarised MS agar medium to induce adventitious shoots, which were afterwards excised, rooted in vitro and cultured to plants. Explants were also screened for their ability to produce callus. Diverse effects of viral infection, ranging from stimulation to inhibition of callus formation and of morphogenesis rate, were observed. The health condition of the tissue proved to affect regeneration potential of Lycopersicon esculentum, whereas wild accesions did not react in that case so distinctly. In cultivated tomato was encountered the decline in competence to reproduce shoots adventitiously in infected tissue. There was also relationship between donor plant health condition and adventitious root formation in regenerated shoots. Experiments with short-term cultures of L. esculenum reveled also that a certain number of shoots regenerated from diseased tissue can be virus-free.

  1. Mouse pancreas tissue slice culture facilitates long-term studies of exocrine and endocrine cell physiology in situ. (United States)

    Marciniak, Anja; Selck, Claudia; Friedrich, Betty; Speier, Stephan


    Studies on pancreatic cell physiology rely on the investigation of exocrine and endocrine cells in vitro. Particularly, in the case of the exocrine tissue these studies have suffered from a reduced functional viability of acinar cells in culture. As a result not only investigations on dispersed acinar cells and isolated acini were limited in their potential, but also prolonged studies on pancreatic exocrine and endocrine cells in an intact pancreatic tissue environment were unfeasible. To overcome these limitations, we aimed to establish a pancreas tissue slice culture platform to allow long-term studies on exocrine and endocrine cells in the intact pancreatic environment. Mouse pancreas tissue slice morphology was assessed to determine optimal long-term culture settings for intact pancreatic tissue. Utilizing optimized culture conditions, cell specificity and function of exocrine acinar cells and endocrine beta cells were characterized over a culture period of 7 days. We found pancreas tissue slices cultured under optimized conditions to have intact tissue specific morphology for the entire culture period. Amylase positive intact acini were present at all time points of culture and acinar cells displayed a typical strong cell polarity. Amylase release from pancreas tissue slices decreased during culture, but maintained the characteristic bell-shaped dose-response curve to increasing caerulein concentrations and a ca. 4-fold maximal over basal release. Additionally, endocrine beta cell viability and function was well preserved until the end of the observation period. Our results show that the tissue slice culture platform provides unprecedented maintenance of pancreatic tissue specific morphology and function over a culture period for at least 4 days and in part even up to 1 week. This analytical advancement now allows mid -to long-term studies on the cell biology of pancreatic disorder pathogenesis and therapy in an intact surrounding in situ.

  2. Mouse pancreas tissue slice culture facilitates long-term studies of exocrine and endocrine cell physiology in situ.

    Directory of Open Access Journals (Sweden)

    Anja Marciniak

    Full Text Available Studies on pancreatic cell physiology rely on the investigation of exocrine and endocrine cells in vitro. Particularly, in the case of the exocrine tissue these studies have suffered from a reduced functional viability of acinar cells in culture. As a result not only investigations on dispersed acinar cells and isolated acini were limited in their potential, but also prolonged studies on pancreatic exocrine and endocrine cells in an intact pancreatic tissue environment were unfeasible. To overcome these limitations, we aimed to establish a pancreas tissue slice culture platform to allow long-term studies on exocrine and endocrine cells in the intact pancreatic environment. Mouse pancreas tissue slice morphology was assessed to determine optimal long-term culture settings for intact pancreatic tissue. Utilizing optimized culture conditions, cell specificity and function of exocrine acinar cells and endocrine beta cells were characterized over a culture period of 7 days. We found pancreas tissue slices cultured under optimized conditions to have intact tissue specific morphology for the entire culture period. Amylase positive intact acini were present at all time points of culture and acinar cells displayed a typical strong cell polarity. Amylase release from pancreas tissue slices decreased during culture, but maintained the characteristic bell-shaped dose-response curve to increasing caerulein concentrations and a ca. 4-fold maximal over basal release. Additionally, endocrine beta cell viability and function was well preserved until the end of the observation period. Our results show that the tissue slice culture platform provides unprecedented maintenance of pancreatic tissue specific morphology and function over a culture period for at least 4 days and in part even up to 1 week. This analytical advancement now allows mid -to long-term studies on the cell biology of pancreatic disorder pathogenesis and therapy in an intact surrounding in situ.

  3. Transcriptomic comparisons between cultured human adipose tissue-derived pericytes and mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Lindolfo da Silva Meirelles


    Full Text Available Mesenchymal stromal cells (MSCs, sometimes called mesenchymal stem cells, are cultured cells able to give rise to mature mesenchymal cells such as adipocytes, osteoblasts, and chondrocytes, and to secrete a wide range of trophic and immunomodulatory molecules. Evidence indicates that pericytes, cells that surround and maintain physical connections with endothelial cells in blood vessels, can give rise to MSCs (da Silva Meirelles et al., 2008 [1]; Caplan and Correa, 2011 [2]. We have compared the transcriptomes of highly purified, human adipose tissue pericytes subjected to culture-expansion in pericyte medium or MSC medium, with that of human adipose tissue MSCs isolated with traditional methods to test the hypothesis that their transcriptomes are similar (da Silva Meirelles et al., 2015 [3]. Here, we provide further information and analyses of microarray data from three pericyte populations cultured in pericyte medium, three pericyte populations cultured in MSC medium, and three adipose tissue MSC populations deposited in the Gene Expression Omnibus under accession number GSE67747. Keywords: Mesenchymal stromal cells, Mesenchymal stem cells, Pericytes, Microarrays

  4. Allelopathy of small everlasting (Antennaria microphylla) : Phytotoxicity to leafy spurge (Euphorbia esula) in tissue culture. (United States)

    Hogan, M E; Manners, G D


    Media and media extracts from callus cultures of small everlasting (Antennaria microphylla) inhibited leafy spurge (Euphorbia esula L.) callus tissue and suspension culture growth (50 and 70% of control, respectively) and were phytotoxic in lettuce and leafy spurge root elongation bioassays (64 and 77% of control, respectively). Hydroquinone, a phytotoxic compound previously isolated from small everlasting, was also biosynthesized by callus and suspension cultures of this species. Exogenously supplied hydroquinone (0.5 mM) was toxic to leafy spurge suspension culture cells and was only partially biotransformed to its nontoxic water-soluble monoglucoside, arbutin, by these cells. This report confirms the chronic involvement of hydroquinone in the allelopathic interaction between small everlasting and leafy spurge.

  5. A Protocol for Rapid, Measurable Plant Tissue Culture Using Stem Disc Meristem Micropropagation of Garlic ("Allium Sativum L.") (United States)

    Peat, Gerry; Jones, Meriel


    Plant tissue culture is becoming an important technique for the mass propagation of plants. Problems with existing techniques, such as slow growth and contamination, have restricted the practical work in plant tissue culture carried out in schools. The new protocol using garlic meristematic stem discs explained in this article addresses many of…

  6. Heritability of regeneration in tissue cultures of sweet potato (Ipomoea batatas L.). (United States)

    Templeton-Somers, K M; Collins, W W


    A population of open-pollinated progeny from 12 parents, and the 12 parents, was surveyed for in vitro growth and regeneration characteristics. Four different tissue culture procedures involving different media and the use of different explants to initiate the cultures were used. Petiole explants from young leaves were used as explants for initiation of callus cultures. These were evaluated for callus growth rate, friability, and callus color and texture, before transferring to each of three different regeneration media for evaluation of morphogenetic potential. Small shoot tips also were used to initiate callus cultures, which were evaluated for the same growth characteristics and transferred to growth-regulator free regeneration media. Regeneration occurred through root or shoot regeneration or through embryogenesis. Tissue culture treatment effects, as well as genotypic effects, were highly significant in determining: the types of callus produced, callus growth rates, color and texture on the two types of media used for the second and third subcultures. The family x treatment interaction was generally not statistically significant, affecting only callus color. Estimates of narrow sense heritability for callus growth rate in both the second and third subcultures were high enough (0.35 and 0.63, respectively) for the evaluation of parental lines for selection procedures. These characteristics were also the only early culture callus traits that were consistently correlated with later morphogenesis of the cultures. They were negatively correlated with root or shoot regeneration. The occurence of somatic embryogenesis was not correlated with early callus growth characteristics. Genetic and treatment effects were highly significant in the evaluation of morphogenetic potential, through root or shoot regeneration, or through embryogenesis. Regeneration of all types was of low frequency for all procedures, expressed in ≦ 11% of the cultures of the total population.

  7. Antiandrogenic actions of medroxyprogesterone acetate on epithelial cells within normal human breast tissues cultured ex vivo. (United States)

    Ochnik, Aleksandra M; Moore, Nicole L; Jankovic-Karasoulos, Tanja; Bianco-Miotto, Tina; Ryan, Natalie K; Thomas, Mervyn R; Birrell, Stephen N; Butler, Lisa M; Tilley, Wayne D; Hickey, Theresa E


    Medroxyprogesterone acetate (MPA), a component of combined estrogen-progestin therapy (EPT), has been associated with increased breast cancer risk in EPT users. MPA can bind to the androgen receptor (AR), and AR signaling inhibits cell growth in breast tissues. Therefore, the aim of this study was to investigate the potential of MPA to disrupt AR signaling in an ex vivo culture model of normal human breast tissue. Histologically normal breast tissues from women undergoing breast surgical operation were cultured in the presence or in the absence of the native AR ligand 5α-dihydrotestosterone (DHT), MPA, or the AR antagonist bicalutamide. Ki67, bromodeoxyuridine, B-cell CLL/lymphoma 2 (BCL2), AR, estrogen receptor α, and progesterone receptor were detected by immunohistochemistry. DHT inhibited the proliferation of breast epithelial cells in an AR-dependent manner within tissues from postmenopausal women, and MPA significantly antagonized this androgenic effect. These hormonal responses were not commonly observed in cultured tissues from premenopausal women. In tissues from postmenopausal women, DHT either induced or repressed BCL2 expression, and the antiandrogenic effect of MPA on BCL2 was variable. MPA significantly opposed the positive effect of DHT on AR stabilization, but these hormones had no significant effect on estrogen receptor α or progesterone receptor levels. In a subset of postmenopausal women, MPA exerts an antiandrogenic effect on breast epithelial cells that is associated with increased proliferation and destabilization of AR protein. This activity may contribute mechanistically to the increased risk of breast cancer in women taking MPA-containing EPT.

  8. Macroporous Hydrogel Scaffolds for Three-Dimensional Cell Culture and Tissue Engineering. (United States)

    Fan, Changjiang; Wang, Dong-An


    Hydrogels have been promising candidate scaffolds for cell delivery and tissue engineering due to their tissue-like physical properties and capability for homogeneous cell loading. However, the encapsulated cells are generally entrapped and constrained in the submicron- or nanosized gel networks, seriously limiting cell growth and tissue formation. Meanwhile, the spatially confined settlement inhibits attachment and spreading of anchorage-dependent cells, leading to their apoptosis. In recent years, macroporous hydrogels have attracted increasing attention in use as cell delivery vehicles and tissue engineering scaffolds. The introduction of macropores within gel scaffolds not only improves their permeability for better nutrient transport but also creates space/interface for cell adhesion, proliferation, and extracellular matrix deposition. Herein, we will first review the development of macroporous gel scaffolds and outline the impact of macropores on cell behaviors. In the first part, the advantages and challenges of hydrogels as three-dimensional (3D) cell culture scaffolds will be described. In the second part, the fabrication of various macroporous hydrogels will be presented. Third, the enhancement of cell activities within macroporous gel scaffolds will be discussed. Finally, several crucial factors that are envisaged to propel the improvement of macroporous gel scaffolds are proposed for 3D cell culture and tissue engineering.

  9. Characterization of cytoskeletal and junctional proteins expressed by cells cultured from human arachnoid granulation tissue

    Directory of Open Access Journals (Sweden)

    Mehta Bhavya C


    Full Text Available Abstract Background The arachnoid granulations (AGs are projections of the arachnoid membrane into the dural venous sinuses. They function, along with the extracranial lymphatics, to circulate the cerebrospinal fluid (CSF to the systemic venous circulation. Disruption of normal CSF dynamics may result in increased intracranial pressures causing many problems including headaches and visual loss, as in idiopathic intracranial hypertension and hydrocephalus. To study the role of AGs in CSF egress, we have grown cells from human AG tissue in vitro and have characterized their expression of those cytoskeletal and junctional proteins that may function in the regulation of CSF outflow. Methods Human AG tissue was obtained at autopsy, and explanted to cell culture dishes coated with fibronectin. Typically, cells migrated from the explanted tissue after 7–10 days in vitro. Second or third passage cells were seeded onto fibronectin-coated coverslips at confluent densities and grown to confluency for 7–10 days. Arachnoidal cells were tested using immunocytochemical methods for the expression of several common cytoskeletal and junctional proteins. Second and third passage cultures were also labeled with the common endothelial markers CD-31 or VE-cadherin (CD144 and their expression was quantified using flow cytometry analysis. Results Confluent cultures of arachnoidal cells expressed the intermediate filament protein vimentin. Cytokeratin intermediate filaments were expressed variably in a subpopulation of cells. The cultures also expressed the junctional proteins connexin43, desmoplakin 1 and 2, E-cadherin, and zonula occludens-1. Flow cytometry analysis indicated that second and third passage cultures failed to express the endothelial cell markers CD31 or VE-cadherin in significant quantities, thereby showing that these cultures did not consist of endothelial cells from the venous sinus wall. Conclusion To our knowledge, this is the first report of

  10. Tissue culture and associated biotechnological interventions for the improvement of coconut (Cocos nucifera L.): a review. (United States)

    Nguyen, Quang Thien; Bandupriya, H D Dharshani; López-Villalobos, Arturo; Sisunandar, S; Foale, Mike; Adkins, Steve W


    The present review discusses not only advances in coconut tissue culture and associated biotechnological interventions but also future research directions toward the resilience of this important palm crop. Coconut (Cocos nucifera L.) is commonly known as the 'tree of life'. Every component of the palm can be used to produce items of value and many can be converted into industrial products. Coconut cultivation faces a number of acute problems that reduce its productivity and competitiveness. These problems include various biotic and abiotic challenges as well as an unstable market for its traditional oil-based products. Around 10 million small-holder farmers cultivate coconut palms worldwide on c. 12 million hectares of land, and many more people own a few coconut palms that contribute to their livelihoods. Inefficiency in the production of seedlings for replanting remains an issue; however, tissue culture and other biotechnological interventions are expected to provide pragmatic solutions. Over the past 60 years, much research has been directed towards developing and improving protocols for (i) embryo culture; (ii) clonal propagation via somatic embryogenesis; (iii) homozygote production via anther culture; (iv) germplasm conservation via cryopreservation; and (v) genetic transformation. Recently other advances have revealed possible new ways to improve these protocols. Although effective embryo culture and cryopreservation are now possible, the limited frequency of conversion of somatic embryos to ex vitro seedlings still prevents the large-scale clonal propagation of coconut. This review illustrates how our knowledge of tissue culture and associated biotechnological interventions in coconut has so far developed. Further improvement of protocols and their application to a wider range of germplasm will continue to open up new horizons for the collection, conservation, breeding and productivity of coconut.

  11. Low cost options for tissue culture technology in developing countries. Proceedings of a technical meeting

    International Nuclear Information System (INIS)


    Tissue culture technology is used for the production of doubled haploids, cryopreservation, propagating new plant varieties, conserving rare and endangered plants, difficult-to-propagate plants, and to produce secondary metabolites and transgenic plants. The production of high quality planting material of crop plants and fruit trees, propagated from vegetative parts, has created new opportunities in global trading, benefited growers, farmers, and nursery owners, and improved rural employment. However, there are still major opportunities to produce and distribute high quality planting material, e.g. crops like banana, date palm, cassava, pineapple, plantain, potato, sugarcane, sweet potato, yams, ornamentals, fruit and forest trees. The main advantage of tissue culture technology lies in the production of high quality and uniform planting material that can be multiplied on a year-round basis under disease-free conditions anywhere irrespective of the season and weather. However, the technology is capital, labor and energy intensive. Although, labor is cheap in many developing countries, the resources of trained personnel and equipment are often not readily available. In addition, energy, particularly electricity, and clean water are costly. The energy requirements for tissue culture technology depend on day temperature, day-length and relative humidity, and they have to be controlled during the process of propagation. Individual plant species also differ in their growth requirements. Hence, it is necessary to have low cost options for weaning, hardening of micropropagated plants and finally growing them in the field. This publication describes options for reducing costs to establish and operate tissue culture facilities and primarily focus on plant micropropagation. It includes papers on the basics of tissue culture technology, low cost options for the design of laboratories, use of culture media and containers, energy and labor saving, integration and adoption of

  12. Low cost options for tissue culture technology in developing countries. Proceedings of a technical meeting

    Energy Technology Data Exchange (ETDEWEB)



    Tissue culture technology is used for the production of doubled haploids, cryopreservation, propagating new plant varieties, conserving rare and endangered plants, difficult-to-propagate plants, and to produce secondary metabolites and transgenic plants. The production of high quality planting material of crop plants and fruit trees, propagated from vegetative parts, has created new opportunities in global trading, benefited growers, farmers, and nursery owners, and improved rural employment. However, there are still major opportunities to produce and distribute high quality planting material, e.g. crops like banana, date palm, cassava, pineapple, plantain, potato, sugarcane, sweet potato, yams, ornamentals, fruit and forest trees. The main advantage of tissue culture technology lies in the production of high quality and uniform planting material that can be multiplied on a year-round basis under disease-free conditions anywhere irrespective of the season and weather. However, the technology is capital, labor and energy intensive. Although, labor is cheap in many developing countries, the resources of trained personnel and equipment are often not readily available. In addition, energy, particularly electricity, and clean water are costly. The energy requirements for tissue culture technology depend on day temperature, day-length and relative humidity, and they have to be controlled during the process of propagation. Individual plant species also differ in their growth requirements. Hence, it is necessary to have low cost options for weaning, hardening of micropropagated plants and finally growing them in the field. This publication describes options for reducing costs to establish and operate tissue culture facilities and primarily focus on plant micropropagation. It includes papers on the basics of tissue culture technology, low cost options for the design of laboratories, use of culture media and containers, energy and labor saving, integration and adoption of

  13. Functional enhancement of chitosan and nanoparticles in cell culture, tissue engineering, and pharmaceutical applications

    Directory of Open Access Journals (Sweden)

    Wenjuan eGao


    Full Text Available Abstract: As a biomaterial, chitosan has been widely used in tissue engineering, wound healing, drug delivery, and other biomedical applications. It can be formulated in a variety of forms, such as powder, film, sphere, gel and fiber. These features make chitosan an almost ideal biomaterial in cell culture applications, and cell cultures arguably constitute the most practical way to evaluate biocompatibility and biotoxicity. The advantages of cell cultures are that they can be performed under totally controlled environments, allow high throughput functional screening, and are less costly, as compared to other assessment methods. Chitosan can also be modified into multilayer composite by combining with other polymers and moieties to alter the properties of chitosan for particular biomedical applications. This review briefly depicts and discusses applications of chitosan and nanoparticles in cell culture, in particular, the effects of chitosan and nanoparticles on cell adhesion, cell survival, and the underlying molecular mechanisms: both stimulatory and inhibitory influences are discussed. Our aim is to update the current status of how nanoparticles can be utilized to modify the properties of chitosan to advance the art of tissue engineering by using cell cultures.

  14. Cell culture density affects the proliferation activity of human adipose tissue stem cells. (United States)

    Kim, Dae Seong; Lee, Myoung Woo; Ko, Young Jong; Chun, Yong Hoon; Kim, Hyung Joon; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee


    In this study, we investigated the effect of cell density on the proliferation activity of human mesenchymal stem cells (MSCs) derived from adipose tissue (AT-MSCs) over time in culture. Passage #4 (P4) and #12 (P12) AT-MSCs from two donors were plated at a density of 200 (culture condition 1, CC1) or 5000 (culture condition 2, CC2) cells cm(-2) . After 7 days of incubation, P4 and P12 AT-MSCs cultured in CC1 were thin and spindle-shaped, whereas those cultured in CC2 had extensive cell-to-cell contacts and an expanded cell volume. In addition, P4 and P12 AT-MSCs in CC1 divided more than three times, while those in CC2 divided less than once on average. Flow cytometric analysis using 5(6)-carboxyfluorescein diacetate N-succinimidyl ester dye showed that the fluorescence intensity of AT-MSCs was lower in CC1 than in CC2. Furthermore, expression of proliferation-associated genes, such as CDC45L, CDC20A and KIF20A, in P4 AT-MSCs was higher in CC1 than in CC2, and this difference was also observed in P12 AT-MSCs. These data demonstrated that cell culture density affects the proliferation activity of MSCs, suggesting that it is feasible to design a strategy to prepare suitable MSCs using specific culture conditions. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Co-cultures and cell sheet engineering as relevant tools to improve the outcome of bone tissue engineering strategies


    Pirraco, Rogério


    Taking into consideration the complex biology of bone tissue it is quite clear that the understanding of the cellular interactions that regulate the homeostasis and regeneration of this remarkable tissue is essential for a successful Tissue Engineering strategy. The in vitro study of these cellular interactions relies on co-culture systems, a tremendously useful methodology where two or more cell types are cultured at the same time. Such strategy increases the complexity of typ...

  16. Three-dimensional hydrogel cell culture systems for modeling neural tissue (United States)

    Frampton, John

    Two-dimensional (2-D) neural cell culture systems have served as physiological models for understanding the cellular and molecular events that underlie responses to physical and chemical stimuli, control sensory and motor function, and lead to the development of neurological diseases. However, the development of three-dimensional (3-D) cell culture systems will be essential for the advancement of experimental research in a variety of fields including tissue engineering, chemical transport and delivery, cell growth, and cell-cell communication. In 3-D cell culture, cells are provided with an environment similar to tissue, in which they are surrounded on all sides by other cells, structural molecules and adhesion ligands. Cells grown in 3-D culture systems display morphologies and functions more similar to those observed in vivo, and can be cultured in such a way as to recapitulate the structural organization and biological properties of tissue. This thesis describes a hydrogel-based culture system, capable of supporting the growth and function of several neural cell types in 3-D. Alginate hydrogels were characterized in terms of their biomechanical and biochemical properties and were functionalized by covalent attachment of whole proteins and peptide epitopes. Methods were developed for rapid cross-linking of alginate hydrogels, thus permitting the incorporation of cells into 3-D scaffolds without adversely affecting cell viability or function. A variety of neural cell types were tested including astrocytes, microglia, and neurons. Cells remained viable and functional for longer than two weeks in culture and displayed process outgrowth in 3-D. Cell constructs were created that varied in cell density, type and organization, providing experimental flexibility for studying cell interactions and behavior. In one set of experiments, 3-D glial-endothelial cell co-cultures were used to model blood-brain barrier (BBB) structure and function. This co-culture system was

  17. [Extraction and analysis of chemical components of essential oil in Thymus vulgaris of tissue culture]. (United States)

    Li, Xiao-Dong; Yang, Li; Xu, Shi-Qian; Li, Jian-Guo; Cheng, Zhi-Hui; Dang, Jian-Zhang


    To extract the essential oils from the Seedlings, the Aseptic Seedlings and the Tissue Culture Seedlings of Thymus vulgaris and analyze their chemical components and the relative contents. The essential oils were extracted by steam distillation, the chemical components and the relative contents were identified and analyzed by gas chromatography-mass spectrometry (GC/MS) and peak area normalization method. The main chemical components of essential oil in these three samples had no significant difference, they all contained the main components of essential oil in Thymus vulgaris: Thymol, Carvacrol, o-Cymene, gamma-Terpinene, Caryophyllene et al. and only had a slight difference in the relative content. This study provides important theoretical foundation and data reference for further study on production of essential oil in thyme by tissue culture technology.

  18. Morphological, biochemical and genetic influence of mutagen treatments on medicinal plant tissue cultures

    International Nuclear Information System (INIS)

    Onisei, T.; Toth, E.; Tesio, B.; Floria, F.


    Gamma rays and/or alkylant agents have been applied on callus tissue, young regenerants and cell suspension in order to establish their effect on morphogenesis, regeneration ability and biosynthetic potential. Growth dynamics, morpho-anatomic variables, secondary metabolite production, cell cytogenetics, enzyme specific activities, isoperoxidase and isoesterase patterns were analyzed in relation to the morphogenetic response of Atropa belladonna, Datura innoxia, Lavandula angustifolia, Chamomilla recutita, Digitalis lanata and Vinca minor tissue cultures. The effects of gamma-ray doses varied from one species to another; 10 to 20 Gy were generally able to stimulate growth and plant regeneration (via organogenesis and somatic embryogenesis), while 10 to 50 Gy enhanced secondary metabolite biosynthesis both in callus and cell suspension culture. Semnificative increase of secondary metabolite production was obtained when treatments with EMS (0.1-0.2%) have been applied to young regenerants. Many differences in biological features and biochemical behaviour were registered 20 days and one year, respectively, after treatment. (author)

  19. Improvement of potato tolerance to salinity using tissue culture techniques and irradiation with in vitro selection

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Arabi, M. I. E.


    A mutation breeding program was conducted to improve potato (Solanum tuberosum) tolerance to salinity. In vitro cultured explants from potato cvs. Draga, Diamant, Spunta were irradiated with gamma doses 25, 30, and 35 Gy. Mutants were isolated to get rid of chimeral tissues and subsequently propagated for in vitro and pot selection pressure. Cultivar Sponta produced the highest number of tolerant plants (4) and only one plant was obtained from Diamant. (authors)

  20. Effects of CO 2 concentration and moisture content of sugar-free media on the tissue-cultured plantlets in a large growth chamber (United States)

    Qu, Y. H.; Lin, C.; Zhou, W.; Li, Y.; Chen, B.; Chen, G. Q.


    The dynamic fluctuations of CO 2 concentration in the tissue culture growth chamber after transplantation of petunia, chrysanthemum and tomato plantlets were recorded with a real-time control system to determine the critical CO 2 concentration levels of 35 μl l -1 at which CO 2 enrichment is needed. The experimental data showed that the tissue-cultured plantlets of petunia, chrysanthemum and tomato had the same CO 2 concentration dynamics. The results indicated that CO 2 enrichment was proper on the second day after transplantation. Petunia plantlets were used to conduct experiments under PPFD of 80 μmol m -2 s -1, and CO 2 concentrations of 350 ± 50 μl l -1, 650 ± 50 μl l -1 and 950 ± 50 μl l -1 as well as medium moisture contents of 60%, 70% and 80%, with the result that plantlets grew better under CO 2 concentration of 650 ± 50 μl l -1 than under the other two concentrations with all the different media water contents. Three media water contents under the same CO 2 concentration produced plantlets with the same quality. The impacts of CO 2 concentrations on plantlets are more important than those of the media water contents. Sugar-free tissue culture, as compared with the conventional culture, showed that CO 2 enrichment to 350 ± 50 μl l -1 can promote the growth of the cultured plantlets. Sugar-free tissue culture produced healthy plantlets with thick roots, almost equivalent to the common plantlets.

  1. Cardiac time intervals and the association with 2D-speckle-tracking, tissue Doppler and conventional echocardiography

    DEFF Research Database (Denmark)

    Biering-Sørensen, Tor; Jensen, Jan Skov; Andersen, Henrik Ullits


    Cardiac time intervals (CTI) are prognostic above and beyond conventional echocardiographic measures. The explanation may be that CTI contain information about both systolic and diastolic measures; this is, however, unknown. The relationship between the CTI and systolic and diastolic function...

  2. Plasmid-dependent attachment of Agrobacterium tumefaciens to plant tissue culture cells. (United States)

    Matthysse, A G; Wyman, P M; Holmes, K V


    Kinetic, microscopic, and biochemical studies show that virulent Ti (tumor inducing)-plasmid-containing strains of Agrobacterium attach to normal tobacco and carrot tissue culture cells. Kinetic studies showed that virulent strains of A. tumefaciens attach to the plant tissue culture cells in increasing numbers during the first 1 to 2 h of incubation of the bacteria with the plant cells. Five Ti-plasmid-containing virulent Agrobacterium strains showed greater attachment to tobacco cells than did five avirulent strains. Light and scanning electron microscopic observations confirmed that virulent strains showed little attachment. Bacterial attachment was blocked by prior incubation of the plant cells with lipopolysaccharide extracted from A. tumefaciens, but not from A. radiobacter, suggesting that bacterial lipopolysaccharide is one of the components involved in the attachment process. At least one other bacterial product may be required for attachment in tissue culture because the virulent A. tumefaciens NT1, which lacks the Ti plasmid, does not itself attach to tobacco cells, but its lipopolysaccharide does inhibit the attachment of virulent strains.

  3. Application of Tissue Culture and Transformation Techniques in Model Species Brachypodium distachyon. (United States)

    Sogutmaz Ozdemir, Bahar; Budak, Hikmet


    Brachypodium distachyon has recently emerged as a model plant species for the grass family (Poaceae) that includes major cereal crops and forage grasses. One of the important traits of a model species is its capacity to be transformed and ease of growing both in tissue culture and in greenhouse conditions. Hence, plant transformation technology is crucial for improvements in agricultural studies, both for the study of new genes and in the production of new transgenic plant species. In this chapter, we review an efficient tissue culture and two different transformation systems for Brachypodium using most commonly preferred gene transfer techniques in plant species, microprojectile bombardment method (biolistics) and Agrobacterium-mediated transformation.In plant transformation studies, frequently used explant materials are immature embryos due to their higher transformation efficiencies and regeneration capacity. However, mature embryos are available throughout the year in contrast to immature embryos. We explain a tissue culture protocol for Brachypodium using mature embryos with the selected inbred lines from our collection. Embryogenic calluses obtained from mature embryos are used to transform Brachypodium with both plant transformation techniques that are revised according to previously studied protocols applied in the grasses, such as applying vacuum infiltration, different wounding effects, modification in inoculation and cocultivation steps or optimization of bombardment parameters.

  4. Chemical evaluation of strawberry plants produced by tissue culturing of gamma irradiated seedlings

    International Nuclear Information System (INIS)

    Maraei, R.W.


    studies were conducted to evaluate the influence of gamma irradiation as a supplementary factor precedes tissue culture application on strawberry seedlings (c.v.Rosa Linda). the strawberry seedling were irradiated using 8 doses of co 60 gamma rays ,150,250, 350 and 500 gray. tissue culture technique was applied on irradiated and unirradiated strawberry seedling. different characteristics of plantlets, plant and fruit of strawberry produced from the double treatment (irradiation followed by tissue culture) were studied as well as the early, total and exportable fruit yields. data indicated that, low radiation doses 50,75 and 100 gray increased all morphological and chemical characteristics of the plantlets, plant and fruit of strawberry, whereas radiation doses higher than 100 gray decreased them significantly. moreover 350 and gray were lethal doses. radiation dose 50 gray increased the survival percentage and the length of plantlets by 1.5% and 50% respectively more than the unirradiated treatment in all multiplication stages

  5. Toxicity and oxidative stress of canine mesenchymal stromal cells from adipose tissue in different culture passages

    Directory of Open Access Journals (Sweden)

    Arícia Gomes Sprada


    Full Text Available Abstract: Stem cells in regenerative therapy have received attention from researchers in recent decades. The culture of these cells allows studies about their behavior and metabolism. Thus, cell culture is the basis for cell therapy and tissue engineering researches. A major concern regarding the use of cultivated stem cell in human or veterinary clinical routine is the risk of carcinogenesis. Cellular activities require a balanced redox state. However, when there is an imbalance in this state, oxidative stress occurs. Oxidative stress contributes to cytotoxicity, which may result in cell death or genomic alterations, favoring the development of cancer cells. The aim of this study was to determine whether there are differences in the behavior of cultured mesenchymal stem cells from canine adipose tissue according to its site of collection (omentum and subcutaneous evaluating the rate of proliferation, viability, level of oxidative stress and cytotoxicity over six passages. For this experiment, two samples of adipose tissue from subcutaneous and omentum where taken from a female dog corpse, 13 years old, Pitbull. The results showed greater levels of oxidative stress in the first and last passages of both groups, favoring cytotoxicity and cell death.

  6. Air exposure induced characteristics of dry eye in conjunctival tissue culture.

    Directory of Open Access Journals (Sweden)

    Hui Lin

    Full Text Available There are several animal models illustrating dry eye pathophysiology. Current study would like to establish an ex vivo tissue culture model for characterizing dry eye. Human conjunctival explants were cultured under airlift or submerged conditions for up to 2 weeks, and only airlifted conjunctival cultures underwent increased epithelial stratification. Starting on day 4, the suprabasal cells displayed decreased K19 expression whereas K10 keratin became evident in airlift group. Pax6 nuclear expression attenuated already at 2 days, while its perinuclear and cytoplasmic expression gradually increased. MUC5AC and MUC19 expression dramatically decreased whereas the full thickness MUC4 and MUC16 expression pattern disappeared soon after initiating the airlift condition. Real time PCR showed K16, K10 and MUC16 gene up-regulated while K19, MUC5AC, MUC19 and MUC4 down-regulated on day 8 and day 14. On day 2 was the appearance of apoptotic epithelial and stromal cells appeared. The Wnt signaling pathway was transiently activated from day 2 to day 10. The inflammatory mediators IL-1β, TNF-α, and MMP-9 were detected in the conditioned media after 6 to 8 days. In conclusion, airlifted conjunctival tissue cultures demonstrated Wnt signaling pathway activation, coupled with squamous metaplasia, mucin pattern alteration, apoptosis and upregulation of proinflammatory cytokine expression. These changes mimic the pathohistological alterations described in dry eye. This correspondence suggests that insight into the pathophysiology of dry eye may be aided through the use of airlifted conjunctival tissue cultures.

  7. Culture Environment-Induced Pluripotency of SACK-Expanded Tissue Stem Cells

    Directory of Open Access Journals (Sweden)

    Jean-François Paré


    Full Text Available Previous efforts to improve the efficiency of cellular reprogramming for the generation of induced pluripotent stem cells (iPSCs have focused mainly on transcription factors and small molecule combinations. Here, we report the results of our focus instead on the phenotype of the cells targeted for reprogramming. We find that adult mouse pancreatic tissue stem cells derived by the method of suppression of asymmetric cell kinetics (SACK acquire increased potency simply by culture under conditions for the production and maintenance of pluripotent stem cells. Moreover, supplementation with the SACK agent xanthine, which promotes symmetric self-renewal, significantly increases the efficiency and degree of acquisition of pluripotency properties. In transplantation analyses, clonal reprogrammed pancreatic stem cells produce slow-growing tumors with tissue derivative of all three embryonic germ layers. This acquisition of pluripotency, without transduction with exogenous transcription factors, supports the concept that tissue stem cells are predisposed to cellular reprogramming, particularly when symmetrically self-renewing.

  8. Fusarium growth on culture media made of tissue juice from irradiated and unirradiated potato tubers

    International Nuclear Information System (INIS)

    Taczanowski, M.


    Fusarium Sulphureum Schlecht is one of the tuber pathogens causing potato storage disease knowing as dry rot. Because irradiation can disturb the tissue defence mechanism against the pathogen, it was decided to carry out experiments on influence of the treatment on subsequent tuber tissue reaction to a maceration process. The maceration as a physical stress was a substitute for the pathogen activity. Tubers of two potato varieties were tested: Mila -a resistant variety to Fusarium and Atol - susceptible one. Tubers of both varieties were irradiated with a dose of 105 kGy. Unirradiated tubers were taken as a control. A day after irradiation the cortex tissue was macerated using an ordinary rasper and the resulted tissue pulp was strained through medical gauze to obtain crude juice. The juice was clarified by centrifugation and then added to dissolved PDA. The volume ratio of juice to PDA was 1:1. The prepared media were dispensed into Petri dishes. Small pieces of the Fusarium culture were put on the surface of the medium at the centre of each Petri dish. Subsequent growth of the fungus was assessed by measurement of culture diameters every 24 hours. Linear functions of the Fusarium growth were obtained for Mila control and Atol control. In the case of Mila, the Fusarium found more favourable conditions for its growth in the presence of juice from irradiated tubers than from the control ones. Making the same comparison for Atol, no difference was detected. (author)

  9. Optimization of an Efficient Non-Tissue Culture Transformation Method for Brassica Juncea

    International Nuclear Information System (INIS)

    Naeem, I.; Munir, I.; Iqbal, A.; Ullah, F.


    The major hurdles in successful in vitro transformation of Brassica juncea through standard tissue culture (STC) method are: culture contamination, somaclonal variations, and lack of expertise. Moreover, the current STC method is time consuming and needs continuous electricity. In the present study, the in planta transformation method through floral dip with or without vacuum infiltration was optimized for successful transformation of B. juncea. The B. juncea CV RAYA Anmol was used for transformation through Agrobacterium tumefaciens strain GV3101 harboring the binary vector plasmid pBinGlyBar4-EADcT. Based on the resistance reaction to the herbicide Basta, 20 and 40 resistant seedlings were obtained from 2000 seed germinated from the plants transformed through floral dip and vacuum infiltration methods, respectively. The PCR analyses further confirmed the presence of transgene in 3 floral dipped plants without vacuum infiltration and 17 floral dipped plants with vacuum infiltration, giving the transformation frequencies of 1.5*10/sup -3/ and 8.5*10/sup -3/, respectively. This method, which avoids tissue culture, will reduce the somaclonal variation accompanying prolonged culture of cells in a dedifferentiated state, will facilitate functional genomics and improvement of Brassica juncea with novel desirable traits while reducing time and expense. (author)

  10. Selection of seed lots of Pinus taeda L. for tissue culture

    Directory of Open Access Journals (Sweden)

    Diego Pascoal Golle


    Full Text Available The aim of this work was to identify the fungi genera associated with three Pinus taeda L. seed lots and to assess the sanitary and physiological quality of these lots for use as selection criteria for tissue culture and evaluate the in vitro establishment of explants from seminal origin in different nutritive media. It was possible to discriminate the lots on the sanitary and physiological quality, as well as to establish in vitro plants of Pinus taeda from cotyledonary nodes obtained from aseptic seed germination of a selected lot by the sanitary and physiological quality higher. The nutritive media MS, ½ MS and WPM were equally suitable for this purpose. For the sanitary analysis the fungal genera Fusarium, Penicillium and Trichoderma were those of the highest sensitivity. For the physiological evaluation were important the variables: abnormal seedlings, strong normal seedlings; length, fresh and dry weight of strong normal seedlings. The analyzes were favorable to choose lots of seeds for in vitro culture and all culture media were adequate for the establishment of this species in tissue culture.

  11. Migration assay on primary culture isolated from patient's primary breast cancer tissue

    Directory of Open Access Journals (Sweden)

    ED Yuliana


    Full Text Available Background: Migration is an essential component of breast cancer metastasis, which studyhas been concentrated on culture of established breast cancer cell lines that do not accuratelyrepresent the sophistication and heterogeneity of patient's breast cancer. An attempt toperform migration assay using Boyden Chamber Assay (BCA on primary culture originatingfrom patient's breast cancer tissue was developed to accommodate upcoming study of breastcancer migration in lndonesian patients.Methods: Pathologically proven primary breast cancer tissue samples were obtained fromCiptomangunkusumo Hospital during core (n=4 and incisional (n=3 biopsies of stage llAup to stage lllA breast cancer patients. Following biopsy, the breast cancer tissue samplesunderwent processings to isolate the cancer cells. These cancer cells were -then resuspendedwithin Dulbecco's modified Eagle's medium (DMEM ahd cultured in 12-well plate. The growthof primary culture were observed and compared between the core biopsy and the incisionalbiopsy specimens. Optimization of BCA method was later performed to investigate themigration of the breast cancer primary culture towards different experirnental conditions, whichwere control, Fetal Bovine Serum (FBS, and Stromal Derived Factor-l (SDF-1. Two differentnumber of breast cancer cells were tested for the optimization of the BCA, which were 1 x 105and3x105cells.Results: None of the culture performed on core biopsy specimens grew, while one out ofthree incisional biopsy specimens grew until confluence. The one primary culture that grewwas later assesed using BCA to assess its migration index towards different experimentalconditions. Using 1 x 10s breast cancer cells in the BCA , the result of the absorbance level ofmigrated cells showed that the migration towards SDF-1 (0.529 nearly doubled the migrationtowards controlmedium (0.239 and FBS (0.209. Meanwhile, the absorbance levelwas simiiarbetween the control medium (1.050, FBS (1 .103

  12. Micropropagation of Pear Rootstock (Pyrus Communis) by using tissue culture technique and gamma irradiation

    International Nuclear Information System (INIS)

    El-Sharnouby, M.E.; ESSAM, E.R.; Ayoub, S.


    New growing shoots from healthy pear rootstock (Pyrus communis) trees were taken and sterilized 3 times in dipping water. Explants were subjected to antioxidant treatment, different media, different additives and different BAP and NAA concentrations. The obtained results showed that Murashig-Skoog (MS) supplemented with 1 mg/l BA was better than Gamborg medium. Adding antioxidant solution and adenine sulphate to the culture medium was preferred for maximizing explants development. Exposing the explants to gamma irradiation at different doses decreased tissue culture parameters with increasing gamma doses. However, the low dose of gamma rays (1 Krad) significantly increased the number of shoots than other gamma treatments. Adding of BAP at 2 mg/l to the culture medium increased number and length of shoots. However, addition of 1 mg/l NAA to the rooting medium led to increase the root formation

  13. Astrocyte cultures derived from human brain tissue express angiotensinogen mRNA

    International Nuclear Information System (INIS)

    Milsted, A.; Barna, B.P.; Ransohoff, R.M.; Brosnihan, K.B.; Ferrario, C.M.


    The authors have identified human cultured cell lines that are useful for studying angiotensinogen gene expression and its regulation in the central nervous system. A model cell system of human central nervous system origin expressing angiotensinogen has not previously been available. Expression of angiotensinogen mRNA appears to be a basal property of noninduced human astrocytes, since astrocytic cell lines derived from human glioblastomas or nonneoplastic human brain tissue invariably produced angiotensinogen mRNA. In situ hybridization histochemistry revealed that angiotensinogen mRNA production was not limited to a subpopulation of astrocytes because >99% of cells in these cultures contained angiotensinogen mRNA. These cell lines will be useful in studies of the molecular mechanisms controlling angiotensin synthesis and the role of biologically active angiotensin in the human brain by allowing the authors to examine regulation of expression of the renin-angiotensin system in human astrocyte cultures

  14. Soft Tissue Changes in Cleft Lip and Palate Patients: Anterior Maxillary Distraction versus Conventional Le-Fort I Osteotomy. (United States)

    Markose, Eldho; Paulose, Joby; Paul, Eldho T


    The purpose of the study was to compare the soft tissue changes after maxillary advancement in patients with maxillary deficiency associated with cleft lip and palate (CLP) by two approaches-anterior maxillary distraction (AMD) and advancement LeFort I osteotomy (ALO). Twenty patients with maxillary hypoplasia associated with cleft lip and palate who had undergone either LeFort I osteotomy or distraction osteogenesis with maxillary advancement were included in this study. Lateral cephalogram taken at various intervals of time were used to evaluate soft tissue and hard tissue changes over time. In both groups, vertical as well as horizontal changes in pronasale was well observed. A substantial increase in nasal parameters was noted in case of AMD group in comparison to ALO. Though maxillary advancement was evident in both the groups, a significant and consistent change was observed in AMD. Significant vertical and horizontal changes were seen with respect to subnasale and labrale superius in AMD group. Soft tissue as well as hard tissue relapse was greater in ALO group than AMD group. Significant soft tissue and hard tissue changes were clearly observed in both the groups, but the treatment results were more consistent in cases treated with AMD. Hence AMD could be considered as a better treatment of choice in cases of maxillary hypoplasia associated with cleft lip and palate.

  15. Production of mutants by irradiation of in vitro-cultured tissues of coconut and banana and their mass propagation by the tissue culture technique

    International Nuclear Information System (INIS)

    Guzman, E.V. de; Rosario, A.G. del; Pagcaliwagan, P.C.


    Regeneration of buds/shoots as well as plantlets was induced from banana shoot tip explants cultured in highly modified Murashige and Skoog's medium supplemented with coconut water and benzyladenine. Initially shoot regeneration was sparse, but on further subculture became profuse. Gamma irradiation at low dosage (1.0 kR) was stimulating to explant growth and bud formation with the two types of explants used. With Bungulan stimulation was observed even at 2.5 kR. Several morphological aberrations were exhibited by shoots of 'irradiated' in vitro plants growing in potted soil. A highly and continuously proliferating tissue strain has been isolated from a subculture which was ultimately derived from an irradiated explant. Its continued proliferation is dependent on an external supply of coconut water and benzyladenine. In vitro-produced plants have been established under field conditions. The 'irradiated' plants are comparable with, and some seem to be better than, the unirradiated controls with respect to height, girth, sucker production and number of hands and fingers per bunch. Higher doses of irradiation are required to produce an adverse effect on growth of coconut embryos during the liquid culture than when growing in solid medium. (author)

  16. Review of vascularised bone tissue-engineering strategies with a focus on co-culture systems. (United States)

    Liu, Yuchun; Chan, Jerry K Y; Teoh, Swee-Hin


    Poor angiogenesis within tissue-engineered grafts has been identified as a main challenge limiting the clinical introduction of bone tissue-engineering (BTE) approaches for the repair of large bone defects. Thick BTE grafts often exhibit poor cellular viability particularly at the core, leading to graft failure and lack of integration with host tissues. Various BTE approaches have been explored for improving vascularisation in tissue-engineered constructs and are briefly discussed in this review. Recent investigations relating to co-culture systems of endothelial and osteoblast-like cells have shown evidence of BTE efficacy in increasing vascularization in thick constructs. This review provides an overview of key concepts related to bone formation and then focuses on the current state of engineered vascularized co-culture systems using bone repair as a model. It will also address key questions regarding the generation of clinically relevant vascularized bone constructs as well as potential directions and considerations for research with the objective of pursuing engineered co-culture systems in other disciplines of vascularized regenerative medicine. The final objective is to generate serious and functional long-lasting vessels for sustainable angiogenesis that will enable enhanced cellular survival within thick voluminous bone grafts, thereby aiding in bone formation and remodelling in the long term. However, more evidence about the quality of blood vessels formed and its associated functional improvement in bone formation as well as a mechanistic understanding of their interactions are necessary for designing better therapeutic strategies for translation to clinical settings. Copyright © 2012 John Wiley & Sons, Ltd.

  17. Protein and Glycoprotein Patterns Related to Morphogenesis in Mammillaria gracillis Pfeiff. Tissue Culture

    Directory of Open Access Journals (Sweden)

    Biljana Balen


    Full Text Available As plants with Crassulacean Acid Metabolism (CAM, cacti are highly affected by artificial environmental conditions in tissue culture. Plants of Mammillaria gracillis Pfeiff. (Cactaceae propagated in vitro produced callus spontaneously. This habituated callus regenerated normal and hyperhydric shoots without the addition of growth regulators. In order to compare habituated callus with the tumorous one, cactus cells were transformed with two strains of Agrobacterium tumefaciens: the wild strain B6S3 (tumour line TW and the rooty mutant GV3101 (tumour line TR. Gene expression in cactus plants, habituated callus, regenerated shoots and two tumour lines was analysed at the level of cellular and extracellular protein and glycoprotein profiles. Proteins were separated by SDS-polyacrylamide gel electrophoresis and 2-D PAGE electrophoresis and silver stained. Concavalin A-peroxidase staining detected glycoproteins with D-manose in their glycan component on protein blots. Developmentally specific protein patterns of Mammillaria gracillis tissue lines were detected. The 2-D PAGE electrophoresis revealed some tissue specific protein groups. The cellular glycoprotein of 42 kDa detected by ConA was highly expressed in undifferentiated tissues (habituated callus, TW and TR tumours and in hyperhydric regenerants. Tumours produced extracellular proteins of 33, 23 and 22 kDa. The N glycosylation of cellular and extracellular proteins was related to specific developmental stage of cactus tissue.

  18. Study of the agroindustrial alterations induced by the irradiated tissue culture in sugar cane, variety NA 56-79

    International Nuclear Information System (INIS)

    Figueiredo Junior, O.


    The use of plant tissue culture and the application of gamma radiation as mutation inducing agents, in the sugar cane plant, variety NA 5679, are studied. The variation in the contents of brix, pol, fiber, purity, extraction, phosphorus, nitrogen, reducing sugars as well as the morphological characteristics are analysed. The 'callus' obtained by the tissue culture were irradiated with 20, 40, and 60 Gy doses. The statistical analysis indicated that the method of tissue culture may, eventually, increase the contents of the technological parameters and the dosages of gamma radiation were not efficient for such purpose. (M.A.C.)

  19. Frozen and fresh ovarian tissue require different culture media to promote in vitro development of bovine preantral follicles. (United States)

    Castro, Simone Vieira; Carvalho, Adeline Andrade; Silva, Cleidson Manoel Gomes; Santos, Francielli Weber; Campello, Cláudio Cabral; de Figueiredo, José Ricardo; Rodrigues, Ana Paula Ribeiro


    The aim of this study was to evaluate the efficiency of different media in the in vitro culture of bovine preantral follicles that were used either fresh or following slow freezing treatment. Frozen and fresh noncultured or cultured ovarian fragments were processed for histological, viability, and cell proliferation analyses. For cryopreservation, a solution containing 1.5 M ethylene glycol was frozen in a programmable biological freezer. After thawing, a portion of the samples was destined for frozen controls. The remainder were cultured in vitro for 5 days in three media: α-MEM, McCoy, or M199. Samples from these culture media were collected on days 1 and 5 for quantification of reactive oxygen species (ROS) and for hormonal assays. In fresh-cultured tissues, the percentage of morphologically normal follicles was significantly higher when cultured in M199 compared to that in the other media. In frozen-cultured tissues, McCoy medium was significantly superior to the other media, and was the only treatment that helped in maintaining the viability similar to fresh and frozen controls. Upon quantification of the nucleolus organizer region, we observed greater proliferation of granulosa cells in the frozen-cultured tissues with McCoy medium, and lesser proliferation in fresh-cultured tissues only with α-MEM. In frozen-cultured tissues, ROS levels were highest at day 1 and progressively reduced during culture, independent of the media used. In conclusion, under the conditions used in this study, the M199 and McCoy media are recommended for the culture of follicles derived from fresh and frozen ovarian tissues, respectively.

  20. Changes in adipose tissue stromal-vascular cells in primary culture due to porcine sera

    International Nuclear Information System (INIS)

    Jewell, D.E.; Hausman, G.J.


    This study was conducted to determine the response of rat stromal-vascular cells to pig sea. Sera were collected from unselected contemporary (lean) and high backfat thickness selected (obese) pigs. Sera from obese pigs were collected either by exsanguination or cannulation. sera from lean pigs during the growing phase (45 kg) and the fattening phase (100-110 kg) were collected. Stromal-vascular cells derived rom rat inguinal tissue were cultured on either 25 cm 2 flasks, collagen-coated coverslips or petri dishes. Cell proliferation was measured by [ 3 H]-thymidine incorporation during the fourth day of culture. Coverslip cultures were used for histochemical analysis. Petri dish cultures were used for analysis of Sn-glycerol-3-phosphate dehydrogenase (GPDH) activity. All cells were plated for 24 hours in media containing 10 fetal bovine sera. Test media contained 2.5, 5.0, 10.0% sera. Sera from obese pigs increased GPDH activity and fat cell production when compared to the lean controls. The increased concentration of sera increased esterase activity and lipid as measured with oil red O. The sera from obese pigs collected at slaughter stimulated more fat cell production than obese sera collected by cannulation. These studies show there are adipogenic factors in obese pigs sera which promote fat cell development in primary cell culture

  1. Chemical And Physiological Studies On Drought Stress Tolerance Of Irradiated Communis Pear Using Tissue Culture

    International Nuclear Information System (INIS)

    Zaied, N.S.; Ragab, E.A.


    The rooted in vitro irradiated pear rootstocks (Pyrus communis) were subjected to drought stress by using different concentrations of mannitol (20, 40, 60, 80 and 100 gm/l), polyethylene glycol (PEG) at concentrations 2, 4, 6, 8 and 10 % to culture medium and also agar at concentrations 6, 8, 10, 12 and 14 gm/l to study their effects on tissue culture and chemical analysis and their tolerance to drought stress. The obtained results showed that the number of shoots, shoot length and number of leaves were higher at 20 and 40 gm/l mannitol. Increasing mannitol concentration enhanced the increase of chlorophyll b, reducing sugars, total indoles and total phenols up to the highest level at 100 gm/l. Adding PEG at concentration 2% to the culture medium encouraged significant increases in the number of shoots and number of leaves and increase chlorophyll a, and non-reducing sugars as well as significant decrease in number of shoots, shoots length, number of leaves, root length and number of roots with increasing agar concentrations to the culture medium. However, decreasing agar concentration in the culture medium induced increase in chlorophyll A and non-reducing sugar

  2. Joint use of developed collagen-containing complexes and cell cultures in creating new tissue equivalents

    Directory of Open Access Journals (Sweden)

    K. V. Kulakova


    Full Text Available The purpose of the study is to assess the possibility of applying the integrated module as the basis of a celltissue equivalent for treatment of wounds of skin and soft tissues. In the frame of the set task the following problems were being solved: research of the spatial structure and architectonics of the surface of the developed base collagen-containing materials and their biocompatibility with cell cultures.Materials and methods. The study of a material which is a two-layer complex film, consisting of collagen and polysaccharide components was carried out. The collagen was separated from the dermis and was then impregnated with particulate demineralized bone matrix (DCM according to the original methodology. For the purposes of the study the dehydrated material was created in the form of a film. Electron microscopic examination of surfaces was performed on scanning electron microscope JEOL JSM-IT300LV in high vacuum and at low values of probe current (< 0,1 nА. Studies to assess the viability of the cells cultivated on films of collagen material (tested for cytotoxicity and the adhesive capacity were performed in vitro using strains of diploid human fibroblasts 4–6 passage. The culture condition was visually assessed using an inverted Leica microscope DM IL (Carl Zeiss, Austria, equipped with a computerizes program of control of culture growth (Leica IM 1000.Results. The data obtained in the study of the surface structure of the developed complex module showed that it seems to be promising as a basic component of the cellular-tissue system with its large number of structural formations for fixation of the cells and a well-organized barrier layer capable of vapor - permeability. Experiments in vitro confirmed the absence of toxicity of the material being studied in relation to the culture of dermal human fibroblasts, suggesting the possibility of creation on its basis of cell-tissue complex and further experimental studies in vivo

  3. Generation of Functional Thyroid Tissue Using 3D-Based Culture of Embryonic Stem Cells. (United States)

    Antonica, Francesco; Kasprzyk, Dominika Figini; Schiavo, Andrea Alex; Romitti, Mírian; Costagliola, Sabine


    During the last decade three-dimensional (3D) cultures of pluripotent stem cells have been intensively used to understand morphogenesis and molecular signaling important for the embryonic development of many tissues. In addition, pluripotent stem cells have been shown to be a valid tool for the in vitro modeling of several congenital or chronic human diseases, opening new possibilities to study their physiopathology without using animal models. Even more interestingly, 3D culture has proved to be a powerful and versatile tool to successfully generate functional tissues ex vivo. Using similar approaches, we here describe a protocol for the generation of functional thyroid tissue using mouse embryonic stem cells and give all the details and references for its characterization and analysis both in vitro and in vivo. This model is a valid approach to study the expression and the function of genes involved in the correct morphogenesis of thyroid gland, to elucidate the mechanisms of production and secretion of thyroid hormones and to test anti-thyroid drugs.

  4. Beauveria bassiana (Balsamo) Vuillemin as an endophyte in tissue culture banana (Musa spp.). (United States)

    Akello, Juliet; Dubois, Thomas; Gold, Clifford S; Coyne, Daniel; Nakavuma, Jessica; Paparu, Pamela


    Beauveria bassiana is considered a virulent pathogen against the banana weevil Cosmopolites sordidus. However, current field application techniques for effective control against this pest remain a limitation and an alternative method for effective field application needs to be investigated. Three screenhouse experiments were conducted to determine the ability of B. bassiana to form an endophytic relationship with tissue culture banana (Musa spp.) plants and to evaluate the plants for possible harmful effects resulting from this relationship. Three Ugandan strains of B. bassiana (G41, S204 and WA) were applied by dipping the roots and rhizome in a conidial suspension, by injecting a conidial suspension into the plant rhizome and by growing the plants in sterile soil mixed with B. bassiana-colonized rice substrate. Four weeks after inoculation, plant growth parameters were determined and plant tissue colonization assessed through re-isolation of B. bassiana. All B. bassiana strains were able to colonize banana plant roots, rhizomes and pseudostem bases. Dipping plants in a conidial suspension achieved the highest colonization with no negative effect on plant growth or survival. Beauveria bassiana strain G41 was the best colonizer (up to 68%, 79% and 41% in roots, rhizome and pseudostem base, respectively) when plants were dipped. This study demonstrated that, depending on strain and inoculation method, B. bassiana can form an endophytic relationship with tissue culture banana plants, causing no harmful effects and might provide an alternative method for biological control of C. sordidus.

  5. Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture

    Directory of Open Access Journals (Sweden)

    Jyoti Kumar


    Full Text Available Aim: This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. Introduction: M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA, Rpt2 and 12S ribosomal RNA (rRNA genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. Materials and Methods: A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. Results: All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631. Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S r

  6. Implementing oxygen control in chip-based cell and tissue culture systems. (United States)

    Oomen, Pieter E; Skolimowski, Maciej D; Verpoorte, Elisabeth


    Oxygen is essential in the energy metabolism of cells, as well as being an important regulatory parameter influencing cell differentiation and function. Interest in precise oxygen control for in vitro cultures of tissues and cells continues to grow, especially with the emergence of the organ-on-a-chip and the desire to emulate in vivo conditions. This was recently discussed in this journal in a Critical Review by Brennan et al. (Lab Chip (2014). DOI: ). Microfluidics can be used to introduce flow to facilitate nutrient supply to and waste removal from in vitro culture systems. Well-defined oxygen gradients can also be established. However, cells can quickly alter the oxygen balance in their vicinity. In this Tutorial Review, we expand on the Brennan paper to focus on the implementation of oxygen analysis in these systems to achieve continuous monitoring. Both electrochemical and optical approaches for the integration of oxygen monitoring in microfluidic tissue and cell culture systems will be discussed. Differences in oxygen requirements from one organ to the next are a challenging problem, as oxygen delivery is limited by its uptake into medium. Hence, we discuss the factors determining oxygen concentrations in solutions and consider the possible use of artificial oxygen carriers to increase dissolved oxygen concentrations. The selection of device material for applications requiring precise oxygen control is discussed in detail, focusing on oxygen permeability. Lastly, a variety of devices is presented, showing the diversity of approaches that can be employed to control and monitor oxygen concentrations in in vitro experiments.

  7. An electrochemical approach to monitor pH change in agar media during plant tissue culture. (United States)

    Wang, Min; Ha, Yang


    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  8. In vitro differentiation of rat spermatogonia into round spermatids in tissue culture. (United States)

    Reda, A; Hou, M; Winton, T R; Chapin, R E; Söder, O; Stukenborg, J-B


    Do the organ culture conditions, previously defined for in vitro murine male germ cell differentiation, also result in differentiation of rat spermatogonia into post-meiotic germ cells exhibiting specific markers for haploid germ cells? We demonstrated the differentiation of rat spermatogonia into post-meiotic cells in vitro, with emphasis on exhibiting, protein markers described for round spermatids. Full spermatogenesis in vitro from immature germ cells using an organ culture technique in mice was first reported 5 years ago. However, no studies reporting the differentiation of rat spermatogonia into post-meiotic germ cells exhibiting the characteristic protein expression profile or into functional sperm have been reported. Organ culture of testicular fragments of 5 days postpartum (dpp) neonatal rats was performed for up to 52 days. Evaluation of microscopic morphology, testosterone levels, mRNA and protein expression as measured by RT-qPCR and immunostaining were conducted to monitor germ cell differentiation in vitro. Potential effects of melatonin, Glutamax® medium, retinoic acid and the presence of epidydimal fat tissue on the spermatogenic process were evaluated. A minimum of three biological replicates were performed for all experiments presented in this study. One-way ANOVA, ANOVA on ranks and student's t-test were applied to perform the statistical analysis. Male germ cells, present in testicular tissue pieces grown from 5 dpp rats, exhibited positive protein expression for Acrosin and Crem (cAMP (cyclic adenosine mono phosphate) response element modulator) after 52 days of culture in vitro. Intra-testicular testosterone production could be observed after 3 days of culture, while when epididymal fat tissue was added, spontaneous contractility of cultured seminiferous tubules could be observed after 21 days. However, no supportive effect of the supplementation with any factor or the co-culturing with epididymal fat tissue on germ cell differentiation in

  9. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital


    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M


    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  10. Cell-surface glycoproteins of human sarcomas: differential expression in normal and malignant tissues and cultured cells

    International Nuclear Information System (INIS)

    Rettig, W.F.; Garin-Chesa, P.; Beresford, H.R.; Oettgen, H.F.; Melamed, M.R.; Old, L.J.


    Normal differentiation and malignant transformation of human cells are characterized by specific changes in surface antigen phenotype. In the present study, the authors have defined six cell-surface antigens of human sarcomas and normal mesenchymal cells, by using mixed hemadsorption assays and immunochemical methods for the analysis of cultured cells and immunohistochemical staining for the analysis of normal tissues and > 200 tumor specimens. Differential patterns of F19, F24, G171, G253, S5, and Thy-1 antigen expression were found to characterize (i) subsets of cultured sarcoma cell lines, (ii) cultured fibroblasts derived from various organs, (iii) normal resting and activated mesenchymal tissues, and (iv) sarcoma and nonmesenchymal tumor tissues. These results provide a basic surface antigenic map for cultured mesenchymal cells and mesenchymal tissues and permit the classification of human sarcomas according to their antigenic phenotypes

  11. Data showing non-conventional HLA-B27 expression in axial joints and gut tissue from B27 transgenic rats, and in frozen and paraffin-fixed synovial SpA tissue

    Directory of Open Access Journals (Sweden)

    Oliwia Rysnik


    Full Text Available Data is presented showing expression of non-conventional (NC heavy chain forms of B27 in synovial tissues from SpA patients. Data is presented showing the expression patterns of NC-B27 in joint, gastrointestinal and lymphoid tissues from B27 transgenic (TG1 rats with M. tuberculosis-induced SpA. Expression of NC-B27 was determined by immunohistochemistry and flow cytometry using HC10 and HD6 antibodies. These data are the extension of the data presented and discussed in “Non-conventional forms of HLA-B27 are expressed in Spondyloarthritis joints and gut tissue” (O. Rysnik, K. McHugh, L. M. van Duivenvoorde, M. N. van Tok, G. Guggino, J. D. Taurog, S. Kollnberger, F. Ciccia, D. L. Baeten, P. Bowness, 2016 [1].

  12. Differentiation of prostate cancer from normal prostate tissue in an animal model: conventional MRI and dynamic contrast-enhanced MRI

    International Nuclear Information System (INIS)

    Gemeinhardt, O.; Prochnow, D.; Taupitz, M.; Hamm, B.; Beyersdorff, D.; Luedemann, L.; Abramjuk, C.


    Purpose: to differentiate orthotopically implanted prostate cancer from normal prostate tissue using magnetic resonance imaging (MRI) and Gd-DTPA-BMA-enhanced dynamic MRI in the rat model. Material and methods: tumors were induced in 15 rats by orthotopic implantation of G subline Dunning rat prostatic tumor cells. MRI was performed 56 to 60 days after tumor cell implantation using T1-weighted spin-echo, T2-weighted turbo SE sequences, and a 2D FLASH sequence for the contrast medium based dynamic study. The interstitial leakage volume, normalized permeability and the permeability surface area product of tumor and healthy prostate were determined quantitatively using a pharmacokinetic model. The results were confirmed by histologic examination. Results: axial T2-weighted TSE images depicted low-intensity areas suspicious for tumor in all 15 animals. The mean tumor volume was 46.5 mm3. In the dynamic study, the suspicious areas in all animals displayed faster and more pronounced signal enhancement than surrounding prostate tissue. The interstitial volume and the permeability surface area product of the tumors increased significantly by 420% (p<0.001) and 424% (p<0.001), respectively, compared to normal prostate tissue, while no significant difference was seen for normalized permeability alone. Conclusion: the results of the present study demonstrate that quantitative analysis of contrast-enhanced dynamic MRI data enables differentiation of small, slowly growing orthotopic prostate cancer from normal prostate tissue in the rat model. (orig.)

  13. Comparison between 3D conventional techniques, field-in-field and electronic tissue compensation for mantle fields planning

    International Nuclear Information System (INIS)

    Martins, Lais P.; Silva, Leonardo P.; Trindade, Cassia; Garcia, Paulo L.; Santos, Maira R.; Batista, Delano V.S.


    External radiotherapy treatment for Hodgkin's lymphoma over diaphragm region requires large radiation fields with protections applied to larynx, humerus head and lungs. The size and shape of the field, which covers different depths, make it difficult to distribute a homogeneous dose. Techniques such as field-in-field and electronic tissue compensation may be used to make dose homogeneous and compensate the obliquity from the tissue. Three types of planning were performed for diagnose of nodular sclerosis Hodgkin's lymphoma: one plan with two fields, AP-PA (AP plan), another with four fields field-in- field (FF plan), and a third one with two fields and electronic tissue compensation (ETC plan). Results showed better gradient, cover of PTV and dose distribution for the ETC plan, besides the advantage from this technique of does not require protection blocks. In the meanwhile, AP and FF plans require simpler dosimetry and fewer MU. Related to the uniformity of dose distribution, AP plan showed hot areas in the neck region, FF plan showed hot areas in the shoulder region and ETC plan showed most uniform distribution without hot areas. The electronic tissue compensation is a useful tool for large and shaped fields as the mantle field, however higher MU and complex dosimetry should be taken in account. (author)

  14. In Vivo-Like Culture Conditions in a Bioreactor Facilitate Improved Tissue Quality in Corneal Storage. (United States)

    Schmid, Richard; Tarau, Ioana-Sandra; Rossi, Angela; Leonhardt, Stefan; Schwarz, Thomas; Schuerlein, Sebastian; Lotz, Christian; Hansmann, Jan


    The cornea is the most-transplanted tissue worldwide. However, the availability and quality of grafts are limited due to the current methods of corneal storage. In this study, a dynamic bioreactor system is employed to enable the control of intraocular pressure and the culture at the air-liquid interface. Thereby, in vivo-like storage conditions are achieved. Different media combinations for endothelium and epithelium are tested in standard and dynamic conditions to enhance the viability of the tissue. In contrast to culture conditions used in eye banks, the combination of the bioreactor and biochrom medium 1 allows to preserve the corneal endothelium and the epithelium. Assessment of transparency, swelling, and the trans-epithelial-electrical-resistance (TEER) strengthens the impact of the in vivo-like tissue culture. For example, compared to corneas stored under static conditions, significantly lower optical densities and significantly higher TEER values were measured (p-value <0.05). Furthermore, healing of epithelial defects is enabled in the bioreactor, characterized by re-epithelialization and initiated stromal regeneration. Based on the obtained results, an easy-to-use 3D-printed bioreactor composed of only two parts was derived to translate the technology from the laboratory to the eye banks. This optimized bioreactor facilitates noninvasive microscopic monitoring. The improved storage conditions ameliorate the quality of corneal grafts and the storage time in the eye banks to increase availability and reduce re-grafting. © 2017 The Authors. Biotechnology Journal Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  15. Using organotypic (raft) epithelial tissue cultures for the biosynthesis and isolation of infectious human papillomaviruses. (United States)

    Ozbun, Michelle A; Patterson, Nicole A


    Papillomaviruses have a strict tropism for epithelial cells, and they are fully reliant on cellular differentiation for completion of their life cycles, resulting in the production of progeny virions. Thus, a permissive environment for full viral replication in vitro-wherein virion morphogenesis occurs under cooperative viral and cellular cues-requires the cultivation of epithelium. Presented in the first section of this unit is a protocol to grow differentiating epithelial tissues that mimic many important morphological and biochemical aspects of normal skin. The technique involves growing epidermal cells atop a dermal equivalent consisting of live fibroblasts and a collagen lattice. Epithelial stratification and differentiation ensues when the keratinocyte-dermal equivalent is placed at the air-liquid interface. The apparent floating nature of the cell-matrix in this method led to the nickname "raft" cultures. The general technique can be applied to normal low passage keratinocytes, to cells stably transfected with papillomavirus genes or genomes, or keratinocytes established from neoplastic lesions. However, infectious papillomavirus particles have only been isolated from organotypic epithelial cultures initiated with cells that maintain oncogenic human papillomavirus genomes in an extrachomosomal replicative form. The second section of this unit is dedicated to a virion isolation method that minimizes aerosol and skin exposure to these human carcinogens. Although the focus of the protocols is on the growth of tissues that yields infectious papillomavirus progeny, this culture system facilitates the investigation of these fastidious viruses during their complex replicative cycles, and raft tissues can be manipulated and harvested at any point during the process. Importantly, a single-step virus growth cycle is achieved in this process, as it is unlikely that progeny virions are released to initiate subsequent rounds of infection. Copyright © 2014 John Wiley


    Directory of Open Access Journals (Sweden)



    Full Text Available Artificially inoculated asparagus tissue culture plantlets with a virulent fungus, Fusarium proliferatum showed signs of infection as early as 4 days after inoculat ion. Macroscopic observations revealed presence of early symptoms such as necrotic lesions at the affected area and light microscopic examinations clearly revealed the post-penetration events that took place including the destruction of surrounding cells. However, little is known of the hyphal activity or advancement on the host's surface at the initial stage after inoculation. Scanning electron microscopic examination clearly revealed the hyphal advancement on the surface and the mode of entrance into the host tissues beneath. Four days after inoculation, the fungi proceeded to spread out from the inoculation point onto the host surface which eventually developed into a sparse network of both aerial and non-aerial hyphae. Non-aerial hyphae form a network of mycelium that adheres to the surface and it's movement appeared to be oriented towards the stomata. Hyphal penetration occurs more often through the stomata, natural openings or wounds. In some cases, the hyphae crossed over the stomatal opening w ithout entering the host tissues. At places where the cuticle layer is absent or not well developed the hyphae successfully grew in between the epidermal cells into the tissues beneath.

  17. Primary microglia isolation from mixed glial cell cultures of neonatal rat brain tissue. (United States)

    Tamashiro, Tami T; Dalgard, Clifton Lee; Byrnes, Kimberly R


    Microglia account for approximately 12% of the total cellular population in the mammalian brain. While neurons and astrocytes are considered the major cell types of the nervous system, microglia play a significant role in normal brain physiology by monitoring tissue for debris and pathogens and maintaining homeostasis in the parenchyma via phagocytic activity. Microglia are activated during a number of injury and disease conditions, including neurodegenerative disease, traumatic brain injury, and nervous system infection. Under these activating conditions, microglia increase their phagocytic activity, undergo morpohological and proliferative change, and actively secrete reactive oxygen and nitrogen species, pro-inflammatory chemokines and cytokines, often activating a paracrine or autocrine loop. As these microglial responses contribute to disease pathogenesis in neurological conditions, research focused on microglia is warranted. Due to the cellular heterogeneity of the brain, it is technically difficult to obtain sufficient microglial sample material with high purity during in vivo experiments. Current research on the neuroprotective and neurotoxic functions of microglia require a routine technical method to consistently generate pure and healthy microglia with sufficient yield for study. We present, in text and video, a protocol to isolate pure primary microglia from mixed glia cultures for a variety of downstream applications. Briefly, this technique utilizes dissociated brain tissue from neonatal rat pups to produce mixed glial cell cultures. After the mixed glial cultures reach confluency, primary microglia are mechanically isolated from the culture by a brief duration of shaking. The microglia are then plated at high purity for experimental study. The principle and protocol of this methodology have been described in the literature. Additionally, alternate methodologies to isolate primary microglia are well described. Homogenized brain tissue may be separated

  18. Nuclear morphology, polyploidy, and chromatin elimination in tissue culture of Allium fistulosum L.

    Directory of Open Access Journals (Sweden)

    Andrzej Joachimiak


    Full Text Available The morphology of cell nuclei in callus obtained from root-tip meristems of Allium fistulosum L. (Monocotyledoneae, Alliaceae was analysed. The most interesting phenomena observed in long-term callus culture were the different mechanisms of cell polyploidization, enlargement of telomeric segments of heterochromatin, and extensive chromatin elimination, associated with instability of nuclei size and DNA content. Protruding heterochromatin "spikes" were observed on the surface of some di- and polyploid nuclei. The presence of these spikes was connected with the formation of small heterochromatic micronuclei frequently found in the cytoplasm. It is suggested that these micronuclei are produced by direct elimination of heterochromatin from the interphase nuclei. Polyploid cells accumulated with each successive cell collection. The ploidy level attained by highly polyploid cells was 15C-220C. The shape of the nuclei and heterochromatin distribution suggest that polyploid nuclei in A. fistulosum tissue culture are produced by endoreduplication and by restitution cycles.

  19. Unusual 4-hydroxybenzaldehyde synthase activity from tissue cultures of the vanilla orchid Vanilla planifolia. (United States)

    Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A


    Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.

  20. Study on rapid propagation of Zanhuang Chinese jujube by tissue culture

    International Nuclear Information System (INIS)

    Li Yun; Wang Yu; Tian Yanting


    Zanhuang jujube is a very precious and rare variety of Chinese jujube. Its development was restricted by the under-developed propagate technique in history. The rapid propagation by tissue culture was studied and the optimum media were screened out. Through studying the condition of initial, proliferating, acclimatizing and rooting culture, 4 media, MS +6-BA 0.5 mg/L+IBA 0.1 mg/L, MS+6-BA 1.5 mg/L+IBA 0.1-0.2 mg/L, MS+KT 0.5 mg/L+NAA 0.2 mg/L and 1/2 MS+IBA 0.6 mg/L+NAA 0.2-0.3 mg/L were selected respectively

  1. Detection of Bacteria by Fluorescence in Situ Hybridization in Culture-Negative Soft Tissue Filler Lesions

    DEFF Research Database (Denmark)

    Bjarnsholt, Thomas; Tolker-Nielsen, Tim; Givskov, Michael


    BACKGROUND Adverse reactions to polyacrylamide gel occur as swellings or nodules, and controversy exists whether these are due to bacterial infection or an autoimmune reaction to the filler. OBJECTIVES Biopsies from culture-negative long-lasting nodules after injection with different types...... of polyacrylamide gel were examined with a combination of Gram stain and fluorescence in situ hybridization. RESULTS Bacteria were detected in biopsies from seven of eight patients. They inhabited gel and intervening tissue and tended to lie in aggregates. CONCLUSION This study supports the assumption...... that infection with bacteria in aggregates causes culture-negative late adverse reactions to polyacrylamide gel, suggesting a biofilm environment. The authors have indicated no significant interest with commercial supporters....

  2. Relative sensitivity of conventional and real-time PCR assays for detection of SFG Rickettsia in blood and tissue samples from laboratory animals.

    Directory of Open Access Journals (Sweden)

    Galina E Zemtsova

    Full Text Available Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87. The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays.

  3. Relative sensitivity of conventional and real-time PCR assays for detection of SFG Rickettsia in blood and tissue samples from laboratory animals. (United States)

    Zemtsova, Galina E; Montgomery, Merrill; Levin, Michael L


    Studies on the natural transmission cycles of zoonotic pathogens and the reservoir competence of vertebrate hosts require methods for reliable diagnosis of infection in wild and laboratory animals. Several PCR-based applications have been developed for detection of infections caused by Spotted Fever group Rickettsia spp. in a variety of animal tissues. These assays are being widely used by researchers, but they differ in their sensitivity and reliability. We compared the sensitivity of five previously published conventional PCR assays and one SYBR green-based real-time PCR assay for the detection of rickettsial DNA in blood and tissue samples from Rickettsia- infected laboratory animals (n = 87). The real-time PCR, which detected rickettsial DNA in 37.9% of samples, was the most sensitive. The next best were the semi-nested ompA assay and rpoB conventional PCR, which detected as positive 18.4% and 14.9% samples respectively. Conventional assays targeting ompB, gltA and hrtA genes have been the least sensitive. Therefore, we recommend the SYBR green-based real-time PCR as a tool for the detection of rickettsial DNA in animal samples due to its higher sensitivity when compared to more traditional assays.

  4. Hormonal effect on polyphenol accumulation in Cassia tissues cultured in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Shah, R R; Subbaiah, K V; Mehta, A R


    Effects of auxin and kinetin on growth and production of phenolic compounds in cultured Cassia fistula L. tissues were examined. Initiation of polyphenols was largely determined by the auxin concentration in the medium. Growth of the cells in relation to accumulation of polyphenols was studied at different auxin and kinetin concentrations. The accumulation of phenolic materials was essentially restricted to the most rapid phase of the growth cycle. Progressive changes in the pattern of peroxidase activity were followed and their relationship with polyphenol synthesis is examined.

  5. Cell culture density affects the stemness gene expression of adipose tissue-derived mesenchymal stem cells. (United States)

    Kim, Dae Seong; Lee, Myoung Woo; Lee, Tae-Hee; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee


    The results of clinical trials using mesenchymal stem cells (MSCs) are controversial due to the heterogeneity of human MSCs and differences in culture conditions. In this regard, it is important to identify gene expression patterns according to culture conditions, and to determine how the cells are expanded and when they should be clinically used. In the current study, stemness gene expression was investigated in adipose tissue-derived MSCs (AT-MSCs) harvested following culture at different densities. AT-MSCs were plated at a density of 200 or 5,000 cells/cm 2 . After 7 days of culture, stemness gene expression was examined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. The proliferation rate of AT-MSCs harvested at a low density (~50% confluent) was higher than that of AT-MSCs harvested at a high density (~90% confluent). Although there were differences in the expression levels of stemness gene, such as octamer-binding transcription factor 4, nanog homeobox ( Nanog ), SRY-box 2, Kruppel like factor 4, v-myc avian myelocytomatosis viral oncogene homolog ( c-Myc ), and lin-28 homolog A, in the AT-MSCs obtained from different donors, RT-qPCR analysis demonstrated differential gene expression patterns according to the cell culture density. Expression levels of stemness genes, particularly Nanog and c-Myc , were upregulated in AT-MSCs harvested at a low density (~50% confluent) in comparison to AT-MSCs from the same donor harvested at a high density (~90% confluent). These results imply that culture conditions, such as the cell density at harvesting, modulate the stemness gene expression and proliferation of MSCs.

  6. Improvement of potato tolerance to salinity using tissue culture techniques and irradiation with in vitro selection

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Arabi, M. I. E.


    A mutation breeding program was conducted to improve potato (Solanum tuberosum) tolerance to salinity. In vitro cultured explants from potato cvs. Draga, Diamant, Spunta were irradiated with gamma doses 25, 30, and 35 Gy.Growing shoots were cut and re-cultured every 2 weeks until the 4th generation (MV 4 ) to make sure no chimeral tissues still existed in the mutant material. Plantlets were subsequently propagated to obtain enough explants for in vitro selection pressure. Around 3000 plantlets from the three cultivars were subjected to selection pressure. MV 4 explants were cultured on MS medium supplemented with the NaCl in varying concentrations ranging between 50 to 200 mM. Surviving plantlets were propagated and re-cultured on a similar medium to insure their tolerance to salinity. Tolerant plantlets were acclimatized and transferred to pots and grown under glasshouse conditions. Plants were later subjected to another selection pressure, by irrigating them using water containing NaCl in concentrations ranging between 50-250 mM in addition to controls irrigated with normal water. Cultivar Spunta produced the highest number of tolerant plants. Four plants of Spunta appeared to be tolerant to salinity whereas only one plant from Diamant and was tolerant and no plants from cultivar Draga were tolerant. Mutant plants varied in number of produced minitubers from 8 - 14. Also, weight of these minitubers varied from less than 1 to 31 grams. (author)

  7. Application of Synthetic Polymeric Scaffolds in Breast Cancer 3D Tissue Cultures and Animal Tumor Models

    Directory of Open Access Journals (Sweden)

    Girdhari Rijal


    Full Text Available Preparation of three-dimensional (3D porous scaffolds from synthetic polymers is a challenge to most laboratories conducting biomedical research. Here, we present a handy and cost-effective method to fabricate polymeric hydrogel and porous scaffolds using poly(lactic-co-glycolic acid (PLGA or polycaprolactone (PCL. Breast cancer cells grown on 3D polymeric scaffolds exhibited distinct survival, morphology, and proliferation compared to those on 2D polymeric surfaces. Mammary epithelial cells cultured on PLGA- or PCL-coated slides expressed extracellular matrix (ECM proteins and their receptors. Estrogen receptor- (ER- positive T47D breast cancer cells are less sensitive to 4-hydroxytamoxifen (4-HT treatment when cultured on the 3D porous scaffolds than in 2D cultures. Finally, cancer cell-laden polymeric scaffolds support consistent tumor formation in animals and biomarker expression as seen in human native tumors. Our data suggest that the porous synthetic polymer scaffolds satisfy the basic requirements for 3D tissue cultures both in vitro and in vivo. The scaffolding technology has appealing potentials to be applied in anticancer drug screening for a better control of the progression of human cancers.

  8. Long-term Stability of Soft Tissue Esthetic Outcomes Following Conventional Single Implant Treatment in the Anterior Maxilla: 10-12 Year Results. (United States)

    Rokn, A; Bassir, S H; Rasouli Ghahroudi, A A; Kharazifard, M J; Manesheof, R


    The present study aimed to evaluate the long-term stability of esthetic outcomes of soft tissue around maxillary anterior single-tooth implants after 10-to-12 years of loading. Patients who had been treated for single-tooth implants in the anterior maxilla between February 2000 and July 2002 were invited to participate in the study. All implants had been placed according to delayed implant placement and conventional loading protocols without any connective tissue graft or papilla preservation flaps. Pink Esthetic Score (PES) was rated using standardized clinical photographs to assess the esthetic outcomes of the implant treatment at the time of crown placement and at time of follow-up examination which was at least 10 years after the crown placement. A total of 19 patients were included. The mean score of PES was 11.63 (SD 1.61; range 7-14) at baseline. After 10-to-12 years of function, a mean PES score of 11.05 (SD 2.09; range 6-14) was recorded. No significant differences were found in the esthetic outcomes, categorized based on clinically relevant levels, between the baseline and follow-up session (p>0.05). Within limitation of the present study, it can be concluded that the esthetic outcomes of soft tissue around the maxillary anterior single-tooth implants placed using conventional implant placement technique remained stable in the long-term.

  9. Automation of 3D reconstruction of neural tissue from large volume of conventional serial section transmission electron micrographs. (United States)

    Mishchenko, Yuriy


    We describe an approach for automation of the process of reconstruction of neural tissue from serial section transmission electron micrographs. Such reconstructions require 3D segmentation of individual neuronal processes (axons and dendrites) performed in densely packed neuropil. We first detect neuronal cell profiles in each image in a stack of serial micrographs with multi-scale ridge detector. Short breaks in detected boundaries are interpolated using anisotropic contour completion formulated in fuzzy-logic framework. Detected profiles from adjacent sections are linked together based on cues such as shape similarity and image texture. Thus obtained 3D segmentation is validated by human operators in computer-guided proofreading process. Our approach makes possible reconstructions of neural tissue at final rate of about 5 microm3/manh, as determined primarily by the speed of proofreading. To date we have applied this approach to reconstruct few blocks of neural tissue from different regions of rat brain totaling over 1000microm3, and used these to evaluate reconstruction speed, quality, error rates, and presence of ambiguous locations in neuropil ssTEM imaging data.

  10. Co-culture with infrapatellar fat pad differentially stimulates proteoglycan synthesis and accumulation in cartilage and meniscus tissues. (United States)

    Nishimuta, James F; Bendernagel, Monica F; Levenston, Marc E


    Although osteoarthritis is widely viewed as a disease of the whole joint, relatively few studies have focused on interactions among joint tissues in joint homeostasis and degeneration. In particular, few studies have examined the effects of the infrapatellar fat pad (IFP) on cartilaginous tissues. The aim of this study was to test the hypothesis that co-culture with healthy IFP would induce degradation of cartilage and meniscus tissues. Bovine articular cartilage, meniscus, and IFP were cultured isolated or as cartilage-fat or meniscus-fat co-cultures for up to 14 days. Conditioned media were assayed for sulfated glycosaminoglycan (sGAG) content, nitrite content, and matrix metalloproteinase (MMP) activity, and explants were assayed for sGAG and DNA contents. Co-cultures exhibited increased cumulative sGAG release and sGAG release rates for both cartilage and meniscus, and the cartilage (but not meniscus) exhibited a substantial synergistic effect of co-culture (sGAG release in co-culture was significantly greater than the summed release from isolated cartilage and fat). Fat co-culture did not significantly alter the sGAG content of either cartilage or meniscus explants, indicating that IFP co-culture stimulated net sGAG production by cartilage. Nitrite release was increased relative to isolated tissue controls in co-cultured meniscus, but not the cartilage, with no synergistic effect of co-culture. Interestingly, MMP-2 production was decreased by co-culture for both cartilage and meniscus. This study demonstrates that healthy IFP may modulate joint homeostasis by stimulating sGAG production in cartilage. Counter to our hypothesis, healthy IFP did not promote degradation of either cartilage or meniscus tissues.

  11. Comparison between xCELLigence biosensor technology and conventional cell culture system for real-time monitoring human tenocytes proliferation and drugs cytotoxicity screening. (United States)

    Chiu, Chih-Hao; Lei, Kin Fong; Yeh, Wen-Ling; Chen, Poyu; Chan, Yi-Sheng; Hsu, Kuo-Yao; Chen, Alvin Chao-Yu


    Local injections of anesthetics, NSAIDs, and corticosteroids for tendinopathies are empirically used. They are believed to have some cytotoxicity toward tenocytes. The maximal efficacy dosages of local injections should be determined. A commercial 2D microfluidic xCELLigence system had been developed to detect real-time cellular proliferation and their responses to different stimuli and had been used in several biomedical applications. The purpose of this study is to determine if human tenocytes can successfully proliferate inside xCELLigence system and the result has high correlation with conventional cell culture methods in the same condition. First passage of human tenocytes was seeded in xCELLigence and conventional 24-well plates. Ketorolac tromethamine, bupivacaine, methylprednisolone, and betamethasone with different concentrations (100, 50, and 10% diluted of clinical usage) were exposed in both systems. Gene expression of type I collagen, type III collagen, tenascin-C, decorin, and scleraxis were compared between two systems. Human tenocytes could proliferate both in xCELLigence and conventional cell culture systems. Cytotoxicity of each drug revealed dose-dependency when exposed to tenocytes in both systems. Significance was found between groups. All the four drugs had comparable cytotoxicity in their 100% concentration. When 50% concentration was used, betamethasone had a relatively decreased cytotoxicity among them in xCELLigence but not in conventional culture. When 10% concentration was used, betamethasone had the least cytotoxicity. Strong and positive correlation was found between cell index of xCELLigence and result of WST-1 assay (Pearson's correlation [r] = 0.914). Positive correlation of gene expression between tenocytes in xCELLigence and conventional culture was also observed. Type I collagen: [r] = 0.823; type III collagen: [r] = 0.899; tenascin-C: [r] = 0.917; decorin: [r] = 0.874; and scleraxis: [r] = 0.965. Human

  12. Diagnostic performance of conventional MRI parameters and apparent diffusion coefficient values in differentiating between benign and malignant soft-tissue tumours. (United States)

    Song, Y; Yoon, Y C; Chong, Y; Seo, S W; Choi, Y-L; Sohn, I; Kim, M-J


    To compare the abilities of conventional magnetic resonance imaging (MRI) and apparent diffusion coefficient (ADC) in differentiating between benign and malignant soft-tissue tumours (STT). A total of 123 patients with STT who underwent 3 T MRI, including diffusion-weighted imaging (DWI), were retrospectively analysed using variate conventional MRI parameters, ADC mean and ADC min . For the all-STT group, the correlation between the malignant STT conventional MRI parameters, except deep compartment involvement, compared to those of benign STT were statistically significant with univariate analysis. Maximum diameter of the tumour (p=0.001; odds ratio [OR], 8.97) and ADC mean (p=0.020; OR, 4.30) were independent factors with multivariate analysis. For the non-myxoid non-haemosiderin STT group, signal heterogeneity on axial T1-weighted imaging (T1WI; p=0.017), ADC mean , and ADC min (p=0.001, p=0.001), showed significant differences with univariate analysis between malignancy and benignity. Signal heterogeneity in axial T1WI (p=0.025; OR, 12.64) and ADC mean (p=0.004; OR, 33.15) were independent factors with multivariate analysis. ADC values as well as conventional MRI parameters were useful in differentiating between benign and malignant STT. The ADC mean was the most powerful diagnostic parameter in non-myxoid non-haemosiderin STT. Copyright © 2017 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  13. Culture of equine fibroblast-like synoviocytes on synthetic tissue scaffolds towards meniscal tissue engineering: a preliminary cell-seeding study

    Directory of Open Access Journals (Sweden)

    Jennifer J. Warnock


    Full Text Available Introduction. Tissue engineering is a new methodology for addressing meniscal injury or loss. Synovium may be an ideal source of cells for in vitro meniscal fibrocartilage formation, however, favorable in vitro culture conditions for synovium must be established in order to achieve this goal. The objective of this study was to determine cellularity, cell distribution, and extracellular matrix (ECM formation of equine fibroblast-like synoviocytes (FLS cultured on synthetic scaffolds, for potential application in synovium-based meniscal tissue engineering. Scaffolds included open-cell poly-L-lactic acid (OPLA sponges and polyglycolic acid (PGA scaffolds cultured in static and dynamic culture conditions, and PGA scaffolds coated in poly-L-lactic (PLLA in dynamic culture conditions.Materials and Methods. Equine FLS were seeded on OPLA and PGA scaffolds, and cultured in a static environment or in a rotating bioreactor for 12 days. Equine FLS were also seeded on PGA scaffolds coated in 2% or 4% PLLA and cultured in a rotating bioreactor for 14 and 21 days. Three scaffolds from each group were fixed, sectioned and stained with Masson’s Trichrome, Safranin-O, and Hematoxylin and Eosin, and cell numbers and distribution were analyzed using computer image analysis. Three PGA and OPLA scaffolds from each culture condition were also analyzed for extracellular matrix (ECM production via dimethylmethylene blue (sulfated glycosaminoglycan assay and hydroxyproline (collagen assay. PLLA coated PGA scaffolds were analyzed using double stranded DNA quantification as areflection of cellularity and confocal laser microscopy in a fluorescent cell viability assay.Results. The highest cellularity occurred in PGA constructs cultured in a rotating bioreactor, which also had a mean sulfated glycosaminoglycan content of 22.3 µg per scaffold. PGA constructs cultured in static conditions had the lowest cellularity. Cells had difficulty adhering to OPLA and the PLLA

  14. Survival and Diversity of Human Homologous Dietary MicroRNAs in Conventionally Cooked Top Sirloin and Dried Bovine Tissue Extracts.

    Directory of Open Access Journals (Sweden)

    Joseph T Dever

    Full Text Available Dietary microRNAs (miRNAs, notably those found in milk, are currently being investigated for their potential to elicit biological effects via canonical binding to human messenger RNA targets once ingested. Besides milk, beef and other bovine tissue-derived ingredients could also be a relevant source of potentially bioactive dietary miRNAs. In this study, we characterized the human homologous miRNA profiles in food-grade, bovine-sourced sirloin, heart and adrenal tissue (raw, cooked, and pasteurized, freeze-dried extracts via deep-sequencing and quantitative reverse transcription PCR (RT-qPCR. A total of 198 human homologous miRNAs were detected at 10 or more normalized reads in all replicates (n = 3 of at least one preparation method. Tissue origin rather than preparation method was the major differentiating factor of miRNA profiles, and adrenal-based miRNA profiles were the most distinct. The ten most prevalent miRNAs in each tissue represented 71-93% of the total normalized counts for all annotated miRNAs. In cooked sirloin, the most abundant miRNAs were miR-10b-5p, (48.8% of total annotated miRNA reads along with the muscle-specific miR-1 (24.1% and miR-206 (4.8%. In dried heart extracts, miR-1 (17.0%, miR-100-5p (16.1% and miR-99a-5p (11.0% gave the highest normalized read counts. In dried adrenal extracts, miR-10b-5p (71.2% was the most prominent followed by miR-143-3p (7.1% and 146b-5p (3.7%. Sequencing results for five detected and two undetected miRNAs were successfully validated by RT-qPCR. We conclude that edible, bovine tissues contain unique profiles of human homologous dietary miRNAs that survive heat-based preparation methods.

  15. Radiation induced variation in potato for tolerance to salinity using tissue culture technique

    International Nuclear Information System (INIS)

    Sharabash, M.T.


    Meristem-tips of potato (Solanum tuberosum) cv. 'Diamant', obtained from tuber sprouts, were cultured on MS medium, and multiplied into plantlets through micropropagation. To induce variation for salt tolerance, the obtained plantlets were irradiated with 0, 20, and 40 Gy gamma rays at 27.7 rad/sec. Irradiated plantlets were cut into single nodes and cultured on MS medium, supplemented with 2000 and 4000 ppm NaCI. Salt tolerant plantlets were transferred for tuberization on MS liquid medium supplemented with the same concentration of NaCI. Micro-tubers, collected after 6 weeks of culture, had fresh weight between 0.03 to 0.3 g. Mini-tubers were obtained by planting micro-tubers in 25 cm pots under insect proof greenhouse. Mini-tuber number per plant ranged from 3 to 6, and the mini-tuber weight ranged from 0.5-3.0 g, depending upon the treatment. Further studies are in progress to produce conventional tubers under salinity stress from the promising variants, specially those tolerant to 4000 ppm, and to assure the stability of the obtained variants. (author)

  16. Comparison of mesencephalic free-floating tissue culture grafts and cell suspension grafts in the 6-hydroxydopamine-lesioned rat

    DEFF Research Database (Denmark)

    Meyer, Morten; Widmer, H R; Wagner, B


    of grafted dopaminergic neurons and to correlate that with the behavioral effects. Additional cultures and acutely prepared explants were also fixed and stored for histological investigation in order to estimate the loss of dopaminergic neurons in culture and after transplantation. Similar behavioral...... numbers of TH-immunoreactive (TH-ir) neurons in grafts of cultured tissue (775 +/- 98, mean +/- SEM) and grafts of fresh, dissociated cell suspension (806 +/- 105, mean +/- SEM). Cell counts in fresh explants, 7-day-old cultures, and grafted cultures revealed a 68.2% loss of TH-ir cells 7 days after......Ventral mesencephalon (VM) of fetal rat and human origin grown as free-floating roller-tube (FFRT) cultures can survive subsequent grafting to the adult rat striatum. To further explore the functional efficacy of such grafts, embryonic day 13 ventral mesencephalic tissue was grafted either after 7...

  17. Finite element study of scaffold architecture design and culture conditions for tissue engineering. (United States)

    Olivares, Andy L; Marsal, Elia; Planell, Josep A; Lacroix, Damien


    Tissue engineering scaffolds provide temporary mechanical support for tissue regeneration and transfer global mechanical load to mechanical stimuli to cells through its architecture. In this study the interactions between scaffold pore morphology, mechanical stimuli developed at the cell microscopic level, and culture conditions applied at the macroscopic scale are studied on two regular scaffold structures. Gyroid and hexagonal scaffolds of 55% and 70% porosity were modeled in a finite element analysis and were submitted to an inlet fluid flow or compressive strain. A mechanoregulation theory based on scaffold shear strain and fluid shear stress was applied for determining the influence of each structures on the mechanical stimuli on initial conditions. Results indicate that the distribution of shear stress induced by fluid perfusion is very dependent on pore distribution within the scaffold. Gyroid architectures provide a better accessibility of the fluid than hexagonal structures. Based on the mechanoregulation theory, the differentiation process in these structures was more sensitive to inlet fluid flow than axial strain of the scaffold. This study provides a computational approach to determine the mechanical stimuli at the cellular level when cells are cultured in a bioreactor and to relate mechanical stimuli with cell differentiation.

  18. Studies on salt and drought tolerance of lavender using tissue culture and gamma rays

    International Nuclear Information System (INIS)

    Essam, K.E.; El-Sharnoby, M.E.


    The present study was carried out to investigate the propagation and chemical composition of Lavandula spica using different cytokinins (BA, Ki and 2ip) on MS medium,, besides medium strength. Also, GA3 concentrations, auxin types, gamma irradiation (0, 2, 4, 6 and 8 Krad), different concentrations of mannitol (10, 20, 40, 80 and 100 mg/l) as well as different salinity concentrations of CaCl 2 or NaCl or both at levels 250, 500, 750 and 1000 ppm were used in the study. Maximum proliferation parameter was produced on MS medium supplemented with 1 mg/l BA than other cytokinin types. Growing the explant of Lavandula. spica on MS medium, containing 3 mg/l BA, gave the highest proliferation, growth and greening parameters. However, using MS medium at half strength supplemented with 3 mg/l BA resulted in significant increase in both shoot elongation and greening parameters as compared with the other medium strengths, while 4 mg/l GA induced the best shoot elongation. Adding 1 mg/l IBA enhanced rooting and also the obtained results showed that increasing gamma irradiation decreased growth and proliferation parameters. Moreover, increasing drought stress induced an adverse effect on tissue culture parameter while some chemical analysis parameters were increased to maximum degree of their tolerance to drought stress. Also, using different salinity treatment by NaCl, CaCl 2 and their combinations showed adverse effects on tissue culture parameters chemical composition

  19. Production of virus-free orchid Cymbidium aloifolium (L.) Sw. by various tissue culture techniques. (United States)

    Pradhan, Shreeti; Regmi, Tripti; Ranjit, Mukunda; Pant, Bijaya


    Orchids are affected by many viruses resulting in poor growth, yield and quality, and an overall decline in population. Cymbidium mosaic virus (CymMV) is one of the common orchid viruses found in Cymbidium species but it infects different orchid genera. In this study Cymbidium aloifolium was propagated in vitro using MS medium at different strength (1.0, ½, and ¼) with or without 0.5 mg/l BAP (6-benzylaminopurine) and 0.5 mg/l NAA (Naphthalene acetic acid). To provide disease-free planting material, source plant for in vitro propagation needs to be screened for pathogenic viruses. In the present study, in vivo -grown source (mother) plants and tissue culture-derived plants of C. aloifolium were tested for CymMV virus using Double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA). All the tissue cultured plants were found to be 100% virus-free whereas the in vivo grown source plants were highly affected by CymMV virus (83.33%). The virus-free in vitro plantlets were multiplied in large scale and then acclimatized on earthen pot containing a mixture of cocopeat, litter and clay in the ratio of 3:2:1. Eighty five percent of acclimatized plantlets survived making this method an efficient mass production system for high quality virus-free C. aloifolium for commercial floriculture and germplasm preservation.

  20. Production of virus-free orchid Cymbidium aloifolium (L. Sw. by various tissue culture techniques

    Directory of Open Access Journals (Sweden)

    Shreeti Pradhan


    Full Text Available Orchids are affected by many viruses resulting in poor growth, yield and quality, and an overall decline in population. Cymbidium mosaic virus (CymMV is one of the common orchid viruses found in Cymbidium species but it infects different orchid genera. In this study Cymbidium aloifolium was propagated in vitro using MS medium at different strength (1.0, ½, and ¼ with or without 0.5 mg/l BAP (6-benzylaminopurine and 0.5 mg/l NAA (Naphthalene acetic acid. To provide disease-free planting material, source plant for in vitro propagation needs to be screened for pathogenic viruses. In the present study, in vivo-grown source (mother plants and tissue culture-derived plants of C. aloifolium were tested for CymMV virus using Double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA. All the tissue cultured plants were found to be 100% virus-free whereas the in vivo grown source plants were highly affected by CymMV virus (83.33%. The virus-free in vitro plantlets were multiplied in large scale and then acclimatized on earthen pot containing a mixture of cocopeat, litter and clay in the ratio of 3:2:1. Eighty five percent of acclimatized plantlets survived making this method an efficient mass production system for high quality virus-free C. aloifolium for commercial floriculture and germplasm preservation. Keywords: Biological sciences, Plant biology

  1. Application of plant cell and tissue culture for the production of phytochemicals in medicinal plants. (United States)

    Pant, Bijaya


    Approximately 80% of the world inhabitants depend on the medicinal plants in the form of traditional formulations for their primary health care system well as in the treatment of a number of diseases since the ancient time. Many commercially used drugs have come from the information of indigenous knowledge of plants and their folk uses. Linking of the indigenous knowledge of medicinal plants to modern research activities provides a new reliable approach, for the discovery of novel drugs much more effectively than with random collection. Increase in population and increasing demand of plant products along with illegal trade are causing depletion of medicinal plants and many are threatened in natural habitat. Plant tissue culture technique has proved potential alternative for the production of desirable bioactive components from plants, to produce the enough amounts of plant material that is needed and for the conservation of threatened species. Different plant tissue culture systems have been extensively studied to improve and enhance the production of plant chemicals in various medicinal plants.

  2. Screenhouse and field persistence of nonpathogenic endophytic Fusarium oxysporum in Musa tissue culture plants. (United States)

    Paparu, Pamela; Dubois, Thomas; Gold, Clifford S; Niere, Björn; Adipala, Ekwamu; Coyne, Daniel


    Two major biotic constraints to highland cooking banana (Musa spp., genome group AAA-EA) production in Uganda are the banana weevil Cosmopolites sordidus and the burrowing nematode Radopholus similis. Endophytic Fusarium oxysporum strains inoculated into tissue culture banana plantlets have shown control of the banana weevil and the nematode. We conducted screenhouse and field experiments to investigate persistence in the roots and rhizome of two endophytic Fusarium oxysporum strains, V2w2 and III4w1, inoculated into tissue-culture banana plantlets of highland cooking banana cultivars Kibuzi and Nabusa. Re-isolation of F. oxysporum showed that endophyte colonization decreased faster from the rhizomes than from the roots of inoculated plants, both in the screenhouse and in the field. Whereas rhizome colonization by F. oxysporum decreased in the screenhouse (4-16 weeks after inoculation), root colonization did not. However, in the field (17-33 weeks after inoculation), a decrease was observed in both rhizome and root colonization. The results show a better persistence in the roots than rhizomes of endophytic F. oxysporum strains V2w2 and III4w1.


    Directory of Open Access Journals (Sweden)

    Lita Soetopo


    Full Text Available The studies were focused on developing an efficient and effective propagation protocol for orchid species from genera Dendrobioum and Phalaenopsis through tissue culture. The Materials used were explants from adventive shoot tip, floral stalk buds and PLBs derived from seeds. The results indicated growth and development of adventive shoot tip explants of Dendrobium: a high survival percentage for explant with green color was shown by D. racianum, followed by D. laxiflorum, D. pseudo-conantum, D. strebloceras, D. lineale, and D. veratrifolium. However, plantlets regeneration occurred only on D. pseudoconantum, and D. strebloceras. Explant regeneration from seed derived protocorm-like bodies on D. spectabile occurred 40 days after inoculation transfer and subculture. High survival percentage of explant from floral stalk shoot was shown by P. amabilis. There were several plantlets surviving in acclimatisation. Explant regeneration from seed derived from protocorm-like bodies on P. hieroglypha occurred 40 days after inoculation and subculture. It was suggested that for ex situ conservation on certain species of Dendrobium and Phalaenopsis in the category of rare germplasms, tissue culture could be applied effectively and efficiently by using explant from adventive shoot tip, floral stalk buds and seed derived protocorm-like body explant for vegetative seed multiplication.

  4. The gene expression profile of non-cultured, highly purified human adipose tissue pericytes: Transcriptomic evidence that pericytes are stem cells in human adipose tissue

    Energy Technology Data Exchange (ETDEWEB)

    Silva Meirelles, Lindolfo da, E-mail: [Center for Cell-Based Therapy (CEPID/FAPESP), Regional Center for Hemotherapy of Ribeirão Preto, University of São Paulo, Rua Tenente Catão Roxo 2501, 14051-140 Ribeirão Preto, SP (Brazil); Laboratory for Stem Cells and Tissue Engineering, PPGBioSaúde, Lutheran University of Brazil, Av. Farroupilha 8001, 92425-900 Canoas, RS (Brazil); Deus Wagatsuma, Virgínia Mara de; Malta, Tathiane Maistro; Bonini Palma, Patrícia Viana [Center for Cell-Based Therapy (CEPID/FAPESP), Regional Center for Hemotherapy of Ribeirão Preto, University of São Paulo, Rua Tenente Catão Roxo 2501, 14051-140 Ribeirão Preto, SP (Brazil); Araújo, Amélia Goes; Panepucci, Rodrigo Alexandre [Laboratory of Large-Scale Functional Biology (LLSFBio), Regional Center for Hemotherapy of Ribeirão Preto, University of São Paulo, Rua Tenente Catão Roxo 2501, 14051-140 Ribeirão Preto, SP (Brazil); and others


    Pericytes (PCs) are a subset of perivascular cells that can give rise to mesenchymal stromal cells (MSCs) when culture-expanded, and are postulated to give rise to MSC-like cells during tissue repair in vivo. PCs have been suggested to behave as stem cells (SCs) in situ in animal models, although evidence for this role in humans is lacking. Here, we analyzed the transcriptomes of highly purified, non-cultured adipose tissue (AT)-derived PCs (ATPCs) to detect gene expression changes that occur as they acquire MSC characteristics in vitro, and evaluated the hypothesis that human ATPCs exhibit a gene expression profile compatible with an AT SC phenotype. The results showed ATPCs are non-proliferative and express genes characteristic not only of PCs, but also of AT stem/progenitor cells. Additional analyses defined a gene expression signature for ATPCs, and revealed putative novel ATPC markers. Almost all AT stem/progenitor cell genes differentially expressed by ATPCs were not expressed by ATMSCs or culture-expanded ATPCs. Genes expressed by ATMSCs but not by ATPCs were also identified. These findings strengthen the hypothesis that PCs are SCs in vascularized tissues, highlight gene expression changes they undergo as they assume an MSC phenotype, and provide new insights into PC biology. - Highlights: • Non-cultured adipose tissue-derived human pericytes (ncATPCs) exhibit a distinctive gene expression signature. • ncATPCs express key adipose tissue stem cell genes previously described in vivo in mice. • ncATPCs express message for anti-proliferative and antiangiogenic molecules. • Most ncATPC-specific transcripts are absent in culture-expanded pericytes or ATMSCs • Gene expression changes ncATPCs undergo as they acquire a cultured ATMSC phenotype are pointed out.

  5. The gene expression profile of non-cultured, highly purified human adipose tissue pericytes: Transcriptomic evidence that pericytes are stem cells in human adipose tissue

    International Nuclear Information System (INIS)

    Silva Meirelles, Lindolfo da; Deus Wagatsuma, Virgínia Mara de; Malta, Tathiane Maistro; Bonini Palma, Patrícia Viana; Araújo, Amélia Goes; Panepucci, Rodrigo Alexandre


    Pericytes (PCs) are a subset of perivascular cells that can give rise to mesenchymal stromal cells (MSCs) when culture-expanded, and are postulated to give rise to MSC-like cells during tissue repair in vivo. PCs have been suggested to behave as stem cells (SCs) in situ in animal models, although evidence for this role in humans is lacking. Here, we analyzed the transcriptomes of highly purified, non-cultured adipose tissue (AT)-derived PCs (ATPCs) to detect gene expression changes that occur as they acquire MSC characteristics in vitro, and evaluated the hypothesis that human ATPCs exhibit a gene expression profile compatible with an AT SC phenotype. The results showed ATPCs are non-proliferative and express genes characteristic not only of PCs, but also of AT stem/progenitor cells. Additional analyses defined a gene expression signature for ATPCs, and revealed putative novel ATPC markers. Almost all AT stem/progenitor cell genes differentially expressed by ATPCs were not expressed by ATMSCs or culture-expanded ATPCs. Genes expressed by ATMSCs but not by ATPCs were also identified. These findings strengthen the hypothesis that PCs are SCs in vascularized tissues, highlight gene expression changes they undergo as they assume an MSC phenotype, and provide new insights into PC biology. - Highlights: • Non-cultured adipose tissue-derived human pericytes (ncATPCs) exhibit a distinctive gene expression signature. • ncATPCs express key adipose tissue stem cell genes previously described in vivo in mice. • ncATPCs express message for anti-proliferative and antiangiogenic molecules. • Most ncATPC-specific transcripts are absent in culture-expanded pericytes or ATMSCs • Gene expression changes ncATPCs undergo as they acquire a cultured ATMSC phenotype are pointed out.

  6. Withania somnifera: Advances and Implementation of Molecular and Tissue Culture Techniques to Enhance Its Application

    Directory of Open Access Journals (Sweden)

    Vibha Pandey


    Full Text Available Withania somnifera, commonly known as Ashwagandha an important medicinal plant largely used in Ayurvedic and indigenous medicine for over 3,000 years. Being a medicinal plant, dried powder, crude extract as well as purified metabolies of the plant has shown promising therapeutic properties. Withanolides are the principal metabolites, responsible for the medicinal properties of the plant. Availability and amount of particular withanolides differ with tissue type and chemotype and its importance leads to identification characterization of several genes/ enzymes related to withanolide biosynthetic pathway. The modulation in withanolides can be achieved by controlling the environmental conditions like, different tissue culture techniques, altered media compositions, use of elicitors, etc. Among all the in vitro techniques, hairy root culture proved its importance at industrial scale, which also gets benefits due to more accumulation (amount and number of withanolides in roots tissues of W. somnifera. Use of media compostion and elicitors further enhances the amount of withanolides in hairy roots. Another important modern day technique used for accumulation of desired secondary metabolites is modulating the gene expression by altering environmental conditions (use of different media composition, elicitors, etc. or through genetic enginnering. Knowing the significance of the gene and the key enzymatic step of the pathway, modulation in withanolide contents can be achieved upto required amount in therapeutic industry. To accomplish maximum productivity through genetic enginnering different means of Withania transformation methods have been developed to obtain maximum transformation efficiency. These standardized transformation procedues have been used to overexpress/silence desired gene in W. somnifera to understand the outcome and succeed with enhanced metabolic production for the ultimate benefit of human race.

  7. Cytogenetic studies on stevia rebaudiana produced by tissue culture and affected by gamma rays and drought

    International Nuclear Information System (INIS)

    Awad, A.S.A


    The present investigation was under taken to carry out in the laboratories of the Natural Products Department, National Center for Radiation Research and Technology, Atomic Energy authority, Nasr city, Cairo, Egypt, to study the effect of gamma radiation doses, osmostress and the combined effects between them on tissue culture, some biochemical analysis and molecular genetic marker in stevia rebaudiana bertoni. The results obtained were: Tissue culture 1- micropropagation media: stevia rebaudiana plantlets cultured on MS medium hormones free for micropropagation.Hormones such as BAP and NAA with different concentrations induced callus formation and give slight growth.Study the effect of gamma radiation, osmostress and the combined effects between them : 1)The effect of gamma radiation on buds survival: Gamma radiation doses (10, 20 and 30 Gy) induced decreasing in bud survival percentage with increasing radiation dose in stevia rebaudiana. The dose 30 Gy was induced 60% mortality.2) Study the effect of gamma radiation on some biochemical analysis: Gamma radiation doses induced increase in the total carbohydrate with doses (20 and 30 Gy) but decreased with dose 10 Gy. Proline contents increased in plantlets with increasing doses . The total protein was increased with doses (10 and 20 Gy), but the dose 30 Gy induced decrease in total protein. Gamma radiation doses induced decreasing in total DNA while, the nucleic acid RNA increased.3) The effect of osmostress on buds survival: The concentrations (40000,50000,60000,70000 and 80000 ppm) from sucrose or sorbitol decreased the bud survival and shoot length in stevia plantlets with increasing sucrose or sorbitol levels. 4) The effect of osmostress on some biochemical analysis: Sucrose and sorbitol concentrations (40000,50000,60000,70000 and 80000 ppm) caused decrease in total carbohydrate.

  8. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik [Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Suh, Jin Suck; Kim, Ah Hyun [Dept. of Radiology and Research Institute of Radiological Science, Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Ryu, Jeong Ah [Dept. of Radiology, Guri Hospital, Hanyang University College of Medicine, Guri (Korea, Republic of); Park, Jeong Seon [Dept. of Radiology, Hanyang University Hospital, Hanyang University College of Medicine, Seoul (Korea, Republic of)


    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  9. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    International Nuclear Information System (INIS)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik; Suh, Jin Suck; Kim, Ah Hyun; Ryu, Jeong Ah; Park, Jeong Seon


    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  10. Picroside I and Picroside II from Tissue Cultures of Picrorhiza kurroa (United States)

    Ganeshkumar, Yamjala; Ramarao, Ajmera; Veeresham, Ciddi


    Background: Picrorhiza kurroa (PK) belongs to Scrophulariaceae family and is a representative endemic, medicinal herb, widely distributed throughout the higher altitudes of alpine Himalayas from west to east, between 3000 and 4500 m above mean sea level. Objective: The objective of the present study is to assess the production of picroside I and picroside II from tissue cultures of PK. Materials and Methods: Auxiliary shoot tips of PK were incubated in Murashige and Skoog medium supplemented with indole-3-butyric acid and kinetin phytohormones. The callus produced was collected at different time intervals and was processed for extraction of picroside I and picroside II followed by thin layer chromatography and high-performance liquid chromatography HPLC analysis. Results: The maximum growth index was found to be 5.109 ± 0.159 at 16-week-old callus culture. The estimation of picroside-I and picroside-II was carried out by (HPLC) analysis; quantity of secondary metabolite found to be 16.37 ± 0.0007 mg/g for PK-I and 6.34 ± 0.0012 mg/g for PK-II. Conclusion: This is the first attempt to produce the Picroside-I and II in large amount by the tissue culture technique. It can be observed that the method of callus culture can be used in production of secondary metabolites Picroside-I and II from PK SUMMARY Picrorhiza kurroa is a high value medicinal herb due to rich source of hepatoprotective metabolites, Picroside-I and Picroside-II. The medicinal importance of P. kurroa is due to its pharmacological properties like hepatoprotective, antioxidant (particularly in liver), antiallergic and antiasthamatic, anticancer activity particularly in liver and immunomodulatory. Shoot apices which were produced a good response was inoculated on selected medium i.e., on MS medium containing 2, 4 D (mg/l) + KN (1mg/l) for induction of callus. The initiation of callus was observed after 4weeks and it was light green and fragile Maximum growth was observed with 3% w/v of sucrose


    Directory of Open Access Journals (Sweden)

    V. V. Ivanov


    Full Text Available Objective. Investigation of hypolipidemic effect of sesquiterpene γ-lactone ahillin in hepatoma tissue culture (HTC cells.Material and methods. In this study we’ve evaluated the effect of γ-lactone sesquiterpene aсhillin and gemfibrozil (comparator drug on the lipid content in the hepatoma tissue culture (HTC cell which were incubated with a fat emulsion lipofundin by fluorescent method with vital dye Nile Redand staining the cells with the dye Oil Red O. The cell viability was investigated using the MTT-test and staining with Trypan blue.Results. Cultivation cells HTC with aсhillin and gemfibrozilat concentrations ranging from 0.5 to1.5 mM and from0.25 mM to0.5 mM, respectively, resulted in dose-dependent decrease of the fluorescence’s intensity Nile Red. It reflects a decrease in lipid content in the cells. At these concentrations the drugs didn’t have cytotoxic effect and the cell viability didn’t change compared to the control culture.An experimental hyperlipidemia in the hepatoma culture cells was induced by adding to the incubation medium a fat emulsion lipofundin at a final concentration 0.05%. The intensity of fluorescence Nile Red in the cells was increased 4 fold (p < 0.05. This result suggests the significant accumulation of lipids in the cell’s cytosol and confirmed by microscopy after staining neutral lipids with the dye Oil Red O. Under these conditions aсhillin and gemfibrozil reduced lipid content in cells and hadthe effect at concentrations of0.5 mM and0.25 mM respectively.Conclusion. In the lipofundin-mediated model of hyperlipidemia the sesquiterpene lactone aсhillin prevents the lipid accumulation in cells. It confirms by decrease of fluorescence Nile Red and reduction lipid drops which were stained with Oil Red O in cytosol. To establish the molecular targets of aсhillin’saction on lipid metabolism in cell culture HTC we need to investigate a gene expression of key enzymes of lipid metabolism.

  12. The use of tissue culture techniques with irradiation to improve potato resistance to late blight

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Arabi, M.I.E.


    A mutation breeding program was conducted to improve potato (Solanum tuberosum) resistance to late blight disease caused by Phytophthora infestans. In vitro cultured explants from potato cvs. Draga, Diamant, Spunta were irradiated with gamma ray doses 25, 30, and 35 Gy. Growing shoots were cut and re-cultured every 2 weeks until the 4 t h generation (MV 4 ) to make sure no chimeral tissues still existed in the mutant material. Plantlets were subsequently propagated to obtain enough explants for in vitro selection pressure. Around 3000 plantlets from the three cultivars were subjected to selection pressure using co-culture technique. MV 4 explants were incubated in jars, containing MS medium, with mycelia of P. infestans. Surviving plantlets were propagated and re-incubated with the pathogen for three consecutive generations. Resistant plantlets were acclimatized and transferred to pots and grown under glasshouse conditions. Plants were later inoculated, at the adult stage, with sporangial suspension. Cultivar Draga produced the highest number of resistant plants. Ten plants of Draga appeared to be resistant to late blight whereas only one plant from each of the other 2 cultivars was resistant. Mutant plants varied in number of produced minitubers from 13 to 70, Also, weight of these minitubers varied from less than 1 to 35 grams. Selected mutant lines will undergo further testing under field conditions for P. infestans resistance and other agronomic characteristics. (author)

  13. Rose (Rosa hybrida L.) tissue culture mutagenesis for new mutants generation

    International Nuclear Information System (INIS)

    Salahbiah Abdul Majid; Rusli Ibrahim


    Tissue culture technique can be used to obtain complete regeneration of plant cells from shoots, rots, flowers, axillary buds and other parts of the plant. In this study, axillary buds from stem cuttings of Cutting Red, Christine Dior and Mini Rose varieties were used as the stating explants. Murashige and Skoog (1962) media supplemented with 6-Benzylaminopurine (BAP, at 4.44 - 8.88μM/l), Napthaleneacetic acid (NAA at 0.54μM/l),, nad 3% sucrose were used for plantlet initiation and regeneration. Cultured axillary buds were exposed to gamma ray (0.250 Gy/s) at 0, 15, 25, 35, 45, 55, 65 and 75 Gy for radiosensitivity test. From the dose respond curve, LD 5 0 the value for cutting red variety was 25 Gy, Christion Dior 30 Gy and Mini Rose 38 Gy, yet 22% of Mini Rose samples survived at 65 Gy and another 10% at 70 Gy. Screening of M3 plants of irradiated cultured shoots, 2 colour variations were obtained at 40 Gy for Cutting Red variety, while 3 colour variations for Mini Rose at 20 Gy. When 6 varieties of Fragrance Rose were irradiated at 40 Gy, 1 colour variation was obtained from 99 screened plants. This study suggests that the dose range of 20 to 45 can be considered for rose mutagenesis study to produce mutants. (Author)

  14. Genetic programming based models in plant tissue culture: An addendum to traditional statistical approach. (United States)

    Mridula, Meenu R; Nair, Ashalatha S; Kumar, K Satheesh


    In this paper, we compared the efficacy of observation based modeling approach using a genetic algorithm with the regular statistical analysis as an alternative methodology in plant research. Preliminary experimental data on in vitro rooting was taken for this study with an aim to understand the effect of charcoal and naphthalene acetic acid (NAA) on successful rooting and also to optimize the two variables for maximum result. Observation-based modelling, as well as traditional approach, could identify NAA as a critical factor in rooting of the plantlets under the experimental conditions employed. Symbolic regression analysis using the software deployed here optimised the treatments studied and was successful in identifying the complex non-linear interaction among the variables, with minimalistic preliminary data. The presence of charcoal in the culture medium has a significant impact on root generation by reducing basal callus mass formation. Such an approach is advantageous for establishing in vitro culture protocols as these models will have significant potential for saving time and expenditure in plant tissue culture laboratories, and it further reduces the need for specialised background.

  15. Diversity and abundance of Beauveria bassiana in soils, stink bugs and plant tissues of common bean from organic and conventional fields. (United States)

    Ramos, Yordanys; Portal, Orelvis; Lysøe, Erik; Meyling, Nicolai V; Klingen, Ingeborg


    The aim of this study was to evaluate the natural occurrence of Beauveria spp. in soil, from infections in the stink bug Piezodorus guildinii, an important pest of common bean (Phaseolus vulgaris) and as endophytes in bean plant tissue. Twelve conventional and 12 organic common bean fields in the Villa Clara province, Cuba were sampled from September 2014 to April 2015. One hundred and fifty Beauveria isolates were obtained from soil samples, bean plant parts and stink bugs. The overall frequency of occurrence of Beauveria isolates in conventional fields (8.4%) was significantly lower than that in organic fields (23.6%). Beauveria were also obtained significantly more frequently from bean roots in organic fields (15.0%) compared to bean roots in conventional fields (3.3%). DNA sequencing of the intergenic Bloc region was performed for Beauveria species identification. All isolates where characterized as Beauveria bassiana (Balsamo-Crivelli) Vuillemin, and clustered with isolates of neotropical origin previously described as AFNEO_1. The Cuban B. bassiana isolates formed five clusters in the phylogeny. Isolates of two clusters originated from all four locations, organic and conventional fields, as well as soil, plants and stink bugs. Organic fields contained isolates of all five clusters while conventional fields only harbored isolates of the two most frequent ones. Mating type PCR assays revealed that mating type distribution was skewed, with MAT1/MAT2 proportion of 146/4, indicating limited potential for recombination. The present study is the first to report of B. bassiana as a naturally occurring endophyte in common bean. Further, it shows that B. bassiana occurs naturally in diverse environments of common bean fields, and constitutes a potential reservoir of natural enemies against pest insects particularly in organic fields. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Pre-irradiation of tissue culture flasks leads to diminished stem and progenitor cell production in long-term bone marrow cultures

    International Nuclear Information System (INIS)

    Rooney, P.; Wright, E.G.


    Empty plastic tissue culture flasks were exposed to X-irradiation doses of 0.3-10.0 Gy, prior to the establishment of long-term bone marrow cultures. During the course of a 10 week culture period, all irradiated plastic flasks exhibited a dramatic decrease in the number of both haemopoietic stem cells and myeloid progenitor cells, in the non-adherent layer, when compared with controls. This decrease was not due to a decrease in the number of non-adherent cells produced. Histological examination of non-adherent cells showed an increase in mature granulocytic cells with few blast cells. Morphologically, the adherent layers of irradiated flasks demonstrated a delay in appearance or absence of fat cell production. X-irradiation of glass tissue culture flasks had no deleterious effect. (author)

  17. Extracellular matrix production by human osteoblasts cultured on biodegradable polymers applicable for tissue engineering. (United States)

    El-Amin, S F; Lu, H H; Khan, Y; Burems, J; Mitchell, J; Tuan, R S; Laurencin, C T


    The nature of the extracellular matrix (ECM) is crucial in regulating cell functions via cell-matrix interactions, cytoskeletal organization, and integrin-mediated signaling. In bone, the ECM is composed of proteins such as collagen (CO), fibronectin (FN), laminin (LM), vitronectin (VN), osteopontin (OP) and osteonectin (ON). For bone tissue engineering, the ECM should also be considered in terms of its function in mediating cell adhesion to biomaterials. This study examined ECM production, cytoskeletal organization, and adhesion of primary human osteoblastic cells on biodegradable matrices applicable for tissue engineering, namely polylactic-co-glycolic acid 50:50 (PLAGA) and polylactic acid (PLA). We hypothesized that the osteocompatible, biodegradable polymer surfaces promote the production of bone-specific ECM proteins in a manner dependent on polymer composition. We first examined whether the PLAGA and PLA matrices could support human osteoblastic cell growth by measuring cell adhesion at 3, 6 and 12h post-plating. Adhesion on PLAGA was consistently higher than on PLA throughout the duration of the experiment, and comparable to tissue culture polystyrene (TCPS). ECM components, including CO, FN, LM, ON, OP and VN, produced on the surface of the polymers were quantified by ELISA and localized by immunofluorescence staining. All of these proteins were present at significantly higher levels on PLAGA compared to PLA or TCPS surfaces. On PLAGA, OP and ON were the most abundant ECM components, followed by CO, FN, VN and LN. Immunofluorescence revealed an extracellular distribution for CO and FN, whereas OP and ON were found both intracellularly as well as extracellularly on the polymer. In addition, the actin cytoskeletal network was more extensive in osteoblasts cultured on PLAGA than on PLA or TCPS. In summary, we found that osteoblasts plated on PLAGA adhered better to the substrate, produced higher levels of ECM molecules, and showed greater cytoskeletal

  18. SU-E-T-501: Normal Tissue Toxicities of Pulsed Low Dose Rate Radiotherapy and Conventional Radiotherapy: An in Vivo Total Body Irradiation Study

    Energy Technology Data Exchange (ETDEWEB)

    Cvetkovic, D; Zhang, P; Wang, B; Chen, L; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)


    Purpose: Pulsed low dose rate radiotherapy (PLDR) is a re-irradiation technique for therapy of recurrent cancers. We have previously shown a significant difference in the weight and survival time between the mice treated with conventional radiotherapy (CRT) and PLDR using total body irradiation (TBI). The purpose of this study was to investigate the in vivo effects of PLDR on normal mouse tissues.Materials and Methods: Twenty two male BALB/c nude mice, 4 months of age, were randomly assigned into a PLDR group (n=10), a CRT group (n=10), and a non-irradiated control group (n=2). The Siemens Artiste accelerator with 6 MV photon beams was used. The mice received a total of 18Gy in 3 fractions with a 20day interval. The CRT group received the 6Gy dose continuously at a dose rate of 300 MU/min. The PLDR group was irradiated with 0.2Gyx20 pulses with a 3min interval between the pulses. The mice were weighed thrice weekly and sacrificed 2 weeks after the last treatment. Brain, heart, lung, liver, spleen, gastrointestinal, urinary and reproductive organs, and sternal bone marrow were removed, formalin-fixed, paraffin-embedded and stained with H and E. Morphological changes were observed under a microscope. Results: Histopathological examination revealed atrophy in several irradiated organs. The degree of atrophy was mild to moderate in the PLDR group, but severe in the CRT group. The most pronounced morphological abnormalities were in the immune and hematopoietic systems, namely spleen and bone marrow. Brain hemorrhage was seen in the CRT group, but not in the PLDR group. Conclusions: Our results showed that PLDR induced less toxicity in the normal mouse tissues than conventional radiotherapy for the same dose and regimen. Considering that PLDR produces equivalent tumor control as conventional radiotherapy, it would be a good modality for treatment of recurrent cancers.

  19. Polyamine patterns in haploid and diploid tobacco tissues and in vitro cultures

    Directory of Open Access Journals (Sweden)

    Sílvia Bicudo Carone


    Full Text Available The aim of this work was to determine PAs levels in pith tissues and callus cultures from haploid and diploid tobacco plants, explanted from the apical and basal regions of the stem. These explants were cultured in an RM-64 medium supplied with IAA and kinetin, under light or in the dark, during successive subcultures. PAs levels followed a basipetal decrease in diploid and an increase in haploid, pith tissues. A similar pattern of total PAs (free + conjugated was observed for the callus of diploid and haploid plants maintained in the light, and for the haploid callus in the dark, whereas the diploid callus in the dark showed a constant increase in total PAs levels until the end of culture. The PA increase in the diploid callus in the dark was related to free Put levels increase. The ploidy status of the plants could express different PA gradients together with the plant pith and in vitro callus cultures.O objetivo deste trabalho foi determinar os níveis de PAs em tecidos de medula e cultura de calos de plantas haplóides e diplóides de tabaco, obtidas da região apical e basal do caule. Estes explantes foram cultivados em meio RM-64 suplementado com AIA e cinetina, na luz e no escuro, durante vários subcultivos. Nos tecidos medulares, os níveis de PAs apresentam um decréscimo basípeto em diplóides e um aumento em haplóides.Um padrão similar nos níveis de PAs totais (livres+ conjugadas foi observado em calos haplóides e diplóides mantidos na luz, e haplóides no escuro, enquanto os diplóides cultivados no escuro mostraram um aumento constante até o final do cultivo. O aumento no conteúdo de PAs nos calos diplóides no escuro, foi devido ao aumento do conteúdo de Put livre. Foi observado que a ploidia da planta pode expressar diferentes gradientes de PA ao longo do tecido medular e nas culturas de calos in vitro.

  20. Monitoring Dynamic Interactions between Breast Cancer Cells and Human Bone Tissue in a Co-Culture Model (United States)

    Contag, Christopher H.; Lie, Wen-Rong; Bammer, Marie C.; Hardy, Jonathan W.; Schmidt, Tobi L.; Maloney, William J.; King, Bonnie L.


    Purpose Bone is a preferential site of breast cancer metastasis and models are needed to study this process at the level of the microenvironment. We have used bioluminescence imaging (BLI) and multiplex biomarker immunoassays to monitor dynamic breast cancer cell behaviors in co-culture with human bone tissue. Procedures Femur tissue fragments harvested from hip replacement surgeries were co-cultured with luciferase-positive MDA-MB-231-fLuc cells. BLI was performed to quantify breast cell division and track migration relative to bone tissue. Breast cell colonization of bone tissues was assessed with immunohistochemistry. Biomarkers in co-culture supernatants were profiled with MILLIPLEX® immunoassays. Results BLI demonstrated increased MDA-MB-231-fLuc proliferation (pbones, and revealed breast cell migration toward bone. Immunohistochemistry illustrated MDA-MB-231-fLuc colonization of bone, and MILLIPLEX® profiles of culture supernatants suggested breast/bone crosstalk. Conclusions Breast cell behaviors that facilitate metastasis occur reproducibly in human bone tissue co-cultures and can be monitored and quantified using BLI and multiplex immunoassays. PMID:24008275

  1. Rotating three-dimensional dynamic culture of adult human bone marrow-derived cells for tissue engineering of hyaline cartilage. (United States)

    Sakai, Shinsuke; Mishima, Hajime; Ishii, Tomoo; Akaogi, Hiroshi; Yoshioka, Tomokazu; Ohyabu, Yoshimi; Chang, Fei; Ochiai, Naoyuki; Uemura, Toshimasa


    The method of constructing cartilage tissue from bone marrow-derived cells in vitro is considered a valuable technique for hyaline cartilage regenerative medicine. Using a rotating wall vessel (RWV) bioreactor developed in a NASA space experiment, we attempted to efficiently construct hyaline cartilage tissue from human bone marrow-derived cells without using a scaffold. Bone marrow aspirates were obtained from the iliac crest of nine patients during orthopedic operation. After their proliferation in monolayer culture, the adherent cells were cultured in the RWV bioreactor with chondrogenic medium for 2 weeks. Cells from the same source were cultured in pellet culture as controls. Histological and immunohistological evaluations (collagen type I and II) and quantification of glycosaminoglycan were performed on formed tissues and compared. The engineered constructs obtained using the RWV bioreactor showed strong features of hyaline cartilage in terms of their morphology as determined by histological and immunohistological evaluations. The glycosaminoglycan contents per microg DNA of the tissues were 10.01 +/- 3.49 microg/microg DNA in the case of the RWV bioreactor and 6.27 +/- 3.41 microg/microg DNA in the case of the pellet culture, and their difference was significant. The RWV bioreactor could provide an excellent environment for three-dimensional cartilage tissue architecture that can promote the chondrogenic differentiation of adult human bone marrow-derived cells.

  2. Diagnostic utility of melanin production by fungi: Study on tissue sections and culture smears with Masson-Fontana stain

    Directory of Open Access Journals (Sweden)

    Challa Sundaram


    Full Text Available Background: Dematiaceous fungi appear brown in tissue section due to melanin in their cell walls. When the brown color is not seen on routine H and E and culture is not available, differentiation of dematiaceous fungi from other fungi is difficult on morphology alone. Aims and Objective: To study if melanin production by dematiaceous fungi can help differentiate them from other types of fungi. Materials and Methods: Fifty tissue sections of various fungal infections and 13 smears from cultures of different species of fungi were stained with Masson Fontana stain to assess melanin production. The tissue sections included biopsies from 26 culture-proven fungi and 24 biopsies of filamentous fungi diagnosed on morphology alone with no culture confirmation. Results: All culture-proven dematiaceous fungi and Zygomycetes showed strong positivity in sections and culture smears. Aspergillus sp showed variable positivity and intensity. Cryptococcus neoformans showed strong positivity in tissue sections and culture smears. Tissue sections of septate filamentous fungi (9/15, Zygomycetes (4/5, and fungi with both hyphal and yeast morphology (4/4 showed positivity for melanin. The septate filamentous fungi negative for melanin were from biopsy samples of fungal sinusitis including both allergic and invasive fungal sinusitis and colonizing fungal balls. Conclusion: Melanin is produced by both dematiaceous and non-dematiaceous fungi. Masson-Fontana stain cannot reliably differentiate dematiaceous fungi from other filamentous fungi like Aspergillus sp; however, absence of melanin in the hyphae may be used to rule out dematiaceous fungi from other filamentous fungi. In the differential diagnosis of yeast fungi, Cryptococcus sp can be differentiated from Candida sp by Masson-Fontana stain in tissue sections.

  3. Cloning crops in a CELSS via tissue culture: Prospects and problems (United States)

    Carman, John G.; Hess, J. Richard


    Micropropagation is currently used to clone fruits, nuts, and vegetables and involves controlling the outgrowth in vitro of basal, axillary, or adventitious buds. Following clonal multiplication, shoots are divided and rooted. This process has greatly reduced space and energy requirements in greenhouses and field nurseries and has increased multiplication rates by greater than 20 fold for some vegetatively propagated crops and breeding lines. Cereal and legume crops can also be cloned by tissue culture through somatic embryogenesis. Somatic embryos can be used to produce 'synthetic seed', which can tolerate desiccation and germinate upon rehydration. Synthetic seed of hybrid wheat, rice, soybean and other crops could be produced in a controlled ecological life support system. Thus, yield advantages of hybreds over inbreds (10 to 20 percent) could be exploited without having to provide additional facilities and energy for parental-line and hybrid seed nurseries.

  4. Tissue culture of adult larch as a tool for breeding purposes

    Energy Technology Data Exchange (ETDEWEB)

    Ewald, D.; Kretzschmar, U. [Federal Research Centre of Forestry and Forest Products, Waldsieversdorf (Germany). Inst. for Forest Tree Biology


    Aimed at the identical reproduction of genotypes which are considered superior different methods were tested to establish and to propagate tissue cultures from old larch trees (L. decidua, L. kaempferi, L. sukaczewii, L. gmelinii, L. eurolepis). Serial subcultures without phytohormones (shoot tip propagation) led to the establishment of clone lines. After ten subcultures propagation velocity, shoot morphology and rooting behavior were similar to juvenile plant material. Serial subcultures which included a cytokinin induction led to the formation of adventitious shoot clusters (adventitious bud propagation). Adventitious shoots derived from male flowers of one L. kaempferi clone could be propagated via shoot tip propagation. Micrografting of meristems in vitro resulted in a regained rooting capacity of green cuttings from micrografts. Combining these in vitro techniques offers now the possibility to propagate selected mature larch trees for different breeding purposes. 23 refs, 5 figs, 2 tabs

  5. Advanced tissue culture used by Twyfords to build up jojoba clones

    Energy Technology Data Exchange (ETDEWEB)


    Twyford Plant Laboratories Ltd. in the UK, using their own advanced methods of plant tissue culture, have built up a bank of 30 different male and female clones of jojoba, the arid land crop whose seeds produced a liquid wax which - amongst other uses - can be substituted for sperm whale oil. The technique involves growing microscopic parts of a parent plant on a medium containing all the necessary growth hormones, salts, vitamins and other nutrients. Growth takes place under artificial light in an all-electric controlled, air-conditioned environment. No other method is so successful for rapidly multiplying plants, particularly those that do not breed true from seed. These include most fruits and some flowers and vegetables.

  6. A fluid dynamics approach to bioreactor design for cell and tissue culture. (United States)

    Dusting, Jonathan; Sheridan, John; Hourigan, Kerry


    The problem of controlling cylindrical tank bioreactor conditions for cell and tissue culture purposes has been considered from a flow dynamics perspective. Simple laminar flows in the vortex breakdown region are proposed as being a suitable alternative to turbulent spinner flask flows and horizontally oriented rotational flows. Vortex breakdown flows have been measured using three-dimensional Stereoscopic particle image velocimetry, and non-dimensionalized velocity and stress distributions are presented. Regions of locally high principal stress occur in the vicinity of the impeller and the lower sidewall. Topological changes in the vortex breakdown region caused by an increase in Reynolds number are reflected in a redistribution of the peak stress regions. The inclusion of submerged scaffold models adds complexity to the flow, although vortex breakdown may still occur. Relatively large stresses occur along the edge of disks jutting into the boundary of the vortex breakdown region. Copyright 2006 Wiley Periodicals, Inc.

  7. Tissue culture of adult larch as a tool for breeding purposes

    Energy Technology Data Exchange (ETDEWEB)

    Ewald, D; Kretzschmar, U [Federal Research Centre of Forestry and Forest Products, Waldsieversdorf (Germany). Inst. for Forest Tree Biology


    Aimed at the identical reproduction of genotypes which are considered superior different methods were tested to establish and to propagate tissue cultures from old larch trees (L. decidua, L. kaempferi, L. sukaczewii, L. gmelinii, L. eurolepis). Serial subcultures without phytohormones (shoot tip propagation) led to the establishment of clone lines. After ten subcultures propagation velocity, shoot morphology and rooting behavior were similar to juvenile plant material. Serial subcultures which included a cytokinin induction led to the formation of adventitious shoot clusters (adventitious bud propagation). Adventitious shoots derived from male flowers of one L. kaempferi clone could be propagated via shoot tip propagation. Micrografting of meristems in vitro resulted in a regained rooting capacity of green cuttings from micrografts. Combining these in vitro techniques offers now the possibility to propagate selected mature larch trees for different breeding purposes. 23 refs, 5 figs, 2 tabs

  8. Plant regeneration from petiole segments of some species in tissue culture

    Directory of Open Access Journals (Sweden)

    Krystyna Klimaszewska


    Full Text Available The regeneration ability of 21 plant species belonging to 14 families was tested. The method of tissue culture in vitro was applied, on basic MS medium with an addition of growth regulators from the auxin and cytokinin groups. From among the investigated plant groups Peperomia scandens and Caladium × hortulanum were capable of plant regeneration, Passiilora coerulea regenerated shoots, Hedera helix, Begonia glabra, Coleus blumei, Fuchsia hybrida, Passiflora suberosa and Peperomia eburnea formed callus and roots, Kalanchoe blossfeldiana, Pelargonium grandiflorum, P. peltatum, P. radula, Coleus shirensis and Magnolia soulangeana produced callus, Philodendron scandens, Rhododendron smirnovii, Hibiscus rosa-sinensis, Coprosma baueri, Cestrum purpureum and Solanum rantonnetii did not exhibit any regeneration reactions.

  9. Increased adsorption of histidine-tagged proteins onto tissue culture polystyrene

    DEFF Research Database (Denmark)

    Holmberg, Maria; Hansen, Thomas Steen; Lind, Johan Ulrik


    and ethylenediaminetetraacetic acid (EDTA), as well as adsorption performed at different pH and ionic strength indicates that the high adsorption is caused by electrostatic interaction between negatively charged carboxylate groups on the TCPS surface and positively charged histidine residues in the proteins. Pre......In this study we compare histidine-tagged and native proteins with regards to adsorption properties. We observe significantly increased adsorption of proteins with an incorporated polyhistidine amino acid motif (HIS-tag) onto tissue culture polystyrene (TCPS) compared to similar proteins without...... a HIS-tag. The effect is not observed on polystyrene (PS). Adsorption experiments have been performed at physiological pH (7.4) and the effect was only observed for the investigated proteins that have pI values below or around 7.4. Competitive adsorption experiments with imidazole...

  10. Molecular characterization of three anther tissue culture varieties of tobaco (Nicotiana tabacum L. using RAPD analysis

    Directory of Open Access Journals (Sweden)

    Gloria Azucena Fernández B.


    Full Text Available Randomly Amplified Polymorphic DNA (RAPO analysis was used to characterize two new Flue Cured and one black tobacco type varieties derived from in vitro anther tissue culture technique. RAPOs are proposed as an appropriate complement of the morphoagronomic characteristics evaluations to fulfil international seed registration standards established for the identification of tobacco varieties. The identification of three tobacco varieties and their parents was carried out using the RAPO analysis with 64 random primers. Polymorphic products, 214 in number, were amplified only from 14 primers. Statistical analysis realized with the NTSYS program version 1.2 using the Jaccard similarity coefficient. The visual inspection revealed that five primers allowed the separation of the varieties in two groups, according to the type of tobacco: the Flue Cured and Black; while a group of nine primers separates each variety and establish its genetic relationship with their parents. The results obtained show that this technique is appropiated to establish genetic differences between tobacco varieties.

  11. Analytical and diagnostic performance of a qPCR assay for Ichthyophonus spp. compared to the tissue culture 'gold standard'. (United States)

    Lowe, Vanessa C; Hershberger, Paul K; Friedman, Carolyn S


    Parasites of the genus Ichthyophonus infect many fish species and have a non-uniform distribution within host tissues. Due in part to this uneven distribution, the comparative sensitivity and accuracy of using molecular-based detection methods versus culture to estimate parasite prevalence is under debate. We evaluated the analytical and diagnostic performance of an existing qPCR assay in comparison to the 'gold standard' culture method using Pacific herring Clupea pallasii with known exposure history. We determined that the assay is suitable for use in this host, and diagnostic specificity was consistently high (>98%) in both heart and liver tissues. Diagnostic sensitivity could not be fully assessed due to low infection rates, but our results suggest that qPCR is not as sensitive as culture under all circumstances. Diagnostic sensitivity of qPCR relative to culture is likely affected by the amount of sample processed. The prevalence values estimated by the 2 methods were not significantly different when sample amounts were equal (heart tissue), but when the assayed sample amounts were unequal (liver tissue), the culture method detected a significantly higher prevalence of the parasite than qPCR. Further, culture of liver also detected significantly more Ichthyophonus infections than culture of heart, suggesting that the density and distribution of parasites in tissues also plays a role in assay sensitivity. This sensitivity issue would be most problematic for fish with light infections. Although qPCR does not detect the presence of a live organism, DNA-based pathogen detection methods provide the opportunity for alternate testing strategies when culture is not possible.


    Directory of Open Access Journals (Sweden)

    Andrej Trampuž


    Full Text Available Background. Synovial fluid and periprosthetic tissue specimens are the standard specimens cultured for the diagnosis of prosthetic joint infection (PJI. We hypothesize that ultrasonication of the explanted prosthesis may improve diagnosis of PJI by dislodging biofilm bacteria from the prosthesis surface and improve the sensitivity and specificity of diagnosis of PJI.Methods. Included were patients undergoing knee prosthesis exchange for septic or biomechanical failure and have not received antimicrobial therapy in the last 2 weeks prior specimen collection. Cultures of synovial fluid and periprosthetic tissue specimens were performed per the usual clinical practice. Additionally, explanted joint components were sonicated for 5 minutes at frequency 40 kHz in sterile Ringer’s solution; aliquots of 0.5 ml sonicate were plated onto five aerobic and five anaerobic blood agar plates, and incubated at 37 °C and examined for the next seven days. The number and identity of each colony morphology was recorded.Results. 35 patients undergoing knee replacement have been studied (24 for aseptic biomechanical failure and 11 for suspected PJI. In patients with PJI, coagulase-negative staphylococci (7 cases, Corynebacterium spp. (2 cases, Staphylococcus aureus (1 case, and viridans group streptococcus (1 case were recovered. Culture sensitivity and specificity were for synovial fluid 88% and 100%, for periprosthetic tissue 83% and 81%, and for explant sonicate 91% and 100%, respectively. In sonicate cultures higher numbers of microorganisms than in periprosthetic tissue cultures were consistently detected.Conclusions. Using synovial fluid, periprosthetic tissue, and explant sonicate cultures, 12%, 17% and 9% of PJI were missed, respectively. Explant sonicate cultures were the most sensitive with respect to the diagnosis of PJI, indicating that explant ultrasonication may improve bacterial recovery. In sonicate cultures, infecting organisms were detected in

  13. Integrin expression by human osteoblasts cultured on degradable polymeric materials applicable for tissue engineered bone. (United States)

    El-Amin, Saadiq F; Attawia, Mohamed; Lu, Helen H; Shah, Asist K; Chang, Richard; Hickok, Noreen J; Tuan, Rocky S; Laurencin, Cato T


    The use of biodegradable polymers in the field of orthopaedic surgery has gained increased popularity, as surgical pins and screws, and as potential biological scaffolds for repairing cartilage and bone defects. One such group of polymers that has gained considerable attention are the polyesters, poly(lactide-co-glycolide) (PLAGA) and polylactic acid (PLA), because of their minimal tissue inflammatory response, favorable biocompatibility and degradation characteristics. The objective of this study was to evaluate human osteoblastic cell adherence and growth on PLAGA and PLA scaffolds by examining integrin receptor (alpha2, alpha3, alpha4, alpha5, alpha6 and beta1) expression. Primary human osteoblastic cells isolated from trabecular bone adhered efficiently to both PLAGA and PLA, with the rate of adherence on PLAGA comparable to that of control tissue culture polystyrene (TCPS), and significantly higher than on PLA polymers at 3, 6 and 12 h. Human osteoblastic phenotypic expression, alkaline phosphatase (ALP) activity was positive on both degradable matrices, whereas osteocalcin levels were significantly higher on cells grown on PLAGA than on PLA composites. Interestingly, the integrin subunits, alpha2, alpha3, alpha4, alpha5, alpha6 and beta1 were all expressed at higher levels by osteoblasts cultured on PLAGA than those on PLA as analyzed by westerns blots and by flow cytometry. Among the integrins, alpha2, beta5 and beta1 showed the greatest difference in levels between the two surfaces. Thus, both PLA and PLAGA support osteoblastic adhesion and its accompanying engagement of integrin receptor and expression of osteocalcin and ALP. However PLAGA consistently appeared to be a better substrate for osteoblastic cells based on these parameters. This study is one of the first to investigate the ability of primary human osteoblastic cells isolated from trabecular bone to adhere to the biodegradable polymers PLAGA and PLA, and to examine the expression of their key

  14. Seismomorphogenesis: a novel approach to acclimatization of tissue culture regenerated plants. (United States)

    Sarmast, Mostafa Khoshhal; Salehi, Hassan; Khosh-Khui, Morteza


    Plantlets under in vitro conditions transferred to ex vivo conditions are exposed to biotic and abiotic stresses. Furthermore, in vitro regenerated plants are typically frail and sometimes difficult to handle subsequently increasing their risk to damage and disease; hence acclimatization of these plantlets is the most important step in tissue culture techniques. An experiment was conducted under in vitro conditions to study the effects of shaking duration (twice daily at 6:00 a.m. and 9:00 p.m. for 2, 4, 8, and 16 min at 250 rpm for 14 days) on Sansevieria trifasciata L. as a model plant. Results showed that shaking improved handling, total plant height, and leaf characteristics of the model plant. Forty-eight hours after 14 days of shaking treatments with increasing shaking time, leaf length decreased but proline content of leaf increased. However, 6 months after starting the experiment different results were observed. In explants that received 16 min of shaking treatment, leaf length and area and photosynthesis rate were increased compared with control plantlets. Six months after starting the experiment, control plantlets had 12.5 % mortality; however, no mortality was observed in other treated explants. The results demonstrated that shaking improved the explants' root length and number and as a simple, cost-effective, and non-chemical novel approach may be substituted for other prevalent acclimatization techniques used for tissue culture regenerated plantlets. Further studies with sensitive plants are needed to establish this hypothesis.

  15. Studies on the use of gamma irradiation and tissue culture in improving brassica napus

    International Nuclear Information System (INIS)

    Khedr, E.K.A.


    The objectives of this study were to:1- Studying the effect of different doses of gamma rays on some growth and yield component traits of three Brassica napus cultivars (Serow6, Serow4 and Pactol) during four consecutive generations aiming to create new genotypes characterized with high yielding traits. 2- Studying the effect of different doses of gamma rays on in vitro biotechnology technique (tissue culture) used in improving Brassica napus. Seeds of three Brassica napus cultivars were irradiated with different gamma ray doses then sown for four consecutive seasons. Data were collected and recorded to clarify the effect gamma irradiation on some yield component traits which were days to flowering , plant height, number of main branches per plant, number of secondary branches per plant, number of pods per plant, number of seeds per pod, weight of 1000-seed, weight of grain yield/plant and oil content of seeds). Results showed that high doses of gamma radiation had enhanced all of the studied traits for each of the three tested cultivars (except the plant height trait for Serow6 and Pactol cultivars). Seven new mutant lines were selected for their superiority in one or more of the studied yield component traits. Regarding the effect of gamma rays on tissue culture techniques, the applied gamma radiation doses did not affect the percentage of seed germination of the three studied cultivars, whereas the percentage of callus induction decreased by increasing the dose of gamma rays for each of the three cultivars and in both types of explants (hypocotyl and cotyledons) used in this experiment.

  16. Standard Operating Procedure (SOP) for Rapid and Efficient Production of Stevia Tissue Culture Seedlings

    International Nuclear Information System (INIS)

    Norazlina Noordin; Peng, C.S.; Rusli Ibrahim


    Stevia rebaudiana Bertoni is a non-caloric natural sweetener which is 300 times sweeter than cane sugar. Extracts from stevia leaves has vast application in food and beverages based industries, can be added to tea and coffee, cooked or baked goods, processed foods and confectionary goods. Recently, stevia attained awareness owing to its natural, non-caloric sweetness by diet/ health conscious and diabetic persons (Arpita et al., 2011). This natural sweetener has high commercial value in global market, it was estimated that global market value for stevia is be around USD11 billion by year 2015. Although stevia is being largely popularized in Malaysia and other countries but large-scale propagation procedures for the continuous supply of planting materials in commercial plantation has yet to be established, optimized and standardized. Furthermore, propagation through stevia seeds is often very difficult due to self-incompatibility which results in sterile seeds (Sakaguchi et al., 1982). Tissue culture is the only rapid process for the mass propagation of stevia and there have been few reports of in vitro growth of stevia (Miyagaya et al., 1986) and in vitro micropropagation from shoot tip and leaf (Uddin et al., 2006). Hence, study was carried out to establish a suitable protocol for in vitro propagation of S. rebaudiana Bertoni that can be further up-scaled for mass propagation of stevia seedlings. The established Standard Operating Procedure (SOP) will ensure rapid and efficient production of stevia tissue culture seedlings for continuous supply of planting materials for commercial stevia plantations in Malaysia. Preparation of growth medium, multiplication of shoots, rooting of plant lets and hardening of ex-vitro rooted plant lets is discussed in this paper. (author)

  17. Strategies on process engineering of chondrocyte culture for cartilage tissue regeneration. (United States)

    Mallick, Sarada Prasanna; Rastogi, Amit; Tripathi, Satyavrat; Srivastava, Pradeep


    The current work is an attempt to study the strategies for cartilage tissue regeneration using porous scaffold in wavy walled airlift bioreactor (ALBR). Novel chitosan, poly (L-lactide) and hyaluronic acid based composite scaffold were prepared. The scaffolds were cross-linked with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, N-hydroxysuccinimide and chondroitin sulfate to obtain interconnected 3D microstructure showing excellent biocompatibility, higher cellular differentiation and increased stability. The surface morphology and porosity of the scaffolds were analyzed using scanning electron microscopy (SEM) and mercury intrusion porosimeter and optimized for chondrocyte regeneration. The study shows that the scaffolds were highly porous with pore size ranging from 48 to 180 µm and the porosities in the range 80-92%. Swelling and in vitro degradation studies were performed for the composite scaffolds; by increasing the chitosan: HA ratio in the composite scaffolds, the swelling property increases and stabilizes after 24 h. There was controlled degradation of composite scaffolds for 4 weeks. The uniform chondrocyte distribution in the scaffold using various growth modes in the shake flask and ALBR was studied by glycosaminoglycans (GAG) quantification, MTT assay and mixing time evaluation. The cell culture studies demonstrated that efficient designing of ALBR increases the cartilage regeneration as compared to using a shake flask. The free chondrocyte microscopy and cell attachment were performed by inverted microscope and SEM, and from the study it was confirmed that the cells uniformly attached to the scaffold. This study focuses on optimizing strategies for the culture of chondrocyte using suitable scaffold for improved cartilage tissue regeneration.

  18. Culture of equine bone marrow mononuclear fraction and adipose tissue-derived stromal vascular fraction cells in different media

    Directory of Open Access Journals (Sweden)

    Gesiane Ribeiro


    Full Text Available The objective of this study was to evaluate the culture of equine bone marrow mononuclear fraction and adipose tissue - derived stromal vascular fraction cells in two different cell culture media. Five adult horses were submitted to bone marrow aspiration from the sternum, and then from the adipose tissue of the gluteal region near the base of the tail. Mononuclear fraction and stromal vascular fraction were isolated from the samples and cultivated in DMEM medium supplemented with 10% fetal bovine serum or in AIM-V medium. The cultures were observed once a week with an inverted microscope, to perform a qualitative analysis of the morphology of the cells as well as the general appearance of the cell culture. Colony-forming units (CFU were counted on days 5, 15 and 25 of cell culture. During the first week of culture, differences were observed between the samples from the same source maintained in different culture media. The number of colonies was significantly higher in samples of bone marrow in relation to samples of adipose tissue.

  19. Factors affecting callus and protoplast production and regeneration of plants from garlic tissue cultures

    International Nuclear Information System (INIS)

    Al-Safadi, B.; Nabulsi, I.


    Five cultivars of garlic, two explants, six callusing media, six regeneration media, two kinds of light and several doses of gamma irradiation were used to determine the best conditions for callus induction and plant regeneration from garlic tissue cultures. Also, some experiments were conducted to study the possibility to isolate protoplast and regenerate plants. The experiment showed that medium MS9 was good for regenerating plant directly from basal plate without going through callus phase. ANOVA exhibited significant differences among used cultivars in their ability to form callus. No significant difference was observed between 16 hr light and complete darkness in callus growth. However, appearance of callus was generally better on darkness. Cultivar varied in their ability to regenerate and interaction between cultivars and media was observed. Cultivar kisswany was the best in regeneration (38%) and medium MS47 was the best among used media (35%). Light type played a significant role in regeneration of plants where red light was much better than white light in inducing regeneration (68% vs 36%). ANOVA revealed significant effect of low doses of gamma irradiation on stimulation regeneration of plant whereas high doses prevented regeneration. Many experiments were conducted to isolate protoplast and regenerate plants. The best method for culturing was the droplet and the best conditions for incubation were complete darkness at 25 Degreed centigrade. This lead to formation of cell wall but no cell division was observed (author)

  20. Hormonal regulation of epithelial organization in a three-dimensional breast tissue culture model. (United States)

    Speroni, Lucia; Whitt, Gregory S; Xylas, Joanna; Quinn, Kyle P; Jondeau-Cabaton, Adeline; Barnes, Clifford; Georgakoudi, Irene; Sonnenschein, Carlos; Soto, Ana M


    The establishment of hormone target breast cells in the 1970's resulted in suitable models for the study of hormone control of cell proliferation and gene expression using two-dimensional (2D) cultures. However, to study mammogenesis and breast tumor development in vitro, cells must be able to organize in three-dimensional (3D) structures like in the tissue. We now report the development of a hormone-sensitive 3D culture model for the study of mammogenesis and neoplastic development. Hormone-sensitive T47D breast cancer cells respond to estradiol in a dose-dependent manner by forming complex epithelial structures. Treatment with the synthetic progestagen promegestone, in the presence of estradiol, results in flat epithelial structures that display cytoplasmic projections, a phenomenon reported to precede side-branching. Additionally, as in the mammary gland, treatment with prolactin in the presence of estradiol induces budding structures. These changes in epithelial organization are accompanied by collagen remodeling. Collagen is the major acellular component of the breast stroma and an important player in tumor development and progression. Quantitative analysis of second harmonic generation of collagen fibers revealed that collagen density was more variable surrounding budding and irregularly shaped structures when compared to more regular structures; suggesting that fiber organization in the former is more anisotropic than in the latter. In sum, this new 3D model recapitulates morphogenetic events modulated by mammogenic hormones in the breast, and is suitable for the evaluation of therapeutic agents.

  1. Increased adsorption of histidine-tagged proteins onto tissue culture polystyrene. (United States)

    Holmberg, Maria; Hansen, Thomas Steen; Lind, Johan Ulrik; Hjortø, Gertrud Malene


    In this study we compare histidine-tagged and native proteins with regards to adsorption properties. We observe significantly increased adsorption of proteins with an incorporated polyhistidine amino acid motif (HIS-tag) onto tissue culture polystyrene (TCPS) compared to similar proteins without a HIS-tag. The effect is not observed on polystyrene (PS). Adsorption experiments have been performed at physiological pH (7.4) and the effect was only observed for the investigated proteins that have pI values below or around 7.4. Competitive adsorption experiments with imidazole and ethylenediaminetetraacetic acid (EDTA), as well as adsorption performed at different pH and ionic strength indicates that the high adsorption is caused by electrostatic interaction between negatively charged carboxylate groups on the TCPS surface and positively charged histidine residues in the proteins. Pre-adsorption of bovine serum albumin (BSA) does not decrease the adsorption of HIS-tagged proteins onto TCPS. Our findings identify a potential problem in using HIS-tagged signalling molecule in assays with cells cultured on TCPS, since the concentration of the molecule in solution might be affected and this could critically influence the assay outcome. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Clonal multiplication of Cymbidiums through tissue culture of the shoot meristem

    Energy Technology Data Exchange (ETDEWEB)

    Wimber, Donald E.


    The propagation of clonal varieties of some orchids is at times exasperatingly slow and occasionally an almost futile effort. Clonal multiplication is generally confined to dlvidlng mature plants and to starting plants from pseudobulbs. There is, of course, the specialized technique for obtaining Phalaenopsis plantlets from the aseptic culture of inflorescence nodes, but this is basically the same thing as propagating plants from pseudobulbs. In certain cases it is highly desirable to rapidly multiply certain clones of orchids. Awarded varieties could thereby be dispersed with great rapidity where now it may take decades for some clones to became fairly common. Commercial flower production would be very much enhanced if certain desirable clones could be multiplied ad infinitum within a short time. Orchid flower production could then be placed more on a par with many of the other cut flowers and the clonal peculiarities of some fo the current hybrids could be pampered instead of ignored. This paper describes a tissue culture method for the rapid propagation of Cymbidium clones.

  3. Effect of flow on vascular endothelial cells grown in tissue culture on polytetrafluoroethylene grafts

    International Nuclear Information System (INIS)

    Sentissi, J.M.; Ramberg, K.; O'Donnell, T.F. Jr.; Connolly, R.J.; Callow, A.D.


    Vascular grafts lined with endothelial cells (EC) grown to confluence in culture before implantation may provide a thromboresistant flow surface. Growth of EC on and their adherence to currently available prosthetic materials under conditions of flow are two impediments remaining in the development of such a graft. To address these problems, 22 polytetrafluoroethylene grafts (PTFE) (5 cm by 4 mm inside diameter) were pretreated with collagen and fibronectin, seeded with 2 to 3 X 10(6) bovine aortic EC per graft, and placed in tissue culture (seeded grafts). Twenty-two grafts pretreated with collagen and fibronectin alone served as controls. After 2 weeks morphologic studies revealed that 20/22 seeded grafts were lined with a confluent endothelial layer. Indium 111-oxine was then used to label the EC-seeded grafts. After exposure to either low (25 ml/min) or high (200 ml/min) flow rates for 60 minutes in an in vitro circuit, examination of the luminal surface of the graft by light microscopy and scanning electron microscopy revealed minimal loss of EC. These findings were corroborated by radionuclide scans that showed an insignificant loss of the EC-associated indium label during exposure to flow (7% low flow, 11% high flow). Pretreatment of PTFE grafts with collagen and fibronectin thus promotes both attachment and adherence of EC even under flow conditions

  4. Constructing Failure: Leonard Hayflick, Biomedicine, and the Problems with Tissue Culture. (United States)

    Park, Hyung Wook


    By examining the use of tissue culture in post-war American biomedicine, this paper investigates how scientists experience and manage failure. I study how Leonard Hayflick forged his new definition of failure and ways of managing it by refuting Alexis Carrel's definition of failure alongside his theory of the immortality of cultured cells. Unlike Carrel, Hayflick claimed that every vertebrate somatic cell should eventually die, unless it transformed into a tumour cell. This claim defined cell death, which had been a problem leading to a laboratory failure, as a normal phenomenon. On the other hand, permanent life, which had been considered a normal cellular characteristic, became a major factor causing scientific failure, since it implied malignant transformation that scientists hoped to control. Hayflick then asserted that his cell strains and method would partly enable scientists to manage this factor-especially that occurred through viral infection-alongside other causes of failure in routine tasks, including bacterial contamination. I argue that the growing biomedical enterprise fostered this work of Hayflick's, which had repercussions in both his career and the uses of cells in diverse investigations. His redefinition of failure in the age of biomedicine resulted in the broad dissemination of his cells, medium, and method as well as his long struggle with the National Institutes of Health (NIH), which caused his temporarily failed career.

  5. Increased Pathogen Identification in Vascular Graft Infections by the Combined Use of Tissue Cultures and 16S rRNA Gene Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Evelyne Ajdler-Schaeffler


    Full Text Available Background: Vascular graft infections (VGI are difficult to diagnose and treat, and despite redo surgery combined with antimicrobial treatment, outcomes are often poor. VGI diagnosis is based on a combination of clinical, radiological, laboratory and microbiological criteria. However, as many of the VGI patients are already under antimicrobial treatment at the time of redo surgery, microbiological identification is often difficult and bacterial cultures often remain negative rendering targeted treatment impossible. We aimed to assess the benefit of 16S rRNA gene polymerase chain reaction (broad-range PCR for better microbiological identification in patients with VGI.Methods: We prospectively analyzed the clinical, microbiological, and treatment data of patients enrolled in the observational Vascular Graft Cohort Study (VASGRA, University Hospital Zurich, Switzerland. The routine diagnostic work-up involved microbiological cultures of minced tissue samples, and the use of molecular techniques in parallel. Patient-related and microbiological data were assessed in descriptive analyses, and we calculated sensitivity, specificity, negative and positive predictive value for broad-range 16S rRNA gene PCR versus culture (considered as gold standard.Results: We investigated 60 patients (median age 66 years (Interquartile range [IQR] 59–75 with confirmed VGI between May 2013 and July 2017. The prevalence of antimicrobial pretreatment at the time of sampling was high [91%; median days of antibiotics 7 days (IQR 1–18]. We investigated 226 microbiological specimens. Thereof, 176 (78% were culture-negative and 50 (22% were culture-positive. There was a concordance of 70% (158/226 between conventional culture and broad-range PCR (sensitivity 58% (95% CI 43–72; specificity 74% (67–80%. Among the group of 176 culture-negative specimens, 46 specimens were broad-range PCR-positive resulting in identification of overall 69 species. Among the culture and

  6. Dynamic culture induces a cell type-dependent response impacting on the thickness of engineered connective tissues. (United States)

    Fortier, Guillaume Marceau; Gauvin, Robert; Proulx, Maryse; Vallée, Maud; Fradette, Julie


    Mesenchymal cells are central to connective tissue homeostasis and are widely used for tissue-engineering applications. Dermal fibroblasts and adipose-derived stromal cells (ASCs) allow successful tissue reconstruction by the self-assembly approach of tissue engineering. This method leads to the production of multilayered tissues, devoid of exogenous biomaterials, that can be used as stromal compartments for skin or vesical reconstruction. These tissues are formed by combining cell sheets, generated through cell stimulation with ascorbic acid, which favours the cell-derived production/organization of matrix components. Since media motion can impact on cell behaviour, we investigated the effect of dynamic culture on mesenchymal cells during tissue reconstruction, using the self-assembly method. Tissues produced using ASCs in the presence of a wave-like movement were nearly twice thicker than under standard conditions, while no difference was observed for tissues produced from dermal fibroblasts. The increased matrix deposition was not correlated with an increased proliferation of ASCs, or by higher transcript levels of fibronectin or collagens I and III. A 30% increase of type V collagen mRNA was observed. Interestingly, tissues engineered from dermal fibroblasts featured a four-fold higher level of MMP-1 transcripts under dynamic conditions. Mechanical properties were similar for tissues reconstructed using dynamic or static conditions. Finally, cell sheets produced using ASCs under dynamic conditions could readily be manipulated, resulting in a 2 week reduction of the production time (from 5 to 3 weeks). Our results describe a distinctive property of ASCs' response to media motion, indicating that their culture under dynamic conditions leads to optimized tissue engineering. Copyright © 2011 John Wiley & Sons, Ltd.

  7. Treatment of chronic desquamative gingivitis using tissue-engineered human cultured gingival epithelial sheets: a case report. (United States)

    Okuda, Kazuhiro; Momose, Manabu; Murata, Masashi; Saito, Yoshinori; lnoie, Masukazu; Shinohara, Chikara; Wolff, Larry F; Yoshie, Hiromasa


    Human cultured gingival epithelial sheets were used as an autologous grafting material for regenerating gingival tissue in the maxillary left and mandibular right quadrants of a patient with chronic desquamative gingivitis. Six months post-surgery in both treated areas, there were gains in keratinized gingiva and no signs of gingival inflammation compared to presurgery. In the maxillary left quadrant, preoperative histopathologic findings revealed the epithelium was separated from the connective tissue and inflammatory cells were extensive. After grafting with the gingival epithelial sheets, inflammatory cells were decreased and separation between epithelium and connective tissue was not observed. The human cultured gingival epithelial sheets fabricated using tissue engineering technology showed significant promise for gingival augmentation in periodontal therapy.

  8. Tissue

    Directory of Open Access Journals (Sweden)

    David Morrissey


    Full Text Available Purpose. In vivo gene therapy directed at tissues of mesenchymal origin could potentially augment healing. We aimed to assess the duration and magnitude of transene expression in vivo in mice and ex vivo in human tissues. Methods. Using bioluminescence imaging, plasmid and adenoviral vector-based transgene expression in murine quadriceps in vivo was examined. Temporal control was assessed using a doxycycline-inducible system. An ex vivo model was developed and optimised using murine tissue, and applied in ex vivo human tissue. Results. In vivo plasmid-based transgene expression did not silence in murine muscle, unlike in liver. Although maximum luciferase expression was higher in muscle with adenoviral delivery compared with plasmid, expression reduced over time. The inducible promoter cassette successfully regulated gene expression with maximum levels a factor of 11 greater than baseline. Expression was re-induced to a similar level on a temporal basis. Luciferase expression was readily detected ex vivo in human muscle and tendon. Conclusions. Plasmid constructs resulted in long-term in vivo gene expression in skeletal muscle, in a controllable fashion utilising an inducible promoter in combination with oral agents. Successful plasmid gene transfection in human ex vivo mesenchymal tissue was demonstrated for the first time.

  9. Mouse Pancreas Tissue Slice Culture Facilitates Long-Term Studies of Exocrine and Endocrine Cell Physiology in situ


    Marciniak, Anja; Selck, Claudia; Friedrich, Betty; Speier, Stephan


    Studies on pancreatic cell physiology rely on the investigation of exocrine and endocrine cells in vitro. Particularly, in the case of the exocrine tissue these studies have suffered from a reduced functional viability of acinar cells in culture. As a result not only investigations on dispersed acinar cells and isolated acini were limited in their potential, but also prolonged studies on pancreatic exocrine and endocrine cells in an intact pancreatic tissue environment were unfeasible. To ove...

  10. Selective enhancement of scopadulcic acid B production in the cultured tissues of Scoparia dulcis by methyl jasmonate. (United States)

    Nkembo, Kasidimoko Marguerite; Lee, Jung-Bum; Hayashi, Toshimitsu


    The effects of methyl jasmonate (MeJA) on isoprenoid production were evaluated in cultured tissues of Scoparia dulcis. It was found that MeJA suppressed the accumulation of chlorophylls, carotenoids, phytol and beta-sitosterol in the tissues. MeJA, however, remarkably enhanced the production of scopadulcic acid B (SDB), with 10 microM being optimal observed concentration for stimulation of SDB production. The maximum concentration of SDB was observed 6 d after MeJA treatment.

  11. Variation in primary and culture-expanded cells derived from connective tissue progenitors in human bone marrow space, bone trabecular surface and adipose tissue. (United States)

    Qadan, Maha A; Piuzzi, Nicolas S; Boehm, Cynthia; Bova, Wesley; Moos, Malcolm; Midura, Ronald J; Hascall, Vincent C; Malcuit, Christopher; Muschler, George F


    Connective tissue progenitors (CTPs) embody the heterogeneous stem and progenitor cell populations present in native tissue. CTPs are essential to the formation and remodeling of connective tissue and represent key targets for tissue-engineering and cell-based therapies. To better understand and characterize CTPs, we aimed to compare the (i) concentration and prevalence, (ii) early in vitro biological behavior and (iii) expression of surface-markers and transcription factors among cells derived from marrow space (MS), trabecular surface (TS), and adipose tissues (AT). Cancellous-bone and subcutaneous-adipose tissues were collected from 8 patients. Cells were isolated and cultured. Colony formation was assayed using Colonyze software based on ASTM standards. Cell concentration ([Cell]), CTP concentration ([CTP]) and CTP prevalence (P CTP ) were determined. Attributes of culture-expanded cells were compared based on (i) effective proliferation rate and (ii) expression of surface-markers CD73, CD90, CD105, SSEA-4, SSEA-3, SSEA-1/CD15, Cripto-1, E-Cadherin/CD324, Ep-CAM/CD326, CD146, hyaluronan and transcription factors Oct3/4, Sox-2 and Nanog using flow cytometry. Mean [Cell], [CTP] and P CTP were significantly different between MS and TS samples (P = 0.03, P = 0.008 and P= 0.0003), respectively. AT-derived cells generated the highest mean total cell yield at day 6 of culture-4-fold greater than TS and more than 40-fold greater than MS per million cells plated. TS colonies grew with higher mean density than MS colonies (290 ± 11 versus 150 ± 11 cell per mm 2 ; P = 0.0002). Expression of classical-mesenchymal stromal cell (MSC) markers was consistently recorded (>95%) from all tissue sources, whereas all the other markers were highly variable. The prevalence and biological potential of CTPs are different between patients and tissue sources and lack variation in classical MSC markers. Other markers are more likely to discriminate differences

  12. Prolonged hypoxic culture and trypsinization increase the pro-angiogenic potential of human adipose tissue-derived stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Jeppe Grøndahl; Frøbert, Ole; Pilgaard, Linda


    Transplantation of mesenchymal stromal cells (MSC), including adipose tissue-derived stem cells (ASC), is a promising option in the treatment of vascular disease. Short-term hypoxic culture of MSC augments secretion of anti-apoptotic and angiogenic cytokines. We hypothesized that prolonged hypoxic...... (1% and 5% oxygen) culture and trypsinization would augment ASC expression of anti-apoptotic and angiogenic cytokines and increase the angiogenic potential of ASC-conditioned media....

  13. Studies in tissue culture of some indigenous rice (Oryza glaberrima Steud.) accessions in Ghana

    International Nuclear Information System (INIS)

    Diawuoh, R.G.


    accessions evaluated, N/4 was the most promising accession in terms of callus induction frequency and regeneration ability. The three accessions of O. glaberrima were again studied for their response to anther culture in terms of callus induction and frequency of plant regeneration using N, Garfish and D oy, MS and Nis tch tissue culture media, and supplemented with 2,4-D (1:(0-5) mg/l) were used for callus induction. No response to callus formation was obtained after 16 weeks of culture and a conclusion was drawn that all three accessions were recalcitrant to anther culture. (au)

  14. Characterization of the Embryogenic Tissue of the Norway Spruce Including a Transition Layer between the Tissue and the Culture Medium by Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    Kořínek R.


    Full Text Available The paper describes the visualization of the cells (ESEs and mucilage (ECMSN in an embryogenic tissue via magnetic resonance imaging (MRI relaxometry measurement combined with the subsequent multi-parametric segmentation. The computed relaxometry maps T1 and T2 show a thin layer (transition layer between the culture medium and the embryogenic tissue. The ESEs, mucilage, and transition layer differ in their relaxation times T1 and T2; thus, these times can be used to characterize the individual parts within the embryogenic tissue. The observed mean values of the relaxation times T1 and T2 of the ESEs, mucilage, and transition layer are as follows: 1469 ± 324 and 53 ± 10 ms, 1784 ± 124 and 74 ± 8 ms, 929 ± 164 and 32 ± 4.7 ms, respectively. The multi-parametric segmentation exploiting the T1 and T2 relaxation times as a classifier shows the distribution of the ESEs and mucilage within the embryogenic tissue. The discussed T1 and T2 indicators can be utilized to characterize both the growth-related changes in an embryogenic tissue and the effect of biotic/abiotic stresses, thus potentially becoming a distinctive indicator of the state of any examined embryogenic tissue.

  15. Comparison of the conventional diagnostic modalities, bactec culture and polymerase chain reaction test for diagnosis of tuberculosis

    Directory of Open Access Journals (Sweden)

    Negi S


    Full Text Available PURPOSE: To evaluate the performance of 65 kDa antigen based PCR assay in clinical samples obtained from pulmonary and extrapulmonary cases of tuberculosis. METHODS: One hundred and fifty six samples were processed for detection of Mycobacterium tuberculosis by ZN smear examination, LJ medium culture, BACTEC radiometric culture and PCR tests. RESULTS: A significant difference was seen in the sensitivities of different tests, the figures being 74.4% for PCR test, 33.79% for ZN smear examination, 48.9% for LJ culture and 55.8% for BACTEC culture (P0.05 as far as specificity of different tests was concerned. PCR test sensitivity in pulmonary and extrapulmonary clinical samples were 72.7% and 75.9% respectively and found to be significantly higher (PM.tuberculosis was 24.03 days by LJ medium culture, 12.89 days by BACTEC culture and less than one day by PCR test. CONCLUSIONS: PCR is a rapid and sensitive method for the early diagnosis of pulmonary and extrapulmonary tuberculosis.

  16. Mohs micrographic surgery in dermatofibrosarcoma protuberans allows tumour clearance with smaller margins and greater preservation of healthy tissue compared with conventional surgery: a study of 74 primary cases. (United States)

    Serra-Guillén, C; Llombart, B; Nagore, E; Guillén, C; Requena, C; Traves, V; Kindem, S; Alcalá, R; Rivas, N; Sanmartín, O


    Dermatofibrosarcoma protuberans (DFSP) is an uncommon skin tumour with aggressive local growth. Whether DFSP should be treated with conventional surgery (CS) or Mohs micrographic surgery (MMS) has long been a topic of debate. To calculate, in a large series of DFSP treated by MMS, the minimum margin that would have been needed to achieve complete clearance by CS. Secondly, to calculate the percentage of healthy tissue that was preserved by MMS rather than CS with 2- and 3-cm margins. The minimum margin was calculated by measuring the largest distance from the visible edge of the tumour to the edge of the definitive surgical defect. Tumour and surgical defect areas for hypothetical CS with 2- and 3-cm margins were calculated using AutoCAD for Windows. A mean minimum margin of 1·34 cm was required to achieve complete clearance for the 74 tumours analysed. The mean percentages of skin spared using MMS rather than CS with 2- and 3-cm margins were 49·4% and 67·9%, respectively. MMS can achieve tumour clearance with smaller margins and greater preservation of healthy tissue than CS. © 2014 British Association of Dermatologists.

  17. Glucocorticoids affect 24 h clock genes expression in human adipose tissue explant cultures.

    Directory of Open Access Journals (Sweden)

    Purificación Gómez-Abellán

    Full Text Available to examine firstly whether CLOCK exhibits a circadian expression in human visceral (V and subcutaneous (S adipose tissue (AT in vitro as compared with BMAL1 and PER2, and secondly to investigate the possible effect of the glucocorticoid analogue dexamethasone (DEX on positive and negative clock genes expression.VAT and SAT biopsies were obtained from morbid obese women (body mass index ≥ 40 kg/m(2 (n = 6. In order to investigate rhythmic expression pattern of clock genes and the effect of DEX on CLOCK, PER2 and BMAL1 expression, control AT (without DEX and AT explants treated with DEX (2 hours were cultured during 24 h and gene expression was analyzed at the following times: 10:00 h, 14:00 h, 18:00 h, 22:00 h, 02:00 h and 06:00 h, using qRT-PCR.CLOCK, BMAL1 and PER2 expression exhibited circadian patterns in both VAT and SAT explants that were adjusted to a typical 24 h sinusoidal curve. PER2 expression (negative element was in antiphase with respect to CLOCK and in phase with BMAL1 expression (both positive elements in the SAT (situation not present in VAT. A marked effect of DEX exposure on both positive and negative clock genes expression patterns was observed. Indeed, DEX treatment modified the rhythmicity pattern towards altered patterns with a period lower than 24 hours in all genes and in both tissues.24 h patterns in CLOCK and BMAL1 (positive clock elements and PER2 (negative element mRNA levels were observed in human adipose explants. These patterns were altered by dexamethasone exposure.

  18. Effect of microcavitary alginate hydrogel with different pore sizes on chondrocyte culture for cartilage tissue engineering

    International Nuclear Information System (INIS)

    Zeng, Lei; Yao, Yongchang; Wang, Dong-an; Chen, Xiaofeng


    In our previous work, a novel microcavitary hydrogel was proven to be effective for proliferation of chondrocytes and maintenance of chondrocytic phenotype. In present work, we further investigated whether the size of microcavity would affect the growth and the function of chondrocytes. By changing the stirring rate, gelatin microspheres in different sizes including small size (80–120 μm), middle size (150–200 μm) and large size (250–300 μm) were prepared. And then porcine chondrocytes were encapsulated into alginate hydrogel with various sizes of gelatin microspheres. Cell Counting Kit-8 (CCK-8), Live/dead staining and real-time PCR were used to analyze the effect of the pore size on cell proliferation and expression of specific chondrocytic genes. According to all the data, cells cultivated in microcavitary hydrogel, especially in small size, had preferable abilities of proliferation and higher expression of cartilaginous markers including type II collagen, aggrecan and cartilage oligomeric matrix protein (COMP). Furthermore, it was shown by western blot assay that the culture of chondrocytes in microcavitary hydrogel could improve the proliferation of cells potentially by inducing the Erk1/2-MAPK pathway. Taken together, this study demonstrated that chondrocytes favored microcavitary alginate hydrogel with pore size within the range of 80–120 μm for better growth and ECM synthesis, in which Erk1/2 pathway was involved. This culture system would be promising for cartilage tissue engineering. - Highlights: • A novel model with microcavitary structure was set up to study the interaction between cells and materials. • Microcavitary alginate hydrogel could enhance the proliferation of chondrocytes and promote the expression of cartilaginous genes as compared with plain alginate hydrogel. • Cells in microcavitary alginate hydrogel with pore size within the range of 80–120 μm were capable of better growth and ECM synthesis

  19. Effect of microcavitary alginate hydrogel with different pore sizes on chondrocyte culture for cartilage tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Lei; Yao, Yongchang [School of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou 510006 (China); Wang, Dong-an, E-mail: [National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou 510006 (China); Division of Bioengineering, School of Chemical and Biomedical Engineering, Nanyang Technological University, Singapore 637457 (Singapore); Chen, Xiaofeng, E-mail: [School of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou 510006 (China)


    In our previous work, a novel microcavitary hydrogel was proven to be effective for proliferation of chondrocytes and maintenance of chondrocytic phenotype. In present work, we further investigated whether the size of microcavity would affect the growth and the function of chondrocytes. By changing the stirring rate, gelatin microspheres in different sizes including small size (80–120 μm), middle size (150–200 μm) and large size (250–300 μm) were prepared. And then porcine chondrocytes were encapsulated into alginate hydrogel with various sizes of gelatin microspheres. Cell Counting Kit-8 (CCK-8), Live/dead staining and real-time PCR were used to analyze the effect of the pore size on cell proliferation and expression of specific chondrocytic genes. According to all the data, cells cultivated in microcavitary hydrogel, especially in small size, had preferable abilities of proliferation and higher expression of cartilaginous markers including type II collagen, aggrecan and cartilage oligomeric matrix protein (COMP). Furthermore, it was shown by western blot assay that the culture of chondrocytes in microcavitary hydrogel could improve the proliferation of cells potentially by inducing the Erk1/2-MAPK pathway. Taken together, this study demonstrated that chondrocytes favored microcavitary alginate hydrogel with pore size within the range of 80–120 μm for better growth and ECM synthesis, in which Erk1/2 pathway was involved. This culture system would be promising for cartilage tissue engineering. - Highlights: • A novel model with microcavitary structure was set up to study the interaction between cells and materials. • Microcavitary alginate hydrogel could enhance the proliferation of chondrocytes and promote the expression of cartilaginous genes as compared with plain alginate hydrogel. • Cells in microcavitary alginate hydrogel with pore size within the range of 80–120 μm were capable of better growth and ECM synthesis.

  20. Prolonged hypoxic culture and trypsinization increase the pro-angiogenic potential of human adipose tissue-derived stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Jeppe Grøndahl; Frøbert, Ole; Pilgaard, Linda


    Transplantation of mesenchymal stromal cells (MSC), including adipose tissue-derived stem cells (ASC), is a promising option in the treatment of vascular disease. Short-term hypoxic culture of MSC augments secretion of anti-apoptotic and angiogenic cytokines. We hypothesized that prolonged hypoxi...

  1. Evaluation of viability and proliferative activity of human urothelial cells cultured onto xenogenic tissue-engineered extracellular matrices.

    LENUS (Irish Health Repository)

    Davis, Niall F


    To evaluate the viability and proliferative activity of human urothelial cells (HUCs) cultured on tissue-engineered extracellular matrix scaffolds and to assess the potential of extracellular matrixes to support the growth of HUCs in their expected in vivo urine environment.

  2. Reduction of /sup 51/Cr-permeability of tissue culture cells by infection with herpes simplex virus type 1

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Habermehl, K.O.; Diefenthal, W.; Hampl, H.


    Infection of different strains of tissue culture cells with herpes simplex virus type 1(HSV-1) resulted in a reduced /sup 51/Cr-permeability. A stability of the cellular membrane to Triton X-100, toxic sera and HSV-specific complement-mediated immune-cytolysis could be observed simultaneously. The results differed with respect to the cell strain used in the experiments.

  3. Characterization of connective tissue growth factor expression in primary cultures of human tubular epithelial cells: modulation by hypoxia

    NARCIS (Netherlands)

    Kroening, Sven; Neubauer, Emily; Wullich, Bernd; Aten, Jan; Goppelt-Struebe, Margarete


    Kroening S, Neubauer E, Wullich B, Aten J, Goppelt-Struebe M. Characterization of connective tissue growth factor expression in primary cultures of human tubular epithelial cells: modulation by hypoxia. Am J Physiol Renal Physiol 298:F796-F806, 2010. First published December 23, 2009;

  4. Comparison of Biocompatibility and Adsorption Properties of Different Plastics for Advanced Microfluidic Cell and Tissue Culture Models

    NARCIS (Netherlands)

    van Midwoud, Paul M.; Janse, Arnout; Merema, M.T.; Groothuis, Geny M. M.; Verpoorte, Elisabeth


    Microfluidic technology is providing new routes toward advanced cell and tissue culture models to better understand human biology and disease. Many advanced devices have been made from poly(dimethylsiloxane) (PDMS) to enable experiments, for example, to study drug metabolism by use of precision cut

  5. Porous PEOT/PBT scaffolds for bone tissue engineering: preparation, characterization, and in vitro bone marrow cell culturing

    NARCIS (Netherlands)

    Claase, M.B.; Grijpma, Dirk W.; Mendes, S.C.; Mendes, Sandra C.; de Bruijn, Joost Dick; Feijen, Jan


    The preparation, characterization, and in vitro bone marrow cell culturing on porous PEOT/PBT copolymer scaffolds are described. These scaffolds are meant for use in bone tissue engineering. Previous research has shown that PEOT/PBT copolymers showed in vivo degradation, calcification, and bone

  6. Proteomic analysis reveals the mechanisms of Mycena dendrobii promoting transplantation survival and growth of tissue culture seedlings of Dendrobium officinale. (United States)

    Xu, X B; Ma, X Y; Lei, H H; Song, H M; Ying, Q C; Xu, M J; Liu, S B; Wang, H Z


    Dendrobium officinale is an important traditional Chinese medicinal herb. Its seedlings generally show low survival and growth when transferred from in vitro tissue culture to a greenhouse or field environment. In this study, the effect of Mycena dendrobii on the survival and growth of D. officinale tissue culture seedlings and the mechanisms involved was explored. Mycena dendrobii were applied underneath the roots of D. officinale tissue culture seedlings. The seedling survival and growth were analysed. The root proteins induced by M. dendrobii were identified using two-dimensional (2-D) electrophoresis and matrix-assisted laser desorption/ionization time-of-flight MS (MALDI-TOF-MS). Mycena dendrobii treatment significantly enhanced survival and growth of D. officinale seedlings. Forty-one proteins induced by M. dendrobii were identified. Among them, 10 were involved in defence and stress response, two were involved in the formation of root or mycorrhizae, and three were related to the biosynthesis of bioactive constituents. These results suggest that enhancing stress tolerance and promoting new root formation induced by M. dendrobii may improve the survival and growth of D. officinale tissue culture seedlings. This study provides a foundation for future use of M. dendrobii in the large-scale cultivation of Dendrobiums. © 2015 The Society for Applied Microbiology.

  7. Characterization of aldehyde dehydrogenase isozymes in ovarian cancer tissues and sphere cultures

    Directory of Open Access Journals (Sweden)

    Saw Yu-Ting


    Full Text Available Abstract Background Aldehyde dehydrogenases belong to a superfamily of detoxifying enzymes that protect cells from carcinogenic aldehydes. Of the superfamily, ALDH1A1 has gained most attention because current studies have shown that its expression is associated with human cancer stem cells. However, ALDH1A1 is only one of the 19 human ALDH subfamilies currently known. The purpose of the present study was to determine if the expression and activities of other major ALDH isozymes are associated with human ovarian cancer and ovarian cancer sphere cultures. Methods Immunohistochemistry was used to delineate ALDH isozyme localization in clinical ovarian tissues. Western Blot analyses were performed on lysates prepared from cancer cell lines and ovarian cancer spheres to confirm the immunohistochemistry findings. Quantitative reverse transcription-polymerase chain reactions were used to measure the mRNA expression levels. The Aldefluor® assay was used to measure ALDH activity in cancer cells from the four tumor subtypes. Results Immunohistochemical staining showed significant overexpression of ALDH1A3, ALDH3A2, and ALDH7A1 isozymes in ovarian tumors relative to normal ovarian tissues. The expression and activity of ALDH1A1 is tumor type-dependent, as seen from immunohistochemisty, Western blot analysis, and the Aldefluor® assay. The expression was elevated in the mucinous and endometrioid ovarian epithelial tumors than in serous and clear cell tumors. In some serous and most clear cell tumors, ALDH1A1 expression was found in the stromal fibroblasts. RNA expression of all studied ALDH isozymes also showed higher expression in endometrioid and mucinous tumors than in the serous and clear cell subtypes. The expression of ALDH enzymes showed tumor type-dependent induction in ovarian cancer cells growing as sphere suspensions in serum-free medium. Conclusions The results of our study indicate that ALDH enzyme expression and activity may be associated

  8. Characterization of aldehyde dehydrogenase isozymes in ovarian cancer tissues and sphere cultures

    International Nuclear Information System (INIS)

    Saw, Yu-Ting; Thompson, David; Vasiliou, Vasilis; Berkowitz, Ross S; Ng, Shu-Wing; Yang, Junzheng; Ng, Shu-Kay; Liu, Shubai; Singh, Surendra; Singh, Margit; Welch, William R; Tsuda, Hiroshi; Fong, Wing-Ping


    Aldehyde dehydrogenases belong to a superfamily of detoxifying enzymes that protect cells from carcinogenic aldehydes. Of the superfamily, ALDH1A1 has gained most attention because current studies have shown that its expression is associated with human cancer stem cells. However, ALDH1A1 is only one of the 19 human ALDH subfamilies currently known. The purpose of the present study was to determine if the expression and activities of other major ALDH isozymes are associated with human ovarian cancer and ovarian cancer sphere cultures. Immunohistochemistry was used to delineate ALDH isozyme localization in clinical ovarian tissues. Western Blot analyses were performed on lysates prepared from cancer cell lines and ovarian cancer spheres to confirm the immunohistochemistry findings. Quantitative reverse transcription-polymerase chain reactions were used to measure the mRNA expression levels. The Aldefluor® assay was used to measure ALDH activity in cancer cells from the four tumor subtypes. Immunohistochemical staining showed significant overexpression of ALDH1A3, ALDH3A2, and ALDH7A1 isozymes in ovarian tumors relative to normal ovarian tissues. The expression and activity of ALDH1A1 is tumor type-dependent, as seen from immunohistochemisty, Western blot analysis, and the Aldefluor® assay. The expression was elevated in the mucinous and endometrioid ovarian epithelial tumors than in serous and clear cell tumors. In some serous and most clear cell tumors, ALDH1A1 expression was found in the stromal fibroblasts. RNA expression of all studied ALDH isozymes also showed higher expression in endometrioid and mucinous tumors than in the serous and clear cell subtypes. The expression of ALDH enzymes showed tumor type-dependent induction in ovarian cancer cells growing as sphere suspensions in serum-free medium. The results of our study indicate that ALDH enzyme expression and activity may be associated with specific cell types in ovarian tumor tissues and vary according to

  9. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture.

    Directory of Open Access Journals (Sweden)

    Pek-Lan Chan

    Full Text Available BACKGROUND: The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR. With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. RESULTS: In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569 outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN. PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. CONCLUSIONS: Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection

  10. Evaluation of Reference Genes for Quantitative Real-Time PCR in Oil Palm Elite Planting Materials Propagated by Tissue Culture (United States)

    Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder


    Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate

  11. Tissue culture-induced genetic and epigenetic variation in triticale (× Triticosecale spp. Wittmack ex A. Camus 1927) regenerants. (United States)

    Machczyńska, Joanna; Zimny, Janusz; Bednarek, Piotr Tomasz


    Plant regeneration via in vitro culture can induce genetic and epigenetic variation; however, the extent of such changes in triticale is not yet understood. In the present study, metAFLP, a variation of methylation-sensitive amplified fragment length polymorphism analysis, was used to investigate tissue culture-induced variation in triticale regenerants derived from four distinct genotypes using androgenesis and somatic embryogenesis. The metAFLP technique enabled identification of both sequence and DNA methylation pattern changes in a single experiment. Moreover, it was possible to quantify subtle effects such as sequence variation, demethylation, and de novo methylation, which affected 19, 5.5, 4.5% of sites, respectively. Comparison of variation in different genotypes and with different in vitro regeneration approaches demonstrated that both the culture technique and genetic background of donor plants affected tissue culture-induced variation. The results showed that the metAFLP approach could be used for quantification of tissue culture-induced variation and provided direct evidence that in vitro plant regeneration could cause genetic and epigenetic variation.

  12. Lipid-mediated glial cell line-derived neurotrophic factor gene transfer to cultured porcine ventral mesencephalic tissue

    DEFF Research Database (Denmark)

    Bauer, Matthias; Meyer, Morten; Brevig, Thomas


    Transplantation of dopaminergic ventral mesencephalic (VM) tissue into the basal ganglia of patients with Parkinson's disease (PD) shows at best moderate symptomatic relief in some of the treated cases. Experimental animal studies and clinical trials with allogenic and xenogenic pig-derived VM...... tissue grafts to PD patients indicate that one reason for the poor outcome of neural transplantation is the low survival and differentiation of grafted dopaminergic neurons. To improve dopaminergic cell survival through a gene-therapeutic approach we have established and report here results of lipid-mediated...... numbers of tyrosine hydroxylase-positive neurons in the cultured VM tissue. We conclude that lipid-mediated gene transfer employed on embryonic pig VM explant cultures is a safe and effective method to improve survival of dopaminergic neurons and may become a valuable tool to improve allo...

  13. Generation of hyaline cartilaginous tissue from mouse adult dermal fibroblast culture by defined factors (United States)

    Hiramatsu, Kunihiko; Sasagawa, Satoru; Outani, Hidetatsu; Nakagawa, Kanako; Yoshikawa, Hideki; Tsumaki, Noriyuki


    Repair of cartilage injury with hyaline cartilage continues to be a challenging clinical problem. Because of the limited number of chondrocytes in vivo, coupled with in vitro de-differentiation of chondrocytes into fibrochondrocytes, which secrete type I collagen and have an altered matrix architecture and mechanical function, there is a need for a novel cell source that produces hyaline cartilage. The generation of induced pluripotent stem (iPS) cells has provided a tool for reprogramming dermal fibroblasts to an undifferentiated state by ectopic expression of reprogramming factors. Here, we show that retroviral expression of two reprogramming factors (c-Myc and Klf4) and one chondrogenic factor (SOX9) induces polygonal chondrogenic cells directly from adult dermal fibroblast cultures. Induced cells expressed marker genes for chondrocytes but not fibroblasts, i.e., the promoters of type I collagen genes were extensively methylated. Although some induced cell lines formed tumors when subcutaneously injected into nude mice, other induced cell lines generated stable homogenous hyaline cartilage–like tissue. Further, the doxycycline-inducible induction system demonstrated that induced cells are able to respond to chondrogenic medium by expressing endogenous Sox9 and maintain chondrogenic potential after substantial reduction of transgene expression. Thus, this approach could lead to the preparation of hyaline cartilage directly from skin, without generating iPS cells. PMID:21293062

  14. Comparison of regeneration potentials in tissue cultures of primitive and cultivated tomato species (Lycopersicon sp.

    Directory of Open Access Journals (Sweden)

    M. Lech


    Full Text Available Regeneration capacities of two tomato cultivars: Potentat and Rutgers, and of three accessions of wild tomato species: Lycopersicon peruvianum PI 128650, L. peruvianum var. dentatum PI 128655 and L. glandulosum were studied using an universal medium suitable for regeneration of those plants from leaf pieces in tissue culture. Fragments of leaf blades were taken from plants raised in greenhouse conditions and placed on a modified MS medium containing 0.3 mg/l IAA and 3.0 mg/l BAP solidified with 1% agar. The explants were transferred every 4-5 weeks on fresh medium of the same composition. It was shown that all the three primitive tomato species revealed much higher multiplication coefficients than the two cultivars. Appropriate values were: 11 - for L. glandulosum, 8 - for L. peruvianum, 7 - for L. peruvianum var. dentatum, 4 - for L. esculentum cv. Potentat and 2 - cv. Rutgers. Completely regenerated plants were obtained from all the tested species, but organogenesis occurred almost two weeks earlier in wild tomatoes than in the culitivated varieties of L. esculentum.


    Directory of Open Access Journals (Sweden)

    Lila Gardenia


    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  16. The application of cell cultures, body fluids and tissues in oncoproteomics

    Directory of Open Access Journals (Sweden)

    Kamila Duś-Szachniewicz


    Full Text Available Mass spectrometry (MS-based proteomics is a rapidly developing technology for the large scale analysis of proteins, their interactions and subcellular localization. In recent years proteomics has attracted much attention in medicine. Since a single biomarker might not have sufficient sensitivity and specificity in clinical practice, the identification of biomarker panels that comprise several proteins would improve the detection and clinical management of cancer patients. Additionally, the characteristics of protein profiles of most severe human malignancies certainly contribute to the understanding of the biology of cancer and fill the gap in our knowledge of carcinogenesis. This knowledge also is likely to result in the discovery of novel potential cancer markers and targets for molecular therapeutics. It is believed that the novel biomarkers will help in the development of personalized therapy tailored to the individual patient and will thereby reduce the mortality rate from cancer. In this review, the use of different types of human clinical samples (cell cultures, tissues and body fluids in oncoproteomics is explained and the latest advances in mass spectrometry-based proteomics biomarker discovery are discussed.

  17. Discrimination and similarity evaluation of tissue-cultured and wild Dendrobium species using Fourier transform infrared spectroscopy (United States)

    Chen, Nai-dong; Chen, Han; Li, Jun; Sang, Mang-mang; Ding, Shen; Yu, Hao


    The FTIR method was applied to evaluate the similarity of tissue-cultured and wild Dendrobium huoshanense C.Z. Tang et S.J. Cheng, Dendrobium officinale Kimura et Migo and Dendrobium moniliforme (Linn.) Sw and discriminate different Dendrobium species, especially D. huoshanense and its main goldbrick Dendrobium henanense J.L. Lu et L.X. Gao. Despite the general pattern of the IR spectra, different intensities, shapes and peak positions were found in the IR spectra of these samples, especially in the range of 1800-600 cm-1, which could be used to discriminate them. The methanol, aqueous extracting procedure and the second derivative transformation obviously enlarged the tiny spectral differences among these samples. The similarity evaluation based on the IR spectra and the second derivative IR spectrum revealed that the similarity of the methanol extracts between tissue-cultured and wild Dendrobiums might be lower than that between different Dendrobium species. The similarities of the powders and aqueous extracts between tissue-cultured and wild Dendrobiums were higher than those between different Dendrobium species. The further principal component analysis showed that the first three components explained 99.7%, 87.7% and 85.1% of data variance for powder, methanol extract and aqueous extract, respectively, demonstrating a good discrimination between samples. Our research suggested that the variations of secondary metabolites between different origins of the investigated Dendrobiums might be higher than what we had supposed. Tissue culture techniques were widely used in the conversation of rare and endangered medicinal amedica, however, our study suggested that the chemical constituents of tissue-cultured plants might be quite different from their wild correspondences.

  18. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  19. Jatobal virus antigenic characterization by ELISA and neutralization test using EIA as indicator, on tissue culture

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M. Figueiredo


    Full Text Available A virus antigenic characterization methodology using an indirect method of antibody detection ELISA with virus-infected cultured cells as antigen and a micro virus neutralisation test using EIA (NT-EIA as an aid to reading were used for antigenic characterization of Jatobal (BeAn 423380. Jatobal virus was characterized as a Bunyaviridae, Bunyavirus genus, Simbu serogroup virus. ELISA using infected cultured cells as antigen is a sensitive and reliable method for identification of viruses and has many advantages over conventional antibody capture ELISA's and other tests: it eliminates solid phase coating with virus and laborious antigen preparation; it permits screening of large numbers of virus antisera faster and more easily than by CF, HAI, or plaque reduction NT. ELISA and NT using EIA as an aid to reading can be applicable to viruses which do not produce cytopathogenic effect. Both techniques are applicable to identification of viruses which grow in mosquito cells.A caracterização antigênica do vírus Jatobal (BeAn 423380 foi efetuada utilizando uma técnica de ELISA para deteccão de anticorpos que utiliza culturas celulares infectadas como antígeno e um micro teste de neutralização para vírus que utiliza o método imunoenzimático como auxiliar para a leitura dos resultados (NT-EIA. O vírus Jatobal foi caracterizado como um Bunyaviridae, gênero Bunyavirus, pertencente ao sorogrupo Simbu. A técnica de ELISA, utilizando culturas celulares infectadas como antígeno, trata-se de método sensível e confiável na identificação de agentes virais, possuindo muitas vantagens sobre ELISA convencionais e outros testes: elimina a preparação laboriosa de antígenos para o revestimento em fase sólida; permite que se teste de forma mais rápida e fácil que por CF, HAI e neutralização por redução de plaques um grande número de antisoros de vírus. ELISA e NT-EIA podem ser utilizados para a classificação de vírus que não produzem

  20. Evaluation of PCR methods for detection of Brucella strains from culture and tissues. (United States)

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar


    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  1. Tooth Tissue Engineering: The Importance of Blood Products as a Supplement in Tissue Culture Medium for Human Pulp Dental Stem Cells. (United States)

    Pisciolaro, Ricardo Luiz; Duailibi, Monica Talarico; Novo, Neil Ferreira; Juliano, Yara; Pallos, Debora; Yelick, Pamela Crotty; Vacanti, Joseph Phillip; Ferreira, Lydia Masako; Duailibi, Silvio Eduardo


    One of the goals in using cells for tissue engineering (TE) and cell therapy consists of optimizing the medium for cell culture. The present study compares three different blood product supplements for improved cell proliferation and protection against DNA damage in cultured human dental pulp stem cells for tooth TE applications. Human cells from dental pulp were first characterized as adult stem cells (ectomesenchymal mixed origin) by flow cytometry. Next, four different cell culture conditions were tested: I, supplement-free; II, supplemented with fetal bovine serum; III, allogeneic human serum; and IV, autologous human serum. Cultured cells were then characterized for cell proliferation, mineralized nodule formation, and colony-forming units (CFU) capability. After 28 days in culture, the comet assay was performed to assess possible damage in cellular DNA. Our results revealed that Protocol IV achieved higher cell proliferation than Protocol I (p = 0.0112). Protocols II and III resulted in higher cell proliferation than Protocol I, but no statistical differences were found relative to Protocol IV. The comet assay revealed less cell damage in cells cultured using Protocol IV as compared to Protocols II and III. The damage percentage observed on Protocol II was significantly higher than all other protocols. CFUs capability was highest using Protocol IV (p = 0.0018) and III, respectively, and the highest degree of mineralization was observed using Protocol IV as compared to Protocols II and III. Protocol IV resulted in significantly improved cell proliferation, and no cell damage was observed. These results demonstrate that human blood product supplements can be used as feasible supplements for culturing adult human dental stem cells.

  2. Comparative evaluation of efficacy and soft tissue wound healing using diode laser (810 nm versus conventional scalpel technique for second-stage implant surgery

    Directory of Open Access Journals (Sweden)

    Manvir Kaur


    Full Text Available Background: This study was aimed to compare the efficacy and soft tissue wound healing using diode lasers (810 nm versus conventional scalpel approach as uncovering technique during the second-stage surgery in implants. This was a prospective, randomized study which was conducted on 20 subjects in which the implants were already placed using a two-stage technique. Implant sites were examined and the patients were randomly divided into two groups. Materials and Methods: Patients were randomly divided into two groups, i.e., Group A and Group B. In Group A, implants were uncovered as a part of Stage II surgery with conventional scalpel technique, and in Group B, implants were uncovered using 810 nm diode laser. Clinical parameters such as need and amount of local anesthesia, duration of surgery, intraoperative bleeding, pain index, wound healing index (HI, and time for impression taking were recorded at various intervals. Results: Statistical differences for clinical parameters were seen between Group A and Group B showing uncovery of implant with laser more effective, and for time of impression taking, difference was statistically significant showing that impressions were taken early in case of Group A because of better healing which was recorded with help of HI, but the difference in time of healing between Group A and Group B was not statistically significant. Conclusion: The use of a diode laser (810 nm in the second-stage implant surgery can minimize surgical trauma, reduce the amount of anesthesia, improve visibility during surgery due to the absence of bleeding, and eliminate postoperative discomfort.

  3. Using Gamma Irradiation To Induce New Mutants In Potatoes Cv. Diamant Through Tissue Culture Technique

    International Nuclear Information System (INIS)

    Sharabash, M.T.; Ali, Amina A. M.; Ahmed, F. A.; Afifi, Abd El-Moneim M.


    The excess salt, usually NaCl, inhibits potato plant growth and decreases tubers yield. The use of gamma irradiation to induce new mutants in potato cv. Diamant through tissue culture technique was the main task of this study. Sterilized meristemic tips of potato tubers were cultured on aseptic solid MS-medium, pH 5.7, and were incubated at 20 ± 2 d eg C and 16 hrs day length of 3000-Lux light intensity, to produce virus-free plantlets. Micro-propagation started after 6-8 weeks and plantlets were sub-cultured every 3-4 weeks to increase plantlets population. Plantlets were exposed to 0, or 40 Gy, dose rate 27.7 rad / sec., using Co 60 source at the National Center for Research and Radiation Technology, Cairo, Egypt. Irradiated and unirradiated plantlets were transplanted into 60 ml liquid 1/2MS-medium, pH 5.7, and supplemented with 0, 2000 or 4000 ppm NaCl. And, they were incubated for 2 weeks under the same conditions of temperature and light till the new plantlets were grown up. Healthy plantlets were selected, and micro-propagated up to the sixth vegetative generation (M 1 V 6 ), under the same conditions of salinity and incubation conditions Thereafter, the plantlets were transferred to tuberization liquid 1/2MS-medium, supplemented with the same mentioned concentrations of NaCl, to obtain microtubers. The microtubers were collected after 6-8 weeks and preserved at 10 deg C for 3 months approximately, to break the dormancy. Sprouted microtubers were sown to obtain minitubers, and subsequently macrotubers. All cultures were performed in 30-cm pots in a protected greenhouse, and were irrigated with the same concentrations of NaCl. It could be elicited that cv. Diamant is salinity sensitive. This was evidenced by the decrease in the average number of tubers per plant and average fresh weight of tuber under salinity stress up 4000 ppm NaCl, comparing to unsaline control treatment. Potato plants, which still healthy and produced tubers under salinity stress up to

  4. Autoradiographic demonstration of unscheduled DNA synthesis in oral tissues treated with chemical carcinogens in short-term organ culture

    International Nuclear Information System (INIS)

    Ide, F.; Umemura, S.; Ishikawa, T.; Takayama, S.


    A system in which oral tissues of inbred F344 adult rats and Syrian golden hamster embryos were used in combination with autoradiography was developed for measurement of unscheduled DNA synthesis (UDS). For this, oral mucosa, submandibular gland, tooth germ and mandible in short-term organ cultures were treated with 4-nitroquinoline l-oxide or N-methyl-N-nitrosourea plus (methyl- 3 H)thymidine. Significant numbers of silver grains, indicating UDS, were detected over the nuclei of cells of all these tissues except rat salivary gland after treatment with carcinogens. This autoradiographic method is suitable for detection of UDS in oral tissues in conditions mimicking those in vivo. Results obtained in this study indicated a potential use of this system for studies on the mechanism of carcinogenesis at a cellular level comparable to in vivo carcinogenesis studies on oral tissues. (author)

  5. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital


    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami


    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  6. Development and comparison of a real-time PCR assay for detection of Dichelobacter nodosus with culturing and conventional PCR: harmonisation between three laboratories

    DEFF Research Database (Denmark)

    Frosth, Sara; Slettemeås, Jannice S.; Jørgensen, Hannah J.


    BACKGROUND: Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet...... was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126...... laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. CONCLUSIONS...


    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica


    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  8. Three-dimensional spheroid culture targeting versatile tissue bioassays using a PDMS-based hanging drop array. (United States)

    Kuo, Ching-Te; Wang, Jong-Yueh; Lin, Yu-Fen; Wo, Andrew M; Chen, Benjamin P C; Lee, Hsinyu


    Biomaterial-based tissue culture platforms have emerged as useful tools to mimic in vivo physiological microenvironments in experimental cell biology and clinical studies. We describe herein a three-dimensional (3D) tissue culture platform using a polydimethylsiloxane (PDMS)-based hanging drop array (PDMS-HDA) methodology. Multicellular spheroids can be achieved within 24 h and further boosted by incorporating collagen fibrils in PDMS-HDA. In addition, the spheroids generated from different human tumor cells exhibited distinct sensitivities toward drug chemotherapeutic agents and radiation as compared with two-dimensional (2D) cultures that often lack in vivo-like biological insights. We also demonstrated that multicellular spheroids may enable key hallmarks of tissue-based bioassays, including drug screening, tumor dissemination, cell co-culture, and tumor invasion. Taken together, these results offer new opportunities not only to achieve the active control of 3D multicellular spheroids on demand, but also to establish a rapid and cost-effective platform to study anti-cancer therapeutics and tumor microenvironments.

  9. Dynamic culture of a thermosensitive collagen hydrogel as an extracellular matrix improves the construction of tissue-engineered peripheral nerve. (United States)

    Huang, Lanfeng; Li, Rui; Liu, Wanguo; Dai, Jin; Du, Zhenwu; Wang, Xiaonan; Ma, Jianchao; Zhao, Jinsong


    Tissue engineering technologies offer new treatment strategies for the repair of peripheral nerve injury, but cell loss between seeding and adhesion to the scaffold remains inevitable. A thermosensitive collagen hydrogel was used as an extracellular matrix in this study and combined with bone marrow mesenchymal stem cells to construct tissue-engineered peripheral nerve composites in vitro. Dynamic culture was performed at an oscillating frequency of 0.5 Hz and 35° swing angle above and below the horizontal plane. The results demonstrated that bone marrow mesenchymal stem cells formed membrane-like structures around the poly-L-lactic acid scaffolds and exhibited regular alignment on the composite surface. Collagen was used to fill in the pores, and seeded cells adhered onto the poly-L-lactic acid fibers. The DNA content of the bone marrow mesenchymal stem cells was higher in the composites constructed with a thermosensitive collagen hydrogel compared with that in collagen I scaffold controls. The cellular DNA content was also higher in the thermosensitive collagen hydrogel composites constructed with the thermosensitive collagen hydrogel in dynamic culture than that in static culture. These results indicate that tissue-engineered composites formed with thermosensitive collagen hydrogel in dynamic culture can maintain larger numbers of seeded cells by avoiding cell loss during the initial adhesion stage. Moreover, seeded cells were distributed throughout the material.

  10. Primary chondrocytes enhance cartilage tissue formation upon co-culture with expanded chondrocytes, dermal fibroblasts, 3T3 feeder cells and embryonic stem cells

    NARCIS (Netherlands)

    Hendriks, J.A.A.; Miclea, Razvan L.; Schotel, Roka; de Bruijn, Ewart; Moroni, Lorenzo; Karperien, Hermanus Bernardus Johannes; Riesle, J.U.; van Blitterswijk, Clemens


    Co-culture models have been increasingly used in tissue engineering applications to understand cell–cell interactions and consequently improve regenerative medicine strategies. Aiming at further elucidating cartilage tissue formation, we co-cultured bovine primary chondrocytes (BPCs) with human


    Directory of Open Access Journals (Sweden)

    Dolgikh Yu.I.


    Full Text Available The genetic variability induced by in vitro conditions known as somaclonal variation is of practical interest due to its potential uses in plant breeding but, on the other hand, if clonal propagation or transformation is main goal, it becomes an unwelcome phenomenon. Thus, it is important to know frequency, the genomic distribution, the mechanisms and factors influencing somaclonal variation. We studied variability of PCR-based DNA markers of cultured tissues and regenerated plants of maize and bread wheat. The original A188 line of maize and the somaclones obtained were tested using 38 RAPD and 10 ISSR primers. None of the A188 plants showed variation in the RAPD and ISSR spectra for any of the primers used. However, the PCR spectra obtained from the somaclones demonstrated some variations, i.e., 22 RAPD primers and 6 ISSR primers differentiated at least one somaclonal variant from the progenitor line. Six SCAR markers were developed based on several RAPD and ISSR fragments. The inheritance of these SCAR markers was verified in the selfing progeny of each somaclone in the R1–R4 generations and in the hybrids, with A188 as the parental line in the F1 and F2 generations. These markers were sequenced and bioinformatic searches were performed to understand the molecular events that may underlie the variability observed in the somaclones. All changes were found in noncoding sequences and were induced by different molecular events, such as the insertion of long terminal repeat transposon, precise miniature inverted repeat transposable element (MITE excision, microdeletion, recombination, and a change in the pool of mitochondrial DNA. In two groups of independently produced somaclones, the same features (morphological, molecular were variable, which confirms the theory of ‘hot spots’ occurring in the genome. The presence of the same molecular markers in the somaclones and in different non-somaclonal maize variants suggests that in some cases

  12. Obtaining unique large kernel rice using chemical mutagenesis in tissue culture

    International Nuclear Information System (INIS)

    Alyoshin, N.E.; Avakyan, E.R.; Alyoshin, E.P.


    Full text: Lines with improved characters have been received by chemical mutagenesis in rice tissue culture. The japonica rice (Oryza sativa L.) varieties 'Krasnodarskii 424', 'Dubovskii 129', 'Slavyanetz', 'Liman', 'Lomello', 'VNIIR 2471' were used for mutation induction. Nnitrozo-N-methylurea (MNH) has been used as a mutagen. Two approaches were applied: 1. Development mutants by mutagenic treatment of seeds 2. Development regenerants from somatic tissue culture. In the first case, dry seeds with removed covering glumes have been treated with a solution of NMH (exposure 24 hours, tested concentrations 0.05%; 0.1%; 0.2%). After treatment seeds have been rinsed and planted into the soil in vessels. The effect of mutagen was very much genotype dependant. The highest frequency of mutants were observed in the following concentrations of MNH: for variety VNIIR 2471 - 0.05-0.1%, for variety Slavyanetz - 0.1%; for Lomello - 0.2%; for Linman - 0.05% and 0.2%. The mutant N 95, which has been selected from variety Liman after treatment with 0.2% concentration of mutagen, had the following improved characters: vegetation period 103 days (110 days for the parent variety); plant height 93.2 cm (98.2 cm - parent variety); length of the main panicle 17.2 cm; 1000 grain mass 44.9 g (39.2 g - parent variety). Mutant line N 101 selected from the same variety Liman after treatment with 0.05% concentration of mutagen mutated also in many characters: vegetation period 103 days; plant height 106 cm; 1000 grain mass was 47.0 g. In the second experiment, a somatic callus of the 2nd passage from varieties Kransnodarskii 424, Dubovskii 129, Slavyanetz, Liman were treated with the solution of mutagen NMH (concentration: 0.05%; 0.1%; 0.2% + 0.1% PABA by 40 minutes at Certomat shaking machine (100 rev./min). The treated callus has been cultivated at MS regeneration media (4 mg 2.4 D + 20 mg /l of sucrose) and MS intermediate media (non-hormonal + PABA) to obtain regenerants. Plant

  13. Ontogenetically-regulated male sterility in tissue culture - induced and spontaneous sorghum mutants

    Directory of Open Access Journals (Sweden)

    Elkonin L.A.


    Full Text Available Variability of male fertility expression in the AS-1 line, a somaclonal variant obtained from tissue culture of CMS-plant, and in the progeny of revenant '124-1' obtained from fertile tiller, which developed on CMS-plant transferred from the field to the greenhouse, was investigated. Both revertants were characterized by similar expression of male fertility during plant ontogenesis: the panicle on the main tiller was almost completely sterile whereas formation of fertile pollen grains and seed set were observed on the panicles of the shoot tillers. A clear basipetal gradient of male fertility was manifested on all panicles: the base had significantly higher per cent of fertile pollen grains in comparison with the middle part, while in the top the anthers were either absent or had few sterile pollen grains. Such an ontogenetically-regulated restoration of male fertility was controlled by nuclear genes and could be transferred through the pollen in crosses with progenitor CMS-line. Growing of AS-1 plants in the growth chambers simultaneously under a long (16/8 and a short (12/12 daylength conditions demonstrated that differences of fertility level in different tillers was not caused by change of photoperiod during plant ontogenesis and functioning of photoperiod-sensitive fertility restoring gene. Whereas, the ontogenetically-regulated expression of male fertility in both revenants was temperature-dependent and was clearly manifested under relatively cool conditions during 2-week period before the beginning of anthesis of the first panicle (average daily temperature 21°C. The increase of the average daily temperature by 2-3 С resulted in sharp increase of male fertility level. Possibility of using AS-1 line in a new "two-line system" of hybrid seed production, which require only two lines (sterile mutant and fertility restorer, is discussed.

  14. Relationship between insulin release and 65zinc efflux from rat pancreatic islets maintained in tissue culture

    International Nuclear Information System (INIS)

    Formby, B.; Schmid-Formby, F.; Grodsky, G.M.


    In short-term batch-incubation or perfusion experiments, we studied insulin release and associated 65 Zn efflux from rat pancreatic islets loaded with 65 Zn by 24-h tissue culture in low-glucose medium. The fractional basal insulin release and 65 Zn efflux were 0.4% and 3% of total content/h/islet, respectively. Thus, basal 65 Zn efflux was much greater than that to be accounted for if zinc was released proportionally with insulin release only; extragranular zinc flux was suggested. Two millimolar glucose, with or without 1 mM 3-isobutyl-1-methylxanthine (IBMX), affected neither insulin release nor associated 65 Zn efflux. Twenty-five millimolar glucose produced a significant threefold increase in insulin release above baseline, but somewhat decreased 65 Zn efflux at marginal significance. Glucose (25 mM) plus 1 mM IBMX provoked a high increase in insulin release and an associated 30% increase in fractional 65 Zn efflux over basal. Calculations based on previous estimations of 65 Zn distribution and equilibrium with islet zinc indicated that molar zinc efflux was more than sufficient to account for a 2-zinc-insulin hexamer. L-Leucine (2 or 20 mM) plus 1 mM IBMX caused far greater 65 Zn efflux for the amount of insulin released, indicating additional 65 Zn mobilization not directly related to insulin secretion. To evaluate 65 Zn efflux during inhibited insulin secretion, batch incubations were performed in 100% D 2 O or at 27 degrees C, conditions that inhibited insulin release stimulated by high glucose plus IBMX. These agents decreased the 65 Zn efflux far below the basal value (35% and 50%, respectively) and greater than could be accounted for by the attendent inhibition of insulin secretion.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Effect of sucrose concentrations on Stevia rebaudiana Bertoni tissue culture and gene expression. (United States)

    Ghorbani, T; Kahrizi, D; Saeidi, M; Arji, I


    Stevia rebaudiana (Bert.) Bertoni is known as sweet plant which it contains a high level of steviol glycosides in the leaves.  This plant has been used from centuries ago as a sweetener for tea. One of the most important steviol glycosides is stevioside that is attractive for diabetic persons. Tissue culture is the only rapid process for the mass propagation of stevia. One of the most important factors in the medium is sucrose that is a necessary for plant growth. In the present study, we use nodal segments of the stem as explants in mediums with different sucrose concentration (50 mM, 100mM and 150mM). Several morphological traits were measured in a 28 day period. Results analysis showed a significant variation between treatments. The highest growth rate, rooting and leaf production was obtained in medium with 100mM sucrose. The correlation between measured traits was significant at the 0.01 level. To investigation of UGT74G1, UGT76G1, UGT85C2 and KS genes expression that are involved in the synthesis of SGs, RT- PCR was done with the housekeeping gene of as internal control. There were significant differences between all media. The results showed thatsucrose 100 mM containing media was more desirable than others for expression of UGT76G1 and UGT85C2 genes. Whereas, the best medium for expression of UGT74G1 was sucrose 150 mM and sucrose 50 mM for KS gene. Totally, it seems that sucrose at a concentration of 100 mMprovides the best condition for stevia growth and steviol glycosides production.

  16. Tissue culture-induced genetic and epigenetic alterations in rice pure-lines, F1 hybrids and polyploids. (United States)

    Wang, Xiaoran; Wu, Rui; Lin, Xiuyun; Bai, Yan; Song, Congdi; Yu, Xiaoming; Xu, Chunming; Zhao, Na; Dong, Yuzhu; Liu, Bao


    Genetic and epigenetic alterations can be invoked by plant tissue culture, which may result in heritable changes in phenotypes, a phenomenon collectively termed somaclonal variation. Although extensive studies have been conducted on the molecular nature and spectrum of tissue culture-induced genomic alterations, the issue of whether and to what extent distinct plant genotypes, e.g., pure-lines, hybrids and polyploids, may respond differentially to the tissue culture condition remains poorly understood. We investigated tissue culture-induced genetic and epigenetic alterations in a set of rice genotypes including two pure-lines (different subspecies), a pair of reciprocal F1 hybrids parented by the two pure-lines, and a pair of reciprocal tetraploids resulted from the hybrids. Using two molecular markers, amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP), both genetic and DNA methylation alterations were detected in calli and regenerants from all six genotypes, but genetic alteration is more prominent than epigenetic alteration. While significant genotypic difference was observed in frequencies of both types of alterations, only genetic alteration showed distinctive features among the three types of genomes, with one hybrid (N/9) being exceptionally labile. Surprisingly, difference in genetic alteration frequencies between the pair of reciprocal F1 hybrids is much greater than that between the two pure-line subspecies. Difference also exists in the pair of reciprocal tetraploids, but is to a less extent than that between the hybrids. The steady-state transcript abundance of genes involved in DNA repair and DNA methylation was significantly altered in both calli and regenerants, and some of which were correlated with the genetic and/or epigenetic alterations. Our results, based on molecular marker analysis of ca. 1,000 genomic loci, document that genetic alteration is the major cause of somaclonal variation in rice

  17. Longitudinal Claudin Gene Expression Analyses in Canine Mammary Tissues and Thereof Derived Primary Cultures and Cell Lines

    Directory of Open Access Journals (Sweden)

    Susanne C. Hammer


    Full Text Available Human and canine mammary tumours show partial claudin expression deregulations. Further, claudins have been used for directed therapeutic approaches. However, the development of claudin targeting approaches requires stable claudin expressing cell lines. This study reports the establishment and characterisation of canine mammary tissue derived cell lines, analysing longitudinally the claudin-1, -3, -4 and -7 expressions in original tissue samples, primary cultures and developed cell lines. Primary cultures were derived from 17 canine mammary tissues: healthy, lobular hyperplasia, simple adenoma, complex adenoma, simple tubular carcinoma, complex carcinoma, carcinoma arising in a benign mixed tumour and benign mixed tissue. Cultivation was performed, if possible, until passage 30. Claudin mRNA and protein expressions were analysed by PCR, QuantiGene Plex Assay, immunocytochemistry and immunofluorescence. Further, cytokeratin expression was analysed immunocytochemically. Cultivation resulted in 11 established cell lines, eight showing epithelial character. In five of the early passages the claudin expressions decreased compared to the original tissues. In general, claudin expressions were diminished during cultivation. Three cell lines kept longitudinally claudin, as well as epithelial marker expressions, representing valuable tools for the development of claudin targeted anti-tumour therapies.

  18. Combined value of Virtual Touch tissue quantification and conventional sonographic features for differentiating benign and malignant thyroid nodules smaller than 10 mm. (United States)

    Zhang, Huiping; Shi, Qiusheng; Gu, Jiying; Jiang, Luying; Bai, Min; Liu, Long; Wu, Ying; Du, Lianfang


    This study aimed to investigate the value of sonographic features including Virtual Touch tissue quantification (VTQ; Siemens Medical Solutions, Mountain View, CA) for differentiating benign and malignant thyroid nodules smaller than 10 mm. Seventy-one thyroid nodules smaller than 10 mm with pathologic diagnoses were included in this study. The conventional sonographic features and quantitative elasticity features (VTQ) were observed and compared between benign and malignant nodules. There were 39 benign and 32 malignant nodules according to histopathologic examination. When compared with benign nodules, malignant nodules were more frequently taller than wide, poorly defined, and markedly hypoechoic (P benign and malignant nodules. The VTQ value for malignant nodules (mean ± SD 3.260 ± 0.725 m/s) was significantly higher than that of benign ones (2.108 ± 0.455 m/s; P benign and malignant thyroid nodules smaller than 10 mm. When VTQ was combined with B-mode sonographic features, the sensitivity was improved significantly.

  19. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat. (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M


    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  20. Establishment and long-term culture of the cell lines derived from gonad tissues of Siberian sturgeon (Acipenser baerii

    Directory of Open Access Journals (Sweden)

    Jun Hyung Ryu


    Full Text Available Abstract To culture germline stem cells in vitro, establishment of the cell lines that can be used as the feeder cells is a prerequisite. In this study, we tried to establish gonad-derived cell lines in Siberian sturgeon (Acipenser baerii. Five 1-year-old A. baerii were used as a donor of gonad tissues, and gonad-dissociated cells were cultured in vitro. Subsequently, determination of growth conditions, long-term culture, characterization, and cryopreservation of the cell lines were also conducted. Five gonad-derived cell lines were stably established and cultured continuously over at least the 73th passage and 402 culture days under the media containing 20 % fetal bovine serum at 28 °C. All cell lines consisted of two main cell types based on morphology even if the ratio of the two cell types was different depending on cell lines. Despite long-term culture, all cell lines maintained diploid DNA contents and expression of several genes that are known to express in the A. baerii gonad. After freezing and thawing of the cell lines, post-thaw cell viabilities between 57.6 and 92.9 % depending on cell lines were indentified, suggesting that stable cryopreservation is possible. The results and the cell lines established in this study will contribute to the development of an in vitro system for A. baerii germline stem cell culture.

  1. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices.


    Christensen, G D; Simpson, W A; Younger, J J; Baddour, L M; Barrett, F F; Melton, D M; Beachey, E H


    The adherence of coagulase-negative staphylococci to smooth surfaces was assayed by measuring the optical densities of stained bacterial films adherent to the floors of plastic tissue culture plates. The optical densities correlated with the weight of the adherent bacterial film (r = 0.906; P less than 0.01). The measurements also agreed with visual assessments of bacterial adherence to culture tubes, microtiter plates, and tissue culture plates. Selected clinical strains were passed through ...

  2. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR. (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane


    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  3. Performance of a real-time PCR assay in routine bovine mastitis diagnostics compared with in-depth conventional culture. (United States)

    Hiitiö, Heidi; Riva, Rauna; Autio, Tiina; Pohjanvirta, Tarja; Holopainen, Jani; Pyörälä, Satu; Pelkonen, Sinikka


    Reliable identification of the aetiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for detecting the most common udder pathogens directly from milk. In this study aseptically taken quarter milk samples were analysed with a real-time PCR assay (Thermo Scientific PathoProof Mastitis Complete-12 Kit, Thermo Fisher Scientific Ltd.) and by semi-quantitative, in-depth bacteriological culture (BC). The aim of the study was to evaluate the diagnostic performance of the real-time PCR assay in routine use. A total of 294 quarter milk samples from routine mastitis cases were cultured in the national reference laboratory of Finland and examined with real-time PCR. With BC, 251 out of 294 (85.7%) of the milk samples had at least one colony on the plate and 38 samples were considered contaminated. In the PCR mastitis assay, DNA of target species was amplified in 244 samples out of 294 (83.0%). The most common bacterial species detected in the samples, irrespective of the diagnostic method, was the coagulase negative staphylococci (CNS) group (later referred as Staphylococcus spp.) followed by Staphylococcus aureus. Sensitivity (Se) and specificity (Sp) for the PCR assay to provide a positive Staph. aureus result was 97.0 and 95.8% compared with BC. For Staphylococcus spp., the corresponding figures were 86.7 and 75.4%. Our results imply that PCR performed well as a diagnostic tool to detect Staph. aureus but may be too nonspecific for Staphylococcus spp. in routine use with the current cut-off Ct value (37.0). Using PCR as the only microbiological method for mastitis diagnostics, clinical relevance of the results should be carefully considered before further decisions, for instance antimicrobial treatment, especially when minor pathogens with low amount of DNA have been detected. Introducing the concept of contaminated samples should also be considered.

  4. Mastitis diagnosis in dairy cows using PathoProof real-time polymerase chain reaction assay in comparison with conventional bacterial culture in a Northern German field study. (United States)

    Spittel, Susanne; Hoedemaker, Martina


    In the following field study, the commercial PathoProof Mastitis PCR Assay, a real-time PCR for identifying eleven mastitis pathogens and the staphylococcal beta-lactamase gene, was compared with conventional bacterial culture. For this purpose, 681 udder quarter samples from 173 clinically healthy cows with varying somatic cell count from four dairy herds in the region of Osnabrück, Lower Saxony, Germany, were collected between July 2010 and February 2011 and subjected to PCR and bacterial culture. The frequency of positive pathogen signals was markedly higher with PCR compared with culture (70.6% vs. 32.2%). This was accompanied by a substantial higher percentage of multiple pathogen identifications and a lower percentage of single identifications in the PCR compared with bacterial culture. Using bacterial culture as gold standard, moderate to high sensitivities (76.9-100%) and specificities (63.3-98.7%) were calculated for six out of seven pathogens with sufficient detection numbers. For Enterococcus spp, the sensitivity was only 9.1%. When the PCR results of pooled udder quarter samples of the 173 cows were compared with the single udder quarter samples, in 72% of the cases, major pathogen DNA was either not found in both types of samples, or in the case of a positive pool sample, the respective pathogens were found in at least one udder quarter sample. With both methods, the most frequently detected mastitis pathogens were coryneform bacteria (PCR: Corynebacterium bovis), coagulase-negative staphylococci (CNS) and Staphylococcus (S.) aureus, followed by Arcanobacterium pyogenes/Peptoniphilus indolicus with PCR, and then with both methods, Streptococcus uberis. The staphylococcal beta-lactamase gene was found in 27.7% of the S. aureus and in 37.0% of the CNS identifications.

  5. Influence of ionizing radiation on synthesis and molecular heterogeneity of catalase in tissue culture of Rauwolfia serpentina

    International Nuclear Information System (INIS)

    Komov, V.P.; Bespalova, E.V.; Strelkova, M.A.


    Changes in activity and molecular heterogeneity of catalase in tissue culture of Rauwolfia serpentina following irradiation in early growth period at the doses of 8 and 50 Gy has been studied. Ionizing radiation accelerate the synthesis and degradation rates of catalase and total protein. A comparative study of changes in enzyme and protein turnover during growth on irradiated and non-irradiated medium has been made [ru

  6. Sensitivity of Pigment Content of Banana and Orchid Tissue Culture Exposed to Extremely Low Frequency Electromagnetic Fiel


    Prihatini, Riry; Saleh, Norihan Mohamad


    Natural exposure of extremely low frequency electromagnetic field (ELF-EMF) occurs in the environment and acts as one of the abiotic factors that affect the growth and development of organisms. This study was conducted to determine the effect of ELF-EMF on the tissue cultured banana and slipper orchid chlorophyll content as one of the indicators in measuring plant photosynthetic capacity. Four days old banana (Musa sp. cv. Berangan) corm and seven days old slipper orchid (Paphiopedilum rothsc...

  7. New method for the study of Amaryllidaceae alkaloid biosynthesis using biotransformation of deuterium-labeled precursor in tissue cultures

    International Nuclear Information System (INIS)

    Tahchy, A. E.; Boisbrun, M.; Chretien, F.; Henry, M.; Chapleur, Y.; Laurain-Mattar, D.; Ptak, A.; Dupire, F.


    Biotransformation of deuterated-4'-O-methylnorbelladine into alkaloids galanthamine and lycorine in tissue cultures of Leucojum aestivum was demonstrated using HPLC coupled to mass spectrometry. GC-MS screening was also carried to investigate other native and deuterated alkaloids. A total of six labeled alkaloids were identified indicating that 4'-O-methyl-d3-norbelladine is incorporated into three different groups of Amaryllidaceae alkaloids that are biosynthesized by three modes of intramolecular oxidative phenol coupling. (authors)

  8. Tissue culture of osteogenic sarcoma in rats, induced by radioactive phosphorus P-32 and the effect of the anti-cancerous agents on these tumor cells under tissue culture

    International Nuclear Information System (INIS)

    Osaka, Shunzo


    Small pieces of osteogenic sarcoma, induced into albino rats of the C.F. Wistar strain by injection of radioactive phosphorus 32 P, were cultured in mixtures of Eagle's minimum essential medium and 20% calf serum. The tumor cells cultured in this way were transplanted into the subcutaneous tissue or the intraabdominal cavity to healthy albino rats. The effect of the anticancerous agents was evaluated by the decrease of nucleic acid composition in these cultured tumor cells. As anti-cancerous agents, cyclophosphamide (CPA), mitomycin C(MMC), and 5-fluorouracil(5-FU) were put into contact with the tumor cells in cultures for two hours under the following dilutions: CPA; 10 -6 , 10 -5 , 10 -4 g/ml. MMC; 2 x 10 -8 , 2 x 10 -7 , 2 x 10 -6 g/ml. 5-FU; 2 x 10 -6 , 2 x 10 -5 , 2 x 10 -4 g/ml. The results are as follows: Three of the seven osteogenic sarcomas in rats were successfully cultured, one of them through more than eighteen generations. After about five hundred thousand cultured cells had been transplanted into the subcutaneous tissues or abdominal cavities of rats, tumors grew in all of them. The histological findings of the tumors in the second generation were quite similar to those of the original tumor. The same process was repeated three times and the tumor showed histogical findings similar to those of the original ones. The capability of nucleic acid synthesis in these cells was decreased at twenty fours after CPA contact and at forty eight hours after MMC. (J.P.N.)

  9. The Effect of a Vegetarian vs Conventional Hypocaloric Diabetic Diet on Thigh Adipose Tissue Distribution in Subjects with Type 2 Diabetes: A Randomized Study. (United States)

    Kahleova, Hana; Klementova, Marta; Herynek, Vit; Skoch, Antonin; Herynek, Stepan; Hill, Martin; Mari, Andrea; Pelikanova, Terezie


    The aim of our study was to compare the effects of a vegetarian and a conventional diet on thigh adipose tissue distribution in subjects with type 2 diabetes (T2D). Seventy-four subjects with T2D were randomly assigned to either follow a vegetarian diet (V, n = 37) or a control group who followed an isocaloric conventional anti-diabetic diet (C, n = 37). Both diets were calorie restricted (-500 kcal/day). To measure insulin sensitivity, the hyperinsulinemic (1 -1 .min -1 ) isoglycemic clamp was conducted. β-Cell function was assessed using a mathematical model after a test meal. Magnetic resonance imaging of the thigh was performed. All subjects were examined at 0, 3, and 6 months. Statistical analyses were performed using repeated measures analysis of variance and a multivariate regression model. Greater reduction was observed in total leg area in V (-13.6 cm 2 [95% confidence interval [CI], -14.2 to -12.9] in V vs -9.9 cm 2 [95% CI, -10.6 to -9.2] in C; Gxt p diets (Gxt, p = 0.64). Subfascial fat was reduced only in response to a vegetarian diet (-0.82 [95% CI, -1.13 to -0.55] cm 2 in V vs -0.44 [95% CI, -0.78 to +0.02] cm 2 in C; Gxt, p = 0.04). The reduction in intramuscular fat tended to be greater in response to a vegetarian diet (-1.78 [95% CI, -2.26 to -1.27] cm 2 in V vs -0.57 [95% CI, -1.06 to -0.09] cm 2 in C; Gxt, p = 0.12). Changes in subcutaneous and subfascial fat correlated with changes in glycated hemoglobin (HbA1c), fasting plasma glucose, and β-cell insulin sensitivity. After adjustment for changes in body mass index (BMI), correlations remained significant for changes in fasting plasma glucose and β-cell insulin sensitivity and with changes in triglycerides. Our data indicate the importance of both subcutaneous and subfascial fat in relationship to glucose and lipid metabolism. BMI , body mass index; C , control group; FPG , fasting plasma glucose; Gxt , interaction between group and time; HbA1c , glycated hemoglobin; MCR

  10. [Effects of endophytic fungi from Dendrobium officinale on host growth and components metabolism of tissue culture seedlings]. (United States)

    Zhu, Bo; Liu, Jing-Jing; Si, Jin-Ping; Qin, Lu-Ping; Han, Ting; Zhao, Li; Wu, Ling-Shang


    The paper aims to study the effects of endophytic fungi from D. officinale cultivated on living trees on growth and components metabolism of tissue culture seedlings. Morphological characteristics and agronomic characters of tissue culture seedlings infected and uninfected by endophytic fungus were observed and measured. Polysaccharides and alcohol-soluble extracts contents were determined by phenol-sulfuric acid method and hot-dipmethod, respectively. Monosacchride composition of polysaccharides and alcohol-soluble extracts components were analyzed by pre-column derivatives HPLC and HPLC method, respectively. It showed that effects of turning to purple of stem nodes could be changed by endophytic fungus. Besides, the endophytic fungus could affect the contents and constitutions of polysaccharides and alcohol-soluble extracts. The strains tested, expect DO34, could promote growth and polysaccharides content of tissue culture seedlings. The strains tested, expect DO12, could promote the accumulation of mannose. Furthermore, DO18, DO19 and DO120 could increase alcohol-soluble extracts. On the basis, four superior strains were selected for mechanism research between endophytic fungus and their hosts and microbiology engineering. Copyright© by the Chinese Pharmaceutical Association.

  11. Screening Test of Greenhouse Seeding Exercise Matrix for Tissue Culture Seeding of Dendrobium Officinale Kimura et Migo

    Directory of Open Access Journals (Sweden)

    Zhou Yuan


    Full Text Available The Dendrobium officinale Kimura et Migo has a high demand on planting matrix, while its tissue culture seeding has much more demands on planting matrix. To find out a seeding exercise matrix to enhance the survival rate of tissue culture seeding of Dendrobium officinale Kimura et Migo more efficiently, this article carries out a screening test of greenhouse seeding exercise matrix material for tissue culture seeding of Dendrobium officinale Kimura et Migo. The test adopts full random test design, mainly for screening test of five matrix materials, namely pine bark, camphor tree bark, fern root, peanut shell and longan bark. Compare the impact of prepared seeding exercise matrix on the survival rate and growth trend (including plant height, growth rate and bud growth rate. The test result shows that: The seeding exercise matrix prepared by fern root is the most efficient, and the survival rate, plant height, growth rate and bud growth rate have achieved 100%, 4.5cm, 43.67% and 54.33% respectively. The main reason may be that the seeding exercise matrix C prepared by fern root is fairly loose and has a great water permeability, which is conducive to the growth of Dendrobium officinale Kimura et Migo.

  12. Royal Jelly Prevents Osteoporosis in Rats: Beneficial Effects in Ovariectomy Model and in Bone Tissue Culture Model

    Directory of Open Access Journals (Sweden)

    Saburo Hidaka


    Full Text Available Royal jelly (RJ has been used worldwide for many years as medical products, health foods and cosmetics. Since RJ contains testosterone and has steroid hormone-type activities, we hypothesized that it may have beneficial effects on osteoporosis. We used both an ovariectomized rat model and a tissue culture model. Rats were divided into eight groups as follows: sham-operated (Sham, ovariectomized (OVX, OVX given 0.5% (w/w raw RJ, OVX given 2.0% (w/w RJ, OVX given 0.5% (w/w protease-treated RJ (pRJ, OVX given 2.0% (w/w pRJ, OVX given 17β-estradiol and OVX given its vehicle, respectively. The Ovariectomy decreased tibial bone mineral density (BMD by 24%. Administration of 17β-estradiol to OVX rats recovered the tibial BMD decrease by 100%. Administration of 2.0% (w/w RJ and 0.5–2.0% (w/w pRJ to OVX rats recovered it by 85% or more. These results indicate that both RJ and pRJ are almost as effective as 17β-estradiol in preventing the development of bone loss induced by ovariectomy in rats. In tissue culture models, both RJ and pRJ increased calcium contents in femoral-diaphyseal and femoral-metaphyseal tissue cultures obtained from normal male rats. However, in a mouse marrow culture model, they neither inhibited the parathyroid hormone (PTH-induced calcium loss nor affected the formation of osteoclast-like cells induced by PTH in mouse marrow culture system. Therefore, our results suggest that both RJ and pRJ may prevent osteoporosis by enhancing intestinal calcium absorption, but not by directly antagonizing the action of PTH.

  13. Evaluation of the effects of titanium dioxide nanoparticles on cultured Rana catesbeiana tailfin tissue

    Directory of Open Access Journals (Sweden)

    S. Austin eHammond


    Full Text Available Nanoparticles (NPs, materials that have one dimension less than 100 nm, are used in manufacturing, health and food products, and consumer products including cosmetics, clothing and household appliances. Their utility to industry is derived from their high surface-area-to-volume ratios and physico-chemical properties distinct from their bulk counterparts, but the near-certainty that NPs will be released into the environment raises the possibility that they could present health risks to humans and wildlife. The thyroid hormones (THs, thyroxine and 3,3’,5-triiodothyronine (T3, are involved in development and metabolism in vertebrates including humans and frogs. Many of the processes of anuran metamorphosis are analogous to human post-embryonic development and disruption of TH action can have drastic effects. These shared features make the metamorphosis of anurans an excellent model for screening for endocrine disrupting chemicals (EDCs. We used the cultured tailfin (C-fin assay to examine the exposure effects of 0.1-10 nM (~8-800 ng/L of three types of ~20 nm TiO2 NPs (P25, M212, M262 and micron-sized TiO2 (μTiO2 ±10 nM T3. The actual Ti levels were 40.9 – 64.7% of the nominal value. Real-time quantitative polymerase chain reaction (QPCR was used to measure the relative amounts of mRNA transcripts encoding TH-responsive thyroid hormone receptors (thra and thrb and Rana larval keratin type I (rlk1, as well as the cellular stress-responsive heat shock protein 30 kDa (hsp30, superoxide dismutase (sod, and catalase (cat. The levels of the TH-responsive transcripts were largely unaffected by any form of TiO2. Some significant effects on stress-related transcripts were observed upon exposure to micron-sized TiO2, P25 and M212 while no effect was observed with M262 exposure. Therefore the risk of adversely affecting amphibian tissue by disrupting TH-signalling or inducing cellular stress is low for these compounds relative to other previously

  14. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan


    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  15. Diagnostic accuracy of morphologic identification of filamentous fungi in paraffin embedded tissue sections: Correlation of histological and culture diagnosis

    Directory of Open Access Journals (Sweden)

    Sundaram Challa


    Full Text Available Aims and Objectives: The aim was to investigate the correlation between histological and culture diagnosis of filamentous fungi. Materials and Methods: Tissue sections from biopsy samples stained with Hematoxylin and Eosin and special stains from samples of chronic invasive/noninvasive sinusitis and intracranial space occupying lesions during 2005-2011 diagnosed to have infection due to filamentous fungi were reviewed. The histopathology and culture diagnoses were analyzed for correlation and discrepancy. Results: There were 125 samples positive for filamentous fungi on biopsy. Of these 76 (60.8% were submitted for culture and fungi grew in 30 (39.97% samples. There was a positive correlation between histological and culture diagnosis in 25 (83.33% samples that included Aspergillus species (16/19, Zygomycetes species (8/10 and dematiaceous fungi (1/1. The negative yield of fungi was more in Zygomycetes species (20/30 when compared to Aspergillus species (25/44. There was a discrepancy in diagnosis in 5/30 (16.67% samples which included probable dual infection in two, and dematiaceous fungi being interpreted as Aspergillus species in three samples. Conclusion: Histopathology plays a major role in the diagnosis of infection due to filamentous fungi, especially when cultures are not submitted or negative. The discrepancy between histological and culture diagnosis was either due to dematiaceous fungi being interpreted as Aspergillus species or probable dual infection.

  16. Human breast cancer histoid: an in vitro 3-dimensional co-culture model that mimics breast cancer tissue. (United States)

    Kaur, Pavinder; Ward, Brenda; Saha, Baisakhi; Young, Lillian; Groshen, Susan; Techy, Geza; Lu, Yani; Atkinson, Roscoe; Taylor, Clive R; Ingram, Marylou; Imam, S Ashraf


    Progress in our understanding of heterotypic cellular interaction in the tumor microenvironment, which is recognized to play major roles in cancer progression, has been hampered due to unavailability of an appropriate in vitro co-culture model. The aim of this study was to generate an in vitro 3-dimensional human breast cancer model, which consists of cancer cells and fibroblasts. Breast cancer cells (UACC-893) and fibroblasts at various densities were co-cultured in a rotating suspension culture system to establish co-culture parameters. Subsequently, UACC-893, BT.20, or MDA.MB.453 were co-cultured with fibroblasts for 9 days. Co-cultures resulted in the generation of breast cancer histoid (BCH) with cancer cells showing the invasion of fibroblast spheroids, which were visualized by immunohistochemical (IHC) staining of sections (4 µm thick) of BCH. A reproducible quantitative expression of C-erbB.2 was detected in UACC-893 cancer cells in BCH sections by IHC staining and the Automated Cellular Imaging System. BCH sections also consistently exhibited qualitative expression of pancytokeratins, p53, Ki-67, or E-cadherin in cancer cells and that of vimentin or GSTPi in fibroblasts, fibronectin in the basement membrane and collagen IV in the extracellular matrix. The expression of the protein analytes and cellular architecture of BCH were markedly similar to those of breast cancer tissue.

  17. A molecular diagnostic tool to replace larval culture in conventional faecal egg count reduction testing in sheep.

    Directory of Open Access Journals (Sweden)

    Florian Roeber

    Full Text Available The accurate diagnosis of parasitic nematode infections in livestock (including sheep and goats is central to their effective control and the detection of the anthelmintic resistance. Traditionally, the faecal egg count reduction test (FECRT, combined with the technique of larval culture (LC, has been used widely to assess drug-susceptibility/resistance in strongylid nematodes. However, this approach suffers from a lack of specificity, sensitivity and reliability, and is time-consuming and costly to conduct. Here, we critically assessed a specific PCR assay to support FECRT, in a well-controlled experiment on sheep with naturally acquired strongylid infections known to be resistant to benzimidazoles. We showed that the PCR results were in close agreement with those of total worm count (TWC, but not of LC. Importantly, albendazole resistance detected by PCR-coupled FECRT was unequivocally linked to Teladorsagia circumcincta and, to lesser extent, Trichostrongylus colubriformis, a result that was not achievable by LC. The key findings from this study demonstrate that our PCR-coupled FECRT approach has major merit for supporting anthelmintic resistance in nematode populations. The findings also show clearly that our PCR assay can be used as an alternative to LC, and is more time-efficient and less laborious, which has important practical implications for the effective management and control strongylid nematodes of sheep.

  18. Distribution of Podoplanin in Synovial Tissues in Rheumatoid Arthritis Patients Using Biologic or Conventional Disease-Modifying Anti-Rheumatic Drugs. (United States)

    Takakubo, Yuya; Oki, Hiroharu; Naganuma, Yasushi; Saski, Kan; Sasaki, Akiko; Tamaki, Yasunobu; Suran, Yang; Konta, Tsuneo; Takagi, Michiaki


    Podoplanin (PDPN) mediates tumor cell migration and invasion, which phenomena might also play a role in severe rheumatoid arthritis (RA). Therefore, the precise cellular distribution of PDPN and it's relationships with inflammation was studied in RA treated with biologic disease-modifying anti-rheumatic drugs (DMARD) or conventional DMARDs (cDMARD). PDPN+ cells were immunostained by NZ-1 mAb, and scored (3+; >50%/ area, 2+; 20%- 50%, 1+; 5%-20%, 0: <5%) in synovial tissues from RA treated with biologic DMARDs (BIO, n=20) or cDMARD (n=20) for comparison with osteoarthritis (OA, n=5), followed by cell grading of inflammation and cell-typing. Inflammatory synovitis score was 1.4 in both BIO and cDMARD, compared to only 0.2 in OA. PDPN+ cells were found in the lining layer (BIO 1.6, cDMARD 1.3, OA 0.2) and lymphoid aggregates (BIO 0.6, cDMRD 0.7, OA 0.2), and correlated with RA-inflammation in BIO- and cDMARD-groups in both area (r=0.7/0.9, r=0.6/0.7, respectively p<0.05). PDPN was expressed in CD68+ type A macrophage-like and 5B5+ type B fibroblast-like cells in the lining layer, and in IL- 17+ cells in lymphoid aggregates in RA. PDPN was markedly increased in the immunologically inflamed RA synovitis, which was surgically treated due to BIO- and cDMARD-resistant RA. PDPN may have potential of a new marker of residual arthritis in local joints for inflammation-associated severe RA. Copyright© Bentham Science Publishers; For any queries, please email at

  19. Fluorescently labaled collagen binding proteins allow specific visualization of collagen in tissues and live cell culture

    NARCIS (Netherlands)

    Krahn, K.B.N.; Bouten, C.V.C.; Tuijl, van S.; Zandvoort, van M.; Merkx, M.


    Visualization of the formation and orientation of collagen fibers in tissue engineering experiments is crucial for understanding the factors that determine the mechanical properties of tissues. In this study, collagen-specific fluorescent probes were developed using a new approach that takes

  20. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone : a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction

    NARCIS (Netherlands)

    den Hartog, Laurens; Huddleston Slater, James J. R.; Vissink, Arjan; Meijer, Henny J. A.; Raghoebar, Gerry M.


    den Hartog L, Huddleston Slater JJR, Vissink A, Meijer HJA, Raghoebar GM. Treatment outcome of immediate, early and conventional single-tooth implants in the aesthetic zone: a systematic review to survival, bone level, soft-tissue, aesthetics and patient satisfaction. J Clin Periodontol 2008; 35:

  1. Effects of cyclic compression on the mechanical properties and calcification process of immature chick bone tissue in culture. (United States)

    Maeda, Eijiro; Nakagaki, Masashi; Ichikawa, Katsuhisa; Nagayama, Kazuaki; Matsumoto, Takeo


    Contribution of mechanical loading to tissue growth during both the development and post-natal maturation is of a particular interest, as its understanding would be important to strategies in bone tissue engineering and regenerative medicine. The present study has been performed to investigate how immature bone responds to mechanical loading using an ex vivo culture system. A slice of the tibia, with the thickness of 3 mm, was obtained from 0-day-old chick. For the ex vivo culture experiment in conjunction with cyclic compressive loading, we developed a custom-made, bioreactor system where both the load and the deformation applied to the specimen was recorded. Cyclic compression, with an amplitude of 0.3 N corresponding to 1 to 2% compressive strain, was applied to immature bone specimen during a 3-day culture period at an overall loading rate 3-4 cycles/min, in the presence of β-glycerol phosphate and dexamethasone in culture medium. The stress-strain relationship was obtained at the beginning and the end of the culture experiment. In addition, analyses for alkaline phosphate release, cell viability and tissue calcification were also performed. It was exhibited that elastic moduli of bone slices were significantly elevated at the end of the 3-day culture in the presence of cyclic compression, which was a similar phenomenon to significant elevation of the elastic moduli of bone tissue by the maturation from 0-day old to 3-day old. By contrast, no significant changes in the moduli were observed in the absence of cyclic compression or in deactivated, cell-free samples. The increases in the moduli were coincided with the increase in calcified area in the bone samples. It was confirmed that immature bone can respond to compressive loading in vitro and demonstrate the growth of bone matrix, similar to natural, in vivo maturation. The elevation of the elastic moduli was attributable to the increased calcified area and the realignment of collagen fibers parallel to

  2. Effects of cyclic compression on the mechanical properties and calcification process of immature chick bone tissue in culture

    Directory of Open Access Journals (Sweden)

    Eijiro Maeda


    Full Text Available Contribution of mechanical loading to tissue growth during both the development and post-natal maturation is of a particular interest, as its understanding would be important to strategies in bone tissue engineering and regenerative medicine. The present study has been performed to investigate how immature bone responds to mechanical loading using an ex vivo culture system. A slice of the tibia, with the thickness of 3 mm, was obtained from 0-day-old chick. For the ex vivo culture experiment in conjunction with cyclic compressive loading, we developed a custom-made, bioreactor system where both the load and the deformation applied to the specimen was recorded. Cyclic compression, with an amplitude of 0.3 N corresponding to 1 to 2% compressive strain, was applied to immature bone specimen during a 3-day culture period at an overall loading rate 3–4 cycles/min, in the presence of β-glycerol phosphate and dexamethasone in culture medium. The stress-strain relationship was obtained at the beginning and the end of the culture experiment. In addition, analyses for alkaline phosphate release, cell viability and tissue calcification were also performed. It was exhibited that elastic moduli of bone slices were significantly elevated at the end of the 3-day culture in the presence of cyclic compression, which was a similar phenomenon to significant elevation of the elastic moduli of bone tissue by the maturation from 0-day old to 3-day old. By contrast, no significant changes in the moduli were observed in the absence of cyclic compression or in deactivated, cell-free samples. The increases in the moduli were coincided with the increase in calcified area in the bone samples. It was confirmed that immature bone can respond to compressive loading in vitro and demonstrate the growth of bone matrix, similar to natural, in vivo maturation. The elevation of the elastic moduli was attributable to the increased calcified area and the realignment of collagen

  3. Oxidative stress under ambient and physiological oxygen tension in tissue culture (United States)

    Jagannathan, Lakshmanan; Cuddapah, Suresh; Costa, Max


    Oxygen (O2) levels range from 2–9% in vivo. However, cell culture experiments are performed at atmospheric O2 levels (21%). Oxidative stress due to generation of reactive oxygen species (ROS) in cells cultured at higher than physiological levels is implicated in multitude of deleterious effects including DNA damage, genomic instability and senescence. In addition, oxidative stress activates redox sensitive transcription factors related to inflammatory signaling and apoptotic signaling. Furthermore, several chromatin-modifying enzymes are affected by ROS, potentially impacting epigenetic regulation of gene expression. While primary cells are cultured at lower O2 levels due to their inability to grow at higher O2, the immortalized cells, which display no such apparent growth difficulties, are typically cultured at 21% O2. This review will provide an overview of issues associated with increased oxygen levels in in vitro cell culture and point out the benefits of using lower levels of oxygen tension even for immortalized cells. PMID:27034917

  4. Induction of osteogenic differentiation of stem cells via a lyophilized microRNA reverse transfection formulation on a tissue culture plate

    Directory of Open Access Journals (Sweden)

    Wu K


    Full Text Available Kaimin Wu,1,* Jie Xu,2,* Mengyuan Liu,1 Wen Song,1 Jun Yan,1 Shan Gao,3 Lingzhou Zhao,2 Yumei Zhang1 1Department of Prosthetic Dentistry, 2Department of Periodontology and Oral Medicine, School of Stomatology, The Fourth Military Medical University, Xi’an, People’s Republic of China; 3The Interdisciplinary Nanoscience Center and Department of Molecular Biology and Genetics, Aarhus University, Aarhus C, Denmark; School of Stomatology, Tianjin Medical University, Tianjin, People’s Republic of China*Both authors contributed equally to this workAbstract: MicroRNA (miRNA regulation is a novel approach to manipulating the fate of mesenchymal stem cells, but an easy, safe, and highly efficient method of transfection is required. In this study, we developed an miRNA reverse transfection formulation by lyophilizing Lipofectamine 2000-miRNA lipoplexes on a tissue culture plate. The lipoplexes can be immobilized on a tissue culture plate with an intact pseudospherical structure and lyophilization without any lyoprotectant. In this study, reverse transfection resulted in highly efficient cellular uptake of miRNA and enabled significant manipulation of the intracellular target miRNA level. Reverse transfection formulations containing Lipofectamine 2000 1 µL per well generated much higher transfection efficiency without obvious cytotoxicity compared with conventional and other transfection methods. Further, the transfection efficiency of the reverse transfection formulations did not deteriorate during 90 days of storage at 4°C and -20°C. We then assessed the efficiency of the miRNA reverse transfection formulation in promoting osteogenic differentiation of mesenchymal stem cells. We found that transfection with anti-miR-138 and miR-148b was efficient for enhancing osteogenic differentiation, as indicated by enhanced osteogenesis-related gene expression, amount of alkaline phosphatase present, production of collagen, and matrix mineralization. Overall

  5. Tissue engineering approaches to develop decellularized tendon matrices functionalized with progenitor cells cultured under undifferentiated and tenogenic conditions

    Directory of Open Access Journals (Sweden)

    Daniele D’Arrigo


    Full Text Available Tendon ruptures and retractions with an extensive tissue loss represent a major clinical problem and a great challenge in surgical reconstruction. Traditional approaches consist in autologous or allogeneic grafts, which still have some drawbacks. Hence, tissue engineering strategies aimed at developing functionalized tendon grafts. In this context, the use of xenogeneic tissues represents a promising perspective to obtain decellularized tendon grafts. This study is focused on the identification of suitable culture conditions for the generation of reseeded and functional decellularized constructs to be used as tendon grafts. Equine superficial digital flexor tendons were decellularized, reseeded with mesenchymal stem cells (MSCs from bone marrow and statically cultured in two different culture media to maintain undifferentiated cells (U-MSCs or to induce a terminal tenogenic differentiation (T-MSCs for 24 hours, 7 and 14 days. Cell viability, proliferation, morphology as well as matrix deposition and type I and III collagen production were assessed by means of histological, immunohistochemical and semi-quantitative analyses. Results showed that cell viability was not affected by any culture conditions and active proliferation was maintained 14 days after reseeding. However, seeded MSCs were not able to penetrate within the dense matrix of the decellularized tendons. Nevertheless, U-MSCs synthesized a greater amount of extracellular matrix rich in type I collagen compared to T-MSCs. In spite of the inability to deeply colonize the decellularized matrix in vitro, reseeding tendon matrices with U-MSCs could represent a suitable method for the functionalization of biological constructs, considering also any potential chemoattractant capability of the newly deposed extracellular matrix to recruit resident cells. This bioengineering approach can be exploited to produce functionalized tendon constructs for the substitution of large tendon defects.

  6. Organotypic three-dimensional culture model of mesenchymal and epithelial cells to examine tissue fusion events. (United States)

    Tissue fusion during early mammalian development requires coordination of multiple cell types, the extracellular matrix, and complex signaling pathways. Fusion events during processes including heart development, neural tube closure, and palatal fusion are dependent on signaling ...

  7. Towards modular bone tissue engineering using Ti-Co-doped phosphate glass microspheres: cytocompatibility and dynamic culture studies. (United States)

    Peticone, Carlotta; De Silva Thompson, David; Owens, Gareth J; Kim, Hae-Won; Micheletti, Martina; Knowles, Jonathan C; Wall, Ivan


    The production of large quantities of functional vascularized bone tissue ex vivo still represent an unmet clinical challenge. Microcarriers offer a potential solution to scalable manufacture of bone tissue due to their high surface area-to-volume ratio and the capacity to be assembled using a modular approach. Microcarriers made of phosphate bioactive glass doped with titanium dioxide have been previously shown to enhance proliferation of osteoblast progenitors and maturation towards functional osteoblasts. Furthemore, doping with cobalt appears to mimic hypoxic conditions that have a key role in promoting angiogenesis. This characteristic could be exploited to meet the clinical requirement of producing vascularized units of bone tissue. In the current study, the human osteosarcoma cell line MG-63 was cultured on phosphate glass microspheres doped with 5% mol titanium dioxide and different concentrations of cobalt oxide (0%, 2% and 5% mol), under static and dynamic conditions (150 and 300 rpm on an orbital shaker). Cell proliferation and the formation of aggregates of cells and microspheres were observed over a period of two weeks in all glass compositions, thus confirming the biocompatibility of the substrate and the suitability of this system for the formation of compact micro-units of tissue. At the concentrations tested, cobalt was not found to be cytotoxic and did not alter cell metabolism. On the other hand, the dynamic environment played a key role, with moderate agitation having a positive effect on cell proliferation while higher agitation resulting in impaired cell growth. Finally, in static culture assays, the capacity of cobalt doping to induce vascular endothelial growth factor (VEGF) upregulation by osteoblastic cells was observed, but was not found to increase linearly with cobalt oxide content. In conclusion, Ti-Co phosphate glasses were found to support osteoblastic cell growth and aggregate formation that is a necessary precursor to tissue

  8. Advanced cell culture technology for generation of in vivo-like tissue models


    Przyborski, Stefan


    Human tissues are mostly composed of different cell types, that are often highly organised in relation to each other. Often cells are arranged in distinct layers that enable signalling and cell-to-cell interactions. Here we describe the application of scaffold-based technology, that can be used to create advanced organotypic 3D models of various tissue types that more closely resemble in vivo-like conditions (Knight et al., 2011). The scaffold comprises a highly porous polystyrene material, e...

  9. Cytokeratin expression of engrafted three-dimensional culture tissues using epithelial cells derived from porcine periodontal ligaments. (United States)

    Yamada, Rie; Kitajima, Kayoko; Arai, Kyoko; Igarashi, Masaru


    This study investigated the differentiation and proliferation of epithelial cells derived from periodontal ligaments after three-dimensional culture using collagen gel with fibroblasts in vitro and in vivo. Epithelial cells and fibroblasts were derived from porcine periodontal ligaments. Epithelial cells were labeled using a fluorescent red membrane marker (PKH-26GL) and were seeded onto collagen gel with fibroblasts, followed by incubation in an air-liquid interface for 7 days. Three-dimensional cultures were grafted onto the backs of nude mice and removed at 1, 7, and 14 days after surgery (in vivo model). Unfixed sections (5 μm) were used to detect the presence of red fluorescent cells. Paraffin sections were analyzed histologically and immunohistochemically. Specimens were compared with three-dimensional culture tissues at 8, 14 and 21 days (in vitro model). Grafted three-dimensional cultures formed a stratified epithelial structure similar to skin in vivo. Epithelial cells were sequenced in basal-layer-like structures at 14 days in vivo. Immunohistochemical findings showed that the expression of cytokeratin was detected in the epithelial layer in in vitro and in vivo models. Ck8 + 18 + 19 was expressed in the upper epithelial layer in the in vitro model at 14 and 21 days, but not in vivo. Involucrin was expressed in the certified layers in vitro at 14 days, but not in vivo. Laminin was detected at the dermo-epidermal junction in vivo at 7 and 14 days, but not in vitro. These results suggest that differentiation of three-dimensional culture tissues differs in vivo and in vitro. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Technical and theoretical considerations about gradient perfusion culture for epithelia used in tissue engineering, biomaterial testing and pharmaceutical research

    Energy Technology Data Exchange (ETDEWEB)

    Minuth, Will W [Department of Molecular and Cellular Anatomy, University of Regensburg, D-93053 Regensburg, University Street 31 (Germany); Strehl, Raimund [Cellartis AB, S-41346 Goeteborg, Arvid Wallgrens Backe 20 (Sweden)


    Epithelia act as biological barriers, which are exposed to different environments at the luminal and basal sides. To simulate this situation and to improve functional features an in vitro gradient perfusion culture technique was developed in our laboratory. This innovative technique appears to be simple at first sight, but the performance needs practical and theoretical knowledge. To harvest intact epithelia after a long-term gradient culture period of many days, leakage, edge damage and pressure differences in the system have to be avoided so that the epithelial barrier function is maintained continuously. Unexpectedly, one of the major obstacles are micro-injuries in the epithelia caused by gas bubbles, which arise during transportation of the medium or due to respiration of the cultured tissue. Gas bubbles randomly accumulate either at the luminal or basal fluid flow of the gradient perfusion culture container. This phenomenon results in fluid pressure differences between the luminal and basal perfusion compartments of the gradient container, which in turn leads to damage of the barrier function. Consequently, the content of gas bubbles in the transported culture medium has to be minimized. Thus, our technical concept is the reduction of gas bubbles while keeping the content of oxygen constant. To follow this strategy we developed a new type of screw cap for media bottles specifically designed to allow fluid contact only with tube and not with cap material. Furthermore, a gas expander module separates gas bubbles from the liquid phase during transportation of the medium. Finally, a new type of gradient culture container allows a permanent elimination of transported gas bubbles. Application of this innovative equipment optimizes the parallel transportation of fluid in the luminal and basal compartments of a gradient culture container. (topical review)

  11. Technical and theoretical considerations about gradient perfusion culture for epithelia used in tissue engineering, biomaterial testing and pharmaceutical research

    International Nuclear Information System (INIS)

    Minuth, Will W; Strehl, Raimund


    Epithelia act as biological barriers, which are exposed to different environments at the luminal and basal sides. To simulate this situation and to improve functional features an in vitro gradient perfusion culture technique was developed in our laboratory. This innovative technique appears to be simple at first sight, but the performance needs practical and theoretical knowledge. To harvest intact epithelia after a long-term gradient culture period of many days, leakage, edge damage and pressure differences in the system have to be avoided so that the epithelial barrier function is maintained continuously. Unexpectedly, one of the major obstacles are micro-injuries in the epithelia caused by gas bubbles, which arise during transportation of the medium or due to respiration of the cultured tissue. Gas bubbles randomly accumulate either at the luminal or basal fluid flow of the gradient perfusion culture container. This phenomenon results in fluid pressure differences between the luminal and basal perfusion compartments of the gradient container, which in turn leads to damage of the barrier function. Consequently, the content of gas bubbles in the transported culture medium has to be minimized. Thus, our technical concept is the reduction of gas bubbles while keeping the content of oxygen constant. To follow this strategy we developed a new type of screw cap for media bottles specifically designed to allow fluid contact only with tube and not with cap material. Furthermore, a gas expander module separates gas bubbles from the liquid phase during transportation of the medium. Finally, a new type of gradient culture container allows a permanent elimination of transported gas bubbles. Application of this innovative equipment optimizes the parallel transportation of fluid in the luminal and basal compartments of a gradient culture container. (topical review)

  12. The use of plant tissue culture system in the mutagenesis of Secale cereale L

    International Nuclear Information System (INIS)

    Rybczynski, J.J.; KozIowska, W.; Turzynski, D.


    Full text: Among cereals, Secale cereale L. is the worst species for 'in vitro' mutagenesis. In the case of seed mutagenesis of rye each seed is expected to be a different genotype and only somatic embryogenesis assures propagation towards numerous individuals possessing the same genotype. Therefore, another system of in-vitro mutagenesis is explored. Immature embryos were isolated from spikes of field growing plants. The established cultures were irradiated with 0.5; 1.0 and 1.5 kR gamma rays on the first day of the culture and after 6 weeks in culture. After irradiation all cultures were subcultured. For mutagenesis in general uniformity of the original material is very important. Therefore, in rye, irradiation of regenerated somatic embryos may be a good approach. (author)

  13. Effect of gamma-radiation on callus initiation and oraganogenesis in the tissue culture of Nicotiana tabaccum L

    International Nuclear Information System (INIS)

    Shin, S. H.; Kim, J. G.; Song, H. S.


    It is generally agreed that ionizing radiations stimulate cell division, growth and development in various organisms including animals and plants. Differentiating tissues are the most sensitive to radiation. The present experiment was carried out to investigate the effects of ionizing radiation on callus initiation and organogenesis from the stem in the culture of Nicotiana tabaccum L. cv. When the stem segments were cultured on a Murashige and Skoog (MS) medium with 2 mg/L kinetin, with 1 mg/L 2,4-Dichlorophenoxyacetic acid (2,4-D), with 2 mg/L kinetin and 1 mg/L 2,4-D, the shoots and callus were differentiated 14 days after cultivation. Callus was especially formed on the MS medium with 2,4-D and/or kinetin and the formation was promoted by 1 Gy and 5 Gy of gamma radiation. The formation of the shoot clusters on the MS medium with 2 mg/L kinetin were prominent in the 5 Gy-irradiated groups. It is concluded that that gamma radiation enhanced the callus initiation and organogenesis in the tissue culture of Nicotiana tabaccum L

  14. Tissue non-specific alkaline phosphatase production by human dental pulp stromal cells is enhanced by high density cell culture. (United States)

    Tomlinson, Matthew J; Dennis, Caitriona; Yang, Xuebin B; Kirkham, Jennifer


    The cell surface hydrolase tissue non-specific alkaline phosphatase (TNAP) (also known as MSCA-1) is used to identify a sub-population of bone marrow stromal cells (BMSCs) with high mineralising potential and is found on subsets of cells within the dental pulp. We aim to determine whether TNAP is co-expressed by human dental pulp stromal cells (hDPSCs) alongside a range of BMSC markers, whether this is an active form of the enzyme and the effects of culture duration and cell density on its expression. Cells from primary dental pulp and culture expanded hDPSCs expressed TNAP. Subsequent analyses revealed persistent TNAP expression and co-expression with BMSC markers such as CD73 and CD90. Flow cytometry and biochemical assays showed that increased culture durations and cell densities enhanced TNAP expression by hDPSCs. Arresting the hDPSC cell cycle also increased TNAP expression. These data confirm that TNAP is co-expressed by hDPSCs together with other BMSC markers and show that cell density affects TNAP expression levels. We conclude that TNAP is a potentially useful marker for hDPSC selection especially for uses in mineralised tissue regenerative therapies.

  15. Correlation of clinical data with fallopian tube specimen immune cells and tissue culture capacity. (United States)

    Ramraj, Satish Kumar; Smith, Katie M; Janakiram, Naveena B; Toal, Coralee; Raman, Ankita; Benbrook, Doris Mangiaracina


    Human fallopian tube fimbria secretory epithelial cells (hFTSECs) are considered an origin of ovarian cancer and methods for their culture from fallopian tube specimens have been reported. Our objective was to determine whether characteristics of the donors or surgeries were associated with the capacities of fimbria specimens to generate hFTSEC cultures or their immune profiles. There were no surgical complications attributable to fallopian tube removal. Attempts to establish primary hFTSEC cultures were successful in 37 of 55 specimens (67%). Success rates did not differ significantly between specimens grouped by patient or surgery characteristics. Established cultures could be revived after cryopreservation and none became contaminated with microorganisms. Two cultures evaluated for long term growth senesced between passages 10 and 15. M1 macrophages were the predominant cell type, while all other immune cells were present at much lower percentages. IL-10 and TGF-β exhibited opposing trends with M1 and M2 macrophages. Plasma IL-10 levels exhibited significant positive correlation with patient age. In conclusion, fallopian tube fimbria specimens exhibit a pro-inflammatory phenotype and can be used to provide a source of hFTSECs that can be cultured for a limited time regardless of the donor patient age or race, or the type of surgery performed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Aplicações da cultura de tecidos em plantas medicinais Applications of tissue culture in medicinal plants

    Directory of Open Access Journals (Sweden)

    T.P. Morais


    Full Text Available Esta revisão tem por objetivo levantar dados de literatura sobre o histórico e a situação atual das técnicas de cultura de tecidos em plantas medicinais. Para tanto, foi realizada uma revisão de publicações do período de 1976 a 2009. A cultura de tecidos é muito utilizada em pesquisas envolvendo plantas medicinais, com destaque para a técnica de micropropagação. A aplicação das técnicas de cultura de tecidos em plantas medicinais tem como perspectivas a obtenção de germoplasma competitivo e adaptado a diversos métodos de cultivo, escolha de novas espécies que servirão como fonte de compostos biologicamente ativos e aprimoramento da produção de fitofármacos, a fim de assegurar exploração sustentável destas espécies.The aim of this literature review is to conduct a survey concerning the history and current situation of tissue culture techniques in medicinal plants. Therefore, a review was done considering the period from 1976 to 2009. Tissue culture is widely applied in medicinal plants researches, especially micropropagation. The perspectives of tissue culture techniques in medicinal plants are related to the development of competitive germoplasm adapted to diverse methods of cultivation, the election of new species that will serve as source of biological active composts, and the improvement of phytochemicals production, in order to assure sustainable exploration of these species.

  17. Regeneration and acclimatization of salt-tolerant arachis hypogaea plants through tissue culture

    International Nuclear Information System (INIS)

    Ghauri, E.G.


    Excised embryos of Arachis hypogaea were cultured on Murashige and Skoog's medium (MS medium) supplemented with different combinations of growth hormones. The highest frequency of callus proliferation (80%) was recorded on MS medium mixed with 1.0 mg/1 of 2,4-D and 0.5 mg/1 of BAP. These cultures were treated with 0.65 mg/l of trans-4-hydroxy-L-proline (HyP) a:1d various concentrations (0.1-0.5%) of NaCl. In all cases the presence of salt reduced the fresh mass of callus. Shoot regeneration in the cultures took place when transferred to MS medium supplemented with 1.0 mg/1 of kinetin (Kin) and 0.5 mg/1 of 6-benzyl aminopurine (BAP). Percentage of shoot regeneration decreased with the increase of NaCl (0.1- 0.5%) in the shoot regeneration medium. Root formation in these cultures took place when the cultures were nurtured on MS medium free of growth hormones. Regeneration, hardening and acclimatization of the salt tolerant plants was conducted. (author)

  18. Use of gel zymography to examine matrix metalloproteinase (gelatinase) expression in brain tissue or in primary glial cultures. (United States)

    Frankowski, Harald; Gu, Yu-Huan; Heo, Ji Hoe; Milner, Richard; Del Zoppo, Gregory J


    Glia synthesize, package, and secrete several species of matrix proteases, including the gelatinases (pro-)MMP-2 and (pro-)MMP-9. In appropriate settings (e.g., experimental ischemia), these MMPs can be assayed from cerebral tissues or from astrocytes and microglia in culture by enzymatic substrate-dependent assays and by gelatin-based zymography. We describe the methodologies for the sensitive quantitative development of the inactive and active forms of both MMP-2 and MMP-9 from tissues and cells, by means of lysis of the collagen substrate in collagen-impregnated gel electropheresis by the zymogen and active gelatinases. These methodologies are a refinement of those used commonly, with instructions to increase sensitivity. Serious and often overlooked issues regarding sources of sample contamination and elements confounding the MMP band development and their interpretation are discussed.

  19. Negative-ion beam surface modification of tissue-culture polystyrene dishes for changing hydrophilic and cell-attachment properties

    International Nuclear Information System (INIS)

    Tsuji, H.; Satoh, H.; Ikeda, S.; Ikemura, S.; Gotoh, Y.; Ishikawa, J.


    Negative-silver-ion implantation into tissue-culture polystyrene (TCPS) dishes was investigated and it was found to modify hydrophilic and cell attachment properties of the dishes. Negative-ion implantation has an advantage of being almost free of surface charging, and is a suitable method for implantation into insulators such as polymers. Negative silver ions are used due to the antibacterial property of silver. Ag-implanted TCPS dishes had a contact angle larger than the normal value of 66 deg. of unimplanted dishes. The contact angle of water had a strong dependence on the ion energy rather than the dose. As a cell-culture experiment, human umbilical vascular endothelial cell (HUVEC) was used in unimplanted and Ag-implanted TCPS dishes, the implantation removed the cell-attachment property of the surface. In implantation with a mask with a striped pattern, most attached cells of HUVEC were in the unimplanted region aligned along a stripe direction

  20. A multifunctional 3D co-culture system for studies of mammary tissue morphogenesis and stem cell biology.

    Directory of Open Access Journals (Sweden)

    Jonathan J Campbell

    Full Text Available Studies on the stem cell niche and the efficacy of cancer therapeutics require complex multicellular structures and interactions between different cell types and extracellular matrix (ECM in three dimensional (3D space. We have engineered a 3D in vitro model of mammary gland that encompasses a defined, porous collagen/hyaluronic acid (HA scaffold forming a physiologically relevant foundation for epithelial and adipocyte co-culture. Polarized ductal and acinar structures form within this scaffold recapitulating normal tissue morphology in the absence of reconstituted basement membrane (rBM hydrogel. Furthermore, organoid developmental outcome can be controlled by the ratio of collagen to HA, with a higher HA concentration favouring acinar morphological development. Importantly, this culture system recapitulates the stem cell niche as primary mammary stem cells form complex organoids, emphasising the utility of this approach for developmental and tumorigenic studies using genetically altered animals or human biopsy material, and for screening cancer therapeutics for personalised medicine.

  1. Influence of Cryopreservation Solution on the In Vitro Culture of Skin Tissues Derived from Collared Peccary (Pecari tajacu Linnaeus, 1758). (United States)

    Borges, Alana A; Lira, Gabriela P O; Nascimento, Lucas E; Queiroz Neta, Luiza B; Santos, Maria V O; Oliveira, Moacir F; Silva, Alexandre R; Pereira, Alexsandra F


    Skin vitrification is a promising and alternative tool for the conservation of biodiversity, especially for wild mammals, such as collared peccaries. Several factors can affect the success of this procedure, such as the cryoprotectant solution used. Therefore, this study was carried out to compare the efficiency of various vitrification solutions for recovery of viable cells after in vitro culture of cryopreserved skin tissues derived from the collared peccary, aiming to study the application in biobanking, where cellular use is not immediately required. Then, Dulbecco's modified Eagle's medium (DMEM) composed of 2.2 g/L sodium bicarbonate and 10% fetal bovine serum (FBS) was supplemented with 3.0 M ethylene glycol (EG) or 3.0 M dimethyl sulfoxide (DMSO) or 1.5 M EG plus 1.5 M DMSO with or without sucrose (SUC; 0.25 M) to produce six solutions for solid-surface vitrification. After warming, skin tissues were cultured in vitro and recovered cells were analyzed for morphology, adhesion, subconfluence, and proliferative activity for developing the growth curve and determining the population doubling time (PDT), and viability by Trypan Blue. The vitrification did not alter the ability of the tissues to adhere to the culture dish, as well as the day of all explants with cell growth, subconfluence samples, subconfluence total time, and PDT (p > 0.05). Moreover, independent of the cryoprotectant solution used, the vitrification altered the day of all attached explants (p  0.05). Additionally, for viability after the third passage, only the EG-SUC group maintained the cell quality (88.3%), when compared with the nonvitrified (97.8%, p > 0.05). In conclusion, DMEM with 10% FBS, 3.0 M EG, and 0.25 M sucrose was the most efficient solution for vitrifying collared peccary skin tissues, leading to the in vitro culture of viable cells.

  2. Formation of proteoglycan and collagen-rich scaffold-free stiff cartilaginous tissue using two-step culture methods with combinations of growth factors. (United States)

    Miyazaki, Tatsuya; Miyauchi, Satoshi; Matsuzaka, Satoshi; Yamagishi, Chie; Kobayashi, Kohei


    Tissue-engineered cartilage may be expected to serve as an alternative to autologous chondrocyte transplantation treatment. Several methods for producing cartilaginous tissue have been reported. In this study, we describe the production of scaffold-free stiff cartilaginous tissue of pig and human, using allogeneic serum and growth factors. The tissue was formed in a mold using chondrocytes recovered from alginate bead culture and maintained in a medium with transforming growth factor-beta and several other additives. In the case of porcine tissue, the tear strength of the tissue and the contents of proteoglycan (PG) and collagen per unit of DNA increased dose-dependently with transforming growth factor-beta. The length of culture was significantly and positively correlated with thickness, tear strength, and PG and collagen contents. Tear strength showed positive high correlations with both PG and collagen contents. A positive correlation was also seen between PG content and collagen content. Similar results were obtained with human cartilaginous tissue formed from chondrocytes expanded in monolayer culture. Further, an in vivo pilot study using pig articular cartilage defect model demonstrated that the cartilaginous tissue was well integrated with surrounding tissue at 13 weeks after the implantation. In conclusion, we successfully produced implantable scaffold-free stiff cartilaginous tissue, which characterized high PG and collagen contents.

  3. Effects of estradiol and medroxyprogesterone acetate on morphology, proliferation and apoptosis of human breast tissue in organ cultures

    International Nuclear Information System (INIS)

    Eigėlienė, Natalija; Härkönen, Pirkko; Erkkola, Risto


    Human breast tissue undergoes phases of proliferation, differentiation and regression regulated by changes of the levels of circulating sex hormones during the menstrual cycle or aging. Ovarian hormones also likely play a key role in the etiology and biology of breast cancer. Reports concerning the proliferative effects of steroid hormones on the normal epithelium of human breast have been conflicting. Some studies have shown that steroid hormones may predispose breast epithelial cells to malignant changes by stimulating their proliferation, which is known to be regulated tightly by stromal cells. The aim of this study was to investigate the effects of 17β-estradiol and medroxyprogesterone acetate on proliferation, apoptosis, expression of differentiation markers and steroid hormone receptors in breast epithelium using an in vitro model of freshly isolated human breast tissue, in which a proper interaction of breast epithelium and stroma has been maintained. Human breast tissues were obtained from women undergoing surgery for breast tumours. Peritumoral tissues were excised and explants were cultured for 3 weeks in medium supplemented with E 2 or MPA or with E 2 +MPA. Endpoints included histopathological, histomorphometric and immunohistochemical assessment of the breast explants. Culture of breast explants for 14 or 21 days with steroid hormones increased proliferative activity and the thickness of acinar and ductal epithelium. E 2 -treatment led to hyperplastic epithelial morphology, MPA to hypersecretory single-layered epithelium and E 2 +MPA to multilayered but organised epithelium. The proliferative response to E 2 in comparison to control (p < 0.001) was more pronounced than to MPA (p < 0.05) or E 2 +MPA (p < 0.05) at 7 and 14 days for Ki-67 and PCNA. E 2 treatment also decreased the proportion of apoptotic cells after 7 (p < 0.01) and 14 (p < 0.01) days. In addition, the relative number of ERα, ERβ and PR positive epithelial cells was decreased by all

  4. Factors Influencing the Tissue Culture and the Agrobacterium tumefaciens-Mediated Transformation of Hybrid Aspen and Poplar Clones. (United States)

    De Block, M


    Tissue culture conditions and transformation have been established for both aspen and poplar. The use of previously described culture conditions resulted in shoot tip necrosis in the shoot cultures and necrosis of stem and leaf explants. Shoot tip necrosis could be overcome by buffering the medium with 2-(N-morpholino)ethanesulfonic acid and Ca-gluconate and by growing the shoots below 25 degrees C. Necrosis of the explants was probably due to an accumulation of ammonium in the explants and could be overcome by adapting the NO(3) (-)/NH(4) (+) ratio of the media. Stem explants of established shoot cultures of the aspen hybrid Populus alba x P. tremula and of the poplar hybrid Populus trichocarpa x P. deltoides were cocultivated with Agrobacterium strains having chimeric bar and neo genes on their disarmed tDNAs. Transformed aspen shoots were obtained from 30 to 40% of the explants, while transformed poplar shoots were obtained from 10% of the explants. Extracts from the transformed trees contained high phosphinotricin acetyltransferase and neomycin phosphotransferase activities, and the trees contained one to three copies of the chimeric genes. The transformed trees were completely resistant to the commercial preparations of the herbicide phosphinotricin (glufosinate), while control trees were not.

  5. Inhibition of collagen production in scleroderma fibroblast cultures by a connective tissue glycoprotein extracted from normal dermis

    International Nuclear Information System (INIS)

    Maquart, F.X.; Bellon, G.; Cornillet-Stoupy, J.; Randoux, A.; Triller, R.; Kalis, B.; Borel, J.P.


    It was shown in a previous paper that a connective tissue glycoprotein (CTGP) extracted from normal rabbit dermis was able to inhibit total protein and collagen syntheses by normal dermis fibroblast cultures. In the present study, the effects of CTGP on scleroderma fibroblasts were investigated. [ 14 C]Proline incorporation into total proteins of the supernatant was not significantly different from that found in controls. By contrast, the amount of collagen, expressed as percentage of total secreted protein, was far higher in scleroderma cultures than in normal ones (14.4% +/- 6.0% vs 4.6% +/- 0.9%). Addition of CTGP to the medium induced a concentration-dependent inhibition of [ 14 C]proline incorporation into proteins from both control and scleroderma cells. In control cultures, no significant decrease of the percentage of collagen was observed, but over 60 micrograms/ml, both cytotoxic effects and inhibition of protein synthesis occurred. In scleroderma cultures, the inhibition was twice as effective on collagen as on noncollagen protein synthesis. The inhibition of collagen secretion was not related either to changes in collagen hydroxylation or to the intracellular catabolism of newly synthesized procollagen

  6. Biochemical markers of embryogenesis in tissue cultures of the maize inbred B73

    International Nuclear Information System (INIS)

    Everett, N.P.; Wach, M.J.; Ashworth, D.J.


    Stable embryogenic, organogenic and undifferentiated cell lines of the maize (Zea mays L.) inbred B73 were used to assess the value of using isozyme analyses and the composition of secreted polysaccharides to identify embryogenic cells. Esterase, glutamate dehydrogenase, alcohol dehydrogenase and β-glucosidase all possessed developmentally regulated isozymes but only esterase and glutamate dehydrogenase could be used to distinguish between embryogenic and shoot-forming cultures. Embryogenic callus and suspension cultures secreted a mucilagenous polysaccharide whose production was stimulated by 2, 4-dichlorophenozyacetic acid (2, 4-D). The polysaccharide was different from root slime and corn hull gum and may be related to the 'cementing layer' in maize kernels (author)

  7. Fractional factorial design for optimization of the SELDI protocol for human adipose tissue culture media

    NARCIS (Netherlands)

    Szalowska, Ewa; van Hijum, Sacha A. F. T.; Roelofsen, Han; Hoek, Annemiek; Vonk, Roel J.; Meerman, Gerard J. te


    The early factors inducing insulin resistance are not known. Therefore, we are interested in studying the secretome of the human visceral adipose tissue as a potential source of unknown peptides and proteins inducing insulin resistance. Surface-enhanced laser desorption/ionization time-of-flight

  8. Coculture strategies in bone tissue engineering: the impact of culture conditions on pluripotent stem cell populations. (United States)

    Janardhanan, Sathyanarayana; Wang, Martha O; Fisher, John P


    The use of pluripotent stem cell populations for bone tissue regeneration provides many opportunities and challenges within the bone tissue engineering field. For example, coculture strategies have been utilized to mimic embryological development of bone tissue, and particularly the critical intercellular signaling pathways. While research in bone biology over the last 20 years has expanded our understanding of these intercellular signaling pathways, we still do not fully understand the impact of the system's physical characteristics (orientation, geometry, and morphology). This review of coculture literature delineates the various forms of coculture systems and their respective outcomes when applied to bone tissue engineering. To understand fully the key differences between the different coculture methods, we must appreciate the underlying paradigms of physiological interactions. Recent advances have enabled us to extrapolate these techniques to larger dimensions and higher geometric resolutions. Finally, the contributions of bioreactors, micropatterned biomaterials, and biomaterial interaction platforms are evaluated to give a sense of the sophistication established by a combination of these concepts with coculture systems.

  9. Characterisation of a bystander effect induced in human tissue explant cultures by low LET radiation

    International Nuclear Information System (INIS)

    Motersill, C.; O'Malley, K.; Seymour, C.B.


    The existence of a bystander effect following both alpha and gamma irradiation of many cell lines is not now in dispute. The significance of this effect for cancer risk assessment and radiotherapy treatment planning requires demonstration of its relevance in vivo. The problem in demonstrating the existence of the effect in vivo is that other systemic effects may mask or confound the effect being investigated and it is practically impossible to attribute an effect in a particular cell to a signal produced in another irradiated cell. To approach this problem, an assay has been developed where fragments of human tissue can be irradiated ex vivo and the media harvested and added to unirradiated, clonogenic cells which have a well characterised and stable response to the bystander signal. The variation in the production of a signal from patient to patient can thus be assessed. The results of a study using tissue from over 100 patients attending Beaumont and St Vincent's Hospitals in Dublin for investigation of urological disorders including follow-up after treatment for transitional cell carcinoma (TCC) and resection of suspect prostatic lesions, are now available. Blood samples from the prostate group were also obtained. The results show that there is variation in the effect of the signal produced by irradiated tissue from different patients. This holds for bladder, prostate and blood. Gender, smoking status and the existence of a malignancy influence the expression of the signal by normal tissue. Male gender, smoking and a pre-existing malignancy all reduce the amount or effect of the signal produced into medium when the tissue is exposed. The effects of exposure to medium containing the signal are transmitted to distant progeny of the exposed cell population. The results may be important not only for understanding radiation risk mechanisms for protection but also for radiotherapy treatment planning where they may open new avenues for development of drugs for combined

  10. Neural stem cells improve neuronal survival in cultured postmortem brain tissue from aged and Alzheimer patients

    NARCIS (Netherlands)

    Wu, L.; Sluiter, A.A.; Guo, Ho Fu; Balesar, R. A.; Swaab, D. F.; Zhou, Jiang Ning; Verwer, R. W H

    Neurodegenerative diseases are progressive and incurable and are becoming ever more prevalent. To study whether neural stem cell can reactivate or rescue functions of impaired neurons in the human aging and neurodegenerating brain, we co-cultured postmortem slices from Alzheimer patients and control

  11. Analysis of soybean tissue culture protein dynamics using difference gel electrophoresis (United States)

    Excised hypocotyls from developing soybean (Glycine max (L.) merr. cv. Jack) were cultivated on agar-solidified medium until callus formed. The calli were then propagated in liquid medium until stable, relatively uniform, finely-divided suspension cultures were obtained. Cells were typically transfe...

  12. Cortical radial glia: identification in tissue culture and evidence for their transformation to astrocytes. (United States)

    Culican, S M; Baumrind, N L; Yamamoto, M; Pearlman, A L


    Radial glia are transiently present in the developing cerebral cortex, where they are thought to guide the migration of neurons from the proliferative zone to the forming cortical plate. To provide a framework for experimental studies of radial glia, we have defined morphological and immunocytochemical criteria to identify them in primary cultures of cortical cells obtained at embryonic day 13 in the mouse. Cortical radial glia in culture for 1-2 d resemble radial glia in vivo: they have a long, thin, unbranched process extending from one or both ends of the elongated cell body and are labeled with the monoclonal antibody RC1 but not with antibodies to glial fibrillary acidic protein (abGFAP). We tested the specificity of RC1 by double-labeling with a panel of cell-type specific antibodies, and found that it labels radial glia, astrocytes, and fibroblast-like cells, but not neurons. Fibroblasts are easily distinguished from glia by morphology and by labeling with antibodies to fibronectin. To test the hypothesis that radial glia become astrocytes when their developmental role is complete, we examined their morphological and immunocytochemical development in culture. After 3-4 d in vitro radial glia develop several branched processes; in this transitional stage they are labeled by both RC1 and abGFAP. Many radial glia lose RC1 immunoreactivity as they become increasingly branched and immunoreactive to abGFAP. In areas of the cultures that have few neurons and in cultures depleted of neurons by washing, flat, nonprocess-bearing glia predominate. These cells do not lose immunoreactivity to RC1 during the 9-d period of observation even though they acquire GFAP.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Improving normal tissue complication probability models: the need to adopt a "data-pooling" culture. (United States)

    Deasy, Joseph O; Bentzen, Søren M; Jackson, Andrew; Ten Haken, Randall K; Yorke, Ellen D; Constine, Louis S; Sharma, Ashish; Marks, Lawrence B


    Clinical studies of the dependence of normal tissue response on dose-volume factors are often confusingly inconsistent, as the QUANTEC reviews demonstrate. A key opportunity to accelerate progress is to begin storing high-quality datasets in repositories. Using available technology, multiple repositories could be conveniently queried, without divulging protected health information, to identify relevant sources of data for further analysis. After obtaining institutional approvals, data could then be pooled, greatly enhancing the capability to construct predictive models that are more widely applicable and better powered to accurately identify key predictive factors (whether dosimetric, image-based, clinical, socioeconomic, or biological). Data pooling has already been carried out effectively in a few normal tissue complication probability studies and should become a common strategy. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Effect of x-ray irradiation on maize inbred line B73 tissue cultures and regenerated plants

    International Nuclear Information System (INIS)

    Wang, A.S.; Cheng, D.S.K.; Milcic, J.B.; Yang, T.C.


    In order to enhance variation induced by the tissue culture process and to obtain agronomically desirable mutants, friable embryogenic tissue cultures of maize (Zea mays L.) inbred line B73 were x-ray irradiated with 11 doses [0-8.4 kilorads (kR)]. Reductions in callus growth rate and embryogenic callus formation occurred with increasing x-ray doses 20 d and 3 months after irradiation. Callus irradiated with 0.8 kR showed a significant increase in growth rate and a 20% increase in embryogenic callus 9 months after irradiation. A total of 230 R 0 plants were regenerated for evaluation. Pollen fertility and seed set of R 0 plants decreased with increasing x-ray dosage. Days to anthesis and plant height of R 0 plants varied among x-ray treatments but were generally reduced with higher dosages. The number of chromosomal aberrations increased with x-ray dosage. The R 1 seeds taken from R 0 plants were also grown and tested for mutant segregation. Plants regenerated from irradiated calli had a two- to 10-fold increase in mutations over plants regenerated from unirradiated control callus. Germination frequency of seeds from R 0 plants decreased with increasing x-ray dosage. Although chlorophyll mutants were most frequently observed, a number of vigorous plants with earlier anthesis date were also recovered

  15. Magnesium prevents phosphate-induced vascular calcification via TRPM7 and Pit-1 in an aortic tissue culture model. (United States)

    Sonou, Tomohiro; Ohya, Masaki; Yashiro, Mitsuru; Masumoto, Asuka; Nakashima, Yuri; Ito, Teppei; Mima, Toru; Negi, Shigeo; Kimura-Suda, Hiromi; Shigematsu, Takashi


    Previous clinical and experimental studies have indicated that magnesium may prevent vascular calcification (VC), but mechanistic characterization has not been reported. This study investigated the influence of increasing magnesium concentrations on VC in a rat aortic tissue culture model. Aortic segments from male Sprague-Dawley rats were incubated in serum-supplemented high-phosphate medium for 10 days. The magnesium concentration in this medium was increased to demonstrate its role in preventing VC, which was assessed by imaging and spectroscopy. The mineral composition of the calcification was analyzed using Fourier transform infrared (FTIR) spectroscopic imaging, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) mapping. Magnesium supplementation of high-phosphate medium dose-dependently suppressed VC (quantified as aortic calcium content), and almost ablated it at 2.4 mm magnesium. The FTIR images and SEM-EDX maps indicated that the distribution of phosphate (as hydroxyapatite), phosphorus and Mg corresponded with calcium content in the aortic ring and VC. The inhibitory effect of magnesium supplementation on VC was partially reduced by 2-aminoethoxy-diphenylborate, an inhibitor of TRPM7. Furthermore, phosphate transporter-1 (Pit-1) protein expression was increased in tissues cultured in HP medium and was gradually-and dose dependently-decreased by magnesium. We conclude that a mechanism involving TRPM7 and Pit-1 underpins the magnesium-mediated reversal of high-phosphate-associated VC.

  16. Genetic and anatomical analysis of normal and abnormal flowers of date palm cultivar barhy derived from offshoot and tissue culture

    International Nuclear Information System (INIS)

    Shair, O.H.


    Random Amplified Polymorphic DNA (RAPD) analysis between 6 normal flower producing offshoot derived and 6 abnormal multiple carpel, flower producing tissue culture (TC) derived trees of cultivar (cv.) Barhy, was performed with the objective to check genetic variation if any at DNA level. DNA samples were extracted from pollinated and un-pollinated flowers from both sets of plants. Amplified RAPD products were clearly detected with 30 primers used in this experiment but only 3 gave a few polymorphic bands which shows low level of genetic variation among the offshoot and TC derived plants. Cluster analysis by the unweighted paired group method of arithmetic means (UPGMA) showed close genomic similarity among the 12 DNA samples with the range of 0.486-0.904 Nei and Li's coefficient in the similarity matrix. The average similarity among the 12 DNA samples was more than 50%. Floral abnormalities in TC derived plants were also studied microscopically. Abnormalities like more than three carpel development, abnormal ovule development and deformities of style and stigma were observed. The results show that the composition and the abnormalities of flowers in TC derived plants of cultivar Barhy may be attributed to epigenetic changes that takes place at different stages of tissue culture and not due to major changes at DNA level. (author)

  17. Comparison of multiple assays for detecting human antibodies directed against antigens on normal and malignant tissue culture cells

    International Nuclear Information System (INIS)

    Rosenberg, S.A.; Schwarz, S.; Anding, H.; Hyatt, C.; Williams, G.M.; Johns Hopkins Univ., Baltimore, Md.


    Four separate assays of human antibody reactivity to four separate normal and malignant human tissue culture cells lines from two patients have been evaluated using a single highly-reactive allogeneic serum. The visual end-point cytolysis assay and the chromium-51 release assay were equally sensitive in measuring complement mediated antibody cytotoxicity and both were far more sensitive than a trypan blue dye exclusion assay. The assay of antibody reactivity by hemadsorption technique was about 10 times more sensitive than any of the cytotoxicity assays. This latter assay measures only IgG antibody however. These assays showed that cell lines from different patients may differ greatly in 'reactivity' to an allogeneic serum and emphasized the importance of utilizing tumor and normal cells from the same patient when using tissue culture cells to search for tumor specific reactivity. These observations emphasize the importance of utilizing multiple assays against paired normal and malignant cells from the same patient to be certain of the specificity and magnitude of the measured antibody

  18. Poly(N-isopropylacrylamide) hydrogel/chitosan scaffold hybrid for three-dimensional stem cell culture and cartilage tissue engineering. (United States)

    Mellati, Amir; Kiamahalleh, Meisam Valizadeh; Madani, S Hadi; Dai, Sheng; Bi, Jingxiu; Jin, Bo; Zhang, Hu


    Providing a controllable and definable three-dimensional (3D) microenvironment for chondrogenic differentiation of mesenchymal stem cells (MSCs) remains a great challenge for cartilage tissue engineering. In this work, poly(N-isopropylacrylamide) (PNIPAAm) polymers with the degrees of polymerization of 100 and 400 (NI100 and NI400) were prepared and the polymer solutions were introduced into the preprepared chitosan porous scaffolds (CS) to form hybrids (CSNI100 and CSNI400, respectively). SEM images indicated that the PNIPAAm gel partially occupied chitosan pores while the interconnected porous structure of chitosan was preserved. MSCs were incorporated within the hybrid and cell proliferation and chondrogenic differentiation were monitored. After 7-day incubation of the cell-laden constructs in a growth medium, the cell viability in CSNI100 and CSNI400 were 54 and 108% higher than that in CS alone, respectively. Glycosaminoglycan and total collagen contents increased 2.6- and 2.5-fold after 28-day culture of cell-laden CSNI400 in the chondrogenic medium. These results suggest that the hybrid structure composed of the chitosan porous scaffold and the well-defined PNIPAAm hydrogel, in particular CSNI400, is suitable for 3D stem cell culture and cartilage tissue engineering. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2764-2774, 2016. © 2016 Wiley Periodicals, Inc.

  19. Repair of segmental bone defect using Totally Vitalized tissue engineered bone graft by a combined perfusion seeding and culture system.

    Directory of Open Access Journals (Sweden)

    Lin Wang

    Full Text Available BACKGROUND: The basic strategy to construct tissue engineered bone graft (TEBG is to combine osteoblastic cells with three dimensional (3D scaffold. Based on this strategy, we proposed the "Totally Vitalized TEBG" (TV-TEBG which was characterized by abundant and homogenously distributed cells with enhanced cell proliferation and differentiation and further investigated its biological performance in repairing segmental bone defect. METHODS: In this study, we constructed the TV-TEBG with the combination of customized flow perfusion seeding/culture system and β-tricalcium phosphate (β-TCP scaffold fabricated by Rapid Prototyping (RP technique. We systemically compared three kinds of TEBG constructed by perfusion seeding and perfusion culture (PSPC method, static seeding and perfusion culture (SSPC method, and static seeding and static culture (SSSC method for their in vitro performance and bone defect healing efficacy with a rabbit model. RESULTS: Our study has demonstrated that TEBG constructed by PSPC method exhibited better biological properties with higher daily D-glucose consumption, increased cell proliferation and differentiation, and better cell distribution, indicating the successful construction of TV-TEBG. After implanted into rabbit radius defects for 12 weeks, PSPC group exerted higher X-ray score close to autograft, much greater mechanical property evidenced by the biomechanical testing and significantly higher new bone formation as shown by histological analysis compared with the other two groups, and eventually obtained favorable healing efficacy of the segmental bone defect that was the closest to autograft transplantation. CONCLUSION: This study demonstrated the feasibility of TV-TEBG construction with combination of perfusion seeding, perfusion culture and RP technique which exerted excellent biological properties. The application of TV-TEBG may become a preferred candidate for segmental bone defect repair in orthopedic and

  20. Use of radiation for inducing mutants in potatoes through tissue culture technique

    International Nuclear Information System (INIS)

    Sharabash, M.T.


    Meristem-tips obtained from sprouts of potato tubers, cv. 'Diamant' (Solanum tuberosum) were cultured on MS-medium and multiplied into plantlets through micropropagation. After 2-3 weeks, the micropropagated plantlets had 5-6 nodes each. The plantlets were irradiated with 20 to 40 Gy gamma rays at 27.7 rad/sec. Irradiated plantlets were cut into single nodes and cultured on MS-medium supplemented with 2 g NaCl. Salt resistant plantlets were transferred to MS-liquid medium supplemented with 2g NaCl/l 5.2, and microtubers were collected after 6 weeks. Minitubers were produced under the same level of salinity. (author). 2 tabs

  1. Improvement of tissue culture, genetic transformation, and applications of biotechnology to Brassica. (United States)

    Ravanfar, Seyed Ali; Orbovic, Vladimir; Moradpour, Mahdi; Abdul Aziz, Maheran; Karan, Ratna; Wallace, Simon; Parajuli, Saroj


    Development of in vitro plant regeneration method from Brassica explants via organogenesis and somatic embryogenesis is influenced by many factors such as culture environment, culture medium composition, explant sources, and genotypes which are reviewed in this study. An efficient in vitro regeneration system to allow genetic transformation of Brassica is a crucial tool for improving its economical value. Methods to optimize transformation protocols for the efficient introduction of desirable traits, and a comparative analysis of these methods are also reviewed. Hence, binary vectors, selectable marker genes, minimum inhibitory concentration of selection agents, reporter marker genes, preculture media, Agrobacterium concentration and regeneration ability of putative transformants for improvement of Agrobacterium-mediated transformation of Brassica are discussed.

  2. Somatic embryogenesis and plant regeneration in Carica papaya L. tissue culture derived from root explants. (United States)

    Chen, M H; Wang, P J; Maeda, E


    The regeneration potential of shoot tip, stem, leaf, cotyledon and root explants of two papaya cultivars (Carica papaya cv. 'Solo' and cv. 'Sunrise') were studed. Callus induction of these two cultivars of papaya showed that the shoot tips and stems are most suitable for forming callus, while leaves, cotyledons and roots are comparatively difficult to induce callus. Callus induction also varied with the varities. Somatic embryogenesis was obtained from 3-month-old root cultures. A medium containing half strength of MS inorganic salts, 160 mg/l adenine sulfate, 1.0 mg/1 NAA, 0.5 mg/1 kinetin and 1.0 mg/1 GA3 was optimal for embryogenesis. The callus maintained high regenerative capacity after two years of culture on this medium. Plants derived from somatic embryos were obtained under green-house conditions.

  3. Use of radiation for inducing mutants in potatoes through tissue culture technique

    Energy Technology Data Exchange (ETDEWEB)

    Sharabash, M T [National Centre for Radiation Research and Technology, Cairo (Egypt)


    Meristem-tips obtained from sprouts of potato tubers, cv. `Diamant` (Solanum tuberosum) were cultured on MS-medium and multiplied into plantlets through micropropagation. After 2-3 weeks, the micropropagated plantlets had 5-6 nodes each. The plantlets were irradiated with 20 to 40 Gy gamma rays at 27.7 rad/sec. Irradiated plantlets were cut into single nodes and cultured on MS-medium supplemented with 2 g NaCl. Salt resistant plantlets were transferred to MS-liquid medium supplemented with 2g NaCl/l 5.2, and microtubers were collected after 6 weeks. Minitubers were produced under the same level of salinity. (author). 2 tabs.

  4. Human endothelin subtype A receptor enhancement during tissue culture via de novo transcription

    DEFF Research Database (Denmark)

    Hansen-Schwartz, Jacob; Nordström, Carl-Henrik; Edvinsson, Lars


    OBJECTIVE: Endothelin (ET) has, since its discovery, increasingly been considered a key player in the pathophysiological processes of cerebral vasospasm in the course of subarachnoid hemorrhage, although it remains unclear how ET is involved. We present data that indicate an inherent capacity...... of human cerebral arteries to change their sensitivity to ET. METHODS: Human cerebral arteries were obtained from patients undergoing intracranial tumor surgery. The vessels were divided into segments and subjected to organ culture for 48 hours. The vessels were then examined by using in vitro...... pharmacological methods and molecular biological techniques. RESULTS: After organ culture of the cerebral arteries, both the sensitivity to and potency of ET were enhanced (maximal response, 152 +/- 9%; -log (50% effective concentration), 10.3 +/- 0.3), in comparison with data for fresh cerebral arteries...

  5. Assessment of chromotoxic effect of gamma radiation and different tissue culture media components

    International Nuclear Information System (INIS)

    Chatterjee, J.; Hossain, Z.; Mandal, A.K.A.; Datta, S.K.


    Chromotoxic effect of different in vitro culture medium compositions were studied on aseptically grown root tip cells of Allium cepa and compared with gamma ray treated Allium cepa bulbs. Different types of chromosomal abnormalities were recorded in all medium composition as normally observed in Allium test with other chemicals and mutagens treated experiment. Different chromosomal abnormalities developed due to different medium components and gamma ray treatment are comparable. (author)





    The aim of this research was to establish cocoa (Theobroma cacao) cell suspensions culture to analyze the total polyphenols content for two Colombian cocoa varieties and to compare the results with the total polyphenols content from the same field varieties. The final results showed that it is possible to produce big amount of cocoa cell biomass able to synthesize the metabolites without loosing its organoleptic properties (smell, color, and flavor), and to produce an acceptable content of to...

  7. Seasonal variations in the pattern of RNA metabolism of tuber tissue in response to excision and culture

    International Nuclear Information System (INIS)

    Macleod, A.J.; Mills, E.D.; Yeoman, M.M.


    Between December 1975 and June 1976 explants excised from Jerusalem artichoke tubers were cultured in the presence and in the absence of 2,4-D, the cells in the tissue dividing only in the presence of 2,4-D, in which the length of the first cell cycle increased nonlinearly from 18 hours to 40 hours as the tubers aged in storage at 4 0 C. Simultaneously the amount of RNA in the tissue declined linearly from 8 to 5 μg RNA per explant. Detailed examination of the RNA metabolism in dividing and in non-dividing cells during February and June 1976 revealed superimposed but independent responses to wounding during excision and to stimulation into growth by 2,4-D. The responses to wounding involved only a very low level of metabolic activity, were complete within a few hours of excision and changed very little with the storage of the tubers. Tissue treated with 2,4-D showed a much higher level of metabolic activity including the periodic accumulation of RNA coupled to its discontinuous synthesis. The features of these growth-related responses changed considerably during the investigation. (author)

  8. Effects of FGF-2 on human adipose tissue derived adult stem cells morphology and chondrogenesis enhancement in Transwell culture

    Energy Technology Data Exchange (ETDEWEB)

    Kabiri, Azadeh, E-mail: [Department of Anatomical Sciences and Molecular Biology, Faculty of Medicine, Isfahan University of Medical Sciences (Iran, Islamic Republic of); Esfandiari, Ebrahim, E-mail: [Department of Anatomical Sciences and Molecular Biology, Faculty of Medicine, Isfahan University of Medical Sciences (Iran, Islamic Republic of); Hashemibeni, Batool, E-mail: [Department of Anatomical Sciences and Molecular Biology, Faculty of Medicine, Isfahan University of Medical Sciences (Iran, Islamic Republic of); Kazemi, Mohammad, E-mail: [Department of Anatomical Sciences and Molecular Biology, Faculty of Medicine, Isfahan University of Medical Sciences (Iran, Islamic Republic of); Mardani, Mohammad, E-mail: [Department of Anatomical Sciences and Molecular Biology, Faculty of Medicine, Isfahan University of Medical Sciences (Iran, Islamic Republic of); Esmaeili, Abolghasem, E-mail: [Cell, Molecular and Developmental Biology Division, Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan (Iran, Islamic Republic of)


    Highlights: Black-Right-Pointing-Pointer We investigated effects of FGF-2 on hADSCs. Black-Right-Pointing-Pointer We examine changes in the level of gene expressions of SOX-9, aggrecan and collagen type II and type X. Black-Right-Pointing-Pointer FGF-2 induces chondrogenesis in hADSCs, which Bullet Increasing information will decrease quality if hospital costs are very different. Black-Right-Pointing-Pointer The result of this study may be beneficial in cartilage tissue engineering. -- Abstract: Injured cartilage is difficult to repair due to its poor vascularisation. Cell based therapies may serve as tools to more effectively regenerate defective cartilage. Both adult mesenchymal stem cells (MSCs) and human adipose derived stem cells (hADSCs) are regarded as potential stem cell sources able to generate functional cartilage for cell transplantation. Growth factors, in particular the TGF-b superfamily, influence many processes during cartilage formation, including cell proliferation, extracellular matrix synthesis, maintenance of the differentiated phenotype, and induction of MSCs towards chondrogenesis. In the current study, we investigated the effects of FGF-2 on hADSC morphology and chondrogenesis in Transwell culture. hADSCs were obtained from patients undergoing elective surgery, and then cultured in expansion medium alone or in the presence of FGF-2 (10 ng/ml). mRNA expression levels of SOX-9, aggrecan and collagen type II and type X were quantified by real-time polymerase chain reaction. The morphology, doubling time, trypsinization time and chondrogenesis of hADSCs were also studied. Expression levels of SOX-9, collagen type II, and aggrecan were all significantly increased in hADSCs expanded in presence of FGF-2. Furthermore FGF-2 induced a slender morphology, whereas doubling time and trypsinization time decreased. Our results suggest that FGF-2 induces hADSCs chondrogenesis in Transwell culture, which may be beneficial in cartilage tissue engineering.

  9. Effects of FGF-2 on human adipose tissue derived adult stem cells morphology and chondrogenesis enhancement in Transwell culture

    International Nuclear Information System (INIS)

    Kabiri, Azadeh; Esfandiari, Ebrahim; Hashemibeni, Batool; Kazemi, Mohammad; Mardani, Mohammad; Esmaeili, Abolghasem


    Highlights: ► We investigated effects of FGF-2 on hADSCs. ► We examine changes in the level of gene expressions of SOX-9, aggrecan and collagen type II and type X. ► FGF-2 induces chondrogenesis in hADSCs, which •Increasing information will decrease quality if hospital costs are very different. ► The result of this study may be beneficial in cartilage tissue engineering. -- Abstract: Injured cartilage is difficult to repair due to its poor vascularisation. Cell based therapies may serve as tools to more effectively regenerate defective cartilage. Both adult mesenchymal stem cells (MSCs) and human adipose derived stem cells (hADSCs) are regarded as potential stem cell sources able to generate functional cartilage for cell transplantation. Growth factors, in particular the TGF-b superfamily, influence many processes during cartilage formation, including cell proliferation, extracellular matrix synthesis, maintenance of the differentiated phenotype, and induction of MSCs towards chondrogenesis. In the current study, we investigated the effects of FGF-2 on hADSC morphology and chondrogenesis in Transwell culture. hADSCs were obtained from patients undergoing elective surgery, and then cultured in expansion medium alone or in the presence of FGF-2 (10 ng/ml). mRNA expression levels of SOX-9, aggrecan and collagen type II and type X were quantified by real-time polymerase chain reaction. The morphology, doubling time, trypsinization time and chondrogenesis of hADSCs were also studied. Expression levels of SOX-9, collagen type II, and aggrecan were all significantly increased in hADSCs expanded in presence of FGF-2. Furthermore FGF-2 induced a slender morphology, whereas doubling time and trypsinization time decreased. Our results suggest that FGF-2 induces hADSCs chondrogenesis in Transwell culture, which may be beneficial in cartilage tissue engineering.

  10. Response of different genotypes of wheat, rice and black beans to anther, embryo and other tissue cultures

    International Nuclear Information System (INIS)

    Franco, E.; Amador, D.; Calderon, J.; Alvarez, G.; Alvarado, J.; Ramazzini, H.; Ramos, S.; Acuna, G.; Zuniga, B.


    The objective of the basic studies we have been conducting in our laboratory is to establish callus induction and in vitro plant regeneration protocols starting with several tissues of Guatemalan varieties of wheat (Triticum aesticum L.), rice (Oryza sativa L.) and especially black bean (Phaseolus vulgaris L.) in order to obtain disease resistance, earliness, and dwarf plants. Wheat anthers and immature embryos of varieties Patzun, Comalapa, Chocoyo, and Xequijel cultured in N 6 , Potato II, and MS basal media supplemented with auxin and cytokinin gave the best responses in callus induction and plant regeneration. Anthers and mature embryos of indica rice varieties Precozicta and Virginai, when cultured in MS, B 5 , N 6 , and Potato II basal media with different hormonal combinations gave a good response in callus induction. However, a satisfactory response in plant regeneration was not obtained. With black beans, when hypocotyls and mature embryos of black bean varieties Quinack Che and Parramos were cultured in MS basal medium supplemented with different concentrations of NAA and kinetin, more than 60% callus induction was produced. When Quinack Che calli were transferred to MS basal medium supplemented with 1 mg/l NAA plus 0.5 mg/l BAP, green points of regeneration were visible in these calli. (author). 34 refs, 28 tabs

  11. Optimization of Polymer-ECM Composite Scaffolds for Tissue Engineering: Effect of Cells and Culture Conditions on Polymeric Nanofiber Mats

    Directory of Open Access Journals (Sweden)

    Ritu Goyal


    Full Text Available The design of composite tissue scaffolds containing an extracellular matrix (ECM and synthetic polymer fibers is a new approach to create bioactive scaffolds that can enhance cell function. Currently, studies investigating the effects of ECM-deposition and decellularization on polymer degradation are still lacking, as are data on optimizing the stability of the ECM-containing composite scaffolds during prolonged cell culture. In this study, we develop fibrous scaffolds using three polymer compositions, representing slow (E0000, medium (E0500, and fast (E1000 degrading materials, to investigate the stability, degradation, and mechanics of the scaffolds during ECM deposition and decellularization, and during the complete cellularization-decell-recell cycle. We report data on percent molecular weight (% Mw retention of polymeric fiber mats, changes in scaffold stiffness, ECM deposition, and the presence of fibronectin after decellularization. We concluded that the fast degrading E1000 (Mw retention ≤ 50% after 28 days was not sufficiently stable to allow scaffold handling after 28 days in culture, while the slow degradation of E0000 (Mw retention ≥ 80% in 28 days did not allow deposited ECM to replace the polymer support. The scaffolds made from medium degrading E0500 (Mw retention about 60% at 28 days allowed the gradual replacement of the polymer network with cell-derived ECM while maintaining the polymer network support. Thus, polymers with an intermediate rate of degradation, maintaining good scaffold handling properties after 28 days in culture, seem best suited for creating ECM-polymer composite scaffolds.

  12. Using in situ nanocellulose-coating technology based on dynamic bacterial cultures for upgrading conventional biomedical materials and reinforcing nanocellulose hydrogels. (United States)

    Zhang, Peng; Chen, Lin; Zhang, Qingsong; Jönsson, Leif J; Hong, Feng F


    Bacterial nanocellulose (BNC) is a microbial nanofibrillar hydrogel with many potential applications. Its use is largely restricted by insufficient strength when in a highly swollen state and by inefficient production using static cultivation. In this study, an in situ nanocellulose-coating technology created a fabric-frame reinforced nanocomposite of BNC hydrogel with superior strength but retained BNC native attributes. By using the proposed technology, production time could be reduced from 10 to 3 days to obtain a desirable hydrogel sheet with approximately the same thickness. This novel technology is easier to scale up and is more suitable for industrial-scale manufacture. The mechanical properties (tensile strength, suture retention strength) and gel characteristics (water holding, absorption and wicking ability) of the fabric-reinforced BNC hydrogel were investigated and compared with those of ordinary BNC hydrogel sheets. The results reveal that the fabric-reinforced BNC hydrogel was equivalent with regard to gel characteristics, and exhibited a qualitative improvement with regard to its mechanical properties. For more advanced applications, coating technology via dynamic bacterial cultures could be used to upgrade conventional biomedical fabrics, i.e. medical cotton gauze or other mesh materials, with nanocellulose. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1077-1084, 2016. © 2016 American Institute of Chemical Engineers.

  13. Impact Assessment of Cigarette Smoke Exposure on Organotypic Bronchial Epithelial Tissue Cultures: A Comparison of Mono-Culture and Coculture Model Containing Fibroblasts (United States)

    Iskandar, Anita R.; Xiang, Yang; Frentzel, Stefan; Talikka, Marja; Leroy, Patrice; Kuehn, Diana; Guedj, Emmanuel; Martin, Florian; Mathis, Carole; Ivanov, Nikolai V.; Peitsch, Manuel C.; Hoeng, Julia


    Organotypic 3D cultures of epithelial cells are grown at the air–liquid interface (ALI) and resemble the in vivo counterparts. Although the complexity of in vivo cellular responses could be better manifested in coculture models in which additional cell types such as fibroblasts were incorporated, the presence of another cell type could mask the response of the other. This study reports the impact of whole cigarette smoke (CS) exposure on organotypic mono- and coculture models to evaluate the relevancy of organotypic models for toxicological assessment of aerosols. Two organotypic bronchial models were directly exposed to low and high concentrations of CS of the reference research cigarette 3R4F: monoculture of bronchial epithelial cells without fibroblasts (BR) and coculture with fibroblasts (BRF) models. Adenylate kinase (AK)-based cytotoxicity, cytochrome P450 (CYP) 1A1/1B1 activity, tissue histology, and concentrations of secreted mediators into the basolateral media, as well as transcriptomes were evaluated following the CS exposure. The results demonstrated similar impact of CS on the AK-based cytotoxicity, CYP1A1/1B1 activity, and tissue histology in both models. However, a greater number of secreted mediators was identified in the basolateral media of the monoculture than in the coculture models. Furthermore, annotation analysis and network-based systems biology analysis of the transcriptomic profiles indicated a more prominent cellular stress and tissue damage following CS in the monoculture epithelium model without fibroblasts. Finally, our results indicated that an in vivo smoking-induced xenobiotic metabolism response of bronchial epithelial cells was better reflected from the in vitro CS-exposed coculture model. PMID:26085348

  14. Induction of different activated phenotypes of mouse peritoneal macrophages grown in different tissue culture media. (United States)

    Kawakami, Tomoya; Koike, Atsushi; Amano, Fumio


    The role of activated macrophages in the host defense against pathogens or tumor cells has been investigated extensively. Many researchers have been using various culture media in in vitro experiments using macrophages. We previously reported that J774.1/JA-4 macrophage-like cells showed great differences in their activated macrophage phenotypes, such as production of reactive oxygen, nitric oxide (NO) or cytokines depending on the culture medium used, either F-12 (Ham's F-12 nutrient mixture) or Dulbecco modified Eagle's medium (DMEM). To examine whether a difference in the culture medium would influence the functions of primary macrophages, we used BALB/c mouse peritoneal macrophages in this study. Among the activated macrophage phenotypes, the expression of inducible NO synthase in LPS- and/or IFN-γ-treated peritoneal macrophages showed the most remarkable differences between F-12 and DMEM; i.e., NO production by LPS- and/or IFN-γ-treated cells was far lower in DMEM than in F-12. Similar results were obtained with C57BL mouse peritoneal macrophages. Besides, dilution of F-12 medium with saline resulted in a slight decrease in NO production, whereas that of DMEM with saline resulted in a significant increase, suggesting the possibility that DMEM contained some inhibitory factor(s) for NO production. However, such a difference in NO production was not observed when macrophage-like cell lines were examined. These results suggest that phenotypes of primary macrophages could be changed significantly with respect to host inflammatory responses by the surrounding environment including nutritional factors and that these altered macrophage phenotypes might influence the biological host defense.

  15. Effects of epidermal growth factor on neural crest cells in tissue culture

    International Nuclear Information System (INIS)

    Erickson, C.A.; Turley, E.A.


    Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis

  16. Effect of radiation and other cytotoxic agents on the growth of cells cultured from normal and tumor tissues from the female genital tract

    International Nuclear Information System (INIS)

    Mothersill, C.; Seymour, C.B.; Bonnar, J.


    A technique is presented which allows the response of human gynecological tissue to radiation and cytotoxic drugs to be assessed using a tissue culture explant system. The technique is simple to use and gives results in line with those obtained for human tissues by more complex culture methods. Data are presented showing how the explant technique developed by the group for other tissues can be adapted to yield acceptable results for normal tissue response to radiation. The potential of the technique for use in predictive testing of individual tumor response is then assessed in five cases of gynecological malignancy. It is clear that variations in sensitivity to different radio- and chemotherapy agents and combinations can be detected. The results obtained require clinical validation and it is hoped that this will come over the next few years from evaluation of patient response to treatment using individually optimized, rather than empirical therapy

  17. Studies of mineralization in tissue culture: optimal conditions for cartilage calcification (United States)

    Boskey, A. L.; Stiner, D.; Doty, S. B.; Binderman, I.; Leboy, P.


    The optimal conditions for obtaining a calcified cartilage matrix approximating that which exists in situ were established in a differentiating chick limb bud mesenchymal cell culture system. Using cells from stage 21-24 embryos in a micro-mass culture, at an optimal density of 0.5 million cells/20 microliters spot, the deposition of small crystals of hydroxyapatite on a collagenous matrix and matrix vesicles was detected by day 21 using X-ray diffraction, FT-IR microscopy, and electron microscopy. Optimal media, containing 1.1 mM Ca, 4 mM P, 25 micrograms/ml vitamin C, 0.3 mg/ml glutamine, no Hepes buffer, and 10% fetal bovine serum, produced matrix resembling the calcifying cartilage matrix of fetal chick long bones. Interestingly, higher concentrations of fetal bovine serum had an inhibitory effect on calcification. The cartilage phenotype was confirmed based on the cellular expression of cartilage collagen and proteoglycan mRNAs, the presence of type II and type X collagen, and cartilage type proteoglycan at the light microscopic level, and the presence of chondrocytes and matrix vesicles at the EM level. The system is proposed as a model for evaluating the events in cell mediated cartilage calcification.


    Directory of Open Access Journals (Sweden)

    Riry Prihatini


    Full Text Available Natural exposure of extremely low frequency electromagnetic field (ELF-EMF occurs in the environment and acts as one of the abiotic factors that affect the growth and development of organisms. This study was conducted to determine the effect of ELF-EMF on the tissue cultured banana and slipper orchid chlorophyll content as one of the indicators in measuring plant photosynthetic capacity. Four days old banana (Musa sp. cv. Berangan corm and seven days old slipper orchid (Paphiopedilum rothschildianum cultures were exposed to 6 and 12 mT ELF-EMF generated by controllable ELF-EMF built up machine for 0.5, 1, 2 and 4 hours. After exposure, the banana and orchid cultures were incubated at 25° C for 8 and 16 weeks, respectively. The results showed that the ELF-EMF exposure had different effects on banana and slipper orchid cultures though both plant species belong to monocotyledon. The highest increase in chlorophyll content on banana was resulted by the high intensity and long duration of ELF-EMF exposure (12 mT for 4 hours, whereas on slipper orchid the modest and short duration of ELF-EMF exposure produced the most excessive chlorophyll content. Different ELF-EMF exposures (12 mT for 4 hours and 6 mT for 30 minutes had potential to be applied on each plant to improve in vitro plant (banana and slipper orchid, respectively growth. The increased chlorophyll and carotene/xanthophyll content on banana indicated that the banana was more tolerant to ELF-EMF exposure compared to slipper orchid. 

  19. Radiation-induced organogenesis: effects of irradiated medium and its components on tobacco tissue culture

    International Nuclear Information System (INIS)

    Degani, N.


    Gamma irradiated medium induces the formation of buds in non-irradiated dark growth tobacco callus (Nicotiana tabacum Var. Wisconsin No.38). Experiments were conducted to determine the component(s) of the medium that is effective in this radiation-induced organogenesis. Fraction of medium were irradiated singly and in combination, then combined with non-irradiated fractions to form the complete growth medium. The results showed that irradiated indoleacetic acid (IAA) was not the effective component in the induction of organogensis. Omission of IAA from the medium resulted in the formation of buds, as expected. Irradiated myo-inositol induced organogenesis more consistently than the other irradiated components. The age of the inoculum tissue and its passage number from the tobacco stem affected the potency of the tobacco callus to organise. (author)

  20. Biodegradable Thermogel as Culture Matrix of Bone Marrow Mesenchymal Stem Cells for Potential Cartilage Tissue Engineering

    Institute of Scientific and Technical Information of China (English)

    Yan-bo Zhang; Jian-xun Ding; Wei-guo Xu; Jie Wu; Fei Chang; Xiu-li Zhuang; Xue-si Chen


    Poly(lactide-co-glycolide)-poly(ethylene glycol)-poly(lactide-co-glycolide) (PLGA-PEG-PLGA) triblock copolymer was synthesized through the ring-opening polymerization of LA and GA with PEG as macroinitiator and stannous octoate as catalyst.The amphiphilic copolymer self-assembled into micelles in aqueous solutions,and formed hydrogels as the increase of temperature at relatively high concentrations (> 15 wt%).The favorable degradability of the hydrogel was confirmed by in vitro and in vivo degradation experiments.The good cellular and tissular compatibilities of the thermogel were demonstrated.The excellent adhesion and proliferation of bone marrow mesenchymal stem cells endowed PLGA-PEG-PLGA thermogelling hydrogel with fascinating prospect for cartilage tissue engineering.