WorldWideScience

Sample records for conventional culture method

  1. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  2. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  3. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.

    1983-01-01

    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  4. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  5. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  6. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau

    1997-01-01

    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  7. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  8. Culture: copying, compression, and conventionality.

    Science.gov (United States)

    Tamariz, Mónica; Kirby, Simon

    2015-01-01

    Through cultural transmission, repeated learning by new individuals transforms cultural information, which tends to become increasingly compressible (Kirby, Cornish, & Smith, ; Smith, Tamariz, & Kirby, ). Existing diffusion chain studies include in their design two processes that could be responsible for this tendency: learning (storing patterns in memory) and reproducing (producing the patterns again). This paper manipulates the presence of learning in a simple iterated drawing design experiment. We find that learning seems to be the causal factor behind the increase in compressibility observed in the transmitted information, while reproducing is a source of random heritable innovations. Only a theory invoking these two aspects of cultural learning will be able to explain human culture's fundamental balance between stability and innovation. Copyright © 2014 Cognitive Science Society, Inc.

  9. Blood culture bottles are superior to conventional media for vitreous culture.

    Science.gov (United States)

    Thariya, Patsuda; Yospaiboon, Yosanan; Sinawat, Suthasinee; Sanguansak, Thuss; Bhoomibunchoo, Chavakij; Laovirojjanakul, Wipada

    2016-08-01

    To compare blood culture bottles and conventional media for the vitreous culture in patients with clinically suspected infectious endophthalmitis. Retrospective comparative study at KKU Eye Center, Khon Kaen University. There were 342 patients with clinically suspected infectious endophthalmitis participated in the study. The vitreous specimens were inoculated in both blood culture bottles and on conventional culture media (blood agar, MacConkey agar, chocolate agar, Sabouraud dextrose agar and thioglycolate broth). The number of positive culture yields in both blood culture bottles and conventional media. Positive culture yields in both methods were found in 151 eyes (49.5%). There were 136 of 151 eyes (90.1%) with positive culture in blood culture bottles, whereas 99 of 151 eyes (65.6%) yielded positive cultures in conventional media. These findings were different with a statistical significance (P culture bottles and conventional media improved the yield. Blood culture bottles are superior to conventional media for vitreous culture in clinically suspected infectious endophthalmitis. Vitreous culture using blood culture bottles should be recommended as the primary method for microbiological diagnosis. A combination of both methods further improves the positive culture yield. © 2016 Royal Australian and New Zealand College of Ophthalmologists.

  10. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  11. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  12. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  13. Conventional laboratory methods for cyanotoxins.

    Science.gov (United States)

    Lawton, Linda A; Edwards, C

    2008-01-01

    It is clear from the literature that numerous methods are available for most cyanotoxins, although many publications on monitoring data indicate that the favored approach is the use proven, robust methods for individual toxins. The most effective approach is the utilization of a robust rapid screen, where positive samples are followed up by qualitative and quantitative analysis to provide the essential decision making data needed for successful management strategies (Fig. 2). Currently, rapid screens are available for microcystins, saxitoxins and anatoxin-a(s), whilst optimisation and validation is needed, many publications report good correlation with the mouse bioassay and HPLC. There is an urgent need for rapid, simple, and inexpensive assays for cylindrospermopsins, anatoxin-a and BMAA. Although methods exist for analysis of BMAA, the fact that a recent study showed 95% of cyanobacteria producing this, some at levels > 6,000 microg g(-1) dry wt, is of concern and rapid screening followed by robust analysis needed. An ideal approach would be a single method capable of extracting and detecting all cyanotoxins. Several publications describe such approaches using LC-MS, but as expected from a group of compounds with diverse chemistry, there are obvious limitations in recoveries during sample processing, chromatographic performance and sensitivity (Dahlmann et al. 2003, Dell'Aversano et al. 2004, Pietsch et al. 2001). Selection of methods must be based on the application requirements, equipment available and cost. For many organisations it may be more cost effective to out-source the occasional analysis. However, as the incidence of blooms appears to be increasing, the need for more rigorous monitoring is needed, sensible investment is needed to meet recommended guidelines. Most of the methods discussed in this paper are suitable for achieving this goal, although clean-up and concentration is usually necessary for physicochemical methods.

  14. Shortening of culture time in conventional cytogenetic dosimetry

    International Nuclear Information System (INIS)

    Lamadrid, Ana I.; Gonzalez, Jorge E.; Romero, Ivonne; Garcia, Omar; Roy, Laurence

    2008-01-01

    Conventional cytogenetic dosimetry based on chromosome aberration in metaphases is a 'gold standard' of bio-dosimetry techniques for radiation dose assessment. This method is laborious and time consuming, the culturing process requires about 48 hours to obtain a satisfactory number of lymphocytes in mitosis. The current approach to reduce the dose estimation time by cytogenetic dosimetry is the preliminary estimation of dose counting only 50 metaphases. Another possibility is to reduce the culture time. The possibility of reduce the culture time under 48 hours adding Calyculin A has been suggested recently. In the present study we tested shorter times using Calyculin A and considering the G2/M-PCC index as culture quality indicator. Peripheral blood from healthy individuals was irradiated and then maintained at 37 C degrees for 2 hours allowing to act the cellular reparation mechanisms, lymphocytes were culture in RPMI 1640 supplemented with foetal calf serum and phytohemagglutinin. Colcemid was added 24 hours after cultures started and Calyculin A was added for the last hour. The cells were collected by centrifugation between 30 to 48 hours. The cells were treated with a hypotonic solution and the fixed cells dropped onto slides. The slides were stained with Giemsa. The incidence of metaphases with chromosomes well defined was scored. Two operators participated to the scoring according the same criteria. The results were analyzed to comparing the G2/M-PCC index relatives to achieve the shortest culture duration. The culture time reduction to 40 hours gives enough G2/M-PCC cells for dose estimation analysis. Lower culture times produced very low G2/M-PCC index. (author)

  15. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma.

    Science.gov (United States)

    Palmini, Gaia; Zonefrati, Roberto; Mavilia, Carmelo; Aldinucci, Alessandra; Luzi, Ettore; Marini, Francesca; Franchi, Alessandro; Capanna, Rodolfo; Tanini, Annalisa; Brandi, Maria Luisa

    2016-10-14

    The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

  16. Efficiency of liquid culture systems over conventional ...

    African Journals Online (AJOL)

    The most common methods of micropropagation involve the proliferation of shoots via a semi solid system. While such semi solid systems have been moderately to highly successful in terms of multiplication yields, it has become increasingly important to improve productivity and reduce the time taken to multiply ...

  17. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  18. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  19. Mitigating the Cultural Challenges of SOF/Conventional Force Interdependence

    Science.gov (United States)

    2013-03-01

    Cultural Challenges of SOF / Conventional Force Interdependence 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...January 16, 2013. 31 Daniel French , “Integration of General Purpose Forces and Army Special Operations,” 1. 32 Edward L. Cardon , “Recognizing

  20. Disability, culture and the U.N. convention.

    Science.gov (United States)

    Bickenbach, Jerome E

    2009-01-01

    Is the universality of human rights, such as those set out in the United Nations Convention on the Rights of Persons with Disabilities, incompatible with therapeutic strategies of respecting cultural differences? I show that universalism is essential to the notion of human rights, as well as the rarely explained, political slogan of 'the rights approach to disability'. Similarly, culture responsiveness is commonly defended by therapists. I argue that the conflict between universalism of rights and cultural sensitivity exist only if these positions are expressed in extreme form: rights absolutism and cultural relativity. If more sensibly spelled out--in the form of progressive realisation of rights and situational sensitivity of difference--there is no conflict at all. Indeed, these more reasonable positions are mutually supportive. I conclude that, given resource and other constraints, the realisation of human rights will always be a matter of political negotiation, and that a social commitment to equality demands that we ensure that only transparent, fully-informed and fully-participatory procedures, respectful of difference [are employed]. These principles should guide us when we have to make hard choices in the implementation of human rights.

  1. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  2. Comparison of lysis-centrifugation with lysis-filtration and a conventional unvented bottle for blood cultures.

    OpenAIRE

    Gill, V J; Zierdt, C H; Wu, T C; Stock, F; Pizzo, P A; MacLowry, J D

    1984-01-01

    Evaluation of a commercially available lysis-centrifugation blood culture system (Isolator, DuPont Co., Wilmington, Del.) and a lysis-filtration blood culture system for 3,111 cultures showed that both methods had comparable recoveries (73 and 68%, respectively) of significant aerobic and facultatively anaerobic isolates. The unvented conventional blood culture bottle had a recovery rate of 59%. Although the lysis-centrifugation and lysis-filtration systems had comparable recoveries of pathog...

  3. The comparison of pyrosequencing molecular Gram stain, culture, and conventional Gram stain for diagnosing orthopaedic infections.

    Science.gov (United States)

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W

    2006-08-01

    We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.

  4. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression

    OpenAIRE

    Lou Yongli; Guo Dewei; Zhang Hui; Song Laijun

    2016-01-01

    In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs) cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI) brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were adminis...

  5. Growth inhibitory factors in bovine faeces impairs detection of Salmonella Dublin by conventional culture procedure

    DEFF Research Database (Denmark)

    Baggesen, Dorte Lau; Nielsen, L.R.; Sørensen, Gitte

    2007-01-01

    Aims: To analyse the relative importance of different biological and technical factors on the analytical sensitivity of conventional culture methods for detection of Salmonella Dublin in cattle faeces. Methods and Results: Faeces samples collected from six adult bovines from different salmonella...... novobiocin, followed by combinations of culture media (three types) and selective media (two types). The sensitivity of each combination and sources of variation in detection were determined by a generalized linear mixed model using a split-plot design. Conclusions: Biological factors, such as faecal origin...... and S. Dublin strain influenced the sensitivity more than technical factors. Overall, the modified semisolid Rappaport Vassiliadis (MSRV)-culture medium had the most reliable detection capability, whereas detection with selenite cystine broth and Mueller Kauffman tetrathionate broth combinations varied...

  6. THE PROTECTION OF CULTURAL GOODS FROM THE ROERICH PACT TO THE HAGUE CONVENTION

    Directory of Open Access Journals (Sweden)

    MARIAN MIHĂILĂ

    2013-05-01

    Full Text Available The study premises and objectives: The idea found at the basis of the discovery of a real value of cultural goods is underlined by the knowledge of their origins and history and of an environmental frame in which these have been produced. This theory could also be applied in regulations provided with certain newly introduced elements as: the absolute interdiction of thefts; the interdiction of destruction and execution of enemy property; the warning of before a terrestrial bombing with naval forces of ports, cities, villages, buildings or houses which are not defended The purpose on this paper is based on the following question: “Which of the gaps of humanitarian international law regarding cultural goods are surfacing?” The research models used are: the interpretative method, the structuralist-systematic method necessary for the knowledge of rules of organization and functioning of law as a system of social organization; the epistemological method, with an important role in the verification of an authentic meaning, fully manifesting the exigency regarding the protection of cultural property. The result of the study is obtained by offering an answer which as argued in this paper, concluding on one side that the discrepancies appeared between provisions (or dispositions of the Hague Convention of 1907 and the events of the First World War have led to an improved idea and to a completion of these norms. Conclusions: The preoccupation for the protection of cultural goods, of the people’s cultural patrimony, thus continues, even if, despite all acts adopted, we observe that certain states destroy willingly the treasures of other peoples. We have thus reached the conclusion that more drastic measures must be adopted more severe sanctions must be applied to states that neglect the norms of humanitarian international law and the existent gaps must be eliminated. For this reason the Second Protocol of The Hague Convention of 1954 has been promoted

  7. REMOVAL OF URANIUM FROM DRINKING WATER BY CONVENTIONAL TREATMENT METHODS

    Science.gov (United States)

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. The paper presents treatment technology information on the effectiveness of conventional method...

  8. The study of cultural objects by nuclear and conventional techniques

    International Nuclear Information System (INIS)

    Palacios, Tulio A.

    2000-01-01

    A survey is given of the techniques that are used at the National Atomic Energy Commission of Argentina for the characterization and study of cultural and archaeological specimens. A short history of these activities is also given. (author)

  9. Ireland and the UNESCO Convention on the Protection of the Underwater Cultural Heritage

    Science.gov (United States)

    Kirwan, Seán

    2010-12-01

    Ratification by Ireland of the 2001 UNESCO Convention on the Protection of the Underwater Cultural Heritage will not be able to take place until after enactment of additional domestic legislation. The reasons for this are examined in the context of Ireland's legal system. Since 1987 Ireland has had extensive legal protection for underwater cultural heritage, but the jurisdictional aspects of the Convention are key to understanding why additional legislation is necessary. Issues relating to salvage law are also considered. The 2001 Convention is placed in the context of development of Irish policy on underwater cultural heritage.

  10. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  11. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression

    Directory of Open Access Journals (Sweden)

    Lou Yongli

    2016-01-01

    Full Text Available In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were administered intranasally to nine day old mice, and analyzed by MRI at day 28. Results indicate that the MSCs, especially the hanging drop cultured MSCs, significantly improved the mice’s cerebellar damage repair. MSCs derived from the hanging drop culture were smaller than those from the conventional culture. The gene expression levels were significantly increased for the MSCs derived from the hanging drop culture. The mechanism might relate to the fact that the hanging drop cultured MSCs can be kept in an undifferentiated state, resulting in its higher expression level of migration receptor of CXCR4.

  12. Evaluation of conventional castaneda and lysis centrifugation blood culture techniques for diagnosis of human brucellosis.

    Science.gov (United States)

    Mantur, Basappa G; Mangalgi, Smita S

    2004-09-01

    We investigated the role of the lysis centrifugation blood culture technique over the conventional Castaneda technique for the diagnosis of human brucellosis. The lysis centrifugation technique has been found to be more sensitive in both acute (20% higher sensitivity; P centrifugation was in the mean detection time, which was only 2.4 days in acute and 2.7 days in chronic cases, with 103 out of 110 (93.6%) and 17 out of 20 (85%) cultures from acute and chronic brucellosis, respectively, detected before the conventional culture was positive. Our results confirmed the potential usefulness of the lysis technique in diagnosis and institution of appropriate antibiotic therapy.

  13. Conventional cable testing methods: strengths, weaknesses and possibilities

    International Nuclear Information System (INIS)

    Reynolds, P.H.

    1988-01-01

    The paper reviews the major conventional methods that can be used to test power plant cables. It assesses their usefulness in diagnosing the condition of the insulation of the cable and then proposes some possible directions for innovation. The methods examined are dc insulation resistance measurement, ac signal injection for continuous monitoring and fault location, and the ac measurement of capacitance and loss angle. Specific subjects considered are the effects of temperature, cable construction and installation, and the validity of insulation resistance or loss angle measurement. The innovative proposals refer to the use of automation in the measurement and of computer-based Expert Systems for the evaluation of the results

  14. Cultural rights in the Convention on the Diversity of Cultural Expressions: included or ignored?

    NARCIS (Netherlands)

    Donders, Y.M.; Kono, T.; Van Uytsel, S.

    2012-01-01

    In 2001, the Universal Declaration on Cultural Diversity was adopted by the Member States of UNESCO. In this Declaration, cultural human rights were commended as an enabling environment for cultural diversity. After the Declaration, the Member States wished to adopt a legally binding instrument on

  15. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  16. A microfluidic-based lid device for conventional cell culture dishes to automatically control oxygen level.

    Science.gov (United States)

    Lee, Seung Yeob; Yang, Sung

    2018-04-25

    Most conventional hypoxic cell culture systems undergo reoxygenation during experimental manipulations, resulting in undesirable effects including the reduction of cell viability. A lid device was developed herein for conventional cell culture dishes to resolve this limitation. The integration of multilayered microfluidic channels inside a thin membrane was designed to prevent the reoxygenation caused by reagent infusion and automatically control the oxygen level. The experimental data clearly show the reducibility of the dissolved oxygen in the infusing reagent and the controllability of the oxygen level inside the dish. The feasibility of the device for hypoxia studies was confirmed by HIF-1α experiments. Therefore, the device could be used as a compact and convenient hypoxic cell culture system to prevent reoxygenation-related issues.

  17. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  18. Methods for safety culture improvement

    International Nuclear Information System (INIS)

    Sivintsev, Yu.V.

    1998-01-01

    New IAEA publication concerning the problems of safety assurance covering different aspects beginning from terminology applied and up to concrete examples of well and poor safety culture development at nuclear facilities is discussed. The safety culture is defined as such set of characteristics and specific activities of institutions and individual persons which states that safety problems of a nuclear facility are given the attention determined by their importance as being of highest priority. The statements of the new document have recommended, not mandatory character. It is emphasized that the process of safety culture improvement at nuclear facilities should be integral component of management procedure, not a bolt on extra

  19. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  20. The Method of Culture Contrast

    DEFF Research Database (Denmark)

    Hasse, Cathrine; Trentemøller, Stine; Motzkau, Johanna

    2009-01-01

    -cultural research can be argued to rest on what has been called implicit comparisons (Nader 1994) of such categorisations. We assume that research of local activities, such as schooling and higher education, is influenced by the researcher's emic and etic categorisations. To get beyond the risk of reproducing...... and surprising challenges of the researcher's emic categorisations. We illustrate the case with examples of different understandings of three terms, hierarchy, family, and sexual harassment, in the Understanding Puzzles in the Gendered European Map (UPGEM) project....

  1. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  2. Dosimetry comparison of pelvimetry methods using conventional radiographs and CT

    International Nuclear Information System (INIS)

    Resten, A.; Suissa, M.; Musset, D.; Mausoleo, F.; Valero, M.; Taylor, S.

    2001-01-01

    To determine the fetal and maternal exposure to radiation by use of thermoluminescent dosimeters in order to compare conventional and CT-scan X-ray. Dosimetry was performed with an anthropomorph phantom. Thermoluminescent dosimeters were positioned on the surface and in the depth of the phantom. Digital radiography of the pelvis was performed according to a standard technique. CT-scan of the pelvis was performed according to the Buthiau's technique. With CT, the dose reached 0.31 to 4.95 mGy, with a dose of 2.32 mGy for the fetal gonads. With standard technique, the doses reached 0.03 to 0.39 mGy, with a dose of 0.39 mGy for the fetal gonads. With CT the fetus and the mother were exposed to 1/10. of the total dose delivered using conventional X-rays and the dose distribution was more homogeneous. (author)

  3. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  4. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  5. Comparison of radiometric and conventional culture systems in detecting Haemophilus influenzae type b bacteremia in rats

    International Nuclear Information System (INIS)

    Mitchell, M.J.; Zwahlen, A.; Elliott, H.L.; Ford, N.K.; Charache, F.P.; Moxon, E.R.

    1985-01-01

    To compare the efficiency of detecting Haemophilus influenzae type b bacteremia by the BACTEC radiometric system and a conventional Trypticase soy broth blood culture system, the authors developed an in vivo model of bacteremia in rats. After intravenous injection of 50 to 200 CFU into adult rats, there was a linear logarithmic increase in CFU per milliliter of rat blood during the first 10 h (r = 0.98), allowing accurate prediction of the level of bacteremia with time. Culture bottles were inoculated with 0.5 ml of blood obtained by cardiac puncture and processed as clinical samples in the microbiology laboratory with RS and conventional protocols. They found the following. (i) The first detection of bacteremia by RS was similar to that by TSB if a Gram stain of the TSB was done on day 1 and was superior if that smear was omitted (P less than 0.01). (ii) The detection times in both systems were comparable at different magnitudes of bacteremia (10(1) to 10(4) CFU/ml). (iii) Supplementation of inoculated bottles with 2 ml of sterile rat blood interfered with Gram stain detection in TSB but resulted in increased 14 CO 2 production in RS. (iv) No difference in detection time was found between RS and TSB for four different clinical isolates. These studies show that, in a biologically relevant model, the detection of positive blood cultures for H. influenzae type b by RS was comparable to or better than detection by TSB when blood was processed analogously to clinical specimens

  6. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  7. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  8. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  9. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  10. A Critical Analysis of the Conventionally Employed Creep Lifing Methods.

    Science.gov (United States)

    Abdallah, Zakaria; Gray, Veronica; Whittaker, Mark; Perkins, Karen

    2014-04-29

    The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  11. Cytokinesis-block micronucleus method in micro-blood cultures

    International Nuclear Information System (INIS)

    Liu Jinwen; Wang Lianzhi; Yang Cangzhen; Yao Yanyu

    1991-01-01

    This paper reports the cytokinesis-block micronucleus method in micro-blood cultures. The observations on detection induced micronuclei of different doses of 60 Co γ-rays irradiation and spontaneous micronucleus of different ages were performed with CB method in comporison with conventional micronucleus (CM) method. The results showed that with direct peripheral micro-blood cultures the cytoknesis-block micronuclei is also obtained. Using CB method, the micronuclei fequency of different ages was linear relationship, Y = 1.62 + 0.74 D, the spontaneous micronuclei frequency of different ages was 4.14%, the induced micronuclei also was a linear relationship, Y = 6.01 + 0.692 D. Using CM method, it showed that the induced micronuclei was a linear relationship, Y = 0.486 D - 1.968, but there is no significant difference between the micronuclei frequency of different ages. Comparison with CM and direct blood smear methods confirmed that the cytokinesis-block method of micro-blood cultures is more sensitive and precise

  12. Differences in gene expression of cells growing in conventional 2D versus 3D cell culture

    International Nuclear Information System (INIS)

    Zschenker, Oliver; Cordes, Nils; Streichert, Thomas

    2009-01-01

    Full text: Telomeres are DNA protein complexes on the ends of chromosomes that distinguish the ends of chromosomes from double strand breaks and prevent degradation or fusion by nonhomologous end-joining. The loss of telomeres is associated with a loss of heterochromatic features leading to a less compact chromatin structure which allows e.g. DNA repair proteins to get better access to the site of the DNA damage and facilitate chromosome fusions. Telomerase is an enzyme that can counteract the loss of telomeres by adding telomeric repeats on the ends of chromosomes. Since telomerase is active in most tumor cells, telomerase is suggested to be the reason for the unlimited number of cell divisions of cancer cells. TRF2 is one of the most important proteins of the Shelterin complex protecting the telomeres from shortening by inhibiting ATM which is up-stream of the DNA repair mechanisms. Thus, we are concentrating on TRF2 and telomerase to investigate the differences in DNA repair in telomeric (heterochromatic) versus euchromatic regions. Human cancer cells with differences in status of p53 and telomerase like A549, UT-SCC15 and FaDu cells are used. Without any treatment, FaDu cells express high levels of telomerase and TRF2 in conventional 2D cell culture which is in contrast to e.g. A549. We found that telomerase is even higher expressed in 3D than in 2D cell culture. To connect telomere associated processes to both repair of radiogenic DNA damage/lesions and to cell-extracellular matrix interactions, we performed whole genome microarray analysis. By comparing the differential expression of genes associated with these three cell functions, we intend to yield new molecular insight into radiotherapy relevant tumor characteristics, particularly radioresistance and DNA damage response network processing. (author)

  13. Comparison between xCELLigence biosensor technology and conventional cell culture system for real-time monitoring human tenocytes proliferation and drugs cytotoxicity screening.

    Science.gov (United States)

    Chiu, Chih-Hao; Lei, Kin Fong; Yeh, Wen-Ling; Chen, Poyu; Chan, Yi-Sheng; Hsu, Kuo-Yao; Chen, Alvin Chao-Yu

    2017-10-16

    Local injections of anesthetics, NSAIDs, and corticosteroids for tendinopathies are empirically used. They are believed to have some cytotoxicity toward tenocytes. The maximal efficacy dosages of local injections should be determined. A commercial 2D microfluidic xCELLigence system had been developed to detect real-time cellular proliferation and their responses to different stimuli and had been used in several biomedical applications. The purpose of this study is to determine if human tenocytes can successfully proliferate inside xCELLigence system and the result has high correlation with conventional cell culture methods in the same condition. First passage of human tenocytes was seeded in xCELLigence and conventional 24-well plates. Ketorolac tromethamine, bupivacaine, methylprednisolone, and betamethasone with different concentrations (100, 50, and 10% diluted of clinical usage) were exposed in both systems. Gene expression of type I collagen, type III collagen, tenascin-C, decorin, and scleraxis were compared between two systems. Human tenocytes could proliferate both in xCELLigence and conventional cell culture systems. Cytotoxicity of each drug revealed dose-dependency when exposed to tenocytes in both systems. Significance was found between groups. All the four drugs had comparable cytotoxicity in their 100% concentration. When 50% concentration was used, betamethasone had a relatively decreased cytotoxicity among them in xCELLigence but not in conventional culture. When 10% concentration was used, betamethasone had the least cytotoxicity. Strong and positive correlation was found between cell index of xCELLigence and result of WST-1 assay (Pearson's correlation [r] = 0.914). Positive correlation of gene expression between tenocytes in xCELLigence and conventional culture was also observed. Type I collagen: [r] = 0.823; type III collagen: [r] = 0.899; tenascin-C: [r] = 0.917; decorin: [r] = 0.874; and scleraxis: [r] = 0.965. Human

  14. Performance of non-conventional yeasts in co-culture with brewers’ yeast for steering ethanol and aroma production

    NARCIS (Netherlands)

    Rijswijck, van Irma M.H.; Wolkers - Rooijackers, Judith C.M.; Abee, Tjakko; Smid, Eddy J.

    2017-01-01

    Increasing interest in new beer types has stimulated the search for approaches to extend the metabolic variation of brewers’ yeast. Therefore, we tested two approaches using non-conventional yeast to create a beer with lower ethanol content and a complex aroma bouquet. First, the mono-culture

  15. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  16. Investigation of Industrialised Building System Performance in Comparison to Conventional Construction Method

    Directory of Open Access Journals (Sweden)

    Othuman Mydin M.A.

    2014-03-01

    Full Text Available Conventional construction methods are still widely practised, although many researches have indicated that this method is less effective compared to the IBS construction method. The existence of the IBS has added to the many techniques within the construction industry. This study is aimed at making comparisons between the two construction approaches. Case studies were conducted at four sites in the state of Penang, Malaysia. Two projects were IBS-based while the remaining two deployed the conventional method of construction. Based on an analysis of the results, it can be concluded that the IBS approach has more to offer compared to the conventional method. Among these advantages are shorter construction periods, reduced overall costs, less labour needs, better site conditions and the production of higher quality components.

  17. INFECTIOUS DISEASES ARE SLEEPING MONSTERS: Conventional and culturally adapted new metaphors in a corpus of abstracts on immunology

    Directory of Open Access Journals (Sweden)

    Laura Hidalgo Downing

    2009-04-01

    Full Text Available In this paper we examine the role played by metaphor in a corpus of sixty abstracts on immunology from Scientific American. We focus on the distinction between conventional metaphors and culturally adapted new metaphors and discuss the role played by metaphor choice in the communicative purposes of the abstracts and their register features. We argue that one of the main strategies used to attract the reader‘s attention is the combination of highly conventionalized metaphors, which occur more frequently in the corpus, together with what we call “culturally adapted new metaphors”, which display different degrees of creativity and are less frequent in the corpus. Conventional metaphors typically reinforce the world view shared by the scientific community and introduce basic ideas on the subject of immunology. Culturally adapted new metaphors include a cline from slightly new perspectives of conventional models, to highly creative uses of metaphor. Culturally adapted new metaphors appeal primarily to a general readership and not to the scientific community, as they tap human emotions and mythic constructions. These play a crucial role in the abstracts, as they contribute to persuasive and didactic communicative functions in the text.

  18. Comparison of BacT/Alert FAN and FAN Plus Bottles with Conventional Medium for Culturing Cerebrospinal Fluid.

    Science.gov (United States)

    Yoo, In Young; Chun, Sejong; Song, Dong Joon; Huh, Hee Jae; Lee, Nam Yong

    2016-11-01

    We compared the BacT/Alert system FAN and FAN Plus media to conventional media for culturing cerebrospinal fluid (CSF) with 2,545 samples. FAN/FAN Plus bottles showed better performance for isolating microorganisms in CSF than conventional media (positive rate, 7.2% [182/2,545] versus 3.1% [80/2,545]). The incremental recovery rate of Cryptococcus neoformans from FAN Plus bottles was higher than that from FAN bottles. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions

    OpenAIRE

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-01-01

    OBJECTIVES Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. MATERIALS AND METHODS Impressions were obtained via two conventional (metal full-arch tray, CI, ...

  20. Impact of Organic and Conventional Systems of Coffee Farming on Soil Properties and Culturable Microbial Diversity.

    Science.gov (United States)

    Velmourougane, Kulandaivelu

    2016-01-01

    A study was undertaken with an objective of evaluating the long-term impacts of organic (ORG) and conventional (CON) methods of coffee farming on soil physical, chemical, biological, and microbial diversity. Electrical conductivity and bulk density were found to increase by 34% and 21%, respectively, in CON compared to ORG system, while water holding capacity was found decreased in both the systems. Significant increase in organic carbon was observed in ORG system. Major nutrients, nitrogen and potassium, levels showed inclination in both ORG and CON system, but the trend was much more pronounced in CON system. Phosphorus was found to increase in both ORG and CON system, but its availability was found to be more with CON system. In biological attributes, higher soil respiration and fluorescein diacetate activity were recorded in ORG system compared to CON system. Higher soil urease activity was observed in CON system, while dehydrogenase activity does not show significant differences between ORG and CON systems. ORG system was found to have higher macrofauna (31.4%), microbial population (34%), and microbial diversity indices compared to CON system. From the present study, it is accomplished that coffee soil under long-term ORG system has better soil properties compared to CON system.

  1. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... PROGRAM FOR CONSUMER PRODUCTS Test Procedures Pt. 430, Subpt. B, App. I Appendix I to Subpart B of Part... between the center and the corners of the conventional gas oven on the diagonals of a horizontal plane...

  2. Conventional and digital radiographic methods in the detection of simulated external root resorptions: A comparative study

    Directory of Open Access Journals (Sweden)

    C J Sanjay

    2009-01-01

    Full Text Available Objective : To evaluate and compare the efficacy of conventional and digital radiographic methods in the detection of simulated external root resorption cavities and also to evaluate whether the detectability was influenced by resorption cavity sizes. Methods : Thirty-two selected teeth from human dentate mandibles were radiographed in orthoradial, mesioradial and distoradial aspect using conventional film (Insight Kodak F-speed; Eastman Kodak, Rochester, NY and a digital sensor (Trophy RVG advanced imaging system with 0.7mm and 1.0mm deep cavities prepared on their vestibular, mesial and distal surfaces at the cervical, middle and apical thirds. Three dental professionals, an endodontist, a radiologist and a general practitioner, evaluated the images twice with a one-week time interval. Results : No statistical significance was seen in the first observation for both conventional and digital radiographic methods in the detection of simulated external root resorptions and for small and medium cavities but statistical difference was noted in the second observation (P< 0.001 for both the methods. Conclusion : Considering the methodology and the overall results, conventional radiographic method (F-speed performed slightly better than the digital radiographic method in the detection of simulated radiographic method but better consistency was seen with the digital system. Overall size of the resorption cavity had no influence on the performance of both methods and suggests that initial external root resorption lesion is not well-appreciated with both the methods as compared to the advanced lesion.

  3. Relationship between conventional culture and flow cytometry for the diagnosis of urinary tract infection.

    Science.gov (United States)

    García-Coca, Marta; Gadea, Ignacio; Esteban, Jaime

    2017-06-01

    Urine culture is the gold standard for the diagnosis of urinary tract infections (UTI). The use of flow cytometry analyzers (FCA) prior to culture allows for the quantification and recognition of cell components in urine to be automated and makes it possible to relate these data to the urine pathogens subsequently identified in cultures. Urine samples were assessed with the Sysmex UF-1000i analyzer. Those that met the criteria for culture (> 25 leukocytes/μL or > 385 bacteria/μL) were subjected to quantitative urine culture on chromogenic agar. Counts of red blood cells (RBC), white blood cells (WBC), epithelial cells (EC), and the kind of microorganisms identified in cultures were evaluated. A total of 17,483 samples were processed by FCA. Of these, 9057 met the criteria for culture. Urine cultures were reduced by 48.2%. The most common urine pathogen was Escherichia coli (60.3%). Negative urine cultures were significantly (p flow cytometer for screening urine samples allows for a reduction in the number of urine cultures. WBC values correlate well with the main urine pathogens related to UTI. The results observed for Enterococcus spp. suggest a low impact of these pathogens as a cause of UTI.

  4. Cultural diversity and recognition in the communication and culture policies frame in Brazil: challenges and prospects for the implementation of the 2005 Unesco Convention

    Directory of Open Access Journals (Sweden)

    Sayonara Leal

    2017-06-01

    Full Text Available http://dx.doi.org/10.5007/2175-7984.2017v16n35p94 This paper discusses the mismatch between the communication and cultural policies regarding broadcasting in Brazil, notably television and audiovisual (movies, with the principle of cultural diversity mentioned in UNESCO’S Convention on the Protection and Promotion of the Diversity of Cultural Expressions of 2005. We start by reflecting on cultural diversity as a built-in problem of the multicultural societies in which demands for recognition operate from the idea of self-esteem and mutual respect as much as from that of social justice, resulting in permanent social struggles in individuals daily lives. Following, we take a glimpse at the problem of cultural diversity in scenarios of broad-range media monopolies, e.g. Brazil’s case, where elements of the democratic ethics, such as freedom of expression, find resistance due to the presence of hegemonic cultural model of production and commercialization of culture and communication. In this respect, we advocate that the fulfillment of the democratizing principles of UNESCO’s 2005 Convention requires reforms in our legal framework for Communications which must be based on the tripod of citizenship, recognition and cultural diversity. The emergence of a cosmopolitan symbolic space that gives visibility to universal and particular narratives and aesthetic forms that inhabit our cultural diversity depends on institutional support and routinization of the “normative recognition” as a norm within our inter-subjective action in the life-world.

  5. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  6. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  7. Sociocultural Conventions in Avatar-Mediated Nonverbal Communication: A Cross-Cultural Analysis of Virtual Proxemics

    OpenAIRE

    Hasler B.S.; Friedman D.A.

    2012-01-01

    We examined whether virtual worlds in which participants interact as avatars could be used as a novel instrument for cross cultural and intercultural communication research. We explored differences between Asian and European cultures regarding their social spatial behavior (i.e. proxemics) in dyadic avatar interactions. Asian dyads interacted at larger distances than European dyads which is consistent with the cross cultural differences typically observed in face to face interactions. Mixed c...

  8. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  9. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  10. Moving Beyond Conventional Wisdom: Advancements in Cross-Cultural Theories of Leadership, Conflict, and Teams.

    Science.gov (United States)

    Gibson, Cristina B; McDaniel, Dana M

    2010-07-01

    In this article, we discuss the importance of a cross-cultural approach to organizational behavior. To do so, we illustrate how cross-cultural research in the past two decades has enabled us to reconceptualize constructs, revise models, and extend boundary conditions in traditional organizational behavior theories. We focus on three domains-teams, leadership, and conflict-and review cross-cultural empirical evidence that has extended several theories in each of these domains. We support the claim that even well-established organizational behavior theories vary in the extent to which they may be applied unilaterally across cultures, thus identifying the critical need to advance these theories via a cross-cultural research agenda. © The Author(s) 2010.

  11. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  12. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The comparative evaluation of patients′ body dry weight under hemodialysis using two methods: Bioelectrical impedance analysis and conventional method

    Directory of Open Access Journals (Sweden)

    Neda Alijanian

    2012-01-01

    Full Text Available Background: Dry weight (DW is an important concept related to patients undergoing hemodialysis. Conventional method seems to be time consuming and operator dependent. Bio impedance analysis (BIA is a new and simple method reported to be an accurate way for estimating DW. In this study, we aimed to compare the conventional estimation of DW with measuring DW by BIA. Materials and Methods: This study involved 130 uremic patients, performed in Isfahan, Iran. DW was calculated by both conventional (CDW and BIA (BIADW method and results were compared based on different grouping factors including sex, underlying cause of renal failure (RF (diabetic RF and non-diabetic RF, body mass index (BMI status, and sessions of hemodialysis. We also calculated the difference between DWs of 2 methods (DW diff = CDW-BIADW. Results: The mean of BIADW was significantly lower than CDW (57.20 ± 1.82 vs 59.36 ± 1.77, P value < 0.001. After grouping cases according to the underlying cause, BMI, sex, and dialysis sessions BIADW was significantly lower than CDW. Conclusion: Based on the combination of problems with CDW measurement which are corrected by BIA, and more clinical reliability of CDW, we concluded that although conventional method is a time-consuming and operator-dependent way to assess DW, DW could be estimated by combining both of these methods by finding the mathematic correlation between these methods.

  14. The relationship between glass ceiling and power distance as a cultural variable by a new method

    OpenAIRE

    Naide Jahangirov; Guler Saglam Ari; Seymur Jahangirov; Nuray Guneri Tosunoglu

    2015-01-01

    Glass ceiling symbolizes a variety of barriers and obstacles that arise from gender inequality at business life. With this mind, culture influences gender dynamics. The purpose of this research was to examine the relationship between the glass ceiling and the power distance as a cultural variable within organizations. Gender variable is taken as a moderator variable in relationship between the concepts. In addition to conventional correlation analysis, we employed a new method to investigate ...

  15. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  16. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  17. Conventional and Alternative Disinfection Methods of Legionella in Water Distribution Systems – Review

    Directory of Open Access Journals (Sweden)

    Pūle Daina

    2016-12-01

    Full Text Available Prevalence of Legionella in drinking water distribution systems is a widespread problem. Outbreaks of Legionella caused diseases occur despite various disinfectants are used in order to control Legionella. Conventional methods like thermal disinfection, silver/copper ionization, ultraviolet irradiation or chlorine-based disinfection have not been effective in the long term for control of biofilm bacteria. Therefore, research to develop more effective disinfection methods is still necessary.

  18. Bacterial diversity associated with the rotifer Brachionus plicatilis sp. complex determined by culture-dependent and -independent methods.

    Science.gov (United States)

    Ishino, Ryota; Iehata, Shunpei; Nakano, Miyo; Tanaka, Reiji; Yoshimatsu, Takao; Maeda, Hiroto

    2012-03-01

    The bacterial communities associated with rotifers (Brachionus plicatilis sp. complex) and their culture water were determined using culture-dependent and -independent methods (16S rRNA gene clone library). The bacterial communities determined by the culture-independent method were more diverse than those determined by the culture-dependent method. Although the culture-dependent method indicated the bacterial community of rotifers was relatively similar to that of the culture water, 16S rRNA gene clone library analyses revealed a great difference between the two microbiotas. Our results suggest that most bacteria associated with rotifers are not easily cultured using conventional methods, and that the microbiota of rotifers do not correspond with that of the culture water completely.

  19. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  20. Culture, Interface Design, and Design Methods for Mobile Devices

    Science.gov (United States)

    Lee, Kun-Pyo

    Aesthetic differences and similarities among cultures are obviously one of the very important issues in cultural design. However, ever since products became knowledge-supporting tools, the visible elements of products have become more universal so that the invisible parts of products such as interface and interaction are getting more important. Therefore, the cultural design should be extended to the invisible elements of culture like people's conceptual models beyond material and phenomenal culture. This chapter aims to explain how we address the invisible cultural elements in interface design and design methods by exploring the users' cognitive styles and communication patterns in different cultures. Regarding cultural interface design, we examined users' conceptual models while interacting with mobile phone and website interfaces, and observed cultural difference in performing tasks and viewing patterns, which appeared to agree with cultural cognitive styles known as Holistic thoughts vs. Analytic thoughts. Regarding design methods for culture, we explored how to localize design methods such as focus group interview and generative session for specific cultural groups, and the results of comparative experiments revealed cultural difference on participants' behaviors and performance in each design method and led us to suggest how to conduct them in East Asian culture. Mobile Observation Analyzer and Wi-Pro, user research tools we invented to capture user behaviors and needs especially in their mobile context, were also introduced.

  1. Heritage under siege: military implementation of the 1954 Convention for the Protection of Cultural Property

    NARCIS (Netherlands)

    Kila, J.D.

    2012-01-01

    Heritage under Siege is the result of a five year long multidisciplinary research focusing on military implementation of protecting and safeguarding Cultural Heritage in the event of conflict. The subject necessitated to involve legal obligations and implications. The main juridical framework in

  2. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    International Nuclear Information System (INIS)

    Kouchakzadeh, Ahmad; Tavakoli, Teymur

    2011-01-01

    Highlights: → Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. → Using thermophysical properties of air and matter. → This manner could be utilized in similar dryer for other agricultural products. → Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  3. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    Energy Technology Data Exchange (ETDEWEB)

    Kouchakzadeh, Ahmad [Agri Machinery Engineering, Ilam University, Ilam (Iran, Islamic Republic of); Tavakoli, Teymur [Agri Machinery Engineering, Tarbyat Modares University, Tehran (Iran, Islamic Republic of)

    2011-07-15

    Highlights: {yields} Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. {yields} Using thermophysical properties of air and matter. {yields} This manner could be utilized in similar dryer for other agricultural products. {yields} Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  4. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  5. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  6. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  7. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  8. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  9. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  10. THE PROTECTION OF CULTURAL GOODS FROM THE ROERICH PACT TO THE HAGUE CONVENTION

    OpenAIRE

    MARIAN MIHĂILĂ

    2013-01-01

    The study premises and objectives: The idea found at the basis of the discovery of a real value of cultural goods is underlined by the knowledge of their origins and history and of an environmental frame in which these have been produced. This theory could also be applied in regulations provided with certain newly introduced elements as: the absolute interdiction of thefts; the interdiction of destruction and execution of enemy property; the warning of before a terrestrial bombing with nav...

  11. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  12. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  13. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  14. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.

    1992-01-01

    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  15. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  16. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  17. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  18. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    OpenAIRE

    A Pourkhalili; M Mirlohi; E Rahimi; M Hojatoleslami

    2012-01-01

    Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying a...

  19. In vitro culture method of powdery mildew (Oidium heveae ...

    African Journals Online (AJOL)

    ELOHO

    2012-08-23

    Aug 23, 2012 ... A method for culturing powdery mildew (Oidium heveae) from isolated leaves of ... solution; d, Colour phase leaves with nutrient solution in culture dish; e, in vitro ... Plant and fungus materials .... same change trend during whole culture period. ... consistent with the field resistance identification results of.

  20. A method for culturing human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1981-01-01

    For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.

  1. Simple and convenient method for culturing anaerobic bacteria.

    OpenAIRE

    Behbehani, M J; Jordan, H V; Santoro, D L

    1982-01-01

    A simple and convenient method for culturing anaerobic bacteria is described. Cultures can be grown in commercially available flasks normally used for preparation of sterile external solutions. A special disposable rubber flask closure maintains anaerobic conditions in the flask after autoclaving. Growth of a variety of anaerobic oral bacteria was comparable to that obtained after anaerobic incubation of broth cultures in Brewer Anaerobic Jars.

  2. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  3. Survey and Recording Technologies in Italian Underwater Cultural Heritage: Research and Public Access Within the Framework of the 2001 UNESCO Convention

    Science.gov (United States)

    Secci, Massimiliano

    2017-08-01

    The 2001 UNESCO Convention on the Protection of the Underwater Cultural Heritage is slowly but peremptorily becoming a standard reference tool for underwater archaeology and underwater cultural heritage management. The many provisions included within the Convention touch on many aspects that are key to an effective protection and promotion of the underwater cultural heritage. Within the web of these provisions many aspects are gaining consideration and driving research in underwater archaeology worldwide. These provisions, when seen within a wider frame of social, economical and technological dynamics, pinpoint many aspects requiring further scrutiny from the disciplinary circle. In the framework of the 2001 UNESCO Convention, this article will analyze the path traveled in technological acquisition in the practice of Italian underwater archaeology and how this has affected the approach to underwater cultural heritage management, particularly highlighting how this process has been further influenced by the adoption in 2001 of the Convention and Italy's ratification of it in 2010.

  4. Comparison of Fluorescence Microscopy and Different Growth Media Culture Methods for Acanthamoeba Keratitis Diagnosis.

    Science.gov (United States)

    Peretz, Avi; Geffen, Yuval; Socea, Soergiu D; Pastukh, Nina; Graffi, Shmuel

    2015-08-01

    Acanthamoeba keratitis (AK), a potentially blinding infection of the cornea, is caused by a free-living protozoan. Culture and microscopic examination of corneal scraping tissue material is the conventional method for identifying Acanthamoeba. In this article, we compared several methods for AK diagnosis of 32 patients: microscopic examination using fluorescent dye, specific culture on growth media-non-nutrient agar (NNA), culture on liquid growth media-peptone yeast glucose (PYG), and TYI-S-33. AK was found in 14 patients. Thirteen of the specimens were found AK positive by fluorescence microscopic examination, 11 specimens were found AK positive on PYG growth media, and 9 specimens were found AK positive on TYI-S-33 growth media. Only five specimens were found AK positive on NNA growth media. Therefore, we recommend using fluorescence microscopy technique and culture method, especially PYG liquid media. © The American Society of Tropical Medicine and Hygiene.

  5. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  6. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    Full Text Available Introduction: Conservation tillage system was recommended for soil erosion control in North America for the first time 60 years ago (Wang et al., 2006. Using this tillage system including minimum and zero tillage has been rapidly developed in recent years. Thearea covered by zero tillage in 2006 was 95 million ha all over the world (Dumanski et al., 2006. In addition to saving soil and water resources, conservation tillage system reduces energy consumption and improves energy indices by combining different tillage and planting operations. Results of research conducted in Fars province shows that conservation tillage saves fuel consumption for 77% compared to the conventional system (Afzalinia et al., 2009. Conservation tillage also reduces energy consumption from 23.6 to 42.8% in comparison to the conventional tillage (Rusu, 2005. Since energy indices would be affected by reduced input energies in conservation tillage, this research was conducted to evaluate the effect of different tillage and planting methods on energy inputs and energy indices in irrigated wheat production in Eghlid region. Materials and Methods: This research was performed to evaluate and compare the energy indices in irrigated wheat production under different tillage and planting methods. The study was conducted in the form of a randomized complete block experimental design with five treatments and three replications in Eghlid region. The treatments were included, conventional tillage and seed broadcasting (A, conventional tillage and planting with Machine Barzegar grain drill (B, reduced tillage and seeding with Roto-seeder (C, direct seeding with Jairan Sanaat grain drill (D, and direct seeding with Sfoggia direct drill (E. Experimental plots with 10 by 50 m dimensions were used in this study. Loss crop residues were taken out of the experimental plots and standing crop residues were retained in the plots. In the conventional tillage method, primary tillage was performed

  7. Comparison of the conventional diagnostic modalities, bactec culture and polymerase chain reaction test for diagnosis of tuberculosis

    Directory of Open Access Journals (Sweden)

    Negi S

    2005-01-01

    Full Text Available PURPOSE: To evaluate the performance of 65 kDa antigen based PCR assay in clinical samples obtained from pulmonary and extrapulmonary cases of tuberculosis. METHODS: One hundred and fifty six samples were processed for detection of Mycobacterium tuberculosis by ZN smear examination, LJ medium culture, BACTEC radiometric culture and PCR tests. RESULTS: A significant difference was seen in the sensitivities of different tests, the figures being 74.4% for PCR test, 33.79% for ZN smear examination, 48.9% for LJ culture and 55.8% for BACTEC culture (P0.05 as far as specificity of different tests was concerned. PCR test sensitivity in pulmonary and extrapulmonary clinical samples were 72.7% and 75.9% respectively and found to be significantly higher (PM.tuberculosis was 24.03 days by LJ medium culture, 12.89 days by BACTEC culture and less than one day by PCR test. CONCLUSIONS: PCR is a rapid and sensitive method for the early diagnosis of pulmonary and extrapulmonary tuberculosis.

  8. A method to determine the number of nanoparticles in a cluster using conventional optical microscopes

    International Nuclear Information System (INIS)

    Kang, Hyeonggon; Attota, Ravikiran; Tondare, Vipin; Vladár, András E.; Kavuri, Premsagar

    2015-01-01

    We present a method that uses conventional optical microscopes to determine the number of nanoparticles in a cluster, which is typically not possible using traditional image-based optical methods due to the diffraction limit. The method, called through-focus scanning optical microscopy (TSOM), uses a series of optical images taken at varying focus levels to achieve this. The optical images cannot directly resolve the individual nanoparticles, but contain information related to the number of particles. The TSOM method makes use of this information to determine the number of nanoparticles in a cluster. Initial good agreement between the simulations and the measurements is also presented. The TSOM method can be applied to fluorescent and non-fluorescent as well as metallic and non-metallic nano-scale materials, including soft materials, making it attractive for tag-less, high-speed, optical analysis of nanoparticles down to 45 nm diameter

  9. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  10. Ergonomic evaluation of conventional and improved methods of aonla pricking with women workers.

    Science.gov (United States)

    Rai, Arpana; Gandhi, Sudesh; Sharma, D K

    2012-01-01

    Conventional and improved methods of aonla pricking were evaluated ergonomically on an experiment conducted for 20 minute with women workers. The working heart rate, energy expenditure rate, total cardiac cost of work and physiological cost of work with conventional tools varied from 93-102 beats.min-1, 6-7.5 kJ.min-1, 285-470 beats, 14 -23 beats.min-1 while with machine varied from 96-105 beats.min-1, 6.5-8 kJ.min-1 , 336-540 beats, 16-27 beats.min-1 respectively. OWAS score for conventional method was 2 indicating corrective measures in near future while with machine was 1 indicating no corrective measures. Result of Nordic Musculoskeletal Questionnaire revealed that subjects complaint of pain in back, neck, right shoulder and right hand due to unnatural body posture and repetitive movement with hand tool. Moreover pricking was carried out in improper lighting conditions (200-300 lux) resulting into finger injuries from sharp edges of hand tool, whereas with machine no such problems were observed. Output with machine increased thrice than hand pricking in a given time. Machine was found useful in terms of saving time, increased productivity, enhanced safety and comfort as involved improved posture, was easy to handle and operate, thus increasing efficiency of the worker leading to better quality of life.

  11. The evolution of chicken stem cell culture methods.

    Science.gov (United States)

    Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

    2017-12-01

    1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

  12. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  14. Mastitis diagnosis in dairy cows using PathoProof real-time polymerase chain reaction assay in comparison with conventional bacterial culture in a Northern German field study.

    Science.gov (United States)

    Spittel, Susanne; Hoedemaker, Martina

    2012-01-01

    In the following field study, the commercial PathoProof Mastitis PCR Assay, a real-time PCR for identifying eleven mastitis pathogens and the staphylococcal beta-lactamase gene, was compared with conventional bacterial culture. For this purpose, 681 udder quarter samples from 173 clinically healthy cows with varying somatic cell count from four dairy herds in the region of Osnabrück, Lower Saxony, Germany, were collected between July 2010 and February 2011 and subjected to PCR and bacterial culture. The frequency of positive pathogen signals was markedly higher with PCR compared with culture (70.6% vs. 32.2%). This was accompanied by a substantial higher percentage of multiple pathogen identifications and a lower percentage of single identifications in the PCR compared with bacterial culture. Using bacterial culture as gold standard, moderate to high sensitivities (76.9-100%) and specificities (63.3-98.7%) were calculated for six out of seven pathogens with sufficient detection numbers. For Enterococcus spp, the sensitivity was only 9.1%. When the PCR results of pooled udder quarter samples of the 173 cows were compared with the single udder quarter samples, in 72% of the cases, major pathogen DNA was either not found in both types of samples, or in the case of a positive pool sample, the respective pathogens were found in at least one udder quarter sample. With both methods, the most frequently detected mastitis pathogens were coryneform bacteria (PCR: Corynebacterium bovis), coagulase-negative staphylococci (CNS) and Staphylococcus (S.) aureus, followed by Arcanobacterium pyogenes/Peptoniphilus indolicus with PCR, and then with both methods, Streptococcus uberis. The staphylococcal beta-lactamase gene was found in 27.7% of the S. aureus and in 37.0% of the CNS identifications.

  15. Comparison of Tooth Color Change After Bleaching With Conventional and Different Light-Activated Methods.

    Science.gov (United States)

    Shahabi, Sima; Assadian, Hadi; Mahmoudi Nahavandi, Alireza; Nokhbatolfoghahaei, Hanieh

    2018-01-01

    Introduction: The demand for esthetic dental treatments is increasing in recent years mainly due to improved oral hygiene and better maintenance of oral health and teeth in older individuals. Bleaching of discolored anterior teeth is the most popular among esthetic dental treatments. Even individuals with sound teeth and adequate esthetics seek to have whiter teeth in the anterior region. The aim of this study was to evaluate tooth color changes following conventional in-office bleaching techniques compared to light-activated methods using different light sources. Methods: Seventy sound anterior teeth (devoided of caries and/or fracture), extracted for periodontal and orthodontic reasons were selected and allocated to 7 groups: (A) control, (B) conventional bleaching (C) LED-activated bleaching, (D) KTP laser-activated bleaching, (E) diode laser-activated bleaching, (F) Nd:YAG laser-activated bleaching and (G) CO2 laser-activated bleaching. Colorimetric evaluation was carried out before and after treatment using a spectrophotoradiometer. Data were analyzed by one- and two-way analysis of variance (ANOVA) as well as multiple comparison methods. Results: The results showed that all bleaching procedures were effective in reducing the yellowness index. However, the KTP laser-activated bleaching was significantly more effective than the other techniques in 95% confidence level. It was also seen that CO2 laser activated method has outperformed groups E, F and G and the conventional bleaching without light activation was not effective at all and represented similar results with the control group. Furthermore, the groups E and G had almost the same results in decreasing the yellowness index. Conclusion: The results showed that all bleaching techniques were effective however, the KTP laser-activated bleaching was significantly more efficient, closely followed by the CO2 laser-activated bleaching technique.

  16. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  17. Reinforcing the role of the conventional C-arm--a novel method for simplified distal interlocking.

    Science.gov (United States)

    Windolf, Markus; Schroeder, Josh; Fliri, Ladina; Dicht, Benno; Liebergall, Meir; Richards, R Geoff

    2012-01-25

    shot to screw tightened) was on average 22% reduced by guided freehand (p = 0.018). In an experimental setting, the newly developed guided freehand technique for distal interlocking has proven to markedly reduce radiation exposure when compared to the conventional freehand technique. The method utilizes established clinical workflows and does not require cost intensive add-on devices or extensive training. The underlying principle carries potential to assist implant positioning in numerous other applications within orthopedics and trauma from screw insertions to placement of plates, nails or prostheses.

  18. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  19. New method for exopolysaccharide determination in culture broth using stirred ultrafiltration cells.

    Science.gov (United States)

    Bergmaier, D; Lacroix, C; Guadalupe Macedo, M; Champagne, C P

    2001-10-01

    A new method to remove simple carbohydrates from culture broth prior to the quantification of exopolysaccharides (EPS) was developed and validated for the EPS-producing strain, Lactobacillus rhamnosus RW-9595M. This method uses ultrafiltration (UF) in stirred cells followed by polysaccharide detection in the retentate by the phenol-sulfuric acid method. The UF method was compared with a conventional method based on ethanol extraction, dialysis, protein removal by trichloroacetic acid (TCA) and freeze-drying. EPS production during pH-controlled batch fermentations in basal minimum medium, whey permeate (WP). and whey permeate supplemented with yeast extract, minerals and Tween-80 (SWP) was determined by the new UF and conventional methods. EPS recovery by the new method ranged from 83% to 104% for EPS added in the concentration range 40-1,500 mg/l in 0.1 M NaCl solution or culture medium. The UF method was rapid (8 h), accurate and simple, and required only a small sample volume (1-5 ml). A very high maximum EPS production was measured in SWP by both the UF and conventional methods (1,718 and 1,755 mg/l).

  20. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  1. Conventional versus molecular methods for diagnosis of tuberculosis in a tertiary care center: A study from Punjab

    Directory of Open Access Journals (Sweden)

    Shavi Nagpal

    2016-01-01

    Full Text Available Background: A fast and accurate diagnosis is necessary to control and eliminate tuberculosis (TB. There have been various studies evaluating the efficacy of polymerase chain reaction (PCR testing in clinical practice. Most of these studies have found PCR as a useful tool to diagnose TB and more so for the extra-pulmonary cases. Aims and Objectives: The aim of the study was to evaluate the results of TB by real-time PCR versus the conventional methods of diagnosis in a tertiary care center in Punjab. Materials and Methods: This study was done in a tertiary care center of Punjab to look for the results of clinical samples tested for TB using PCR, Ziehl–Neelsen staining and culture on Lowenstein–Jensen medium. 16S rRNA gene was used for Mycobacterium tuberculosis detection in PCR. This study included all samples tested for TB from July 2015 to October 2015. Results: A total of 214 samples were tested for TB using smear microscopy, culture and PCR (including 194 [90.6%] extra-pulmonary and 20 [9.3%] pulmonary samples. These included 76 cerebrospinal fluid, 30 pleural fluid, 42 tissues, 17 ascitic fluid, 13 urine, 15 bronchoalveolar lavage (BAL, 16 pus, and 5 sputum samples. Smear microscopy was positive in a total of 4 samples out of 214 (1.8%, which included 2 sputum, 1 tissue, and 1 ascitic fluid samples, while culture was positive for 6 samples (2.8% which included 2 sputum, 1 pus, 1 BAL, 1 tissue, and 1 ascitic fluid sample. The TB PCR results were positive in a total of 71 (33.1% samples out of 214. In addition, three samples also tested positive for Mycobacteria other than TB. Conclusion: PCR is a very rapid and accurate diagnostic tool for early detection of TB in particularly for extrapulmonary TB.

  2. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  3. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  4. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub [KHNP Central Research Institute, Daejeon (Korea, Republic of)

    2012-10-15

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology.

  5. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    International Nuclear Information System (INIS)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub

    2012-01-01

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology

  6. A comparison of methods for demonstrating artificial bone lesions; conventional versus computer tomography

    International Nuclear Information System (INIS)

    Heller, M.; Wenk, M.; Jend, H.H.

    1984-01-01

    Conventional tomography (T) and computer tomography (CT) were used for examining 97 artificial bone lesions at various sites. The purpose of the study was to determine how far CT can replace T in the diagnosis of skeletal abnormalities. The results have shown that modern CT, particularly in its high resolution form, equals T and provides additional information (substrate of a lesion, its relationship to neighbouring tissues, simultaneous demonstration of soft tissue etc.). These cannot be shown successfully by T. It follows that CT is indicated as the primary method of examination for lesions of the facial skeleton, skull base, spine, pelvis and, to some extent, extremities. (orig.) [de

  7. Radiation exposure in X-ray angiography and comparisons between digital and conventional methods of imaging

    International Nuclear Information System (INIS)

    Schaberg, J.

    1987-01-01

    The more recent developments and techniques in the field of angiography are examined for associated radiation exposure risks for patients and investigators and then compared to the conventional methods of angiography. It could be shown that digital subtraction angiography is generally associated with a lesser risk of somatic exposure of the patient, provided that the equipment used offers an adjustable useful-beam range and focus. The fact that above-table X-ray tubes are now generally replaced with X-ray systems installed under the examination table permits the relatively high doses, to which investigators are exposed during angiography, to be reduced by a factor of 3. (DG) [de

  8. Review of conventional and novel food processing methods on food allergens.

    Science.gov (United States)

    Vanga, Sai Kranthi; Singh, Ashutosh; Raghavan, Vijaya

    2017-07-03

    With the turn of this century, novel food processing techniques have become commercially very important because of their profound advantages over the traditional methods. These novel processing methods tend to preserve the characteristic properties of food including their organoleptic and nutritional qualities better when compared with the conventional food processing methods. During the same period of time, there is a clear rise in the populations suffering from food allergies, especially infants and children. Though, this fact is widely attributed to the changing livelihood of population in both developed and developing nations and to the introduction of new food habits with advent of novel foods and new processing techniques, their complete role is still uncertain. Under the circumstance, it is very important to understand the structural changes in the protein as food is processed to comprehend whether the specific processing technique (conventional and novel) is increasing or mitigating the allergenicity. Various modern means are now being employed to understand the conformational changes in the protein which can affect the allergenicity. In this review, the processing effects on protein structure and allergenicity are discussed along with the insinuations of recent studies and techniques for establishing a platform to investigate future pathway to reduce or eliminate allergenicity in the population.

  9. Explaining the Effectiveness of the Contrast Culture Method for Managing Interpersonal Interactions across Cultures

    Science.gov (United States)

    Hiratsuka, Hiroyoshi; Suzuki, Hanako; Pusina, Alexis

    2016-01-01

    One of the current challenges in the field of intercultural education comes from the limited availability of training efficacy studies. The present study focused on explaining the effectiveness of the Contrast Culture Method (CCM) as an intercultural education method for managing interpersonal interactions across cultures between graduate…

  10. Exposure to radiation through the residual activity of waste treated by conventional methods

    International Nuclear Information System (INIS)

    Deckert, A.; Hoppe, G.; John, T.; Thierfeldt, S.

    1993-01-01

    Data obtained by questionnaires provided information on the type, amount, nuclide vector and maximum permissible value of low-level radioactive residues that occur in nuclear installations of due to industrial, scientific and medical uses of radioactive materials and are officially released to be disposed of by conventional methods. The general legal background of waste disposal methods, in particular the official regulations surrounding the waste disposal law, were described. On this basis, parameters and maximum radioactive burdens were specifically defined for garbage dumps for refuse from private households and those for building rubbish. Investigations were carried out into exposure paths that may have a role in the radioactive doses taken up by personnel (inhalation) or the general population (ingestion) through contaminated water. The radiation dose attributable to those exposure paths were expressed in relation to a specific unit activity of waste (1 bq/G). A dose of 10 μ Sv/r was taken as a standard to define a threshold value for each individual nuclide released for conventional waste disposal. It appears reasonable that such values are determined for groups of nuclides. (HP) [de

  11. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  12. Intestinal preparation for colon enema with fosfo-soda fleet versus the conventional method

    International Nuclear Information System (INIS)

    Vecchioli Caldazza, A.; Celi, G.; De Franco, A.; Parrella, A.; Minordi, L.M.; Marano, P.

    1999-01-01

    The authors evaluate the possible optimization of a well-tolerated and versatile method of intestinal preparation able to adequately free the lumen and consequently improve diagnostic results with a lower risk of prolonged hospital stay for incorrectly prepared patients. They examined 40 patients, namely 20 men and 20 women referred to the Institute of radiology of the 'Sacro Cuore' Catholic University of Rome (Italy), Gastrointestinal tract unit, to undergo double contrast colonic enema. The statistical analysis of all data was performed with Wilcoxon test. Intestinal preparation with fosfo-soda fleet appeared to be definitely better than the conventional method relative to tolerance, while providing similarly satisfactory data relative to the other parameters [it

  13. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  14. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  15. An alternative method for Plasmodium culture synchronization.

    Science.gov (United States)

    Lelièvre, J; Berry, A; Benoit-Vical, F

    2005-03-01

    Since the synchronization of Plasmodium falciparum has become an essential tool in research, we have investigated the use of a commercial gelatine solution, Plasmion, to replace Plasmagel, which is now difficult to obtain. This method also avoids the use of techniques based on Percoll-glucose gradients. The Plasmion-based technique proved to be a good method and could become an alternative to Plasmagel.

  16. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  17. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  18. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  19. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  20. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for

  1. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  2. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  3. Suggestions on the Development of Safety Culture Assessment Method

    International Nuclear Information System (INIS)

    Choi, Young Sung; Choi, Kwang Sik; Kim, Woong Sik

    2006-01-01

    Several efforts have been made to assess safety culture of organization that operates nuclear power plants in Korea. The MOST and KINS played a major role to develop assessment methods and KHNP applied them to its NPPs. This paper explains the two methods developed by KINS briefly and presents the insights obtained from the two different applications. It concludes with some suggestions for safety culture assessment based on the insights

  4. Evaluation of osteoporosis using conventional radiographic methods and dual energy x-ray absorptiometry

    International Nuclear Information System (INIS)

    Anburajan, M.

    2001-01-01

    In India, conventional radiographs play a major part in evaluating osteoporosis since advanced bone densitometers are expensive and not widely available. Our aim in this study was to investigate the usefulness of conventional radiographic methods, viz., clavicle and metacarpal radiogrammetry, quantitative vertebral morphometry, Singh's index, hip geometry compared to a sophisticated method, viz., DXA for studying osteoporosis in south Indian men (n=663) and women (n=741). This study provides data on BMD of the proximal femur in normal south Indian females. In women, aged above 65 years, BMD of femoral neck, trochanter, and Ward's triangle decreased by 0.90%, 0.84%, and 1.66% per annum, respectively. In 45 pre- and post-menopausal women without fractures, total hip BMD correlated significantly ( p 2 =0.47), medial cortical thickness of the femoral shaft (r 2 =0.38) and neck (r 2 =0.29), combined cortical thickness (CCT) and %CCT of the clavicle (r 2 =0.54 each), and the second metacarpal (r 2 =0.51 and r 2 =0.53, respectively). On comparing variables studied for osteoporotic women with corresponding values in the premenopausal group, the average difference in SD from the mean was greatest for clavicle radiogrammetry (-3.7 SD for %CCT of the clavicle). An empirical formula for predicting total hip BMD with good sensitivity was derived from a multiple linear regression equation involving three independent variables, viz., CCT, %CCT of the clavicle (measured from the chest radiograph) and the patient's age. This author's equation, with modified weightings, has 82% sensitivity and 94% specificity and a positive and negative predictive value of 88% and 91% respectively. A chest radiograph in combination with the formula would serve as a readily available, inexpensive tool for assessing post-menopausal osteoporosis, especially in developing countries

  5. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  6. The effect of Montessori Method on teaching cultural and creative ...

    African Journals Online (AJOL)

    The Effect of the Montessori Method on teaching was investigated among children to discover their artistic development in Zaria, Kaduna State. The problem of the study is that the Montessori Method on teaching cultural and creative arts is not adequately explored in the primary schools, while other teaching methods used, ...

  7. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

    Science.gov (United States)

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-10-19

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  8. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

    Directory of Open Access Journals (Sweden)

    Akiko Edagawa

    2015-10-01

    Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  9. Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

    International Nuclear Information System (INIS)

    Cota, P.L.

    1987-01-01

    The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

  10. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  11. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  12. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  13. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  14. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  15. Microbial Diversity of a Camembert-Type Cheese Using Freeze-Dried Tibetan Kefir Coculture as Starter Culture by Culture-Dependent and Culture-Independent Methods

    Science.gov (United States)

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese. PMID:25360757

  16. Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

    Directory of Open Access Journals (Sweden)

    Jun Mei

    Full Text Available The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR-denaturing gradient gel electrophoresis (DGGE analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates. Meanwhile, Kazachstania servazzii (51 isolates represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates. However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

  17. Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

    Science.gov (United States)

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

  18. Artificial neural networks versus conventional methods for boiling water reactor stability monitoring

    International Nuclear Information System (INIS)

    Hagen, T.H.J.J. van der

    1995-01-01

    The application of an artificial neural network (ANN) for boiling water reactor (BWR) stability monitoring was studied. A three-layer perceptron was trained on synthetic autocorrelation functions to estimate the decay ratio and the resonance frequency from measured neutron noise. Training of the ANN was improved by adding noise to the training patterns and by applying nonconventional error definitions in the generalized delta rule. The performance of the developed ANN was compared with those of conventional stability monitoring techniques. Explicit care was taken for generating unbiased test data. It is found that the trained ANN is capable of monitoring the stability of the Dodewaard BWR for four specific cases. By comparing properties such as the false alarm ratio, the alarm failure ratio, and the average time to alarm, it is shown that it performs worse than model-based methods in stability monitoring of exact second-order systems but that it is more robust (better resistant to corruptions of the input data and to deviations of the system at issue from an exact second-order system) than other methods. The latter explains its good performance on the Dodewaard BWR and is promising for the application of an ANN for stability monitoring of other reactors and for other operating conditions

  19. Treatment of waste water by a combined technique of radiation and conventional method

    International Nuclear Information System (INIS)

    Sakumoto, A.; Miyata, T.

    1984-01-01

    Treatment of waste water by radiation in combination with a conventional method such as biological oxidation, coagulation with Fe 2 (SO 4 ) 3 , and ozonation has been studied for reducing necessary dose. Ethylene glycol ethers, polyoxyethylene n-nonyl phenyl ether (NPE), polyvinyl alcohol (PVA), ethylene glycol, phenol, and oxalic acid were used as a model pollutant. The combined use of radiation and biological oxidation markedly improved the removal of TOC in aqueous oxygenated solution of ethylene glycol ethers. The combined use of radiation and coagulation had remarkable effects on the reduction of TOC in aqueous deoxygenated solution of NPE or PVA. The simultaneous use of radiation and ozone gave a synergistic effect on oxidative degradation of organic pollutants. The synergistic effect was suggested to arise from chain reactions having a powerful oxidizing agent (OH radical). The rate of TOC removal by the process depended on dose rate. Aqueous solution of 150 mg/l oxalic acid was treated by the combined use of electron beams and ozone using a new type of irradiation vessel to reduce TOC with G(-TOC) of 87 at 2.3 x 10 7 rad/h. The simultaneous use of radiation and ozone is superior to the removal of TOC by other combined methods and can be applied irrespective of the type of organic matter. (author)

  20. A simple method for multiday imaging of slice cultures.

    Science.gov (United States)

    Seidl, Armin H; Rubel, Edwin W

    2010-01-01

    The organotypic slice culture (Stoppini et al. A simple method for organotypic cultures of nervous tissue. 1991;37:173-182) has become the method of choice to answer a variety of questions in neuroscience. For many experiments, however, it would be beneficial to image or manipulate a slice culture repeatedly, for example, over the course of many days. We prepared organotypic slice cultures of the auditory brainstem of P3 and P4 mice and kept them in vitro for up to 4 weeks. Single cells in the auditory brainstem were transfected with plasmids expressing fluorescent proteins by way of electroporation (Haas et al. Single-cell electroporation for gene transfer in vivo. 2001;29:583-591). The culture was then placed in a chamber perfused with oxygenated ACSF and the labeled cell imaged with an inverted wide-field microscope repeatedly for multiple days, recording several time-points per day, before returning the slice to the incubator. We describe a simple method to image a slice culture preparation during the course of multiple days and over many continuous hours, without noticeable damage to the tissue or photobleaching. Our method uses a simple, inexpensive custom-built insulator constructed around the microscope to maintain controlled temperature and uses a perfusion chamber as used for in vitro slice recordings. (c) 2009 Wiley-Liss, Inc.

  1. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  2. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  3. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  4. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  5. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  6. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Ghoos, Y [UZ Gasthuisberg, Gastrointestinal Pathophysiology, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile); Lawson, F [Clinique Padre Pio, Cotonou (Benin); Muzeke, A [Faculte de Medicine, University of Kinshasa, Kinshasa (Congo); Ndjaye, M F [Cercle Senegalais Gastroenterologie, Dakar (Senegal)

    2000-07-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, {sup 13}CO{sub 2} and H{sub 2} breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  7. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  8. Cultural adaptation and translation of measures: an integrated method.

    Science.gov (United States)

    Sidani, Souraya; Guruge, Sepali; Miranda, Joyal; Ford-Gilboe, Marilyn; Varcoe, Colleen

    2010-04-01

    Differences in the conceptualization and operationalization of health-related concepts may exist across cultures. Such differences underscore the importance of examining conceptual equivalence when adapting and translating instruments. In this article, we describe an integrated method for exploring conceptual equivalence within the process of adapting and translating measures. The integrated method involves five phases including selection of instruments for cultural adaptation and translation; assessment of conceptual equivalence, leading to the generation of a set of items deemed to be culturally and linguistically appropriate to assess the concept of interest in the target community; forward translation; back translation (optional); and pre-testing of the set of items. Strengths and limitations of the proposed integrated method are discussed. (c) 2010 Wiley Periodicals, Inc.

  9. Characteristics of ovulation method acceptors: a cross-cultural assessment.

    Science.gov (United States)

    Klaus, H; Labbok, M; Barker, D

    1988-01-01

    Five programs of instruction in the ovulation method (OM) in diverse geographic and cultural settings are described, and characteristics of approximately 200 consecutive OM acceptors in each program are examined. Major findings include: the religious background and family size of acceptors are variable, as is the level of previous contraceptive use. Acceptors are drawn from a wide range of socioeconomic and religious backgrounds; however, family planning intention was similarly distributed in all five countries. In sum, the ovulation method is accepted by persons from a variety of backgrounds within and between cultural setting.

  10. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  11. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  12. Performance of a real-time PCR assay in routine bovine mastitis diagnostics compared with in-depth conventional culture.

    Science.gov (United States)

    Hiitiö, Heidi; Riva, Rauna; Autio, Tiina; Pohjanvirta, Tarja; Holopainen, Jani; Pyörälä, Satu; Pelkonen, Sinikka

    2015-05-01

    Reliable identification of the aetiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for detecting the most common udder pathogens directly from milk. In this study aseptically taken quarter milk samples were analysed with a real-time PCR assay (Thermo Scientific PathoProof Mastitis Complete-12 Kit, Thermo Fisher Scientific Ltd.) and by semi-quantitative, in-depth bacteriological culture (BC). The aim of the study was to evaluate the diagnostic performance of the real-time PCR assay in routine use. A total of 294 quarter milk samples from routine mastitis cases were cultured in the national reference laboratory of Finland and examined with real-time PCR. With BC, 251 out of 294 (85.7%) of the milk samples had at least one colony on the plate and 38 samples were considered contaminated. In the PCR mastitis assay, DNA of target species was amplified in 244 samples out of 294 (83.0%). The most common bacterial species detected in the samples, irrespective of the diagnostic method, was the coagulase negative staphylococci (CNS) group (later referred as Staphylococcus spp.) followed by Staphylococcus aureus. Sensitivity (Se) and specificity (Sp) for the PCR assay to provide a positive Staph. aureus result was 97.0 and 95.8% compared with BC. For Staphylococcus spp., the corresponding figures were 86.7 and 75.4%. Our results imply that PCR performed well as a diagnostic tool to detect Staph. aureus but may be too nonspecific for Staphylococcus spp. in routine use with the current cut-off Ct value (37.0). Using PCR as the only microbiological method for mastitis diagnostics, clinical relevance of the results should be carefully considered before further decisions, for instance antimicrobial treatment, especially when minor pathogens with low amount of DNA have been detected. Introducing the concept of contaminated samples should also be considered.

  13. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  14. Simple method for culture of peripheral blood lymphocytes of Testudinidae.

    Science.gov (United States)

    Silva, T L; Silva, M I A; Venancio, L P R; Zago, C E S; Moscheta, V A G; Lima, A V B; Vizotto, L D; Santos, J R; Bonini-Domingos, C R; Azeredo-Oliveira, M T V

    2011-12-06

    We developed and optimized a simple, efficient and inexpensive method for in vitro culture of peripheral blood lymphocytes from the Brazilian tortoise Chelonoidis carbonaria (Testudinidae), testing various parameters, including culture medium, mitogen concentration, mitotic index, culture volume, incubation time, and mitotic arrest. Peripheral blood samples were obtained from the costal vein of four couples. The conditions that gave a good mitotic index were lymphocytes cultured at 37°C in minimum essential medium (7.5 mL), with phytohemagglutinin as a mitogen (0.375 mL), plus streptomycin/penicillin (0.1 mL), and an incubation period of 72 h. Mitotic arrest was induced by 2-h exposure to colchicine (0.1 mL), 70 h after establishing the culture. After mitotic arrest, the cells were hypotonized with 0.075 M KCl for 2 h and fixed with methanol/acetic acid (3:1). The non-banded mitotic chromosomes were visualized by Giemsa staining. The diploid chromosome number of C. carbonaria was found to be 52 in females and males, and sex chromosomes were not observed. We were able to culture peripheral blood lymphocytes of a Brazilian tortoise in vitro, for the preparation of mitotic chromosomes.

  15. Dialectical Method and the Critical Political Economy of Culture

    Directory of Open Access Journals (Sweden)

    Brice Nixon

    2012-05-01

    Full Text Available This article argues that the quality that defines critical political economy is its critical method. Definitions of the critical political economy of culture are considered and shown to focus on specific theoretical concerns while not fully addressing the fundamental issue of method. Method is here discussed in terms of the way human reason is used to produce knowledge. A critical method for Marx is a historical materialist dialectical method, thus this paper argues for a deeper consideration of the Marxist dialectical method in relation to critical political-economic theorizing. Sources for methodological consideration from Marx to 20th-century Western Marxists are outlined. The potential contribution of the Marxist dialectical method in the continued development of the critical political economy of culture is demonstrated by showing the possibility of developing a complementary critical political economy of consciousness. Smythe’s theorizing of audiences as workers is considered as a useful starting point, and its potential development through incorporation of the work of other critical scholars of media and culture is outlined.

  16. Sponge cell culture? A molecular identification method for sponge cells

    NARCIS (Netherlands)

    Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

  17. Effect of integration of cultural, botanical, and chemical methods of ...

    African Journals Online (AJOL)

    A field experiment was conducted from November 2011 to June 2013 to evaluate the effects of botanical, cultural, and chemical methods on termite colony survival, crop and wooden damage, and other biological activities in Ghimbi district of western Ethiopia. The termite mounds were dug and the following treatments were ...

  18. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  19. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  20. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  1. Effect of Chemistry Triangle Oriented Learning Media on Cooperative, Individual and Conventional Method on Chemistry Learning Result

    Science.gov (United States)

    Latisma D, L.; Kurniawan, W.; Seprima, S.; Nirbayani, E. S.; Ellizar, E.; Hardeli, H.

    2018-04-01

    The purpose of this study was to see which method are well used with the Chemistry Triangle-oriented learning media. This quasi experimental research involves first grade of senior high school students in six schools namely each two SMA N in Solok city, in Pasaman and two SMKN in Pariaman. The sampling technique was done by Cluster Random Sampling. Data were collected by test and analyzed by one-way anova and Kruskall Wallish test. The results showed that the high school students in Solok learning taught by cooperative method is better than the results of student learning taught by conventional and Individual methods, both for students who have high initial ability and low-ability. Research in SMK showed that the overall student learning outcomes taught by conventional method is better than the student learning outcomes taught by cooperative and individual methods. Student learning outcomes that have high initial ability taught by individual method is better than student learning outcomes that are taught by cooperative method and for students who have low initial ability, there is no difference in student learning outcomes taught by cooperative, individual and conventional methods. Learning in high school in Pasaman showed no significant difference in learning outcomes of the three methods undertaken.

  2. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  3. The discussion on the qualitative and quantitative evaluation methods for safety culture

    International Nuclear Information System (INIS)

    Gao Kefu

    2005-01-01

    The fundamental methods for safely culture evaluation are described. Combining with the practice of the quantitative evaluation of safety culture in Daya Bay NPP, the quantitative evaluation method for safety culture are discussed. (author)

  4. Water Quality Improvement of Media Culture for Tilapia (Oreochromis niloticus) with Cleaner Production Method

    Science.gov (United States)

    Haeruddin; Supriharyono; Febrianto, S.

    2018-02-01

    The tilapia (Oreochromis niloticus), is known as a high adaptability and brackish water tolerance fish. This fish is also has a meat with high protein content, that ranges about 65 -75%. Generally the tilapia is cultured using a conventional system with high density. It is caused degradation of water quality of media culture, and finally increase mortality rate of fish cultured. The application of tilapia cultivation with cleaner production method by giving enzyme into the feed to upgrade the efficiency of feed utilization, presumed that could improve the water quality of cultivation media. It is due to the lower of feed and feces residues. Therefore the concentration of toxic compounds, such as ammonia, nitrite and sulfide, will be lower. The experiments were conducted for 35 days with a completely factorial randomized design. The first factor was the dosage of enzyme in the feed, consisting of 4 dosages, and the second factor was the duration of the test fish maintenance (5 weeks). Water quality variables examined included ammonia, nitrite and sulfide. The results showed that enzyme dosage had no significantly impact on ammonia, nitrite and sulfide concentrations in the test media culture. However, the feeding with enzyme in low dosage, resulted less concentration of ammonia, nitrite and sulfide than it was without enzyme). The duration of fish cultured has significantly effect on the concentration of ammonia, nitrite and sulfide in the test media. While it is no significantly correlation between dosage and duration of maintenance.

  5. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  6. The effect of three culture methods on intensive culture system of pacific white shrimp ( Litopenaeus vannamei)

    Science.gov (United States)

    Ma, Zhen; Wan, Rong; Song, Xiefa; Gao, Lei

    2013-09-01

    Different culture methods may affect the intensive culture system of Pacific white shrimp ( Litopenaeus vannamei) regarding water quality and growth and economic performance. This study evaluated the potential effects of three culture methods through cultivation of juvenile shrimps under consistent tank management conditions for 84 d. The three methods involved shrimp cultivation in different tanks, i.e., outdoor tanks with cement bottom (mode-C), greenhouse tanks with cement bottom (mode-G) and outdoor tanks with mud-substrate (mode-M). Results showed that water temperature was significantly higher in mode-G than that in mode-C ( P shrimps. In the mid-late period, the average concentrations of TAN, NO2-N, DIP and COD were significantly lower in mode-M and mode-G compared with those in mode-C ( P shrimp weight among different treatments ( P > 0.05), mode-M had significantly higher shrimp yield, survival rate and feed conversion rate ( P < 0.05) than other modes. There were significant differences in revenue and net return among different treatments ( P < 0.05). These demonstrated that the treatments of mode-G and mode-M were conductive to the intensive culture system of L. vannamei.

  7. Simple Sample Preparation Method for Direct Microbial Identification and Susceptibility Testing From Positive Blood Cultures.

    Science.gov (United States)

    Pan, Hong-Wei; Li, Wei; Li, Rong-Guo; Li, Yong; Zhang, Yi; Sun, En-Hua

    2018-01-01

    Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.

  8. Simple Sample Preparation Method for Direct Microbial Identification and Susceptibility Testing From Positive Blood Cultures

    Directory of Open Access Journals (Sweden)

    Hong-wei Pan

    2018-03-01

    Full Text Available Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in <15 min. The correct rate of direct MALDI-TOF MS identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.

  9. Treatment of children with Helicobacter infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); Lawson, W [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absoptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    There is a large interest about Heliobacter pylori infection in childhood nowadays. The prevalence of infection is very high in developing countries and this is extremely correlated to the living conditions with consequences on the future health of children. Contamination mode is not well known but environment factors are involved. We used {sup 13}C Urea Breath Test to assess the prevalence rate in beninese asymptomatic children aged 7-11 years old (about 86%). We evaluated the influence of either conventional or probiotics therapy in eradicating Hp infection and some relationships with growth parameters. We concluded that conventional therapy or use of probiotics might improve infection status and probably influence growth factors in childhood. (author)

  10. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  11. Comparative study on flow rate measurement by nuclear and conventional methods in selected rivers at Ulu Langat district, Selangor

    Energy Technology Data Exchange (ETDEWEB)

    Wan Mohamad Tahir, Wan Zakaria; Mohamad, Daud; Hamzah, Abdul Razak; Yusuf, Johari Mohamad; Aziz Wan Mohamad, Wan Abdul

    1986-06-01

    A radiotracer technique using Tc-99 to measure flows of small rivers was introduced in Malaysia. Three rivers in the Ulu Langat District were selected for a comparative study on flow rate determination by conventional and radioisotope methods. Radioisotopic approach, comprising injection procedures, calibration, mixing length and safety aspects are discussed. The results measured by radioisotope method are compared to the Drainage and Irrigation Department's (DID's) discharge curves data collected from 1980 to 1982 which is calibrated using a current meter. The results are comparable and fall within the range obtained by conventional method. Related to this study, a comprehensive work on stream gauging of moderate and high flow rates using both methods is proposed to be carried out directly.

  12. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  13. Methods to Improve Cultural Communication Skills in Special Operations Forces

    National Research Council Canada - National Science Library

    Wise, J

    1998-01-01

    .... Three culture-specific templates were developed, each describing a culture and identifying culture-specific behaviors that were prioritized through focus groups of cultural informants and clustering analysis...

  14. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  15. Effect of amaranth dye on the growth and properties of conventional and SR method grown KAP single crystals

    Science.gov (United States)

    Babu Rao, G.; P., Rajesh; Ramasamy, P.

    2018-04-01

    The 0.1 mol% amaranth added KAP single crystals were grown from aqueous solutions by both slow evaporation solution technique and Sankaranarayanan-Ramasamy method. The single crystal having dimension of 45 mm length and 12 mm diameter was grown with growth rate of 1.5 mm/day using SR method. 87 % transmittance is obtained for SR method grown amaranth added KAP single crystal. The high intense luminescence at 661 nm is obtained from amaranth added conventional and SR method grown KAP single crystal. The amaranth added KAP single crystal possesses good mechanical and laser damage threshold stability.

  16. Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system

    Directory of Open Access Journals (Sweden)

    N S Ozen

    2011-01-01

    Full Text Available Purpose: Differentiation of Staphylococcus aureus (S. aureus from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT, slide agglutination test (Dry Spot Staphytect Plus, conventional polymerase chain reaction (PCR and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. Materials and Methods: A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. Results: The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Conclusion: Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

  17. Blood culture bottles are superior to lysis-centrifugation tubes for bacteriological diagnosis of spontaneous bacterial peritonitis.

    OpenAIRE

    Siersema, P D; de Marie, S; van Zeijl, J H; Bac, D J; Wilson, J H

    1992-01-01

    The conventional method of ascitic fluid culturing was compared with the bedside inoculation of ascites into blood culture bottles and into lysis-centrifugation tubes. The conventional culture method was compared with the blood culture bottle method in 31 episodes of spontaneous bacterial peritonitis (SBP). Cultures were positive with the conventional culture method in 11 (35%) episodes and with the blood culture bottle method in 26 (84%) episodes (P less than 0.001). The lysis-centrifugation...

  18. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  19. Diversity of endophytic bacteria of Dendrobium officinale based on culture-dependent and culture-independent methods

    Directory of Open Access Journals (Sweden)

    Cong Pei

    2017-01-01

    Full Text Available Culture-dependent and culture-independent methods were compared and evaluated in the study of the endophytic diversity of Dendrobium officinale. Culture-independent methods consisted of polymerase chain reaction–denaturing gradient gel electrophoresis (PCR-DGGE and metagenome methods. According to the results, differences were found between the three methods. Three phyla, namely Firmicutes, Proteobacteria, and Actinobacteria, were detected using the culture-dependent method, and two phyla, Firmicutes and Proteobacteria, were detected by the DGGE method. Using the metagenome method, four major phyla were determined, including Proteobacteria (76.54%, Actinobacteria (18.56%, Firmicutes (2.27%, and Bacteroidetes (1.56%. A distinct trend was obtained at the genus level in terms of the method and the corresponding number of genera determined. There were 449 genera and 16 genera obtained from the metagenome and DGGE methods, respectively, and only 7 genera were obtained through the culture-dependent method. By comparison, all the genera from the culture-dependent and DGGE methods were contained in the members determined using the metagenome method. Overall, culture-dependent methods are limited to ‘finding’ endophytic bacteria in plants. DGGE is an alternative to investigating primary diversity patterns; however, the metagenome method is still the best choice for determining the endophytic profile in plants. It is essential to use multiphasic approaches to study cultured and uncultured microbes.

  20. Development of a New Safety Culture Assessment Method for Nuclear Power Plants (NPPs) (A study to suggest a new safety culture assessment method in nuclear power plants)

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sang Min; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)

    2014-08-15

    This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness.

  1. Development of a New Safety Culture Assessment Method for Nuclear Power Plants (NPPs) (A study to suggest a new safety culture assessment method in nuclear power plants)

    International Nuclear Information System (INIS)

    Han, Sang Min; Seong, Poong Hyun

    2014-01-01

    This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness

  2. Electron microscopy methods in studies of cultural heritage sites

    Energy Technology Data Exchange (ETDEWEB)

    Vasiliev, A. L., E-mail: a.vasiliev56@gmail.com; Kovalchuk, M. V.; Yatsishina, E. B. [National Research Centre “Kurchatov Institute” (Russian Federation)

    2016-11-15

    The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

  3. Electron microscopy methods in studies of cultural heritage sites

    Science.gov (United States)

    Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.

    2016-11-01

    The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient "nanotechnologies"; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

  4. Electron microscopy methods in studies of cultural heritage sites

    International Nuclear Information System (INIS)

    Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.

    2016-01-01

    The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

  5. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  6. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  7. Culture-Bound Syndromes of a Brazilian Amazon Riverine population: Tentative correspondence between traditional and conventional medicine terms and possible ethnopharmacological implications.

    Science.gov (United States)

    Pagani, E; Santos, J de F L; Rodrigues, E

    2017-05-05

    It is not always possible to correlate the "emic" terms to the "etic" ones during ethnopharmacological surveys, especially regarding those related to Culture-Bound Syndromes (CBS). Nevertheless, it is the role of ethnopharmacology to address these correlations, since they are the basis for the understanding of potential bioactives. This study reports the clinical manifestations and therapeutic resources used for the treatment of CBS among some riverine inhabitants of Brazilian Amazonia. An effort was made to establish a correspondence between the local "emic" terms of traditional medicine and the symptoms or diseases known by conventional medicine ("etic" terms). The ultimate goal was to gain insights to suggest further pharmacological studies with the local resources. Fieldwork was guided by methods of anthropology, botany and zoology-with the assistance of a doctor-among the traditional healing experts in Jaú National Park (during 199 days in 1995) and Unini River Extractive Reserve (210 days from 2008 to 2012). Fifty-nine healers of different kinds were interviewed: a prayer-maker, medium, natural resource expert, massage therapist, midwife and snakebite healer. The clinical manifestations and healing resources of the following CBS were collected: "mau olhado" (evil eye), "quebrante" (chipping); "espante" (fright or susto); "doença do ar" (air diseases); "vento caído" (fallen wind); "derrame" (leakage); "mãe do corpo" (mother of the body) and "panema" (unlucky). The first three seem to be local variations of other CBSs already described in Latin America. "doença do ar", "vento caído", "derrame" and "mãe do corpo" seem to be folk terms for known conventional medical disorders, while "panema" is a yet undescribed Brazilian CBS that is possibly related to dysthymic disorder or depression and deserves further investigation. Treatments included prayer rituals, fumigation, baths and oral remedies using 25 plants and 10 animals. It was possible to establish

  8. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  9. Understanding Global / Local Cultural Leadership : Issues and Methods

    NARCIS (Netherlands)

    Kolsteeg, Johan

    2017-01-01

    Cultural leaders sail between the Scylla and Charibdis of aggregated trans- and supranational cultural-political discourses and the cultural needs of local communities. How do these dynamics influence the work of cultural leaders? How can we understand the work of cultural leaders to connect

  10. Comparison of PCR method with the culture method for identification of gonococci from endocervical swabs

    Directory of Open Access Journals (Sweden)

    Alam A

    2002-01-01

    Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.

  11. Culture, Method, and the Content of Self-Concepts: Testing Trait, Individual-Self-Primacy, and Cultural Psychology Perspectives.

    Science.gov (United States)

    Del Prado, Alicia M; Church, A Timothy; Katigbak, Marcia S; Miramontes, Lilia G; Whitty, Monica; Curtis, Guy J; de Jesús Vargas-Flores, José; Ibáñez-Reyes, Joselina; Ortiz, Fernando A; Reyes, Jose Alberto S

    2007-12-01

    Three theoretical perspectives on cultural universals and differences in the content of self-concepts were tested in individualistic (United States, n = 178; Australia, n = 112) and collectivistic (Mexico, n = 157; Philippines, n = 138) cultures, using three methods of self-concept assessment. Support was found for both trait perspectives and the individual-self-primacy hypothesis. In contrast, support for cultural psychology hypotheses was limited because traits and other personal attributes were not more salient, or social attributes less salient, in individualistic cultures than collectivistic cultures. The salience of some aspects of self-concept depended on the method of assessment, calling into question conclusions based on monomethod studies.

  12. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  13. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  14. Comparison of four methods for rapid identification of Staphylococcus aureus directly from BACTEC 9240 blood culture system.

    Science.gov (United States)

    Ozen, N S; Ogunc, D; Mutlu, D; Ongut, G; Baysan, B O; Gunseren, F

    2011-01-01

    Differentiation of Staphylococcus aureus (S. aureus) from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS) from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT), slide agglutination test (Dry Spot Staphytect Plus), conventional polymerase chain reaction (PCR) and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs) with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.

  15. A new method to culture sweetpotato in space farming

    Science.gov (United States)

    Tsuyuki, I.; Ishii, Y.; Oda, M.; Kitaya, Y.; Mori, G.

    Sweetpotato production in space has many advantages over that of other crops; the plant has a higher growth rate and a higher yield with less fertilizer and less water, and functions as an efficient CO_2/O_2 converter. In a limited space in space farming, however, it is not favorable that sweetpotato shoots develop vigorously while the roots have not enlarged yet, because the sweetpotato organ of interest is not the shoot but the tuberous root. Cuttings of sweetpotato (Ipomoea batatas Lam. "Beniazuma") were used in this study. Each cutting was cut off from the 2nd - 10th nodes from the apices of mother branches and consisted of one expanded leaf, one node and five cm long stem. The cuttings were cultured suboptimally on a mixed soil (peat-moss:vermiculite=1:1 in volume) in a greenhouse under sunlight. Growth characteristics of the cuttings removed axillary buds were compared with cuttings with axillary buds in the first experiment. The cuttings without axillary buds started tuberous root bulking about 30 days after the onset of the experiment. The harvest index (tuberous root dry mass/total dry mass) was 0.5 after 70 days. Whereas, the control plant with an axillary bud developed a lateral shoot and formed no tuberous root during 70 days in the experiment. It was necessary to remove the axillary buds in order to form the tuberous roots in this method. To evaluate the effect of light intensity on tuberous root formation, cuttings without axillary buds were shaded with cheesecloth having 43% of light transmittance in the second experiment. The tuberous root formation was retarded 50 days in shaded cuttings compared with control cuttings. The tuberous roots were quickly formed and the large harvest index was ensured in this method with cuttings without axillary buds. Therefore the method is expected to be advantageous to culture sweetpotato at a high density with rapid turn over in a limited culture space in space farming.

  16. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  17. Comparative Analysis of Conventional Method with Activity Based Costing in PT Mulia Sejati Gallery

    OpenAIRE

    Erena, Irma Nadia; Gani, Engelwati

    2016-01-01

    The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data ana...

  18. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  19. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  20. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  1. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  2. [Application of a modified culturing method for lymphocytes in cytogenetic research].

    Science.gov (United States)

    Gao, Chaoxian; Hui, Changye; Zhang, Wen; Guo, Yan; Li, Limei; Chen, Yuting; Zhang, Liuzhuo; Yang, Xinyue; Huang, Xianqing

    2016-08-01

    To establish a modified method for microculturing whole human blood for cytogenetic analysis. A novel tube rack was designed to overcome the drawbacks of directly culturing the cells within centrifuge tubes. The fractions of human plasma, human serum and two commercial fetal bovine sera were analyzed with 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The influence of adding 0%, 5%, 10%, 15%, 20%, 25% and 30% autologous plasma to the culture on lymphocyte transformation rate and mitotic index (MI) was examined. The SDS-PAGE analysis showed a significant difference between commercial fetal bovine sera, and that the components of human plasma were similar to those of fetal bovine serum. The value of MI in lymphocyte was evidently increased along with addition of autologous plasma. However, this has exerted no significant effect on the transformation rate. With the addition of 10% autologous plasma, the MI value has become much higher than the conventional method. A modified method was established by application of a novel tube inclined rack and optimization of whole blood inoculation. This method is easier and cheaper, and is suitable for application in clinical practice.

  3. Participatory Methods and UCA Project: understanding technologies as culture

    Directory of Open Access Journals (Sweden)

    Magda Pischetola

    2015-12-01

    Full Text Available Abstract In the complex and changing context of digital culture, the media become an important space of relation, as they have the crucial role of articulating new cultural logics that lead to disruptions in the school environment. To understand this change, new methods of analysis and research have been created, the so-called Participatory Methodologies. They are action research strategies aimed at intervening in a given social situation. In the analysis proposed here, such methodologies will help us to address the challenge of involving digital technologies in school culture, through the participation of different individuals involved. Two qualitative case studies about the project Um Computador por Aluno – the Brazilian One Laptop per Child -, carried out in 2012 in the schools of Santa Catarina and Bahia, are the first of two phases of the research presented. The results concern a "vertical" form of technology insertion in schools, which led to frustration and de-motivation at several levels. Starting from these considerations, the second stage of research proposes a pedagogical intervention in one of four schools in the field. The methodologies of participatory video and photography are chosen as possibilities of action-reflection-action on the sociocultural reality of students through the experience of sharing. The results show the importance of carrying out creative activities, appropriate to a social conception of learning, as well as the centrality of children and youth as agency and a broader need to redefine the relationship between teacher and student, in a more "horizontal" perspective process of teaching and learning. Keywords: Projeto UCA. Participatory Research Method. Innovative teaching-learning.

  4. Development and comparison of a real-time PCR assay for detection of Dichelobacter nodosus with culturing and conventional PCR: harmonisation between three laboratories

    DEFF Research Database (Denmark)

    Frosth, Sara; Slettemeås, Jannice S.; Jørgensen, Hannah J.

    2012-01-01

    BACKGROUND: Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet...... was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126...... laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. CONCLUSIONS...

  5. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  7. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  8. Co-interviewing across gender and culture: expanding qualitative research methods in Melanesia.

    Science.gov (United States)

    Redman-MacLaren, Michelle L; Api, Unia K; Darius, Matupit; Tommbe, Rachael; Mafile'o, Tracie A; MacLaren, David J

    2014-09-06

    The social and cultural positions of both researchers and research participants influence qualitative methods and study findings. In Papua New Guinea (PNG), as in other contexts, gender is a key organising characteristic and needs to be central to the design and conduct of research. The colonial history between researcher and participant is also critical to understanding potential power differences. This is particularly relevant to public health research, much of which has emerged from a positivist paradigm. This paper describes our critical reflection of flexible researcher responses enacted during qualitative research in PNG. Led by a senior male HIV researcher from PNG, a male from a PNG university and a female from an Australian university conducted qualitative interviews about faith-based responses to HIV in PNG. The two researchers planned to conduct one-on-one interviews matching gender of participants and interviewer. However, while conducting the study, four participants explicitly requested to be interviewed by both researchers. This experience led us to critically consider socially and culturally situated ways of understanding semi-structured interviewing for public health research in Melanesia. New understandings about public health research include: (i) a challenge to the convention that the researcher holds more power than the research participant, (ii) the importance of audience in Melanesia, (iii) cultural safety can be provided when two people co-interview and (iv) the effect an esteemed leader heading the research may have on people's willingness to participate. Researchers who occupy insider-outsider roles in PNG may provide participants new possibilities to communicate key ideas. Our recent experience has taught us public health research methods that are gender sensitive and culturally situated are pivotal to successful research in Melanesia. Qualitative research requires adaptability and reflexivity. Public health research methods must continue

  9. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Ndiaye, M F; Mbengue, M; Mbaye, P S; Diouf, S [Societe Senegalaise de Gasto-enterologie et d' hepatologie, Dakar (Senegal); Ghoos, Y [Labo. Digestie Absorptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    Helicobacter pylori infection is one of the most common bacterial infection (82 %) in Senegal where malnutrition is common in children (25 %). Our aims were to definite prevalence of H. pylori, to determine the relationship between Hp infection and undernourishment and to verify the efficiency of treatment with probiotic. In some studies a positive effect of Saccharomyces boulardii has been demonstrated against H. pylori. We have included healthy children 7 to 10 years of age. 108 out of 129 (84%) were H. pylori-positive by breath-test. Two groups were randomised. Group A was treated with ten days' standard triple therapy (Omeprazole 1 mg Kg/day in single day gift, Amoxycillin 50 mg/kg/two times per day and Clarithromycin 250 mg two times per day). Group B received probiotic (250 mg of Saccharomyces boulardii with 5g Inulin three times per day) for 3 months. Evaluation of treatment was done one month after the end of therapy. Seventy one children out of 110 (64.5%) had digestive symptoms in their medical history. The main signs were recurrent abdominal pain in 64 cases. BMI were less than 18.50 in all the children with H. pylori infection without other nutritional abnormaly. Eight children were eradicated after treatment seven in the group under conventional treatment (58%) and one in the group under probiotics (6%). We concluded that prevalence of H. pylori infection is very high in young children as of the 7 years' age in urban as in rural environments. Symptoms are not specific. No significant difference in the nutritional state is observed between H. pylori-positive and H. pylori-negative children. Treatment by probiotics does not seem to give efficient results for eradication of H. pylori. (author)

  10. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  11. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  12. A non-conventional watershed partitioning method for semi-distributed hydrological modelling: the package ALADHYN

    Science.gov (United States)

    Menduni, Giovanni; Pagani, Alessandro; Rulli, Maria Cristina; Rosso, Renzo

    2002-02-01

    The extraction of the river network from a digital elevation model (DEM) plays a fundamental role in modelling spatially distributed hydrological processes. The present paper deals with a new two-step procedure based on the preliminary identification of an ideal drainage network (IDN) from contour lines through a variable mesh size, and the further extraction of the actual drainage network (AND) from the IDN using land morphology. The steepest downslope direction search is used to identify individual channels, which are further merged into a network path draining to a given node of the IDN. The contributing area, peaks and saddles are determined by means of a steepest upslope direction search. The basin area is thus partitioned into physically based finite elements enclosed by irregular polygons. Different methods, i.e. the constant and variable threshold area methods, the contour line curvature method, and a topologic method descending from the Hortonian ordering scheme, are used to extract the ADN from the IDN. The contour line curvature method is shown to provide the most appropriate method from a comparison with field surveys. Using the ADN one can model the hydrological response of any sub-basin using a semi-distributed approach. The model presented here combines storm abstraction by the SCS-CN method with surface runoff routing as a geomorphological dispersion process. This is modelled using the gamma instantaneous unit hydrograph as parameterized by river geomorphology. The results are implemented using a project-oriented software facility for the Analysis of LAnd Digital HYdrological Networks (ALADHYN).

  13. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  14. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  15. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

  16. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  17. A comparison of new and conventional methods for quantification of tooth color

    NARCIS (Netherlands)

    Burgt, van der T.P.; Bosch, ten J.J.; Borsboom, P.C.F.; Kortsmit, W.J.P.M.

    1990-01-01

    Tooth color is caused by volume reflection, that is, passage of incident light through the tooth followed by backward emergence. This passage is concurrent with sideward displacement of photons that, in effect, influences the result of usual instrumental methods of determining tooth color. This

  18. Near infrared spectrometry for faecal fat measurement: comparison with conventional gravimetric and titrimetric methods.

    Science.gov (United States)

    Benini, L; Caliari, S; Guidi, G C; Vaona, B; Talamini, G; Vantini, I; Scuro, L A

    1989-01-01

    This investigation was aimed at comparing a new method for measuring faecal fat excretion, carried out with a semi-automated instrument by using near infrared analysis (NIRA), with the traditional titrimetric (Van de Kamer) and gravimetric (Sobel) methods. Near infrared analysis faecal fat was assayed on the three day stool collection from 118 patients (68 chronic pancreatitis, 19 organic diseases of the gastrointestinal tract, 19 alcoholic liver disease, 12 functional gastrointestinal disorders). A strict linear correlation was found between NIRA and both the titrimetric (r = 0.928, p less than 0.0001) and the gravimetric (r = 0.971, p less than 0.0001) methods. On homogenised faeces, a mean coefficient of variation of 2.1 (SD 1.71)% was found. Before homogenisation (where a mean coefficient of variation of 7% was found) accurate results were obtained when the mean of five measurements was considered. In conclusion, the assay of faecal fat excretion by the near infrared reflessometry appears a simple, rapid and reliable method for measuring steatorrhoea. PMID:2583563

  19. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  20. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  1. Evaluation of head and neck cancer with 18F-FDG PET: a comparison with conventional methods

    International Nuclear Information System (INIS)

    Kresnik, E.; Mikosch, P.; Gallowitsch, H.J.; Heinisch, M.; Unterweger, O.; Kumnig, G.; Gomez, I.; Lind, P.; Kogler, D.; Wieser, S.; Gruenbacher, G.; Raunik, W.

    2001-01-01

    The aim of this study was to evaluate the usefulness of 18 F-FDG PET in the diagnosis and staging of primary and recurrent malignant head and neck tumours in comparison with conventional imaging methods [including ultrasonography, radiography, computed tomography (CT) and magnetic resonance imaging (MRI)], physical examination, panendoscopy and biopsies in clinical routine. A total of 54 patients (13 female, 41 male, age 61.3±12 years) were investigated retrospectively. Three groups were formed. In group I, 18 F-FDG PET was performed in 15 patients to detect unknown primary cancers. In group II, 24 studies were obtained for preoperative staging of proven head and neck cancer. In group III, 18 F-FDG PET was used in 15 patients to monitor tumour recurrence after radiotherapy and/or chemotherapy. In all patients, imaging was obtained at 70 min after the intravenous administration of 180 MBq 18 F-FDG. In 11 of the 15 patients in group I, the primary cancer could be found with 18 F-FDG, yielding a detection rate of 73.3%. In 4 of the 15 patients, CT findings were also suggestive of the primary cancer but were nonetheless equivocal. In these patients, 18 F-FDG showed increased 18 F-FDG uptake by the primary tumour, which was confirmed by histology. One patient had recurrence of breast carcinoma that could not be detected with 18 F-FDG PET, but was detected by CT. In three cases, the primary cancer could not be found with any imaging method. Among the 24 patients in group II investigated for staging purposes, 18 F-FDG PET detected a total of 13 local and three distant lymph node metastases, whereas the conventional imaging methods detected only nine local and one distant lymph node metastases. The results of 18 F-FDG PET led to an upstaging in 5/24 (20.8%) patients. The conventional imaging methods were false positive in 5/24 (20.8%). There was one false positive result using 18 F-FDG PET. Among the 15 patients of group III with suspected recurrence after radiotherapy

  2. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  3. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  4. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  5. Comparison of conventional versus Hybrid knife peroral endoscopic myotomy methods for esophageal achalasia: a case-control study.

    Science.gov (United States)

    Tang, Xiaowei; Gong, Wei; Deng, Zhiliang; Zhou, Jieqiong; Ren, Yutang; Zhang, Qiang; Chen, Zhenyu; Jiang, Bo

    2016-01-01

    Peroral endoscopic myotomy (POEM) has been developed to treat achalasia as a novel less invasive modality. We aimed to compare the efficacy and safety of conventional knife versus Hybrid knife (HK) during POEM procedure. Between June 2012 and July 2014, 31 patients underwent POEM using HK in our department (HK group), and 36 patients underwent POEM using conventional method (injection needle and triangular tip [TT] knife, TT group). Procedure-related parameters, symptom relief, adverse events were compared between two groups. There were no significant differences in the age, sex and other baseline characteristics between the two groups. The mean procedural time was significantly shorter in HK group than TT group (53.0 ± 17.2 vs. 67.6 ± 28.4 min, p = 0.015). The mean frequency of devices exchange was 4.7 ± 1.7 in HK group and 10.9 ± 1.8 in TT group (p = 0.000). No serious adverse events occurred postoperatively in both groups. At one-year follow-up, a total of 94% treatment success was achieved in all patients (93.5% in HK group and 94.4% in TT group, p = 0.877). HK in POEM can shorten the procedural time, and achieve similar treatment success compared to conventional TT knife.

  6. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  7. Managing Sonchus arvensis using mechanical and cultural methods

    Directory of Open Access Journals (Sweden)

    P. VANHALA

    2008-12-01

    Full Text Available Perennial sow-thistle (Sonchus arvensis L. represents an increasing problem in Finland. Options for mechanical and cultural control of S. arvensis were studied in a field experiment on clay soil under organic production. The experiment consisted of different crop sequences: spring cereal (barley, Hordeum vulgare L., in 2001, oats, Avena sativa L., in 2002 with or without inter-row hoeing and/or stubble cultivation, bare fallow, fibre hemp (Cannabis sativa L., and ley with mowing. In 2003 the entire field was sown to spring wheat. Crop plant and Sonchus shoot density and dry mass prior to cereal harvest and crop yield were assessed. The control effect was rated: bare fallow > ley > cereal with or without inter-row hoeing > poor growth fibre hemp. Bare fallow was an effective but costly way to reduce S. arvensis infestation. Introduction of a regularly mown green fallow or silage ley in the crop rotation is advisable. Mechanical weed control by inter-row hoeing in cereals limits S. arvensis growth. Infestation might also be reduced by stubble cultivation in autumn. When managing S. arvensis using mechanical and cultural methods, appropriate options, including a competitive crop, should be chosen for the specific field and rotation.;

  8. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  9. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  10. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods.

    Science.gov (United States)

    Alavi, Shiva; Kachuie, Marzie

    2017-01-01

    This study was conducted to assess the hardness of orthodontic brackets produced by metal injection molding (MIM) and conventional methods and different orthodontic wires (stainless steel, nickel-titanium [Ni-Ti], and beta-titanium alloys) for better clinical results. A total of 15 specimens from each brand of orthodontic brackets and wires were examined. The brackets (Elite Opti-Mim which is produced by MIM process and Ultratrimm which is produced by conventional brazing method) and the wires (stainless steel, Ni-Ti, and beta-titanium) were embedded in epoxy resin, followed by grinding, polishing, and coating. Then, X-ray energy dispersive spectroscopy (EDS) microanalysis was applied to assess their elemental composition. The same specimen surfaces were repolished and used for Vickers microhardness assessment. Hardness was statistically analyzed with Kruskal-Wallis test, followed by Mann-Whitney test at the 0.05 level of significance. The X-ray EDS analysis revealed different ferrous or co-based alloys in each bracket. The maximum mean hardness values of the wires were achieved for stainless steel (SS) (529.85 Vickers hardness [VHN]) versus the minimum values for beta-titanium (334.65 VHN). Among the brackets, Elite Opti-Mim exhibited significantly higher VHN values (262.66 VHN) compared to Ultratrimm (206.59 VHN). VHN values of wire alloys were significantly higher than those of the brackets. MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  11. Comparison of conventional and nuclear-medical examination methods in the field of nephro-urology

    International Nuclear Information System (INIS)

    Pfannenstiel, P.

    1975-07-01

    Main part of this study is a further simplification of the 131 I-hippuran total body clearance, a method which was first described by Oberhausen (1968). As a result of the study the clearance can now be calculated with only one scintillation detector after i.v. injection of 131 I-hippuran. Essential for this simplification is the exact localisation of the detector at the right or left shoulder region of the patient. The unilateral clearance is calculated from the total body clearance in conjunction with the simultaneously registered isotope renogram. This method was routinely applied to 4,138 patients during November 15th 1971 and March 31st 1975. In special groups of patients sequential renal studies with the gamma-camera, renal rectilinear scans, xenon-133-washout curves from the kidneys and radioimmuno-assays of angiotensin were performed for comparison. All data were analysed in view of other clinical and radiological data. Recommendations for rational procedures in diagnosis and control of therapy of the most common nephro-urological disorders were derived from a joint study of 16 hospitals analysing 1,979 cases. (orig.) [de

  12. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    deviations (RSDs) of 2.3−3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate......, and falcarinol in year 1 were 222, 30, and 94 μg of falcarindiol equiv/g of dry weight, respectively, and 3−15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year−year variation was observed for falcarindiol-3-acetate....

  13. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  14. Use of the Culture Care Theory and ethnonursing method to discover how nursing faculty teach culture care.

    Science.gov (United States)

    Mixer, Sandra J

    2008-04-01

    As the world becomes increasingly multicultural, transcultural nursing education is critical to ensuring a culturally competent workforce. This paper presents a comprehensive review of literature and results of an ethnonursing pilot study using the Culture Care Theory (CCT) to discover how nursing faculty teach culture care. The literature revealed that despite 50 years of transcultural nursing knowledge development through theory, research and practice, there remains a lack of formal, integrated culture education in nursing. The importance of faculty providing generic and professional care to nursing students and using an organising framework to teach culture care was discovered. Additionally, care was essential for faculty health and well-being to enable faculty to teach culture care. This unique use of the theory and method demonstrates its usefulness in discovering and describing the complex nature of teaching culture care. Larger scale studies are predicted to further substantiate the CCT, building the discipline of nursing.

  15. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  16. The Teaching Methods of Cultural Factors in The Classroom

    Institute of Scientific and Technical Information of China (English)

    Jia Mengyang

    2014-01-01

    Culture knowledge plays an important role in linguistic proficiency and currently most teaching activities are stil happened inthe traditionalclassroom. So this paper introducedsome ofthe practicalteachingmethods ofChinese culture inthe Chinese language classroom.

  17. Expanded image database of pistachio x-ray images and classification by conventional methods

    Science.gov (United States)

    Keagy, Pamela M.; Schatzki, Thomas F.; Le, Lan Chau; Casasent, David P.; Weber, David

    1996-12-01

    In order to develop sorting methods for insect damaged pistachio nuts, a large data set of pistachio x-ray images (6,759 nuts) was created. Both film and linescan sensor images were acquired, nuts dissected and internal conditions coded using the U.S. Grade standards and definitions for pistachios. A subset of 1199 good and 686 insect damaged nuts was used to calculate and test discriminant functions. Statistical parameters of image histograms were evaluated for inclusion by forward stepwise discrimination. Using three variables in the discriminant function, 89% of test set nuts were correctly identified. Comparable data for 6 human subjects ranged from 67 to 92%. If the loss of good nuts is held to 1% by requiring a high probability to discard a nut as insect damaged, approximately half of the insect damage present in clean pistachio nuts may be detected and removed by x-ray inspection.

  18. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  19. A fast and highly sensitive blood culture PCR method for clinical detection of Salmonella enterica serovar Typhi

    Directory of Open Access Journals (Sweden)

    Zhou Liqing

    2010-04-01

    Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture

  20. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  1. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  2. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  3. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  4. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  5. Familiarity Vs Trust: A Comparative Study of Domain Scientists' Trust in Visual Analytics and Conventional Analysis Methods.

    Science.gov (United States)

    Dasgupta, Aritra; Lee, Joon-Yong; Wilson, Ryan; Lafrance, Robert A; Cramer, Nick; Cook, Kristin; Payne, Samuel

    2017-01-01

    Combining interactive visualization with automated analytical methods like statistics and data mining facilitates data-driven discovery. These visual analytic methods are beginning to be instantiated within mixed-initiative systems, where humans and machines collaboratively influence evidence-gathering and decision-making. But an open research question is that, when domain experts analyze their data, can they completely trust the outputs and operations on the machine-side? Visualization potentially leads to a transparent analysis process, but do domain experts always trust what they see? To address these questions, we present results from the design and evaluation of a mixed-initiative, visual analytics system for biologists, focusing on analyzing the relationships between familiarity of an analysis medium and domain experts' trust. We propose a trust-augmented design of the visual analytics system, that explicitly takes into account domain-specific tasks, conventions, and preferences. For evaluating the system, we present the results of a controlled user study with 34 biologists where we compare the variation of the level of trust across conventional and visual analytic mediums and explore the influence of familiarity and task complexity on trust. We find that despite being unfamiliar with a visual analytic medium, scientists seem to have an average level of trust that is comparable with the same in conventional analysis medium. In fact, for complex sense-making tasks, we find that the visual analytic system is able to inspire greater trust than other mediums. We summarize the implications of our findings with directions for future research on trustworthiness of visual analytic systems.

  6. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Brunser, O; Cruchet, S; Gotteland, M; Verbeke, S [Gastroenterology Unit, Institute of Nutrition and Food Technology (INTA), University of Chile, Santiago (Chile)

    2000-07-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The {sup 13}C-urea breath test ({sup 13}C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the {sup 13}C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics.

  8. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  9. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  10. The relationship between glass ceiling and power distance as a cultural variable by a new method

    Directory of Open Access Journals (Sweden)

    Naide Jahangirov

    2015-12-01

    Full Text Available Glass ceiling symbolizes a variety of barriers and obstacles that arise from gender inequality at business life. With this mind, culture influences gender dynamics. The purpose of this research was to examine the relationship between the glass ceiling and the power distance as a cultural variable within organizations. Gender variable is taken as a moderator variable in relationship between the concepts. In addition to conventional correlation analysis, we employed a new method to investigate this relationship in detail. The survey data were obtained from 109 people working at a research center which operated as a part of the non-profit private university in Ankara, Turkey. The relationship between the variables was revealed by a new method which was developed as an addition to the correlation in survey. The analysis revealed that the female staff perceived the glass ceiling and the power distance more intensely than the male staff. In addition, the medium level relation was determined between the power distance and the glass ceiling perception among female staff.

  11. A molecular diagnostic tool to replace larval culture in conventional faecal egg count reduction testing in sheep.

    Directory of Open Access Journals (Sweden)

    Florian Roeber

    Full Text Available The accurate diagnosis of parasitic nematode infections in livestock (including sheep and goats is central to their effective control and the detection of the anthelmintic resistance. Traditionally, the faecal egg count reduction test (FECRT, combined with the technique of larval culture (LC, has been used widely to assess drug-susceptibility/resistance in strongylid nematodes. However, this approach suffers from a lack of specificity, sensitivity and reliability, and is time-consuming and costly to conduct. Here, we critically assessed a specific PCR assay to support FECRT, in a well-controlled experiment on sheep with naturally acquired strongylid infections known to be resistant to benzimidazoles. We showed that the PCR results were in close agreement with those of total worm count (TWC, but not of LC. Importantly, albendazole resistance detected by PCR-coupled FECRT was unequivocally linked to Teladorsagia circumcincta and, to lesser extent, Trichostrongylus colubriformis, a result that was not achievable by LC. The key findings from this study demonstrate that our PCR-coupled FECRT approach has major merit for supporting anthelmintic resistance in nematode populations. The findings also show clearly that our PCR assay can be used as an alternative to LC, and is more time-efficient and less laborious, which has important practical implications for the effective management and control strongylid nematodes of sheep.

  12. Characterization and stability studies of a novel liposomal cyclosporin A prepared using the supercritical fluid method: comparison with the modified conventional Bangham method

    Directory of Open Access Journals (Sweden)

    Karn PR

    2013-01-01

    Full Text Available Pankaj Ranjan Karn,1,3 Wonkyung Cho,1,3 Hee-Jun Park,1,3 Jeong-Sook Park,3 Sung-Joo Hwang1,21Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 2College of Pharmacy, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 3College of Pharmacy, Chungnam National University, Yuseong-gu, Daejeon, Republic of KoreaAbstract: A novel method to prepare cyclosporin A encapsulated liposomes was introduced using supercritical fluid of carbon dioxide (SCF-CO2 as an antisolvent. To investigate the strength of the newly developed SCF-CO2 method compared with the modified conventional Bangham method, particle size, zeta potential, and polydispersity index (PDI of both liposomal formulations were characterized and compared. In addition, entrapment efficiency (EE and drug loading (DL characteristics were analyzed by reversed-phase high-performance liquid chromatography. Significantly larger particle size and PDI were revealed from the conventional method, while EE (% and DL (% did not exhibit any significant differences. The SCF-CO2 liposomes were found to be relatively smaller, multilamellar, and spherical with a smoother surface as determined by transmission electron microscopy. SCF-CO2 liposomes showed no significant differences in their particle size and PDI after more than 3 months, whereas conventional liposomes exhibited significant changes in their particle size. The initial yield (%, EE (%, and DL (% of SCF-CO2 liposomes and conventional liposomes were 90.98 ± 2.94, 92.20 ± 1.36, 20.99 ± 0.84 and 90.72 ± 2.83, 90.24 ± 1.37, 20.47 ± 0.94, respectively, which changed after 14 weeks to 86.65 ± 0.30, 87.63 ± 0.72, 18.98 ± 0.22 and 75.04 ± 8.80, 84.59 ± 5.13, 15.94 ± 2.80, respectively. Therefore, the newly developed SCF-CO2 method could be a better alternative compared with the conventional method and may provide a promising approach for large-scale production of liposomes

  13. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  14. NON-CONVENTIONAL MACHINING PROCESSES SELECTION USING MULTI-OBJECTIVE OPTIMIZATION ON THE BASIS OF RATIO ANALYSIS METHOD

    Directory of Open Access Journals (Sweden)

    MILOŠ MADIĆ

    2015-11-01

    Full Text Available The role of non-conventional machining processes (NCMPs in today’s manufacturing environment has been well acknowledged. For effective utilization of the capabilities and advantages of different NCMPs, selection of the most appropriate NCMP for a given machining application requires consideration of different conflicting criteria. The right choice of the NCMP is critical to the success and competitiveness of the company. As the NCMP selection problem involves consideration of different conflicting criteria, of different relative importance, the multi-criteria decision making (MCDM methods are very useful in systematical selection of the most appropriate NCMP. This paper presents the application of a recent MCDM method, i.e., the multi-objective optimization on the basis of ratio analysis (MOORA method to solve NCMP selection which has been defined considering different performance criteria of four most widely used NCMPs. In order to determine the relative significance of considered quality criteria a pair-wise comparison matrix of the analytic hierarchy process was used. The results obtained using the MOORA method showed perfect correlation with those obtained by the technique for order preference by similarity to ideal solution (TOPSIS method which proves the applicability and potentiality of this MCDM method for solving complex NCMP selection problems.

  15. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  16. EFFICACY OF CULTURAL METHODS IN THE CONTROL OF ...

    African Journals Online (AJOL)

    owner

    2014-04-02

    Apr 2, 2014 ... conventional disease control involving chemical fumigation with ... the promising non-chemical strategies may form part of the urgently ... In Kenya, Rhizoctonia damping off is a serious disease of tomato and other vegetables.

  17. Nutrition and culture in professional football. A mixed method approach.

    Science.gov (United States)

    Ono, Mutsumi; Kennedy, Eileen; Reeves, Sue; Cronin, Linda

    2012-02-01

    An adequate diet is essential for the optimal performance of professional football (soccer) players. Existing studies have shown that players fail to consume such a diet, without interrogating the reasons for this. The aim of this study was to explore the difficulties professional football players experience in consuming a diet for optimal performance. It utilized a mixed method approach, combining nutritional intake assessment with qualitative interviews, to ascertain both what was consumed and the wider cultural factors that affect consumption. The study found a high variability in individual intake which ranged widely from 2648 to 4606 kcal/day. In addition, the intake of carbohydrate was significantly lower than that recommended. The study revealed that the main food choices for carbohydrate and protein intake were pasta and chicken respectively. Interview results showed the importance of tradition within the world of professional football in structuring the players' approach to nutrition. In addition, the players' personal eating habits that derived from their class and national habitus restricted their food choice by conflicting with the dietary choices promoted within the professional football clubs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Research on fuzzy comprehensive assessment method of nuclear power plant safety culture

    International Nuclear Information System (INIS)

    Xiang Yuanyuan; Chen Xukun; Xu Rongbin

    2012-01-01

    Considering the traits of safety culture in nuclear plant, 38 safety culture assessment indexes are established from 4 aspects such as safety values, safety institution, safety behavior and safety sub- stances. Based on it, a comprehensive assessment method for nuclear power plant safety culture is constructed by using AHP (Analytic Hierarchy Process) approach and fuzzy mathematics. The comprehensive assessment method has the quality of high precision and high operability, which can support the decision making of safety culture development. (authors)

  19. Utilizing the Project Method for Teaching Culture and Intercultural Competence

    Science.gov (United States)

    Euler, Sasha S.

    2017-01-01

    This article presents a detailed methodological outline for teaching culture through project work. It is argued that because project work makes it possible to gain transferrable and applicable knowledge and insight, it is the ideal tool for teaching culture with the aim of achieving real intercultural communicative competence (ICC). Preceding the…

  20. The Effect of Culture Methods and Serum Supplementation on Developmental Competence of Bovine Embryos Cultured In Vitro

    Science.gov (United States)

    The objective of this study was to compare the developmental competence of bovine in vitro fertilized embryos in three different culture methods; microdrop method (50 µl of medium under mineral oil in petri dishes) compared to tube methods (1 ml of medium in tubes) with or without oil overlay, and t...

  1. Comparison of type and frequency of chromosome aberrations by conventional and G-staining methods in Hiroshima atomic bomb survivors

    International Nuclear Information System (INIS)

    Ohtaki, Kazuo; Shimba, Hachiro; Sofuni, Toshio; Awa, A.A.

    1982-07-01

    Somatic chromosomes derived from cultured lymphocytes of 23 atomic bomb survivors of Hiroshima were analyzed to determine the type and frequency of radiation-induced structural aberrations, using in sequence the ordinary staining method (O-method) and the trypsin G-banding method (G-method). Of 896 cells examined, 342 were found to contain induced aberrations, including 31 cells in which the precise identification of the type of aberrations was not possible even by the G-method. The number of chromosome aberrations observed was 376 in the 311 cells where aberrant precise identification was possible. The majority (288 or 76.6%) were intra- or inter-chromosomal symmetric exchanges due to a two-break event, while only 24 were found to be asymmetric exchanges (dicentrics, rings, and interstitial deletions). Further, there were 28 aberrations showing acentric fragments and terminal deletions, and the remaining 36 were complex intra- and inter-chromosomal exchanges involving three or more breaks which result in insertions and double translocations. A comparative karyotype analysis of the same metaphases examined by the sequential 0- And G-methods was carried out independently on 361 aberrations, mostly of the symmetric type. It was found that 78 (21.6%) of the 361 were detected only by the G-method; among these were 14 paracentric inversions, 48 reciprocal interchanges of chromosome segments with either equal length (11) or unequal length (37), 14 minor deletions and 2 complex rearrangements, all of which were nevertheless judged to fall within the normal range of variation by theO-method. In contrast, 25 aberrations detected in O-method chromosomes which were overcontracted or twisted, were shown to have normal banding patterns by the G-method. (author)

  2. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  3. The comparison of assessment of pigeon semen motility and sperm concentration by conventional methods and the CASA system (HTM IVOS).

    Science.gov (United States)

    Klimowicz, M D; Nizanski, W; Batkowski, F; Savic, M A

    2008-07-01

    The aim of these experiments was to compare conventional, microscopic methods of evaluating pigeon sperm motility and concentration to those measured by computer-assisted sperm analysis (CASA system). Semen was collected twice a week from two groups of pigeons, each of 40 males (group I: meat-type breed; group II: fancy pigeon) using the lumbo-sacral and cloacal region massage method. Ejaculates collected in each group were diluted 1:100 in BPSE solution and divided into two equal samples. One sample was examined subjectively by microscope and the second one was analysed using CASA system. The sperm concentration was measured by CASA using the anti-collision (AC) system and fluorescent staining (IDENT). There were not any significant differences between the methods of evaluation of sperm concentration. High positive correlations in both groups were observed between the sperm concentration estimated by Thom counting chamber and AC (r=0.87 and r=0.91, respectively), and between the sperm concentration evaluated by Thom counting chamber and IDENT (r=0.85 and r=0.90, respectively). The mean values for CASA measurement of proportion of motile spermatozoa (MOT) and progressive movement (PMOT) were significantly lower than the values estimated subjectively in both groups of pigeons (pCASA system is very rapid, objective and sensitive method in detecting subtle motility characteristics as well as sperm concentration and is recommended for future research into pigeon semen.

  4. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  5. Storage stability of margarines produced from enzymatically interesterified fats compared to those prepared by conventional methods - Chemical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Pedersen, Lars Saaby

    2006-01-01

    margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25øC for 12wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by the conventional methods (chemical interesterification and physical blending......In this study, four margarine hardstocks were produced, two from enzymatically interesterified fats at 80 and 100% conversion, one from chemically randomized fat and one from physically mixed fat. These four hardstocks, blended with 50% sunflower oil, were mainly used for the production of table...... interesterified fat had higher PV in weeks4, 8 and10 than the margarines produced from the enzymatically interesterified fats and the physically blended fat. These differences were not caused by different contents of tocopherols in the hardstocks. The differences between the processes for chemical and enzymatic...

  6. Comparison of porcelain bond strength of different metal frameworks prepared by using conventional and recently introduced fabrication methods.

    Science.gov (United States)

    Kaleli, Necati; Saraç, Duygu

    2017-07-01

    Most studies evaluating dental laser sintering systems have focused on the marginal accuracy of the restorations. However, the bond strength at the metal-ceramic interface is another important factor that affects the survival of restorations, and currently, few studies focus on this aspect. The purpose of this in vitro study was to compare the porcelain bond strength of cobalt-chromium (Co-Cr) metal frameworks prepared by using the conventional lost-wax technique, milling, direct metal laser sintering (DMLS), and laser cusing, a direct process powder-bed system. A total of 96 metal frameworks (n=24 in each group) were prepared by using conventional lost-wax (group C), milling (group M), DMLS (group LS), and direct process powder-bed (group LC) methods according to International Organization for Standardization standard ISO 9693-1. After porcelain application, a 3-point bend test was applied to each specimen by using a universal testing machine. Data were statistically analyzed using 1-way ANOVA and Tukey honest significant difference tests (α=.05). Failure types at the metal-ceramic interfaces were examined using stereomicroscopy. Additionally, 1 specimen from each group was prepared for scanning electron microscopy analysis to evaluate the surface topography of metal frameworks. The mean bond strength was 38.08 ±3.82 MPa for group C, 39.29 ±3.51 MPa for group M, 40.73 ±3.58 MPa for group LS, and 41.24 ±3.75 MPa for group LC. Statistically significant differences were observed among the 4 groups (P=.016). All groups, except for LS, exhibited adhesive and mixed type bond failure. Both of the laser sintering methods were found to be successful in terms of metal-ceramic bond strength. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  7. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

    Science.gov (United States)

    Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

    2014-03-07

    The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

  8. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  9. Between Contemporary Art and Cultural Analysis: Alternative Methods for Knowledge Production

    Directory of Open Access Journals (Sweden)

    Billy Ehn

    2012-03-01

    Full Text Available Artistic research suggests alternative methods for producing various kinds of knowledge, whether within or without the confines of academe. These methods may involve either the production of investigative artworks or the writing by the artist of a doctoral dissertation about his or her own work. For cultural researchers, the methods employed by artists engaged in these processes are both familiar and challenging, as conventional ethnography is mixed with more unpredictable experiments. This article presents several contemporary artworks, including sculpture, film, dance, installation and performance that explore various aspects of reality. What can be learnt from these works? And what could be achieved by an open exchange between artists and academic researchers? Four methodological approaches are highlighted as being of particular interest. The first relates to artists’ tendency to live experimentally, using themselves both as actors and as research objects. The second arises from the very tangible ways in which contemporary artworks approach the theme of materiality. The third relates to the emotional nature of much of contemporary art – even when it is categorised as conceptual – in its creation, forms of presentation, and influence on the spectator. Finally, many artists are gifted with the ability to find and communicate surprising meanings in ordinary life. How do they do this? Part of the answer seems to be that although artists are open to the implementation of “wild whims”, they exploit their spontaneity in a highly professional manner.

  10. Transnational Cultural Leadership as a Situated Practice : Dilemmas and Methods

    NARCIS (Netherlands)

    Kolsteeg, Johan

    2017-01-01

    In a longitudinal transnational research project, a network of European research institutions and field organisations aims to understand how cultural managers mediate global and local pressures concerning creative autonomy, economy and ideology. Among the research questions are which variables

  11. Theory and Method in Cross-Cultural Psychology

    Science.gov (United States)

    Malpass, Roy S.

    1977-01-01

    Cross cultural psychology is considered as a methodological strategy, as a means of evaluating hypotheses of unicultural origins with evidence of more panhuman relevance, and as a means of developing new theoretical psychological phenomena. (Author)

  12. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  13. Multiple Contexts, Multiple Methods: A Study of Academic and Cultural Identity among Children of Immigrant Parents

    Science.gov (United States)

    Urdan, Tim; Munoz, Chantico

    2012-01-01

    Multiple methods were used to examine the academic motivation and cultural identity of a sample of college undergraduates. The children of immigrant parents (CIPs, n = 52) and the children of non-immigrant parents (non-CIPs, n = 42) completed surveys assessing core cultural identity, valuing of cultural accomplishments, academic self-concept,…

  14. Individualism-Collectivism and Power Distance Cultural Dimensions: How Each Influences Parental Disciplinary Methods

    Science.gov (United States)

    Schwab, Karen Walker

    2013-01-01

    This paper is a literature review using the Douglas-Widavasky Grid/Group theory as a framework to examine, from a cross cultural perspective, preferred parental disciplinary methods. The four rival cultures defined in the Grid/Group theory mirror the cultural dimensions of individualism-collectivism and power distance described by Geert Hofstede.…

  15. Methods and Techniques of Sampling, Culturing and Identifying of Subsurface Bacteria

    International Nuclear Information System (INIS)

    Lee, Seung Yeop; Baik, Min Hoon

    2010-11-01

    This report described sampling, culturing and identifying of KURT underground bacteria, which existed as iron-, manganese-, and sulfate-reducing bacteria. The methods of culturing and media preparation were different by bacteria species affecting bacteria growth-rates. It will be possible for the cultured bacteria to be used for various applied experiments and researches in the future

  16. Detection of Mycobacterium avium subsp. paratuberculosis from cattle and buffaloes in Egypt using traditional culture, serological and molecular based methods

    Directory of Open Access Journals (Sweden)

    G. S. Abdellrazeq

    2014-08-01

    Full Text Available Background: Johne's disease (JD caused by Mycobacterium avium subsp. paratuberculosis (MAP represents a real threat to the agriculture and dairy food industries and believed to be a potential public health problem. Signs of infection in ruminant include weight loss, diarrhea, decreased milk production, and eventually death. The definition of an infected animal based either on the presence of anti-MAP antibodies, or positive bacterial culture. No treatment for the disease exists and controlling the disease is difficult due to its long latent period. JD is a worldwide problem and multiple studies in many countries have been carried out to determine the prevalence of MAP infections. Although some primary non intensive studies confirm presence of JD in Egypt, the disease is currently neglected by the official Egyptian veterinary agencies. There is no official data, no national control program, and no used vaccine. Aim: This study aimed to evaluate three conventional diagnostic methods for MAP under the Egyptian circumstances with a general aim to determine the appropriate strategy to develop a JD control program. These methods were pooled fecal culture, humoral response and insertion sequence IS900 targets polymerase chain reaction (IS900 PCR. Materials and Methods: Fecal and serum samples (500 each were collected from Holstein-Friesian cattle and buffaloes housed in five Egyptian governorates. Fecal samples were examined for MAP on the basis of a strategic pooling procedure and performed on Herrold's Egg Yolk Agar Medium (HEYM. Smears were prepared from developed colonies and stained using a Ziehl-Neelsen (ZN technique. The identity of developed colonies was further confirmed by PCR analysis of IS900 sequence. Sera from both culture-positive and culture-negative animals were evaluated individually for humoral response. Results: Out of 50 pooled specimens, 34 (68% fecal cultures were positive for MAP. Serum positive samples of culture

  17. Organizational Culture and the Deployment of Agile Methods: The Competing Values Model View

    Science.gov (United States)

    Iivari, Juhani; Iivari, Netta

    A number of researchers have identified organizational culture as a factor that potentially affects the deployment of agile systems development methods. Inspired by the study of Iivari and Huisman (2007), which focused on the deployment of traditional systems development methods, the present paper proposes a number of hypotheses about the influence of organizational culture on the deployment of agile methods.

  18. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  19. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  1. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  2. Microstructural and Mechanical Properties of Porous 60NiTi Prepared by Conventional Press-and-sinter Method

    Directory of Open Access Journals (Sweden)

    Khanlari Khashayar

    2017-01-01

    Full Text Available An intermetallic nickel-titanium alloy, 60NiTi, comprised of approximately 60 wt.% Ni and 40 wt.% Ti, contains a broad combination of physical and mechanical properties such as high hardness, low elastic modulus, resistance to aqueous corrosion and good biocompatibility. These unique combinations make this alloy an attractive candidate for medical components such as implants and prosthesis, where biocompatible materials with high hardness and low stiffness are typically used. The conventional press-and-sinter method which represents the least complex, most flexible and economic powder metallurgy method was used to produce porous 60NiTi parts suitable for biomedical applications. The effect of sintering holding time on the microstructure and mechanical properties is investigated. The structure of the as sintered parts is quite porous which is beneficial based on the medical point of view. The ultimate compressive strength of the samples is higher than that of the compact human bone and can, therefore, meet the strength demand of implants for general bone replacement applications.

  3. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  4. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  5. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  6. ADSA Foundation Scholar Award: Trends in culture-independent methods for assessing dairy food quality and safety: emerging metagenomic tools.

    Science.gov (United States)

    Yeung, Marie

    2012-12-01

    Enhancing the quality and safety of dairy food is critical to maintaining the competitiveness of dairy products in the food and beverage market and in reinforcing consumer confidence in the dairy industry. Raw milk quality has a significant effect on finished product quality. Several microbial groups found in raw milk have been shown to adversely affect the shelf life of pasteurized milk. Current microbiological criteria used to define milk quality are based primarily on culture-dependent methods, some of which are perceived to lack the desired sensitivity and specificity. To supplement traditional methods, culture-independent methods are increasingly being used to identify specific species or microbial groups, and to detect indicator genes or proteins in raw milk or dairy products. Some molecular subtyping techniques have been developed to track the transmission of microbes in dairy environments. The burgeoning "-omics" technologies offer new and exciting opportunities to enhance our understanding of food quality and safety in relation to microbes. Metagenomics has the potential to characterize microbial diversity, detect nonculturable microbes, and identify unique sequences or other factors associated with dairy product quality and safety. In this review, fluid milk will be used as the primary example to examine the adequacy and validity of conventional methods, the current trend of culture-independent methods, and the potential applications of metagenomics in dairy food research. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Development of an Evaluation Method for Team Safety Culture Competencies using Social Network Analysis

    International Nuclear Information System (INIS)

    Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun

    2016-01-01

    In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved

  8. Development of an Evaluation Method for Team Safety Culture Competencies using Social Network Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)

    2016-05-15

    In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved.

  9. Determination of lactic microflora of kefir grains and kefir beverage by using culture-dependent and culture-independent methods.

    Science.gov (United States)

    Kesmen, Zülal; Kacmaz, Nazife

    2011-01-01

    In this study, we investigated the bacterial compositions of kefir grains and kefir beverages collected from different regions of Turkey by using culture-independent and culture-dependent methods. In the culture-independent detection, 10 different species of bacteria were detected in total by using the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis of the 16S rRNA gene V3 region. Among these species, Lactobacillus kefiranofaciens was the most dominant one in the kefir grains, while Lactococcus lactis was found to be significantly prevalent in the kefir beverages. In the culture-dependent detection, the primary differentiation and grouping of the isolates from kefir beverages and kefir grains were performed using repetitive sequence-based PCR (rep-PCR) fingerprinting, and the results were validated by 16S rDNA full-length sequencing. According to the results of culture-dependent methods, the most frequently isolated species were L. lactis, Leuconostoc mesenteroides, and Lactobacillus kefiri, respectively. Only 3 species, which are L. lactis, Lactobacillus acidophilus, and Streptococcus thermophilus, were detected with both culture-dependent and culture-independent methods. This study showed that the combination of both methods is necessary for a detailed and reliable investigation of microbial communities in kefir grains and kefir beverages. Due to their artisan- and region-dependent microflora, kefir products can be a source of interesting lactic acid bacteria, either new taxa or strains with specific functional properties, which might be used for the development of new starter cultures and innovative food products. Therefore, an increasing demand exists for new strains that show desirable effects on the product characteristics Artisan dairy products are a candidate source of such microorganisms. For this reason, in this study, the bacterial compositions of kefir grains and kefir beverages obtained from

  10. Comparison on extraction yield of sennoside A and sennoside B from senna (Cassia angustifolia) using conventional and non conventional extraction techniques and their quantification using a validated HPLC-PDA detection method.

    Science.gov (United States)

    Dhanani, Tushar; Singh, Raghuraj; Reddy, Nagaraja; Trivedi, A; Kumar, Satyanshu

    2017-05-01

    Senna is an important medicinal plant and is used in many Ayurvedic formulations. Dianthraquinone glucosides are the main bioactive phytochemicals present in leaves and pods of senna. The extraction efficiency in terms of yield and composition of the extract of senna prepared using both conventional (cold percolation at room temperature and refluxing) and non conventional (ultrasound and microwave assisted solvent extraction as well as supercritical fluid extraction) techniques were compared in the present study. Also a rapid reverse phase HPLC-PDA detection method was developed and validated for the simultaneous determination of sennoside A and sennoside B in the different extracts of senna leaves. Ultrasound and microwave assisted solvent extraction techniques were more effective in terms of yield and composition of the extracts compared to cold percolation at room temperature and refluxing methods of extraction.

  11. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  12. A Method to Preclude Moisture Condensation in Plated Tissue Cultures

    Science.gov (United States)

    Alex M. Diner

    1992-01-01

    Excessive condensate normally accumulates in in vitro-illuminated petri dishes containing plant tissue cultures, causing avariety of problems. A dark-colored rubber net-mesh placed over the petri dishes prevented such condensation, even when charcoal-supplemented media are used under high light intensity in a growth chamber.

  13. LABORATORY CULTURE METHODS FOR THE MOTTLED SCULPIN (COTTUS BAIRDI)

    Science.gov (United States)

    Fish from the family Cottidae (Sculpin Family) are being researched to determine their sensitivity to various metals in freshwater systems. The ability to culture them in the lab would facilitate species sensitivity comparisons. We collected adult mottled sculpins (C. bairdi) f...

  14. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R

    2003-01-01

    neurons is seen after 3 weeks (2 weeks in ascorbic acid), suggesting that basal lamina production is important even for glial ensheathment in the enteric nervous system. No overgrowth of fibroblasts or other nonneuronal cells was noted in any cultures, and myelination of the peripheral nervous system...

  15. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  16. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  17. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  18. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  19. Using in situ nanocellulose-coating technology based on dynamic bacterial cultures for upgrading conventional biomedical materials and reinforcing nanocellulose hydrogels.

    Science.gov (United States)

    Zhang, Peng; Chen, Lin; Zhang, Qingsong; Jönsson, Leif J; Hong, Feng F

    2016-07-08

    Bacterial nanocellulose (BNC) is a microbial nanofibrillar hydrogel with many potential applications. Its use is largely restricted by insufficient strength when in a highly swollen state and by inefficient production using static cultivation. In this study, an in situ nanocellulose-coating technology created a fabric-frame reinforced nanocomposite of BNC hydrogel with superior strength but retained BNC native attributes. By using the proposed technology, production time could be reduced from 10 to 3 days to obtain a desirable hydrogel sheet with approximately the same thickness. This novel technology is easier to scale up and is more suitable for industrial-scale manufacture. The mechanical properties (tensile strength, suture retention strength) and gel characteristics (water holding, absorption and wicking ability) of the fabric-reinforced BNC hydrogel were investigated and compared with those of ordinary BNC hydrogel sheets. The results reveal that the fabric-reinforced BNC hydrogel was equivalent with regard to gel characteristics, and exhibited a qualitative improvement with regard to its mechanical properties. For more advanced applications, coating technology via dynamic bacterial cultures could be used to upgrade conventional biomedical fabrics, i.e. medical cotton gauze or other mesh materials, with nanocellulose. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1077-1084, 2016. © 2016 American Institute of Chemical Engineers.

  20. A new cell primo-culture method for freshwater benthic diatom communities

    OpenAIRE

    Debenest, Timothée; Silvestre, Jérôme; Coste, Michel; Delmas, François; Pinelli, Eric

    2009-01-01

    A new cell primo-culture method was developed for the benthic diatom community isolated from biofilm sampled in rivers. The approach comprised three steps: (1) scraping biofilm from river pebbles, (2) diatom isolation from biofilm, and (3) diatom community culture. With a view to designing a method able to stimulate the growth of diatoms, to limit the development of other microorganisms, and to maintain in culture a community similar to the original natural one, different factors were test...

  1. POSITIONING ANALYSIS OF ISLAMIC BANK vis-àvis CONVENTIONAL BANK IN INDONESIA USING PARAMETRIC SFA AND DFA METHODS15

    Directory of Open Access Journals (Sweden)

    Ir Ascarya

    2014-03-01

    Full Text Available This study will measure and compare the efficiency of Conventional and Islamic banks in Indonesia using parametric approach stochastic frontier approach (SFA and distribution free approach (DFA. These measurements will provide comprehensive and robust results of efficiency of individual bank compare to its peer group. The results using parametric SFA show that in 2002, conventional banks (0.79 were slightly more efficient than Islamic banks (0.77, while in 2003, the efficiency of Islamic banks improved to 0.84 and the efficiency of conventional banks worsen to 0.76, so that Islamic banks have become more efficient than conventional banks. Conventional and Islamic banks have been improving and converged to the highest level of efficiency (1.00 since 2004. The DFA results show that conventional banks (0.89 are only slightly more efficient than Islamic banks (0.87. Conventional public bank (0.93 is the most efficient, while Islamic regional bank (0.84 is the least efficient. Moreover, efficient banks (conventional and Islamic do not always have lower OCOI (operating costs divided by operating income, while banks with better OCOI usually are more profitable (have better return on assets or ROA. Therefore, technically, Islamic banks have shown their readiness to compete head to head with their conventional counterparts. However, other aspects, such as, number of networks and branches, service quality, convenience, products and services provided, human resources, and pricing, should have become the next priorities for improvements.JEL Classification : C10, C33, G21, G28Keywords : Islamic Banking, Efficiency, Stochastic Frontier Approach, Distribution Free Approach

  2. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of diagnosis of >50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  3. Comparison of Standard Culture-Based Method to Culture-Independent Method for Evaluation of Hygiene Effects on the Hand Microbiome.

    Science.gov (United States)

    Zapka, C; Leff, J; Henley, J; Tittl, J; De Nardo, E; Butler, M; Griggs, R; Fierer, N; Edmonds-Wilson, S

    2017-03-28

    Hands play a critical role in the transmission of microbiota on one's own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water). We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs) but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples ( P hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research. IMPORTANCE The hand microbiome is a critical area of research for diverse fields, such as public health and forensics. The suitability of culture-independent methods for assessing effects of hygiene products on microbiota has not been demonstrated. This is the first controlled laboratory clinical hand study to have compared traditional hand hygiene test methods with newer culture-independent characterization methods typically used by skin microbiologists. This study resulted in recommendations for hand hygiene product testing, development of methods, and future hand skin microbiome research. It also demonstrated the importance of inclusion of skin physiological metadata in

  4. Development of a rapid culture method to induce adipocyte differentiation of human bone marrow-derived mesenchymal stem cells

    International Nuclear Information System (INIS)

    Ninomiya, Yuichi; Sugahara-Yamashita, Yzumi; Nakachi, Yutaka; Tokuzawa, Yoshimi; Okazaki, Yasushi; Nishiyama, Masahiko

    2010-01-01

    Human mesenchymal stem cells (hMSCs) derived from bone marrow are multipotent stem cells that can regenerate mesenchymal tissues such as adipose, bone or muscle. It is thought that hMSCs can be utilized as a cell resource for tissue engineering and as human models to study cell differentiation mechanisms, such as adipogenesis, osteoblastogenesis and so on. Since it takes 2-3 weeks for hMSCs to differentiate into adipocytes using conventional culture methods, the development of methods to induce faster differentiation into adipocytes is required. In this study we optimized the culture conditions for adipocyte induction to achieve a shorter cultivation time for the induction of adipocyte differentiation in bone marrow-derived hMSCs. Briefly, we used a cocktail of dexamethasone, insulin, methylisobutylxanthine (DIM) plus a peroxisome proliferator-activated receptor γ agonist, rosiglitazone (DIMRo) as a new adipogenic differentiation medium. We successfully shortened the period of cultivation to 7-8 days from 2-3 weeks. We also found that rosiglitazone alone was unable to induce adipocyte differentiation from hMSCs in vitro. However, rosiglitazone appears to enhance hMSC adipogenesis in the presence of other hormones and/or compounds, such as DIM. Furthermore, the inhibitory activity of TGF-β1 on adipogenesis could be investigated using DIMRo-treated hMSCs. We conclude that our rapid new culture method is very useful in measuring the effect of molecules that affect adipogenesis in hMSCs.

  5. Identity and quantity of microorganisms in necrotising fasciitis determined by culture and molecular methods

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Nielsen, Per Halkjær

    communities were more common by molecular methods than culture. Correspondence between findings by culture and molecular methods indicates that the latter may be an appropriate method. The advantages of using molecular methods are: 1) identification of the pathogen(s) even when antibiotics have been...... involved in the disease may add to the knowledge of NF pathogenesis and influence the administration of antibiotics, thereby potentially improving the outcome for the patients. In this study the aim was to investigate the applicability of different molecular methods as compared to standard culture......-based methods. We investigated the microbial communities in 21 samples obtained during debridement of NF patients (n=8). Samples were examined by standard bacteriological examination (culture and microscopy) at Rigshospitalet (Copenhagen, Denmark) and a range of molecular methods. The best DNA extraction...

  6. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  7. A method for isolating identifying and culturing of rat trachea-bronchia epithelial cells

    International Nuclear Information System (INIS)

    Cui Fengmei; Su Shibiao; Nie Jihua; Li Bingyan; Tong Jian

    2005-01-01

    Objective: To explore a method for isolating identifying and culturing the rat trachea-bronchia epithelial cells. Methods: The rat trachea-bronchia epithelial cells were isolated by digestion with pronase and brushing with cell brush, identified using confocul and cultured in entire F12 media with no serum. Results: With this method, cells in high purity and high viability could be obtained, and about 10 6 cells per rat. The cells grow well in entire F12 media with no serum. Conclusion: The method is useful for isolating rate trachea-bronchia epithelial cells and the entire F12 media with no serum is effective for culturing. (authors)

  8. Triangulation and the importance of establishing valid methods for food safety culture evaluation.

    Science.gov (United States)

    Jespersen, Lone; Wallace, Carol A

    2017-10-01

    The research evaluates maturity of food safety culture in five multi-national food companies using method triangulation, specifically self-assessment scale, performance documents, and semi-structured interviews. Weaknesses associated with each individual method are known but there are few studies in food safety where a method triangulation approach is used for both data collection and data analysis. Significantly, this research shows that individual results taken in isolation can lead to wrong conclusions, resulting in potentially failing tactics and wasted investments. However, by applying method triangulation and reviewing results from a range of culture measurement tools it is possible to better direct investments and interventions. The findings add to the food safety culture paradigm beyond a single evaluation of food safety culture using generic culture surveys. Copyright © 2017. Published by Elsevier Ltd.

  9. Progress on CD-DVD laser microfabrication method to develop cell culture scaffolds integrating biomimetic characteristics

    Science.gov (United States)

    Hautefeuille, Mathieu; Vázquez-Victorio, Genaro; Cruz-Ramírez, Aaron; Cabriales, Lucia; Jiménez-Diaz, Edgar; Escutia-Guadarrama, Lidia; López-Aparicio, Jehú; Pérez-Calixto, Daniel; Cano-Jorge, Mariel; Nieto-Rivera, Brenda; Sánchez-Olvera, Raúl

    2018-02-01

    The development of organ-on-chip and biological scaffolds is currently requiring simpler methods to microstructure biocompatible materials in three dimensions, fabricate structural and functional elements in biomaterials or modify the physicochemical properties of desired substrates. With the aim of creating simple, cost-effective alternatives to conventional existing techniques to produce such platforms with very specific properties, a low-power CD-DVD laser pickup head was recycled and mounted on a programmable three-axis micro-displacement system in order to modify the surface of polymeric materials in a local fashion. Thanks to a specially-designed method using a strongly absorbing additive coating the materials of interest, it has been possible to establish and precisely control processes useful in microtechnology for biomedical applications and normally restricted to much less affordable high-power lasers. In this work, we present our latest progress regarding the application of our fabrication technique to the development of organ-on-chip platforms thanks to the simple integration of several biomimetic characteristics typically achieved with traditional, less cost-effective microtechnology methods in one step or through replica-molding. Our straightforward approach indeed enables great control of local laser microablation for true on-demand biomimetic micropatterned designs in several transparent polymers and hydrogels of tunable stiffness and is allowing integration of microfluidics, microelectronics, optical waveguides, surface microstructuring and even transfer of superficial protein micropatterns on a variety of biocompatible materials. The results presented here were validated using hepatic and fibroblasts cell lines to demonstrate the viability of our procedure for organ-on-chip development and show the impact of such features in cell culture.

  10. Culture.

    Science.gov (United States)

    Smith, Timothy B; Rodríguez, Melanie Domenech; Bernal, Guillermo

    2011-02-01

    This article summarizes the definitions, means, and research of adapting psychotherapy to clients' cultural backgrounds. We begin by reviewing the prevailing definitions of cultural adaptation and providing a clinical example. We present an original meta-analysis of 65 experimental and quasi-experimental studies involving 8,620 participants. The omnibus effect size of d = .46 indicates that treatments specifically adapted for clients of color were moderately more effective with that clientele than traditional treatments. The most effective treatments tended to be those with greater numbers of cultural adaptations. Mental health services targeted to a specific cultural group were several times more effective than those provided to clients from a variety of cultural backgrounds. We recommend a series of research-supported therapeutic practices that account for clients' culture, with culture-specific treatments being more effective than generally culture-sensitive treatments. © 2010 Wiley Periodicals, Inc.

  11. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  12. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  14. A Method Sustaining the Bioelectric, Biophysical, and Bioenergetic Function of Cultured Rabbit Atrial Cells

    OpenAIRE

    Noa Kirschner Peretz; Sofia Segal; Limor Arbel-Ganon; Ronen Ben Jehuda; Ronen Ben Jehuda; Yuval Shemer; Yuval Shemer; Binyamin Eisen; Binyamin Eisen; Moran Davoodi; Ofer Binah; Ofer Binah; Yael Yaniv

    2017-01-01

    Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM), which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells w...

  15. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  16. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    Full Text Available Introduction: Continuing growth in human population and consumptionmeans that the global demand for food will increase for at least another 40 years and that the world needs 70-100% more food by 2050. Environmental issues such as climate change, depletion of naturalresources and biodiversity loss increasingly threaten the welfare ofhuman civilization. Confronting these threats requires, among otherthings, behavioral changes in citizens, governments and companies.Farmers and other producers are responding to consumer concerns about pesticides by creating new marketing opportunities for products grown with environmentally sound practices. Environmental economists are increasingly interested in better understanding of how people cognitively organize their beliefs and attitudes towards environmental change in order to identify key motives and barriers that stimulate or prevent action.The purpose of the presentinvestigation is to evaluate the consumers’ preferences and factors affecting their choice for conventional, healthy and organic cucumbers in Isfahan, Iran. Materials and Methods: Data were collected on a sample of 230consumers in 2013 by using the proportionate stratification samplingmethod through face-to-face interviews based on a comprehensive structured questionnaire. Before the survey, the reliability and validity of the questionnaire were initially evaluated in a pre-test study, respectively, by using Cronbach’s alpha coefficient and Kaiser-Meyer-Olkin (KMO criteria. Individual preferences were uncovered in choice experiment method (CEM by a contingent ranking experiment. In a contingent ranking experiment, respondents are required to rank a set of alternative options, characterized by a number of attributes, which are offered at different levels across the options.Data were analyzed by multinomial logit models. The approach consists of modeling utility, that isto say the net benefit a consumer obtains from selecting a

  17. Rapid identification of pathogens directly from blood culture bottles by Bruker matrix-assisted laser desorption laser ionization-time of flight mass spectrometry versus routine methods.

    Science.gov (United States)

    Jamal, Wafaa; Saleem, Rola; Rotimi, Vincent O

    2013-08-01

    The use of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for identification of microorganisms directly from blood culture is an exciting dimension to the microbiologists. We evaluated the performance of Bruker SepsiTyper kit™ (STK) for direct identification of bacteria from positive blood culture. This was done in parallel with conventional methods. Nonrepetitive positive blood cultures from 160 consecutive patients were prospectively evaluated by both methods. Of 160 positive blood cultures, the STK identified 114 (75.6%) isolates and routine conventional method 150 (93%). Thirty-six isolates were misidentified or not identified by the kit. Of these, 5 had score of >2.000 and 31 had an unreliable low score of <1.7. Four of 8 yeasts were identified correctly. The average turnaround time using the STK was 35 min, including extraction steps and 30:12 to 36:12 h with routine method. The STK holds promise for timely management of bacteremic patients. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Choice of Appropriate Multimedia Technology and Teaching Methods for Different Culture Groups

    Science.gov (United States)

    Taratoukhina, Julia

    2014-01-01

    This paper describes the prerequisites for development in the area of cross-cultural multimedia didactics. This approach is based on research studies of differences between mentalities, ways of working with educational information, culturally-specific teaching methods and teaching techniques that determine differentiated approaches to the choice…

  19. Perceptions of Organizational Culture of a Multi-Campus Community College District: Mixed Methods in Concert

    Science.gov (United States)

    Kuster Dale, Kimberly

    2012-01-01

    This concurrent, mixed-methods case study analyzed perceptions of current and preferred organizational culture within a rural, multi-campus community college district. This phenomenon was examined by analyzing and comparing data collected by surveying all full-time employees utilizing the Organizational Culture Assessment Instrument (OCAI) and…

  20. EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE

    NARCIS (Netherlands)

    MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ

    A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of

  1. The comparison of two different embryo culture methods in the course of in vitro fertilization program.

    Directory of Open Access Journals (Sweden)

    Barbara Grzechocinska

    2008-04-01

    Full Text Available The objective of the study was to compare two different embryo culture methods in the course of in vitro fertilization program by means of fertilization rate, embryo development, total time and cost. 98 patients undergoing assisted reproduction procedures due to infertility were analyzed. The inclusion criteria for the study: first IVF-ET program, at least 10 MII oocytes, no indications for ICSI. Oocytes were divided into two study groups: group A- open culture (oocytes placed in four-well dishes together, then inseminated and cultured in successive wells and group B - a closed culture (oocytes placed in microdroplets, each embryo cultured separately. The fertilization rate was assessed around 18 hours from insemination. The embryos were classified into four classes. The best embryos were chosen for transfer. In the group A the fertilization rate obtained was lower than in group B (68% vs. 78%, respectively. The microdroplet culture required more time on the insemination day and on the second day of culture, while the four-well dish method required more time on the first day of culture and on the day of transfer. On analyzing the total cost of the above procedures (MI medium and oil costs it occurred that the microdroplet culture was more expensive than the four-well dish method (due to the intake of paraffin oil. However, the difference was of no practical importance. In the conclusion, microdroplet culture gives a higher fertilization rate than four-well dish culture, probably due to a homogenous sperm distribution. Despite the differences in time outside the incubator and laboratory expenses (which are after all insignificant microdroplet culture allows a better control over the embryo development. The embryos of best developmental potential can therefore be chosen for ET.

  2. An Evaluation Method for Team Competencies to Enhance Nuclear Safety Culture

    International Nuclear Information System (INIS)

    Hang, S. M.; Seong, P. H.; Kim, A. R.

    2016-01-01

    Safety culture has received attention in safety-critical industries, including nuclear power plants (NPPs), due to various prominent accidents such as concealment of a Station Blackout (SBO) of Kori NPP unit 1 in 2012, the Sewol ferry accident in 2014, and the Chernobyl accident in 1986. Analysis reports have pointed out that one of the major contributors to the cause of the accidents is ‘the lack of safety culture’. The term, nuclear safety culture, was firstly defined after the Chernobyl accident by the IAEA in INSAG report no. 4, as follows “Safety culture is that assembly of characteristics and attitudes in organizations and individuals which establishes that, as an overriding priority, nuclear plant safety issues receive the attention warranted their significance.” Afterwards, a wide consensus grew among researchers and nuclear-related organizations, that safety culture should be evaluated and managed in a certain manner. Consequently, each nuclear-related organization defined and developed their own safety culture definitions and assessment methods. However, none of these methods provides a way for an individual or a team to enhance the safety culture of an organization. Especially for a team, which is the smallest working unit in NPPs, team members easily overlook their required practices to improve nuclear safety culture. Therefore in this study, we suggested a method to estimate nuclear safety culture of a team, by approaching with the ‘competency’ point of view. The competency is commonly focused on individuals, and defined as, “underlying characteristics of an individual that are causally related to effective or superior performance in a job.” Similar to safety culture, the definition of competency focuses on characteristics and attitudes of individuals. Thus, we defined ‘safety culture competency’ as “underlying characteristics and outward attitudes of individuals that are causally related to a healthy and strong nuclear safety

  3. Comparison of Standard Culture-Based Method to Culture-Independent Method for Evaluation of Hygiene Effects on the Hand Microbiome

    Science.gov (United States)

    Leff, J.; Henley, J.; Tittl, J.; De Nardo, E.; Butler, M.; Griggs, R.; Fierer, N.

    2017-01-01

    ABSTRACT Hands play a critical role in the transmission of microbiota on one’s own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water). We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs) but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples (P hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research. PMID:28351915

  4. Tourismological valorization of intangible cultural heritage of Serbia according to the Hilary du Cros method

    Directory of Open Access Journals (Sweden)

    Željko Bjeljac

    2016-02-01

    Full Text Available The folk artistry of Serbia is rich in spiritual values tied to customs, celebrations, music, song, dance, games, stories and legends, and this kind of cultural heritage is presented through numerous festivals, events and tourist manifestations. In 2012, the network for the safeguarding of intangible cultural heritage was formed, comprised of the National committee for intangible cultural heritage, the Commission for admission into the registry of intangible cultural heritage, a network of coordinators and the Center for intangible cultural heritage of Serbia. These institutions have chosen 6 elements of intangible cultural heritage, out of 27 suggestions: the slava, the Đurđevdan ritual, the kolo dance, singing accompanied by gusle, Slovakian naive painting, the custom of making and lighting farmers’ candles, Pirot carpet weaving, and Zlakusa pottery as elements of cultural heritage which reflect the national and cultural identity of the Serbian people, and Slavic minorities. These elements of intangible cultural heritage have a certain tourism potential and can represent an important factor in the forming of the tourist brand of Serbia. In order to determine the importance of the 27 suggestions of intangible cultural elements of Serbia, an analysis was conducted, using an adapted form of the Hilary du Cros method of tourist valorization.

  5. Method for organotypic tissue culture in the aged animal

    Directory of Open Access Journals (Sweden)

    Jared Schommer

    2017-01-01

    • Our method permits slices from mice as old as 16 months and rabbits as old as years of age to survive ex vivo up to 8 weeks [6–9]. Such a slice system may be relevant to investigating age-related brain diseases.

  6. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  7. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Plant management in natural areas: balancing chemical, mechanical, and cultural control methods

    Science.gov (United States)

    Steven Manning; James. Miller

    2011-01-01

    After determining the best course of action for control of an invasive plant population, it is important to understand the variety of methods available to the integrated pest management professional. A variety of methods are now widely used in managing invasive plants in natural areas, including chemical, mechanical, and cultural control methods. Once the preferred...

  9. Bacterial diversity determination using culture-dependent and culture-independent methods

    Directory of Open Access Journals (Sweden)

    M. Ghiasian

    2017-04-01

    Full Text Available Mud volcanoes are taken into consideration by geologists and oil industry experts have given their association with oil and gas reserves and methane greenhouse gas production in hydrosphere and atmosphere. Gomishan mud volcano phenomenon in the southeastern edge of the Caspian Sea, given its oil and gas resources, has been studied by some geologists in terms of geology and tectonics but not in terms of microbiology. Accordingly, it seems necessary to study this phenomenon from the perspective of microbiology in order to identify prokaryotes living in this area. Prokaryotes diversity in Mud volcano has been studied by cultivation techniques, fluorescence in situ hybridization, and denaturing gradient gel electrophoresis of PCR-amplified fragments of 16S rRNA genes. Total cell abundance in the mud volcano from 1×101-6×101per milliliter was determined by 4', 6-diamidino-2-phenylindole direct count. The detectable proportion of Archaea to Bacteria in the community by FISH was one to five. High viable counts (1 – 3 × 106 were obtained in culture media. A total of 122 isolates were obtained, 46 colonies were selected based on primarily morphological and physiological traits, and their 16S rRNA sequences were determined. The isolated genera included Halomonas (20%, Arthrobacter (5%, Kocuria (5%, Thalassobacillus (5%, Marinobacter (20%, Paracoccus (5%, Roseovarius (5%, Jeotgalicoccus (5%, Bacillus (15%, and Staphylococcus (15%. Regarding DGGE analysis, selected bands were obtained from the gels, reamplified and sequenced. Overall, 75% of the bacterial sequences were related to Rahnella and 25% related to Serratia.

  10. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    Science.gov (United States)

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  11. [Evaluation of PNA-FISH method for direct identification of Candida species in blood culture samples and its potential impact on guidance of antifungal therapy].

    Science.gov (United States)

    Doğan, Özlem; İnkaya, Ahmet Çağkan; Gülmez, Dolunay; Uzun, Ömrüm; Akova, Murat; Arıkan Akdağlı, Sevtap

    2016-10-01

    Early antifungal therapy has a major influence on survival in candidemia. Rapid identification of the species has importance for the treatment, prediction of the species-specific primary resistance and variable antifungal susceptibility. Recently, molecular-based methods attempt to reduce the time between the positive signal of a blood culture and identification of the fungus. PNA-FISH (Peptide nucleic acid fluorescence in situ hybridization) assay distinguishes a number of frequently isolated Candida species in groups following the growth in blood culture. The aim of this study was to investigate the correlation of the species identified by PNA-FISH with conventional identification methods in yeast positive blood cultures and its influence on the selection of antifungal therapy. Specimens of adult patients diagnosed as yeast with Gram stain in signal-positive blood cultures between August to December 2013, were included in the study. The strains were concomitantly cultivated by subculturing from the blood culture bottles onto solid media and identified by conventional methods (germ tube test, ID32C and morphology on cornmeal Tween 80 agar). Rapid species identification was performed by Yeast Traffic Light PNA-FISH, which generates green flourescence for Candida albicans and Candida parapsilosis, yellow for Candida tropicalis, and red for Candida krusei and Candida glabrata. C.tropicalis was identified as a single species whereas the others were identified in pairs. The time points when the yeast positive blood culture bottle was received by the mycology laboratory and reporting of the species identification results by PNA-FISH and the conventional methods were recorded. Seven C.albicans, six C.glabrata, three C.parapsilosis, one C.tropicalis, one C.krusei, one Cryptococcus neoformans, one Saprochaete capitata (Blastoschizomyces capitatus), one C.albicans and Candida dubliniensis, one C.krusei and C.dubliniensis, and one C.glabrata and C.parapsilosis were

  12. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    Science.gov (United States)

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  13. A novel method for coral explant culture and micropropagation.

    Science.gov (United States)

    Vizel, Maya; Loya, Yossi; Downs, Craig A; Kramarsky-Winter, Esti

    2011-06-01

    We describe here a method for the micropropagation of coral that creates progeny from tissue explants derived from a single polyp or colonial corals. Coral tissue explants of various sizes (0.5-2.5 mm in diameter) were manually microdissected from the solitary coral Fungia granulosa. Explants could be maintained in an undeveloped state or induced to develop into polyps by manipulating environmental parameters such as light and temperature regimes, as well as substrate type. Fully developed polyps were able to be maintained for a long-term in a closed sea water system. Further, we demonstrate that mature explants are also amenable to this technique with the micropropagation of second-generation explants and their development into mature polyps. We thereby experimentally have established coral clonal lines that maintain their ability to differentiate without the need for chemical induction or genetic manipulation. The versatility of this method is also demonstrated through its application to two other coral species, the colonial corals Oculina patigonica and Favia favus.

  14. In Vitro Culturing and Live Imaging of Drosophila Egg Chambers: A History and Adaptable Method.

    Science.gov (United States)

    Peters, Nathaniel C; Berg, Celeste A

    2016-01-01

    The development of the Drosophila egg chamber encompasses a myriad of diverse germline and somatic events, and as such, the egg chamber has become a widely used and influential developmental model. Advantages of this system include physical accessibility, genetic tractability, and amenability to microscopy and live culturing, the last of which is the focus of this chapter. To provide adequate context, we summarize the structure of the Drosophila ovary and egg chamber, the morphogenetic events of oogenesis, the history of egg-chamber live culturing, and many of the important discoveries that this culturing has afforded. Subsequently, we discuss various culturing methods that have facilitated analyses of different stages of egg-chamber development and different types of cells within the egg chamber, and we present an optimized protocol for live culturing Drosophila egg chambers.We designed this protocol for culturing late-stage Drosophila egg chambers and live imaging epithelial tube morphogenesis, but with appropriate modifications, it can be used to culture egg chambers of any stage. The protocol employs a liquid-permeable, weighted "blanket" to gently hold egg chambers against the coverslip in a glass-bottomed culture dish so the egg chambers can be imaged on an inverted microscope. This setup provides a more buffered, stable, culturing environment than previously published methods by using a larger volume of culture media, but the setup is also compatible with small volumes. This chapter should aid researchers in their efforts to culture and live-image Drosophila egg chambers, further augmenting the impressive power of this model system.

  15. Towards a culturally independent participatory design method: Fusing game elements into the design process

    DEFF Research Database (Denmark)

    Jensen, Mika Yasuoka; Nakatani, Momoko; Ohno, Takehiko

    2013-01-01

    Historically, Participatory Design (PD) was introduced and applied in the Scandinavian and American context as a practical design method for collective creativity and stakeholder involvement. In this paper, by fusing game elements into PD, we suggest a first step towards a culturally independent ...... imply that the introduction of game elements allows PD to be effectively utilized in culturally diverse settings.......Historically, Participatory Design (PD) was introduced and applied in the Scandinavian and American context as a practical design method for collective creativity and stakeholder involvement. In this paper, by fusing game elements into PD, we suggest a first step towards a culturally independent PD...... method called the ICT Service Design Game to ease the prevailing concern that PD has limited applicability in other cultural settings. We conduct four experiments on ICT Service Design Game in Scandinavia and Asia to evaluate its feasibility. The experiments identify some differences in the PD process...

  16. Microbiological study of lactic acid bacteria in kefir grains by culture-dependent and culture-independent methods.

    Science.gov (United States)

    Chen, Hsi-Chia; Wang, Sheng-Yao; Chen, Ming-Ju

    2008-05-01

    Lactic acid bacteria (LAB) in different original kefir grains were first assessed using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) by a culture-dependent way, and were further confirmed by DNA sequencing techniques. Results indicated that a combined method of cultivation with PCR-DGGE and subsequent DNA sequencing could successfully identify four LAB strains from three kefir grains from Taiwan (named Hsinchu, Mongolia and Ilan). Lactobacillus kefiri accounted, in the three kefir grains, for at least half of the isolated colonies while Lb. kefiranofaciens was the second most frequently isolated species. Leuconostoc mesenteroides was less frequently found but still in the three kefir grains conversely to Lactococcus lactis which based on culture-dependent isolation was only found in two of the kefir grains. It was interesting to find that all three kefir grains contain similar LAB species. Furthermore, the DGGE as a culture-independent method was also applied to detect the LAB strains. Results indicated that Lb. kefiranofaciens was found in all three kefir grains, whereas Lb. kefiri was only observed in Hsinchu kefir grain and Lc. lactis was found in both Mongolia and Ilan samples. Two additional strains, Pseudomonas spp. and E. coli, were also detected in kefir grains.

  17. Diversity of Termitomyces associated with fungus-farming termites assessed by cultural and culture-independent methods.

    Science.gov (United States)

    Makonde, Huxley M; Boga, Hamadi I; Osiemo, Zipporah; Mwirichia, Romano; Stielow, J Benjamin; Göker, Markus; Klenk, Hans-Peter

    2013-01-01

    Fungus-cultivating termites make use of an obligate mutualism with fungi from the genus Termitomyces, which are acquired through either vertical transmission via reproductive alates or horizontally transmitted during the formation of new mounds. Termitomyces taxonomy, and thus estimating diversity and host specificity of these fungi, is challenging because fruiting bodies are rarely found. Molecular techniques can be applied but need not necessarily yield the same outcome than morphological identification. Culture-dependent and culture-independent methods were used to comprehensively assess host specificity and gut fungal diversity. Termites were identified using mitochondrial cytochrome oxidase II (COII) genes. Twenty-three Termitomyces cultures were isolated from fungal combs. Internal transcribed spacer (ITS) clone libraries were constructed from termite guts. Presence of Termitomyces was confirmed using specific and universal primers. Termitomyces species boundaries were estimated by cross-comparison of macromorphological and sequence features, and ITS clustering parameters accordingly optimized. The overall trends in coverage of Termitomyces diversity and host associations were estimated using Genbank data. Results indicate a monoculture of Termitomyces in the guts as well as the isolation sources (fungal combs). However, cases of more than one Termitomyces strains per mound were observed since mounds can contain different termite colonies. The newly found cultures, as well as the clustering analysis of GenBank data indicate that there are on average between one and two host genera per Termitomyces species. Saturation does not appear to have been reached, neither for the total number of known Termitomyces species nor for the number of Termitomyces species per host taxon, nor for the number of known hosts per Termitomyces species. Considering the rarity of Termitomyces fruiting bodies, it is suggested to base the future taxonomy of the group mainly on well

  18. Diversity of Termitomyces associated with fungus-farming termites assessed by cultural and culture-independent methods.

    Directory of Open Access Journals (Sweden)

    Huxley M Makonde

    Full Text Available BACKGROUND: Fungus-cultivating termites make use of an obligate mutualism with fungi from the genus Termitomyces, which are acquired through either vertical transmission via reproductive alates or horizontally transmitted during the formation of new mounds. Termitomyces taxonomy, and thus estimating diversity and host specificity of these fungi, is challenging because fruiting bodies are rarely found. Molecular techniques can be applied but need not necessarily yield the same outcome than morphological identification. METHODOLOGY: Culture-dependent and culture-independent methods were used to comprehensively assess host specificity and gut fungal diversity. Termites were identified using mitochondrial cytochrome oxidase II (COII genes. Twenty-three Termitomyces cultures were isolated from fungal combs. Internal transcribed spacer (ITS clone libraries were constructed from termite guts. Presence of Termitomyces was confirmed using specific and universal primers. Termitomyces species boundaries were estimated by cross-comparison of macromorphological and sequence features, and ITS clustering parameters accordingly optimized. The overall trends in coverage of Termitomyces diversity and host associations were estimated using Genbank data. RESULTS AND CONCLUSION: Results indicate a monoculture of Termitomyces in the guts as well as the isolation sources (fungal combs. However, cases of more than one Termitomyces strains per mound were observed since mounds can contain different termite colonies. The newly found cultures, as well as the clustering analysis of GenBank data indicate that there are on average between one and two host genera per Termitomyces species. Saturation does not appear to have been reached, neither for the total number of known Termitomyces species nor for the number of Termitomyces species per host taxon, nor for the number of known hosts per Termitomyces species. Considering the rarity of Termitomyces fruiting bodies, it is

  19. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  20. Accuracy and precision of 3 intraoral scanners and accuracy of conventional impressions: A novel in vivo analysis method.

    Science.gov (United States)

    Nedelcu, R; Olsson, P; Nyström, I; Rydén, J; Thor, A

    2018-02-01

    To evaluate a novel methodology using industrial scanners as a reference, and assess in vivo accuracy of 3 intraoral scanners (IOS) and conventional impressions. Further, to evaluate IOS precision in vivo. Four reference-bodies were bonded to the buccal surfaces of upper premolars and incisors in five subjects. After three reference-scans, ATOS Core 80 (ATOS), subjects were scanned three times with three IOS systems: 3M True Definition (3M), CEREC Omnicam (OMNI) and Trios 3 (TRIOS). One conventional impression (IMPR) was taken, 3M Impregum Penta Soft, and poured models were digitized with laboratory scanner 3shape D1000 (D1000). Best-fit alignment of reference-bodies and 3D Compare Analysis was performed. Precision of ATOS and D1000 was assessed for quantitative evaluation and comparison. Accuracy of IOS and IMPR were analyzed using ATOS as reference. Precision of IOS was evaluated through intra-system comparison. Precision of ATOS reference scanner (mean 0.6 μm) and D1000 (mean 0.5 μm) was high. Pairwise multiple comparisons of reference-bodies located in different tooth positions displayed a statistically significant difference of accuracy between two scanner-groups: 3M and TRIOS, over OMNI (p value range 0.0001 to 0.0006). IMPR did not show any statistically significant difference to IOS. However, deviations of IOS and IMPR were within a similar magnitude. No statistical difference was found for IOS precision. The methodology can be used for assessing accuracy of IOS and IMPR in vivo in up to five units bilaterally from midline. 3M and TRIOS had a higher accuracy than OMNI. IMPR overlapped both groups. Intraoral scanners can be used as a replacement for conventional impressions when restoring up to ten units without extended edentulous spans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. The environmental impact of coal technology: Politics and methods of achieving an international convention to protect the earth's atmosphere

    International Nuclear Information System (INIS)

    1992-01-01

    Particular attention will be paid to the following points during the international Round Table discussions: Technology transfer and political opportunities for the environmentally-compatible use of coal in developing and transitional countries who rely on coal to meet their energy needs. Supporting this challenge for the international community of coal-based energy conservation in these countries, particularly through development aid. To increasingly accept our collective responsibility for energy considerations and environmental effects, based on a better understanding of the countries' differing limits and obligations in achieving the goal of a convention to protect the earth's atmosphere. (orig.) [de

  2. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  3. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  4. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  5. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well.

  6. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    Full Text Available Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other

  7. Comparison of Standard Culture-Based Method to Culture-Independent Method for Evaluation of Hygiene Effects on the Hand Microbiome

    Directory of Open Access Journals (Sweden)

    C. Zapka

    2017-03-01

    Full Text Available Hands play a critical role in the transmission of microbiota on one’s own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water. We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples (P < 0.001; we were unable to detect changes with glove-based samples. Bacterial cell counts significantly decreased with use of the ABHS (P < 0.05 and ethanol control (P < 0.05. Skin hydration at baseline correlated with bacterial abundances, bacterial community composition, pH, and redness across subjects. The importance of the method choice was substantial. These findings are important to ensure improvement of hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research.

  8. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  9. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  10. A fluorescence anisotropy method for measuring protein concentration in complex cell culture media.

    Science.gov (United States)

    Groza, Radu Constantin; Calvet, Amandine; Ryder, Alan G

    2014-04-22

    The rapid, quantitative analysis of the complex cell culture media used in biopharmaceutical manufacturing is of critical importance. Requirements for cell culture media composition profiling, or changes in specific analyte concentrations (e.g. amino acids in the media or product protein in the bioprocess broth) often necessitate the use of complicated analytical methods and extensive sample handling. Rapid spectroscopic methods like multi-dimensional fluorescence (MDF) spectroscopy have been successfully applied for the routine determination of compositional changes in cell culture media and bioprocess broths. Quantifying macromolecules in cell culture media is a specific challenge as there is a need to implement measurements rapidly on the prepared media. However, the use of standard fluorescence spectroscopy is complicated by the emission overlap from many media components. Here, we demonstrate how combining anisotropy measurements with standard total synchronous fluorescence spectroscopy (TSFS) provides a rapid, accurate quantitation method for cell culture media. Anisotropy provides emission resolution between large and small fluorophores while TSFS provides a robust measurement space. Model cell culture media was prepared using yeastolate (2.5 mg mL(-1)) spiked with bovine serum albumin (0 to 5 mg mL(-1)). Using this method, protein emission is clearly discriminated from background yeastolate emission, allowing for accurate bovine serum albumin (BSA) quantification over a 0.1 to 4.0 mg mL(-1) range with a limit of detection (LOD) of 13.8 μg mL(-1). Copyright © 2014. Published by Elsevier B.V.

  11. Reproducibility of CSF quantitative culture methods for estimating rate of clearance in cryptococcal meningitis.

    Science.gov (United States)

    Dyal, Jonathan; Akampurira, Andrew; Rhein, Joshua; Morawski, Bozena M; Kiggundu, Reuben; Nabeta, Henry W; Musubire, Abdu K; Bahr, Nathan C; Williams, Darlisha A; Bicanic, Tihana; Larsen, Robert A; Meya, David B; Boulware, David R

    2016-05-01

    Quantitative cerebrospinal fluid (CSF) cultures provide a measure of disease severity in cryptococcal meningitis. The fungal clearance rate by quantitative cultures has become a primary endpoint for phase II clinical trials. This study determined the inter-assay accuracy of three different quantitative culture methodologies. Among 91 participants with meningitis symptoms in Kampala, Uganda, during August-November 2013, 305 CSF samples were prospectively collected from patients at multiple time points during treatment. Samples were simultaneously cultured by three methods: (1) St. George's 100 mcl input volume of CSF with five 1:10 serial dilutions, (2) AIDS Clinical Trials Group (ACTG) method using 1000, 100, 10 mcl input volumes, and two 1:100 dilutions with 100 and 10 mcl input volume per dilution on seven agar plates; and (3) 10 mcl calibrated loop of undiluted and 1:100 diluted CSF (loop). Quantitative culture values did not statistically differ between St. George-ACTG methods (P= .09) but did for St. George-10 mcl loop (Pmethods was high (r≥0.88). For detecting sterility, the ACTG-method had the highest negative predictive value of 97% (91% St. George, 60% loop), but the ACTG-method had occasional (∼10%) difficulties in quantification due to colony clumping. For CSF clearance rate, St. George-ACTG methods did not differ overall (mean -0.05 ± 0.07 log10CFU/ml/day;P= .14) on a group level; however, individual-level clearance varied. The St. George and ACTG quantitative CSF culture methods produced comparable but not identical results. Quantitative cultures can inform treatment management strategies. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

    Science.gov (United States)

    Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

    2015-11-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Cultural continuity, traditional Indigenous language, and diabetes in Alberta First Nations: a mixed methods study.

    Science.gov (United States)

    Oster, Richard T; Grier, Angela; Lightning, Rick; Mayan, Maria J; Toth, Ellen L

    2014-10-19

    We used an exploratory sequential mixed methods approach to study the association between cultural continuity, self-determination, and diabetes prevalence in First Nations in Alberta, Canada. We conducted a qualitative description where we interviewed 10 Cree and Blackfoot leaders (members of Chief and Council) from across the province to understand cultural continuity, self-determination, and their relationship to health and diabetes, in the Alberta First Nations context. Based on the qualitative findings, we then conducted a cross-sectional analysis using provincial administrative data and publically available data for 31 First Nations communities to quantitatively examine any relationship between cultural continuity and diabetes prevalence. Cultural continuity, or "being who we are", is foundational to health in successful First Nations. Self-determination, or "being a self-sufficient Nation", stems from cultural continuity and is seriously compromised in today's Alberta Cree and Blackfoot Nations. Unfortunately, First Nations are in a continuous struggle with government policy. The intergenerational effects of colonization continue to impact the culture, which undermines the sense of self-determination, and contributes to diabetes and ill health. Crude diabetes prevalence varied dramatically among First Nations with values as low as 1.2% and as high as 18.3%. Those First Nations that appeared to have more cultural continuity (measured by traditional Indigenous language knowledge) had significantly lower diabetes prevalence after adjustment for socio-economic factors (p =0.007). First Nations that have been better able to preserve their culture may be relatively protected from diabetes.

  14. POINT CLOUD MAPPING METHODS FOR DOCUMENTING CULTURAL LANDSCAPE FEATURES AT THE WORMSLOE STATE HISTORIC SITE, SAVANNAH, GEORGIA, USA

    Directory of Open Access Journals (Sweden)

    T. R. Jordana

    2016-06-01

    Full Text Available Documentation of the three-dimensional (3D cultural landscape has traditionally been conducted during site visits using conventional photographs, standard ground surveys and manual measurements. In recent years, there have been rapid developments in technologies that produce highly accurate 3D point clouds, including aerial LiDAR, terrestrial laser scanning, and photogrammetric data reduction from unmanned aerial systems (UAS images and hand held photographs using Structure from Motion (SfM methods. These 3D point clouds can be precisely scaled and used to conduct measurements of features even after the site visit has ended. As a consequence, it is becoming increasingly possible to collect non-destructive data for a wide variety of cultural site features, including landscapes, buildings, vegetation, artefacts and gardens. As part of a project for the U.S. National Park Service, a variety of data sets have been collected for the Wormsloe State Historic Site, near Savannah, Georgia, USA. In an effort to demonstrate the utility and versatility of these methods at a range of scales, comparisons of the features mapped with different techniques will be discussed with regards to accuracy, data set completeness, cost and ease-of-use.

  15. [The comparison of different bronchial aspirate culturing methods in patients with ventilator-associated pneumonia (VAP)].

    Science.gov (United States)

    Kowalczyk, Wojciech; Rybicki, Zbigniew; Tomaszewski, Dariusz; Truszczyński, Andrzej; Guzek, Aneta

    2011-01-01

    Although broncho-alveolar lavage (BAL) culture and protected specimen brush (PSB) are regarded as the most effective methods in the diagnosis of VAP, a simple endotracheal aspiration (EA) is frequently performed during routine care, because of its simplicity and low cost. We compared the effectiveness of EA with BAL and PSB in VAP patients. Sixty-one adult VAP patients, ventilated for longer than 48 h, were cultured with all three methods. Positive cultures were obtained from 63.9% of patients, with Acinetobacter baumannii being the most common pathogen. There was a high positive correlation between simple aspirates and BAL (k 0.817, CI 0.664-0.840, p aspirates and PSB (k 0.667, CI 0.483-0.871, p aspirate culturing, compared to BAL and PSB, it can be used successfully in most cases.

  16. A Method Sustaining the Bioelectric, Biophysical, and Bioenergetic Function of Cultured Rabbit Atrial Cells

    Directory of Open Access Journals (Sweden)

    Noa Kirschner Peretz

    2017-08-01

    Full Text Available Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM, which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells were maintained in culture for 24 h in a medium enriched with a myofilament contraction inhibitor, BDM. The morphology and volume of the cells, including their ability to contract in response to 1–3 Hz electrical pacing, was maintained at the same level as fresh cells. Importantly, the cells could be successfully infected with a GFP adenovirus. Action potentials, Ca2+ transients, and local Ca2+ spark parameters were similar in the cultured and in fresh cells. Finally, these cultured cells' flavoprotein autofluorescence was maintained at a constant level in response to electrical pacing, a response similar to that of fresh cells. Thus, eliminating contraction during the culture period preserves the bioelectric, biophysical and bioenergetic properties of rabbit atrial myocytes. This method therefore has the potential to further improve our understanding of energetic and biochemical regulation in the atria.

  17. A method for establishing human primary gastric epithelial cell culture from fresh surgical gastric tissues.

    Science.gov (United States)

    Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu

    2015-08-01

    At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.

  18. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  19. Comparing Amazon's Mechanical Turk Platform to Conventional Data Collection Methods in the Health and Medical Research Literature.

    Science.gov (United States)

    Mortensen, Karoline; Hughes, Taylor L

    2018-04-01

    The goal of this article is to conduct an assessment of the peer-reviewed primary literature with study objectives to analyze Amazon.com 's Mechanical Turk (MTurk) as a research tool in a health services research and medical context. Searches of Google Scholar and PubMed databases were conducted in February 2017. We screened article titles and abstracts to identify relevant articles that compare data from MTurk samples in a health and medical context to another sample, expert opinion, or other gold standard. Full-text manuscript reviews were conducted for the 35 articles that met the study criteria. The vast majority of the studies supported the use of MTurk for a variety of academic purposes. The literature overwhelmingly concludes that MTurk is an efficient, reliable, cost-effective tool for generating sample responses that are largely comparable to those collected via more conventional means. Caveats include survey responses may not be generalizable to the US population.

  20. An elemental concentration open source database for Hogdahl-Convention and Westcott-Formalism based on K0-INAA method in Malaysia

    International Nuclear Information System (INIS)

    Yavar, A.R.; Sukiman Sarmani; Tan, C.Y.; Rafie, N.N.; Lim, S.W.E.; Khoo, K.S.

    2012-01-01

    An electronic database has been developed and implemented for K 0 -INAA method in Malaysia. Databases are often developed according to national requirements. This database contains constant nuclear data for k 0 -INAA method. Hogdahl-convention and Westcott-formalism as 3 separate command user interfaces. It has been created using Microsoft Access 2007 under a Windows operating system. This database saves time and the quality of results can be assured when the calculation of neutron flux parameters and concentration of elements by k 0 -INAA method are utilised. An evaluation of the database was conducted by IAEA Soil7 where the results published which showed a high level of consistency. (Author)

  1. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  2. FEATURES OF METHODS OF FUTURE PHYSICAL CULTURE TEACHERS’ TRAINING FOR PHYSICAL EDUCATION OF HIGH SCHOOL STUDENTS

    Directory of Open Access Journals (Sweden)

    Петро Джуринський

    2014-12-01

    Full Text Available The paper presents the methodical approaches and recommendations on implementation of methods of future Physical Culture teachers to physical education of high school students into study process at a higher educational institution. The role of the approbated study discipline “Theory and methods of physical education at high school” has been determined in this research. It has also been defined, that future Physical Culture teacher’s training for physical education of high school students is a system of organizational and educational measures, ensuring the formation of future teacher’s professional knowledge and skills. The article presents the defined tasks, criteria, tools, forms, pedagogical conditions and stages of students’ training for teaching classes of Physical Education to high school students. Approbation of methodical approaches to future Physical Culture teachers’ training for physical education of high school students demonstrated their efficacy

  3. The bacteriology of chronic venous leg ulcer examined by culture-independent molecular methods

    DEFF Research Database (Denmark)

    Thomsen, Trine R; Aasholm, Martin S; Rudkjøbing, Vibeke B

    2010-01-01

    The bacterial microbiota plays an important role in the prolonged healing of chronic venous leg ulcers. The present study compared the bacterial diversity within ulcer material from 14 skin graft operations of chronic venous leg ulcers using culture-based methods and molecular biological methods...

  4. Culture methods of allograft musculoskeletal tissue samples in Australian bacteriology laboratories.

    Science.gov (United States)

    Varettas, Kerry

    2013-12-01

    Samples of allograft musculoskeletal tissue are cultured by bacteriology laboratories to determine the presence of bacteria and fungi. In Australia, this testing is performed by 6 TGA-licensed clinical bacteriology laboratories with samples received from 10 tissue banks. Culture methods of swab and tissue samples employ a combination of solid agar and/or broth media to enhance micro-organism growth and maximise recovery. All six Australian laboratories receive Amies transport swabs and, except for one laboratory, a corresponding biopsy sample for testing. Three of the 6 laboratories culture at least one allograft sample directly onto solid agar. Only one laboratory did not use a broth culture for any sample received. An international literature review found that a similar combination of musculoskeletal tissue samples were cultured onto solid agar and/or broth media. Although variations of allograft musculoskeletal tissue samples, culture media and methods are used in Australian and international bacteriology laboratories, validation studies and method evaluations have challenged and supported their use in recovering fungi and aerobic and anaerobic bacteria.

  5. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  6. The study of cultural objects by nuclear and conventional techniques; Estudio de bienes culturales con tecnicas de caracterizacion nucleares y convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Palacios, Tulio A [Comision Nacional de Energia Atomica, General San Martin (Argentina). Centro Atomico Constituyentes

    2000-07-01

    A survey is given of the techniques that are used at the National Atomic Energy Commission of Argentina for the characterization and study of cultural and archaeological specimens. A short history of these activities is also given. (author)

  7. Searching for Innovations and Methods of Using the Cultural Heritage on the Example of Upper Silesia

    Science.gov (United States)

    Wagner, Tomasz

    2017-10-01

    The basic subject of this paper is historical and cultural heritage of some parts of Upper Silesia, bind by common history and similar problems at present days. The paper presents some selected historical phenomena that have influenced contemporary space, mentioned above, and contemporary issues of heritage protection in Upper Silesia. The Silesian architecture interpretation, since 1989, is strongly covered with some ideological and national ideas. The last 25 years are the next level of development which contains rapidly transformation of the space what is caused by another economical transformations. In this period, we can observe landscape transformations, liquidation of objects and historical structures, loos of regional features, spontaneous adaptation processes of objects and many methods of implementation forms of protection, and using of cultural resources. Some upheaval linked to the state borders changes, system, economy and ethnic transformation caused that former Upper Silesia border area focuses phenomena that exists in some other similar European areas which are abutments of cultures and traditions. The latest period in the history of Upper Silesia gives us time to reflect the character of changes in architecture and city planning of the area and appraisal of efficiency these practices which are connected to cultural heritage perseveration. The phenomena of the last decades are: decrement of regional features, elimination of objects, which were a key feature of the regional cultural heritage, deformation of these forms that were shaped in the history and some trials of using these elements of cultural heritage, which are widely recognized as cultural values. In this situation, it is important to seek creative solutions that will neutralize bad processes resulting from bad law and practice. The most important phenomena of temporary space is searching of innovative fields and methods and use of cultural resources. An important part of the article is

  8. An efficient method for the establishment of cell suspension cultures in potato (Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Sajid, Z.A.

    2016-01-01

    Cell suspension cultures offers an In vitro system that can be used as a tool for various studies involving mutant selection, mass propagation, protoplast isolation, gene transfer and selection of cell-lines which are resistant to various biotic or abiotic stresses. Research work on the development of cell suspension cultures was carried out to establish the most efficient method in Potato (cv. Desiree). Healthy, well-proliferating tissues from different types of callus cultures (compact, friable, embryogenic or non-embryogenic) were inoculated on various media combinations, i.e., MS, MS2 or AA liquid medium containing 18.09 micro M 2, 4-D. A fixed quantity (0.5-1.0 g) of callus tissue from 60-day-old callus cultures was transferred to 10-25 ml of liquid medium in 100 ml Erlenmeyer flask. Cultures were placed on an orbital shaker and agitated at different speeds (75, 100 or 125 rpm) under 16-h photoperiod at 25 ± 2 degree C. Medium was changed after every 3 days and fractionated tissue was filtered after every 6 days through sterile mesh (100-800 micro m) to develop a cell-line by transferring resulting suspension to fresh medium under the same conditions. Results indicated that eight-week-old translucent, friable, off-white callus cultures were an excellent starting material for the initiation of homogeneous cell suspension cultures as compared to other tested sources. Of the three tested media (MS, MS2 or AA medium containing 18.09 micro M 2, 4-D), MS2 was found to be a better medium for the initiation of cell suspension cultures. Cell suspension cultures, placed in 16-h photoperiod at 25 ± 2 degree C and agitated at 120 rpm using a gyratory shaker showed excellent results. Several other factors influencing quick establishment of cell suspension cultures in this cultivar are also discussed in this communication. (author)

  9. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  10. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  11. Establishment of primary bovine intestinal epithelial cell culture and clone method.

    Science.gov (United States)

    Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi

    2017-01-01

    The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.

  12. A Novel Method for Culturing of Leptothrix sp. Strain OUMS1 in Natural Conditions

    Directory of Open Access Journals (Sweden)

    Tomoko Suzuki

    2012-05-01

    Full Text Available Although some strains of Leptothrix spp. isolated from aquatic environments have been characterized by culturing them in laboratory conditions, they often show morphological and chemical features distinct from those found in natural environments. To resolve this discrepancy, a novel cultivation method was devised for culturing such strains in natural groundwater. Leptothrix sp. strain OUMS1 was pre-cultured in a medium lacking Fe for 2 days, and then injected into a small dialysis tube bag and immersed in a container with continuously flowing groundwater for 1–3 and 14 days. Microscopic analysis of the initial phase of sheath formation and arbitrary comparisons with medium cultures revealed that in groundwater the surface coat of the sheath comprised much thinner fibrils, and an inner sheath wall that was much thinner and more indistinct compared with medium cultures. These differences were probably attributable to poorer secretion from the cell surface in groundwater conditions. A nutrient-rich medium likely activates cell metabolism and promotes secretion, resulting in a thicker inner sheath wall and thicker outer coat fibrils. Aqueous-phase Fe was deposited on immature sheaths in a similar manner in both cultures. These results indicate that laboratory culture of isolated microbes does not always reflect their characteristics in natural environments.

  13. Preparation of nickel and Ni_3Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    International Nuclear Information System (INIS)

    Li, Pingyun; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-01-01

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N_2 atmosphere. Ni and Ni_3Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni_3Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni_3Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N_2 protecting atmosphere. The Ni and Ni_3Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni_3Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni_3Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni_3Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  14. Comparing rapid and culture indicator bacteria methods at inland lake beaches

    Science.gov (United States)

    Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Kephart, Christopher M.

    2013-01-01

    A rapid method, quantitative polymerase chain reaction (qPCR), for quantifying indicator bacteria in recreational waters is desirable for public health protection. We report that replacing current Escherichia coli standards with new US Environmental Protection Agency beach action values (BAVs) for enterococci by culture or qPCR may result in more advisories being posted at inland recreational lakes. In this study, concentrations of E. coli and enterococci by culture methods were compared to concentrations of Enterococcus spp. by qPCR at 3 inland lake beaches in Ohio. The E. coli and enterococci culture results were significantly related at all beaches; however, the relations between culture results and Enterococcus spp. qPCR results were not always significant and differed among beaches. All the qPCR results exceeded the new BAV for Enterococcus spp. by qPCR, whereas only 23.7% of culture results for E. coli and 79% of culture results for enterococci exceeded the current standard for E. coli or BAV for enterococci.

  15. Culture-Dependent and -Independent Methods Capture Different Microbial Community Fractions in Hydrocarbon-Contaminated Soils.

    Directory of Open Access Journals (Sweden)

    Franck O P Stefani

    Full Text Available Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequencing of total soil DNA with culture-dependent (isolation using seven different growth media techniques to analyse the bacterial and fungal communities from hydrocarbon-contaminated soils. Although bacterial and fungal rarefaction curves were saturated for both methods, only 2.4% and 8.2% of the bacterial and fungal OTUs, respectively, were shared between datasets. Isolated taxa increased the total recovered species richness by only 2% for bacteria and 5% for fungi. Interestingly, none of the bacteria that we isolated were representative of the major bacterial OTUs recovered by 454-pyrosequencing. Isolation of fungi was moderately more effective at capturing the dominant OTUs observed by culture-independent analysis, as 3 of 31 cultured fungal strains ranked among the 20 most abundant fungal OTUs in the 454-pyrosequencing dataset. This study is one of the most comprehensive comparisons of microbial communities from hydrocarbon-contaminated soils using both isolation and high-throughput sequencing methods.

  16. Culture-Dependent and -Independent Methods Capture Different Microbial Community Fractions in Hydrocarbon-Contaminated Soils.

    Science.gov (United States)

    Stefani, Franck O P; Bell, Terrence H; Marchand, Charlotte; de la Providencia, Ivan E; El Yassimi, Abdel; St-Arnaud, Marc; Hijri, Mohamed

    2015-01-01

    Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequencing of total soil DNA) with culture-dependent (isolation using seven different growth media) techniques to analyse the bacterial and fungal communities from hydrocarbon-contaminated soils. Although bacterial and fungal rarefaction curves were saturated for both methods, only 2.4% and 8.2% of the bacterial and fungal OTUs, respectively, were shared between datasets. Isolated taxa increased the total recovered species richness by only 2% for bacteria and 5% for fungi. Interestingly, none of the bacteria that we isolated were representative of the major bacterial OTUs recovered by 454-pyrosequencing. Isolation of fungi was moderately more effective at capturing the dominant OTUs observed by culture-independent analysis, as 3 of 31 cultured fungal strains ranked among the 20 most abundant fungal OTUs in the 454-pyrosequencing dataset. This study is one of the most comprehensive comparisons of microbial communities from hydrocarbon-contaminated soils using both isolation and high-throughput sequencing methods.

  17. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  18. Method and Apparatus for a Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Kleis, Stanley J. (Inventor); Geffert, Sandra K. (Inventor); Gonda, Steve R. (Inventor)

    2015-01-01

    A bioreactor and method that permits continuous and simultaneous short, moderate, or long term cell culturing of one or more cell types or tissue in a laminar flow configuration is disclosed, where the bioreactor supports at least two laminar flow zones, which are isolated by laminar flow without the need for physical barriers between the zones. The bioreactors of this invention are ideally suited for studying short, moderate and long term studies of cell cultures and the response of cell cultures to one or more stressors such as pharmaceuticals, hypoxia, pathogens, or any other stressor. The bioreactors of this invention are also ideally suited for short, moderate or long term cell culturing with periodic cell harvesting and/or medium processing for secreted cellular components.

  19. Deaf: A Concept Analysis From a Cultural Perspective Using the Wilson Method of Concept Analysis Development.

    Science.gov (United States)

    Pendergrass, Kathy M; Newman, Susan D; Jones, Elaine; Jenkins, Carolyn H

    2017-07-01

    The purpose of this article is to provide an analysis of the concept Deaf to increase health care provider (HCP) understanding from a cultural perspective. Deaf signers, people with hearing loss who communicate primarily in American Sign Language (ASL), generally define the term Deaf as a cultural heritage. In the health care setting, the term deaf is most often defined as a pathological condition requiring medical intervention. When HCPs are unaware that there are both cultural and pathological views of hearing loss, significant barriers may exist between the HCP and the Deaf individual. The concept of Deaf is analyzed using the Wilsonian method. Essential elements of the concept "Deaf" from a cultural perspective include a personal choice to communicate primarily in ASL and identify with the Deaf community. Resources for HCPs are needed to quickly identify Deaf signers and provide appropriate communication.

  20. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  1. Comparison of conventional, model-based quantitative planar, and quantitative SPECT image processing methods for organ activity estimation using In-111 agents

    International Nuclear Information System (INIS)

    He, Bin; Frey, Eric C

    2006-01-01

    Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based

  2. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  3. Latent class analysis of the diagnostic characteristics of PCR and conventional bacteriological culture in diagnosing intramammary infections caused by Staphylococcus aureus in dairy cows at dry off

    Directory of Open Access Journals (Sweden)

    Cederlöf Sara Ellinor

    2012-11-01

    Full Text Available Abstract Background Staphylococcus aureus is one of the most common causes of intramammary infections in dairy cows at dry off. Reliable identification is important for disease management on herd level and for antimicrobial treatment of infected animals. Our objective was to evaluate the test characteristics of PathoProof ™ Mastitis PCR Assay and bacteriological culture (BC in diagnosing bovine intramammary infections caused by S. aureus at dry off at different PCR cycle threshold (Ct-value cut-offs. Methods Sterile quarter samples and non-sterile composite samples from 140 animals in seven herds were collected in connection with the dairy herd improvement (DHI milk recording. All quarter samples were analyzed using BC whereas all composite samples were analyzed with PathoProof ™ Mastitis PCR Assay. Latent class analysis was used to estimate test properties for PCR and BC in the absence of a perfect reference test. The population was divided into two geographically divided subpopulations and the Hui-Walter 2-test 2-populations model applied to estimate Se, Sp for the two tests, and prevalence for the two subpopulations. Results The Se for PCR increased with increasing Ct-value cut-off, accompanied by a small decrease in Sp. For BC the Se decreased and Sp increased with increasing Ct-value cut-off. Most optimal test estimates for the real-time PCR assay were at a Ct-value cut-off of 37; 0.93 [95% posterior probability interval (PPI 0.60-0.99] for Se and 0.95 [95% PPI 0.95-0.99] for Sp. At the same Ct-value cut-off, Se and Sp for BC were 0.83 [95% PPI 0.66-0.99] and 0.97 [95% PPI 0.91-0.99] respectively. Depending on the chosen PCR Ct-value cut-off, the prevalence in the subpopulations varied; the prevalence increased with increasing PCR Ct-value cut-offs. Conclusion Neither BC nor real-time PCR is a perfect test in detecting IMI in dairy cows at dry off. The changes in sensitivity and prevalence at different Ct-value cut-offs for both PCR and

  4. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  5. Optimization of an Efficient Non-Tissue Culture Transformation Method for Brassica Juncea

    International Nuclear Information System (INIS)

    Naeem, I.; Munir, I.; Iqbal, A.; Ullah, F.

    2016-01-01

    The major hurdles in successful in vitro transformation of Brassica juncea through standard tissue culture (STC) method are: culture contamination, somaclonal variations, and lack of expertise. Moreover, the current STC method is time consuming and needs continuous electricity. In the present study, the in planta transformation method through floral dip with or without vacuum infiltration was optimized for successful transformation of B. juncea. The B. juncea CV RAYA Anmol was used for transformation through Agrobacterium tumefaciens strain GV3101 harboring the binary vector plasmid pBinGlyBar4-EADcT. Based on the resistance reaction to the herbicide Basta, 20 and 40 resistant seedlings were obtained from 2000 seed germinated from the plants transformed through floral dip and vacuum infiltration methods, respectively. The PCR analyses further confirmed the presence of transgene in 3 floral dipped plants without vacuum infiltration and 17 floral dipped plants with vacuum infiltration, giving the transformation frequencies of 1.5*10/sup -3/ and 8.5*10/sup -3/, respectively. This method, which avoids tissue culture, will reduce the somaclonal variation accompanying prolonged culture of cells in a dedifferentiated state, will facilitate functional genomics and improvement of Brassica juncea with novel desirable traits while reducing time and expense. (author)

  6. cultural

    Directory of Open Access Journals (Sweden)

    Irene Kreutz

    2006-01-01

    Full Text Available Es un estudio cualitativo que adoptó como referencial teorico-motodológico la antropología y la etnografía. Presenta las experiencias vivenciadas por mujeres de una comunidad en el proceso salud-enfermedad, con el objetivo de comprender los determinantes sócio-culturales e históricos de las prácticas de prevención y tratamiento adoptados por el grupo cultural por medio de la entrevista semi-estructurada. Los temas que emergieron fueron: la relación entre la alimentación y lo proceso salud-enfermedad, las relaciones con el sistema de salud oficial y el proceso salud-enfermedad y lo sobrenatural. Los dados revelaron que los moradores de la comunidad investigada tienen un modo particular de explicar sus procedimientos terapéuticos. Consideramos que es papel de los profesionales de la salud en sus prácticas, la adopción de abordajes o enfoques que consideren al individuo en su dimensión sócio-cultural e histórica, considerando la enorme diversidad cultural en nuestro país.

  7. Method for Derivatization and Detection of Chemical Weapons Convention Related Sulfur Chlorides via Electrophilic Addition with 3-Hexyne.

    Science.gov (United States)

    Goud, D Raghavender; Pardasani, Deepak; Purohit, Ajay Kumar; Tak, Vijay; Dubey, Devendra Kumar

    2015-07-07

    Sulfur monochloride (S2Cl2) and sulfur dichloride (SCl2) are important precursors of the extremely toxic chemical warfare agent sulfur mustard and classified, respectively, into schedule 3.B.12 and 3.B.13 of the Chemical Weapons Convention (CWC). Hence, their detection and identification is of vital importance for verification of CWC. These chemicals are difficult to detect directly using chromatographic techniques as they decompose and do not elute. Until now, the use of gas chromatographic approaches to follow the derivatized sulfur chlorides is not reported in the literature. The electrophilic addition reaction of sulfur monochloride and sulfur dichloride toward 3-hexyne was explored for the development of a novel derivatization protocol, and the products were subjected to gas chromatography-mass spectrometric (GC-MS) analysis. Among various unsaturated reagents like alkenes and alkynes, symmetrical alkyne 3-hexyne was optimized to be the suitable derivatizing agent for these analytes. Acetonitrile was found to be the suitable solvent for the derivatization reaction. The sample preparation protocol for the identification of these analytes from hexane spiked with petrol matrix was also optimized. Liquid-liquid extraction followed by derivatization was employed for the identification of these analytes from petrol matrix. Under the established conditions, the detection and quantification limits are 2.6 μg/mL, 8.6 μg/mL for S2Cl2 and 2.3 μg/mL, 7.7 μg/mL for SCl2, respectively, in selected ion monitoring (SIM) mode. The calibration curve had a linear relationship with y = 0.022x - 0.331 and r(2) = 0.992 for the working range of 10 to 500 μg/mL for S2Cl2 and y = 0.007x - 0.064 and r(2) = 0.991 for the working range of 10 to 100 μg/mL for SCl2, respectively. The intraday RSDs were between 4.80 to 6.41%, 2.73 to 6.44% and interday RSDs were between 2.20 to 7.25% and 2.34 to 5.95% for S2Cl2 and SCl2, respectively.

  8. Methods for culturing saltwater rotifers (Brachionus plicatilis) for rearing larval zebrafish.

    Science.gov (United States)

    Lawrence, Christian; Sanders, Erik; Henry, Eric

    2012-09-01

    The saltwater rotifer, Brachionus plicatilis, is widely used in the aquaculture industry as a prey item for first-feeding fishes due to its ease of culture, small size, rapid reproductive rate, and amenability to enrichment with nutrients. Despite the distinct advantages of this approach, rotifers have only been sporadically utilized for rearing larval zebrafish, primarily because of the common misconception that maintaining cultures of rotifers is difficult and excessively time-consuming. Here we present simple methods for maintaining continuous cultures of rotifers capable of supporting even the very largest zebrafish aquaculture facility, with minimal investments in materials, time, labor, and space. Examples of the methods' application in one large, existing facility is provided, and troubleshooting of common problems is discussed.

  9. Transferring methods to teach business administration from one cultural context to another

    Directory of Open Access Journals (Sweden)

    Marie Catalo

    2015-12-01

    Full Text Available What happens when a teaching method is transferred from one cultural context to another? In this article we investigate this question by looking at how Computer Based Simulations (CBS were transposed from a French context to an Egyptian one. In this article we demonstrate, through the case of Egypt, how culture and the characteristics of the school system impact learning abilities. We describe what happens when Egyptian students are confronted with learning modes they have not encountered prior to University, in the context of an Egyptian-French dual-degree programme in business administration and business informatics. We show that the transfer of CBS as a teaching method revealed cultural differences between French and Egyptian students. As a consequence the teaching objectives of CBS were redefined in order to take the Egyptian context into account.

  10. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  11. A comparison between the conventional manual ROI method and an automatic algorithm for semiquantitative analysis of SPECT studies

    International Nuclear Information System (INIS)

    Pagan, L; Novi, B; Guidarelli, G; Tranfaglia, C; Galli, S; Lucchi, G; Fagioli, G

    2011-01-01

    In this study, the performance of a free software for automatic segmentation of striatal SPECT brain studies (BasGanV2 - www.aimn.it) and a standard manual Region Of Interest (ROI) method were compared. The anthropomorphic Alderson RSD phantom, filled with solutions at different concentration of 123 I-FP-CIT with Caudate-Putamen to Background ratios between 1 and 8.7 and Caudate to Putamen ratios between 1 and 2, was imaged on a Philips-Irix triple head gamma camera. Images were reconstructed using filtered back-projection and processed with both BasGanV2, that provides normalized striatal uptake values on volumetric anatomical ROIs, and a manual method, based on average counts per voxel in ROIs drawn in a three-slice section. Caudate-Putamen/Background and Caudate/Putamen ratios obtained with the two methods were compared with true experimental ratios. Good correlation was found for each method; BasGanV2, however, has higher R index (BasGan R mean = 0.95, p mean = 0.89, p 123 I-FP-CIT SPECT data with, moreover, the advantage of the availability of a control subject's database.

  12. Room for improvement? Leadership, innovation culture and uptake of quality improvement methods in general practice.

    Science.gov (United States)

    Apekey, Tanefa A; McSorley, Gerry; Tilling, Michelle; Siriwardena, A Niroshan

    2011-04-01

    Leadership and innovation are currently seen as essential elements for the development and maintenance of high-quality care. Little is known about the relationship between leadership and culture of innovation and the extent to which quality improvement methods are used in general practice. This study aimed to assess the relationship between leadership behaviour, culture of innovation and adoption of quality improvement methods in general practice. Self-administered postal questionnaires were sent to general practitioner quality improvement leads in one county in the UK between June and December 2007. The questionnaire consisted of background information, a 12-item scale to assess leadership behaviour, a seven-dimension self-rating scale for culture of innovation and questions on current use of quality improvement tools and techniques. Sixty-three completed questionnaires (62%) were returned. Leadership behaviours were not commonly reported. Most practices reported a positive culture of innovation, featuring relationship most strongly, followed by targets and information but rated lower on other dimensions of rewards, risk and resources. There was a significant positive correlation between leadership behaviour and the culture of innovation (r = 0.57; P improvement methods were not adopted by most participating practices. Leadership behaviours were infrequently reported and this was associated with a limited culture of innovation in participating general practices. There was little use of quality improvement methods beyond clinical and significant event audit. Practices need support to enhance leadership skills, encourage innovation and develop quality improvement skills if improvements in health care are to accelerate. © 2010 Blackwell Publishing Ltd.

  13. Comparative evaluation of the efficacy of chemomechanical caries removal agent (Papacarie and conventional method of caries removal: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jawa D

    2010-06-01

    Full Text Available Painless dentistry, minimal intervention and thus giving comfort, relief and solace and instill positive attitude toward dental treatments, are some of the factors justifying the specialty of pediatric dentistry. Thus, this in vitro study was undertaken to compare the efficacy of a new chemomechanical caries removal agent, Papacarie (Formula and Acao, with conventional slow-speed rotary instrument (bur. Papacarie is a new formulation and has the main active ingredient papain, an endoprotein with bactericidal, bacteriostatic and anti-inflammatory actions. Twenty extracted human molar teeth with deep dentine caries and no enamel coverage were selected for the study. After the preparation of the teeth and removal of the caries with the respective methods, they were decalcified, dehydrated and embedded in paraffin blocks for histologic studies. Serial sections of 5 μm thickness were examined for the presence of bacteria under light microscope. Though complete removal of caries was achieved significantly in both the methods, there was less marked destruction of dentinal tubules in chemomechanical caries removal method by Papacarie. Thus, Papacarie is recommended as an efficient, easy to perform, comfortable and less destructive solution for the patient seeking an alternative to the conventional method.

  14. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method.

    Science.gov (United States)

    Aminsobhani, Mohsen; Razmi, Hasan; Nozari, Solmaz

    2015-07-01

    Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method. Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi) rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey's post hoc test. There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05). Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique. According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  15. Development of Nuclear Safety Culture evaluation method for an operation team based on the probabilistic approach

    International Nuclear Information System (INIS)

    Han, Sang Min; Lee, Seung Min; Yim, Ho Bin; Seong, Poong Hyun

    2018-01-01

    Highlights: •We proposed a Probabilistic Safety Culture Healthiness Evaluation Method. •Positive relationship between the ‘success’ states of NSC and performance was shown. •The state probability profile showed a unique ratio regardless of the scenarios. •Cutset analysis provided not only root causes but also the latent causes of failures. •Pro-SCHEMe was found to be applicable to Korea NPPs. -- Abstract: The aim of this study is to propose a new quantitative evaluation method for Nuclear Safety Culture (NSC) in Nuclear Power Plant (NPP) operation teams based on the probabilistic approach. Various NSC evaluation methods have been developed, and the Korea NPP utility company has conducted the NSC assessment according to international practice. However, most of methods are conducted by interviews, observations, and the self-assessment. Consequently, the results are often qualitative, subjective, and mainly dependent on evaluator’s judgement, so the assessment results can be interpreted from different perspectives. To resolve limitations of present evaluation methods, the concept of Safety Culture Healthiness was suggested to produce quantitative results and provide faster evaluation process. This paper presents Probabilistic Safety Culture Healthiness Evaluation Method (Pro-SCHEMe) to generate quantitative inputs for Human Reliability Assessment (HRA) in Probabilistic Safety Assessment (PSA). Evaluation items which correspond to a basic event in PSA are derived in the first part of the paper through the literature survey; mostly from nuclear-related organizations such as the International Atomic Energy Agency (IAEA), the United States Nuclear Regulatory Commission (U.S.NRC), and the Institute of Nuclear Power Operations (INPO). Event trees (ETs) and fault trees (FTs) are devised to apply evaluation items to PSA based on the relationships among such items. The Modeling Guidelines are also suggested to classify and calculate NSC characteristics of

  16. Teaching cross-cultural communication skills online: a multi-method evaluation.

    Science.gov (United States)

    Lee, Amy L; Mader, Emily M; Morley, Christopher P

    2015-04-01

    Cultural competency education is an important and required part of undergraduate medical education. The objective of this study was to evaluate whether an online cross-cultural communication module could increase student use of cross-cultural communication questions that assess the patient's definition of the problem, the way the problem affects their life, their concerns about the problem, and what the treatment should be (PACT). We used multi-method assessment of students assigned to family medicine clerkship blocks that were randomized to receive online cultural competency and PACT training added to their standard curriculum or to a control group receiving the standard curriculum only. Outcomes included comparison, via analysis of variance, of number of PACT questions used during an observed Standardized Patient Exercise, end-of-year OSCE scores, and qualitative analysis of student narratives. Students (n=119) who participated in the online module (n=60) demonstrated increased use of cross-cultural communication PACT questions compared to the control group (n=59) and generally had positive themes emerge from their reflective writing. The module had the biggest impact on students who later went on to match in high communication specialties. Online teaching of cross-cultural communication skills can be effective at changing medical student behavior.

  17. Efficacy of adding the Kinesio Taping method to guideline-endorsed conventional physiotherapy in patients with chronic nonspecific low back pain: a randomised controlled trial.

    Science.gov (United States)

    Added, Marco Aurélio Nemitalla; Costa, Leonardo Oliveira Pena; Fukuda, Thiago Yukio; de Freitas, Diego Galace; Salomão, Evelyn Cassia; Monteiro, Renan Lima; Costa, Lucíola da Cunha Menezes

    2013-10-24

    Chronic nonspecific low back pain is a significant health condition with high prevalence worldwide and it is associated with enormous costs to society. Clinical practice guidelines show that many interventions are available to treat patients with chronic low back pain, but the vast majority of these interventions have a modest effect in reducing pain and disability. An intervention that has been widespread in recent years is the use of elastic bandages called Kinesio Taping. Although Kinesio Taping has been used extensively in clinical practice, current evidence does not support the use of this intervention; however these conclusions are based on a small number of underpowered studies. Therefore, questions remain about the effectiveness of the Kinesio Taping method as an additional treatment to interventions, such as conventional physiotherapy, that have already been recommended by the current clinical practice guidelines in robust and high-quality randomised controlled trials. We aim to determine the effectiveness of the addition of the use of Kinesio Taping in patients with chronic nonspecific low back pain who receive guideline-endorsed conventional physiotherapy. One hundred and forty-eight patients will be randomly allocated to receive either conventional physiotherapy, which consists of a combination of manual therapy techniques, general exercises, and specific stabilisation exercises (Guideline-Endorsed Conventional Physiotherapy Group) or to receive conventional physiotherapy with the addition of Kinesio Taping to the lumbar spine (Conventional Physiotherapy plus Kinesio Taping Group) over a period of 5 weeks (10 sessions of treatment). Clinical outcomes (pain intensity, disability and global perceived effect) will be collected at baseline and at 5 weeks, 3 months, and 6 months after randomisation. We will also collect satisfaction with care and adverse effects after treatment. Data will be collected by a blinded assessor. All statistical analysis will be

  18. Analysis of Longitudinal Studies With Repeated Outcome Measures: Adjusting for Time-Dependent Confounding Using Conventional Methods.

    Science.gov (United States)

    Keogh, Ruth H; Daniel, Rhian M; VanderWeele, Tyler J; Vansteelandt, Stijn

    2018-05-01

    Estimation of causal effects of time-varying exposures using longitudinal data is a common problem in epidemiology. When there are time-varying confounders, which may include past outcomes, affected by prior exposure, standard regression methods can lead to bias. Methods such as inverse probability weighted estimation of marginal structural models have been developed to address this problem. However, in this paper we show how standard regression methods can be used, even in the presence of time-dependent confounding, to estimate the total effect of an exposure on a subsequent outcome by controlling appropriately for prior exposures, outcomes, and time-varying covariates. We refer to the resulting estimation approach as sequential conditional mean models (SCMMs), which can be fitted using generalized estimating equations. We outline this approach and describe how including propensity score adjustment is advantageous. We compare the causal effects being estimated using SCMMs and marginal structural models, and we compare the two approaches using simulations. SCMMs enable more precise inferences, with greater robustness against model misspecification via propensity score adjustment, and easily accommodate continuous exposures and interactions. A new test for direct effects of past exposures on a subsequent outcome is described.

  19. a Method of 3d Measurement and Reconstruction for Cultural Relics in Museums

    Science.gov (United States)

    Zheng, S.; Zhou, Y.; Huang, R.; Zhou, L.; Xu, X.; Wang, C.

    2012-07-01

    Three-dimensional measurement and reconstruction during conservation and restoration of cultural relics have become an essential part of a modem museum regular work. Although many kinds of methods including laser scanning, computer vision and close-range photogrammetry have been put forward, but problems still exist, such as contradiction between cost and good result, time and fine effect. Aimed at these problems, this paper proposed a structure-light based method for 3D measurement and reconstruction of cultural relics in museums. Firstly, based on structure-light principle, digitalization hardware has been built and with its help, dense point cloud of cultural relics' surface can be easily acquired. To produce accurate 3D geometry model from point cloud data, multi processing algorithms have been developed and corresponding software has been implemented whose functions include blunder detection and removal, point cloud alignment and merge, 3D mesh construction and simplification. Finally, high-resolution images are captured and the alignment of these images and 3D geometry model is conducted and realistic, accurate 3D model is constructed. Based on such method, a complete system including hardware and software are built. Multi-kinds of cultural relics have been used to test this method and results prove its own feature such as high efficiency, high accuracy, easy operation and so on.

  20. Anthropology and International Business Research Methods in DBA Teaching: Frameworks for Cultural Awareness.

    Science.gov (United States)

    Whiteley, Alma

    2001-01-01

    Discusses the rationale for introducing anthropology into a doctoral-level international business research methods course. Describes three anthropological frameworks designed for the course: a cultural awareness model adapted from G. Morgan's (1980) idea of paradigmatic orthodoxy; key organizing principles; and a mapping model allowing researchers…

  1. X-ray and synchrotron methods in studies of cultural heritage sites

    Energy Technology Data Exchange (ETDEWEB)

    Koval’chuk, M. V.; Yatsishina, E. B.; Blagov, A. E.; Tereshchenko, E. Yu., E-mail: elenatereschenko@yandex.ru; Prosekov, P. A.; Dyakova, Yu. A. [National Research Centre “Kurchatov Institute” (Russian Federation)

    2016-09-15

    X-ray and synchrotron methods that are most widely used in studies of cultural heritage objects (including archaeological sites)—X-ray diffraction analysis, X-ray spectroscopy, and visualization techniques— have been considered. The reported examples show high efficiency and informativeness of natural science studies when solving most diverse problems of archaeology, history, the study of art, museology, etc.

  2. Learning as Researchers and Teachers: The Development of a Pedagogical Culture for Social Science Research Methods?

    Science.gov (United States)

    Kilburn, Daniel; Nind, Melanie; Wiles, Rose

    2014-01-01

    In light of calls to improve the capacity for social science research within UK higher education, this article explores the possibilities for an emerging pedagogy for research methods. A lack of pedagogical culture in this field has been identified by previous studies. In response, we examine pedagogical literature surrounding approaches for…

  3. X-ray and synchrotron methods in studies of cultural heritage sites

    International Nuclear Information System (INIS)

    Koval’chuk, M. V.; Yatsishina, E. B.; Blagov, A. E.; Tereshchenko, E. Yu.; Prosekov, P. A.; Dyakova, Yu. A.

    2016-01-01

    X-ray and synchrotron methods that are most widely used in studies of cultural heritage objects (including archaeological sites)—X-ray diffraction analysis, X-ray spectroscopy, and visualization techniques— have been considered. The reported examples show high efficiency and informativeness of natural science studies when solving most diverse problems of archaeology, history, the study of art, museology, etc.

  4. When Smokey says "No": Fire-less methods for growing plants adapted to cultural fire regimes

    Science.gov (United States)

    Daniela Shebitz; Justine E. James

    2010-01-01

    Two culturally-significant plants (sweetgrass [Anthoxanthum nitens] and beargrass [Xerophyllum tenax]) are used as case studies for investigating methods of restoring plant populations that are adapted to indigenous burning practices without using fire. Reports from tribal members that the plants of interest were declining in traditional gathering areas provided the...

  5. Digital Storytelling: A Method for Engaging Students and Increasing Cultural Competency

    Science.gov (United States)

    Grant, Natalie S.; Bolin, Brien L.

    2016-01-01

    Digital storytelling is explored as a method of engaging students in the development of media literacy and cultural competency. This paper describes the perceptions and experiences of 96 undergraduate students at a large Midwestern university, after completing a digital storytelling project in a semester-long diversity course. Digital storytelling…

  6. Establishment and Characterization of Primary Cultures from Iranian Oral Squamous Cell Carcinoma Patients by Enzymatic Method and Explant Culture

    Directory of Open Access Journals (Sweden)

    Meysam Ganjibakhsh

    2017-10-01

    Full Text Available Objectives: Oral Squamous Cell Carcinoma (OSCC is the most frequent oral cancer worldwide. It is known as the eighth most common cancer in men and as the fifth most common cancer in women. Cytogenetic and biochemical studies in recent decades have emphasized the necessity of providing an appropriate tool for such researches. Cancer cell culture is a useful tool for investigations on biochemical, genetic, molecular and immunological characteristics of different cancers, including oral cancer. Here, we explain the establishment process of five primary oral cancer cells derived from an Iranian population.Materials and Methods: The specimens were obtained from five oral cancer patients. Enzymatic, explant culture and magnetic-activated cell sorting (MACS methods were used for cell isolation. After quality control tests, characterization and authentication of primary oral cancer cells were performed by short tandem repeats (STR profiling, chromosome analysis, species identification, and monitoring the growth, morphology and the expression of CD326 and CD133 markers.Results: Five primary oral cancer cells were established from an Iranian population. The flow cytometry results showed that the isolated cells were positive for CD326 and CD133 markers. Furthermore, the cells were free from mycoplasma, bacterial and fungal contamination. No misidentified or cross-contaminated cells were detected by STR analysis.Conclusions: Human primary oral cancer cells provide an extremely useful platform for studying carcinogenesis pathways of oral cancer in Iranian population. They may be helpful in explaining the ethnic differences in cancer biology and the individuality in anticancer drug response in future studies.

  7. Children's activities and their meanings for parents: a mixed-methods study in six Western cultures.

    Science.gov (United States)

    Harkness, Sara; Zylicz, Piotr Olaf; Super, Charles M; Welles-Nyström, Barbara; Bermúdez, Moisés Ríos; Bonichini, Sabrina; Moscardino, Ughetta; Mavridis, Caroline Johnston

    2011-12-01

    Theoretical perspectives and research in sociology, anthropology, sociolinguistics, and cultural psychology converge in recognizing the significance of children's time spent in various activities, especially in the family context. Knowing how children's time is deployed, however, only gives us a partial answer to how children acquire competence; the other part must take into account the culturally constructed meanings of activities, from the perspective of those who organize and direct children's daily lives. In this article, we report on a study of children's routine daily activities and on the meanings that parents attribute to them in six Western middle-class cultural communities located in Italy, The Netherlands, Poland, Spain, Sweden, and the United States (N = 183). Using week-long time diaries kept by parents, we first demonstrate similarities as well as significant differences in children's daily routines across the cultural samples. We then present brief vignettes--"a day in the life" --of children from each sample. Parent interviews were coded for themes in the meanings attributed to various activities. Excerpts from parent interviews, focusing on four major activities (meals, family time, play, school- or developmentally related activities), are presented to illustrate how cultural meanings and themes are woven into parents' organization and understanding of their children's daily lives. The results of this mixed-method approach provide a more reliable and nuanced picture of children's and families' daily lives than could be derived from either method alone.

  8. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  9. Comparison of Vitek Matrix-assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry Versus Conventional Methods in Candida Identification.

    Science.gov (United States)

    Keçeli, Sema Aşkın; Dündar, Devrim; Tamer, Gülden Sönmez

    2016-02-01

    Candida species are generally identified by conventional methods such as germ tube or morphological appearance on corn meal agar, biochemical methods using API kits and molecular biological methods. Alternative to these methods, rapid and accurate identification methods of microorganisms called matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDİ-TOF MS) has recently been described. In this study, Candida identification results by API Candida kit, API 20C AUX kit and identifications on corn meal agar (CMA) are compared with the results obtained on Vitek-MS. All results were confirmed by sequencing internal transcribed spacer (ITS) regions of rDNA. Totally, 97 Candida strains were identified by germ tube test, CMA, API and Vitek-MS. Vitek-MS results were compatible with 74.2 % of API 20C AUX and 81.4 % of CMA results. The difference between the results of API Candida and API 20C AUX was detected. The ratio of discrepancy between Vitek-MS and API 20C AUX was 25.8 %. Candida species mostly identified as C. famata or C. tropicalis by and not compatible with API kits were identified as C. albicans by Vitek-MS. Sixteen Candida species having discrepant results with Vitek-MS, API or CMA were randomly chosen, and ITS sequence analysis was performed. The results of sequencing were compatible 56.2 % with API 20C AUX, 50 % with CMA and 93.7 % with Vitek-MS. When compared with conventional identification methods, MS results are more reliable and rapid for Candida identification. MS system may be used as routine identification method in clinical microbiology laboratories.

  10. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  11. Integrated functional modeling method for NPP plant DiD risk monitor and its application for conventional PWR

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, Hidekazu; Yang, Ming; Zhang, Zhijian [Harbin Engineering University, Harbin (China)

    2014-08-15

    The development of a new risk monitor system is introduced in this paper, which can be applied not only to severe accident prevention in daily operation but also to serve as to mitigate the radiological hazard just after severe accident happens and long term management of post-severe accident consequences. The summary of the fundamental method is summarized on how to configure the Plant Defense in-Depth (Did) Risk Monitor by object-oriented software system based on functional modeling approach. Following the authors??preceding preliminary study for AP1000, the way of realizing the proposed method of configuring the plant Did risk monitor was investigated for a safety-enhanced Japanese PWR design to meet with the tight anti-severe accident requirements set by national regulation in Japan after Fukushima Daiichi accident. The result of this example practice of the presented preliminary study for Japanese PWR was for the level 4 of the Did in case of beyond design basis accident, that is, loss of all AC power + RCP seal LOCA, against the former case of AP1000 for level 3 Did in case of large LOCA.

  12. Clinical value of FDG hybrid-PET in staging and restaging of malignant lymphoma. Compared with conventional diagnostic methods

    International Nuclear Information System (INIS)

    Pichler, R.; Maschek, W.; Hatzl-Griesenhofer, M.; Huber, H.; Wimmer, G.; Wahl, G.; Fridrik, M.

    2000-01-01

    Aim of the present retrospective study was to validate the clinical value of F-18-FDG PET imaging in lymphoma patients with a dual head camera modified for coincidence detection. Staging before and after oncological treatment was compared with a conservative diagnostic approach. Methods: 48 patients (28 non-Hodgkin lymphoma, 20 Hodgkin's disease) received FDG-Hybrid-PET scans. Pretherapeutic staging was realized in 28 patients, 9 of them had control studies after they had completed therapy. Totally 29 persons were examined for posttherapeutic restaging. Computed tomography imaging and lymph node sonography was performed in all cases. Results were validated by clinical follow-up, in three cases a recidive was proven by biopsy. Results: CT and ultrasound detected 77 lesions in 28 patients compared with 100 visualized by PET, but this difference in pretherapeutic staging did not reach significance at p>0.05 by Fisher's t-test. Hybrid-PET obtained a sensitivity of 93%, a specifity of 79%, a positive of 82% and a negative predictive value of 92% for detection of residual disease. The values for CT+US were 87%, 64%, 72% and 88% respectively. Conclusion: FDG Hybrid-PET is as or even more accurate than standard morphologic diagnostic methods for prestaging in malignant lymphoma. Additionally, there is a substancial benefit for therapy monitoring of residual disease using coincidence detection PET with a 3/4-inch crystal gamma camera. (orig.) [de

  13. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  14. Analysis of reverse heat transfer for conventional and optimized lubri-cooling methods during tangential surface grinding of ABNT 1020 steel

    Directory of Open Access Journals (Sweden)

    Henrique Cotait Razuk

    Full Text Available Abstract A numerical thermal model was developed to evaluate the heat flux which is conducted to a rectangular workpiece of steel plate ABNT 1020, thus making it possible to compute the maximum temperature in the grinding surface, taking into account the rectangular distribution of heat flux, the thermal properties of the grinding wheel conventional Al2O3, the piece to be machined and the lubri-refrigerating fluid. The finite volume method was employed for the discretization of the direct thermal problem from the heat diffusion equation associated with the two-dimensional problem of heat conduction in transient regime. The inverse thermal problem was solved by the Golden Section technique. The thermal flux, when compared to the conventional technique of method of application fluid, was reduced by 84.0% in the practices performed with cutting depth of 30µm, at 74.0% in practices with cutting depth of 45µm and 61.2% in the aggressive practices of 60µm, thus demonstrating the applicability of the optimized method for fluid application.

  15. Microscale validation of 4-aminoantipyrine test method for quantifying phenolic compounds in microbial culture

    International Nuclear Information System (INIS)

    Justiz Mendoza, Ibrahin; Aguilera Rodriguez, Isabel; Perez Portuondo, Irasema

    2014-01-01

    Validation of test methods microscale is currently of great importance due to the economic and environmental advantages possessed, which constitutes a prerequisite for the performance of services and quality assurance of the results to provide customer. This paper addresses the microscale validation of 4-aminoantipyrine spectrophotometric method for the quantification of phenolic compounds in culture medium. Parameters linearity, precision, regression, accuracy, detection limits, quantification limits and robustness were evaluated, addition to the comparison test with no standardized method for determining polyphenols (Folin Ciocalteu). The results showed that both methods are feasible for determining phenols

  16. Assessment of adiposity in psoriatic patients by dual energy X-ray absorptiometry compared to conventional methods*

    Science.gov (United States)

    Diniz, Michelle dos Santos; Bavoso, Nádia Couto; Kakehasi, Adriana Maria; Lauria, Márcio Weissheimer; Soares, Maria Marta Sarquis; Machado-Pinto, Jackson

    2016-01-01

    BACKGROUND Obesity is considered a chronic low-grade inflammatory disease that shares mediators of inflammation with psoriasis, such as TNF-α and IL-6. The relationship between these two conditions involves factors such as predisposition and response to therapy, in addition to an association with cardiovascular disease. OBJECTIVES The aim of the present study was to investigate the prevalence of adiposity as determined by body mass index (BMI), waist circumference (WC), and dual energy X-ray absorptiometry (DXA) evaluation in patients with psoriasis. METHODS BMI, WC and body composition by DXA were measured in 42 psoriatic patients without joint complaints and in 41 control patients using standard procedures. In the comparison between cases and controls, we used Pearson’s Χ2 test or Fisher’s exact test, and the nonparametric Mann-Whitney test. The difference between the diverse classification methods for obesity was evaluated using McNemar’s test. To test the level of agreement between those variables, we used the weighted kappa coefficient. RESULTS There was no difference in the prevalence of obesity among cases and controls. Both BMI and WC had low agreement with measures of body fat evaluated by DXA. With the use of DXA scanning, prevalence of overweight and obesity in patients with psoriasis was 83.3%, which constitutes a strong evidence of the need for intervention on this metabolic parameter. CONCLUSION Dual energy X-ray absorptiometry was more capable of identifying obesity compared with BMI and WC both in psoriatic and control patients. PMID:27192512

  17. Ascitic Fluid Culture In Cirrhotic Patients With Spontaneous Bacterial Peritonitis

    International Nuclear Information System (INIS)

    Sajjad, M.; Khan, Z.A.; Khan, M.S.

    2016-01-01

    Objective: To determine the frequency and compare the culture yield of bacterial isolation by conventional and blood culture BACTEC bottle techniques in cirrhotic patients with spontaneous bacterial peritonitis (SBP). Study Design: Cross-sectional comparative study. Place and Duration of Study: Pathology Department, Bannu Medical College, Bannu, KPK, from January 2012 to December 2013. Methodology: Paracentesis of 20 ml of ascitic fluid tapped from cirrhotic patients with SBP was carried out by a single technologist. The analysis included differential leukocyte count (DLC), while 5 ml each of the fluid was inoculated into conventional culture media and BACTEC blood culture bottle. All the data were analysed on (SPSS) version 16 to determine frequencies with percentages and mean values with standard deviation. Chi-square test was used for comparing the yield of conventional and blood culture bottle methods. P-value was considered significant if < 0.05. Results: In 105 cases of ascitic fluid analyses, 27 (25.72 percent) had positive ascitic fluid culture whereas 78 (74.28 percent) had negative ascitic fluid culture. Ascitic fluid culture was positive in 6 cases by conventional culture media and in 27 cases by BACTEC culture bottle media (p < 0.001). Bacterial isolation was obtained by both culture methods in 6 cases (p < 0.001). Conclusion: Direct bedside inoculation of ascitic fluid by BACTEC culture bottle method has better yield as compared to conventional culture method. (author)

  18. A study on evaluating validity of SNR calculation using a conventional two region method in MR images applied a multichannel coil and parallel imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwan Woo; Son, Soon Yong [Dept. of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Min, Jung Whan [Dept. of Radiological Technology, Shingu University, Sungnam (Korea, Republic of); Kwon, Kyung Tae [Dept. of Radiological Technology, Dongnam Health University, Suwon (Korea, Republic of); Yoo, Beong Gyu; Lee, Jong Seok [Dept. of Radiotechnology, Wonkwang Health Science University, Iksan (Korea, Republic of)

    2015-12-15

    The purpose of this study was to investigate the problems of a signal to noise ratio measurement using a two region measurement method that is conventionally used when using a multi-channel coil and a parallel imaging technique. As a research method, after calculating the standard SNR using a single channel head coil of which coil satisfies three preconditions when using a two region measurement method, we made comparisons and evaluations after calculating an SNR by using a two region measurement method of which method is problematic because it is used without considering the methods recommended by reputable organizations and the preconditions at the time of using a multi-channel coil and a parallel imaging technique. We found that a two region measurement method using a multi-channel coil and a parallel imaging technique shows the highest relative standard deviation, and thus shows a low degree of precision. In addition, we found out that the difference of SNR according to ROI location was very high, and thus a spatial noise distribution was not uniform. Also, 95% confidence interval through Blend-Altman plot is the widest, and thus the conformity degree with a two region measurement method using the standard single channel head coil is low. By directly comparing an AAPM method, which serves as a standard of a performance evaluation test of a magnetic resonance imaging device under the same image acquisition conditions, an NEMA method which can accurately determine the noise level in a signal region and the methods recommended by manufacturers of a magnetic resonance imaging device, there is a significance in that we quantitatively verified the inaccurate problems of a signal to noise ratio using a two region measurement method when using a multi-channel coil and a parallel imaging technique of which method does not satisfy the preconditions that researchers could overlook.

  19. A study on modeling nitrogen dioxide concentrations using land-use regression and conventionally used exposure assessment methods

    Science.gov (United States)

    Choi, Giehae; Bell, Michelle L.; Lee, Jong-Tae

    2017-04-01

    The land-use regression (LUR) approach to estimate the levels of ambient air pollutants is becoming popular due to its high validity in predicting small-area variations. However, only a few studies have been conducted in Asian countries, and much less research has been conducted on comparing the performances and applied estimates of different exposure assessments including LUR. The main objectives of the current study were to conduct nitrogen dioxide (NO2) exposure assessment with four methods including LUR in the Republic of Korea, to compare the model performances, and to estimate the empirical NO2 exposures of a cohort. The study population was defined as the year 2010 participants of a government-supported cohort established for bio-monitoring in Ulsan, Republic of Korea. The annual ambient NO2 exposures of the 969 study participants were estimated with LUR, nearest station, inverse distance weighting, and ordinary kriging. Modeling was based on the annual NO2 average, traffic-related data, land-use data, and altitude of the 13 regularly monitored stations. The final LUR model indicated that area of transportation, distance to residential area, and area of wetland were important predictors of NO2. The LUR model explained 85.8% of the variation observed in the 13 monitoring stations of the year 2009. The LUR model outperformed the others based on leave-one out cross-validation comparing the correlations and root-mean square error. All NO2 estimates ranged from 11.3-18.0 ppb, with that of LUR having the widest range. The NO2 exposure levels of the residents differed by demographics. However, the average was below the national annual guidelines of the Republic of Korea (30 ppb). The LUR models showed high performances in an industrial city in the Republic of Korea, despite the small sample size and limited data. Our findings suggest that the LUR method may be useful in similar settings in Asian countries where the target region is small and availability of data is

  20. Evaluation of conventional and alternative monitoring methods for a recreational marine beach with nonpoint source of fecal contamination.

    Science.gov (United States)

    Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E

    2010-11-01

    The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.

  1. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  2. Preparation and study of tramadol imprinted micro-and nanoparticles by precipitation polymerization: microwave irradiation and conventional heating method.

    Science.gov (United States)

    Seifi, Mahmoud; Hassanpour Moghadam, Maryam; Hadizadeh, Farzin; Ali-Asgari, Safa; Aboli, Jafar; Mohajeri, Seyed Ahmad

    2014-08-25

    In the present work a series of tramadole imprinted micro- and nanoparticles were prepared and study their recognition properties. Methacrylic acid (MAA), as a functional monomer, ethylene glycol dimethacrylate (EGDMA) as a cross-linker and different solvents (chloroform, toluene and acetonitrile (ACN)) were used for the preparation of molecularly imprinted polymers (MIPs) and non-imprinted polymers (NIPs). Several factors such as template/monomer molar ratio, volume of polymerization solvent, total monomers/solvent volume ratio, polymerization condition (heating or microwave irradiation) were also investigated. Particle size of the polymers, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), rebinding, selectivity tests and release study were applied for evaluation of the polymers. The optimized polymers with smaller particle size and superior binding properties were obtained in acetonitrile under heating method. MIPA4 with a size of 42.6 nm and a binding factor (BF) of 6.79 was selected for selectivity and release tests. The polymerization was not successful in acetonitrile and toluene under microwave irradiation. The MIPA4 could selectively adsorb tramadol, compared to imipramine, naltrexone and gabapentin. The data showed that tramadol release from MIPA4 was significantly slower than that of its non-imprinted polymer. Therefore, MIP nanoparticles with high selectivity, binding capacity and ability to control tramadol release could be obtained in precipitation polymerization with optimized condition. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Clinical and anatomic pathology effects of serial blood sampling in rat toxicology studies, using conventional or microsampling methods.

    Science.gov (United States)

    Caron, Alexis; Lelong, Christine; Bartels, T; Dorchies, O; Gury, T; Chalier, Catherine; Benning, Véronique

    2015-08-01

    As a general practice in rodent toxicology studies, satellite animals are used for toxicokinetic determinations, because of the potential impact of serial blood sampling on toxicological endpoints. Besides toxicological and toxicokinetic determinations, blood samples obtained longitudinally from a same animal may be used for the assessment of additional parameters (e.g., metabolism, pharmacodynamics, safety biomarkers) to maximize information that can be deduced from rodents. We investigated whether removal of up to 6 × 200 μL of blood over 24h can be applied in GLP rat toxicology studies without affecting the scientific outcome. 8 week-old female rats (200-300 g) were dosed for up to 1 month with a standard vehicle and subjected or not (controls) to serial blood sampling for sham toxicokinetic/ancillary determinations, using miniaturized methods allowing collection of 6 × 50, 100 or 200 μL over 24h. In-life endpoints, clinical pathology parameters and histopathology of organs sensitive to blood volume reduction were evaluated at several time points after completion of sampling. In sampled rats, minimal and reversible changes in red blood cell mass (maximally 15%) and subtle variations in liver enzymes, fibrinogen and neutrophils were not associated with any organ/tissue macroscopic or microscopic correlate. Serial blood sampling (up to 6 × 200 μL over 24h) is compatible with the assessment of standard toxicity endpoints in adult rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Characterization of microbes in prosthetic joint specimens by culture-independent molecular methods

    DEFF Research Database (Denmark)

    Xu, Yijuan; Rudkjøbing, Vibeke Børsholt; Simonsen, Ole

    Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study was to inves......Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... was to investigate the microbial diversity in surgical samples (eg. synovial fluid, periprosthetic tissue, removed prosthesis) from 22 prosthetic patients using a range of culture-independent molecular methods including broad range 16S rRNA gene PCR, cloning, phylogeny, quantitative PCR (qPCR), and fluorescence...

  5. Microbial transformation of tannin-rich substrate to gallic acid through co-culture method.

    Science.gov (United States)

    Banerjee, Rintu; Mukherjee, Gargi; Patra, Krushna Chandra

    2005-05-01

    Modified solid-state fermentation (MSSF) of tannin-rich substrate yielding tannase and gallic acid was carried out using a co-culture of the filamentous fungi, Rhizopus oryzae (RO IIT RB-13, NRRL 21498) and Aspergillus foetidus (GMRB013 MTCC 3557). Powdered fruits of Terminalia chebula and powdered pod cover of Caesalpinia digyna was used in the process and the different process parameters for maximum production of tannase and gallic acid by co-culture method were optimized through media engineering. MSSF was carried out at the optimum conditions of 30 degrees C and 80% relative humidity. The optimal pH and incubation period was 5.0 and 48 h respectively. Through the co-culture technique the maximum yield of tannase and gallic acid was found to be 41.3 U/ml and 94.8% respectively.

  6. Reflexive photography: an alternative method for documenting the learning process of cultural competence.

    Science.gov (United States)

    Amerson, Roxanne; Livingston, Wade G

    2014-04-01

    This qualitative descriptive study used reflexive photography to evaluate the learning process of cultural competence during an international service-learning project in Guatemala. Reflexive photography is an innovative qualitative research technique that examines participants' interactions with their environment through their personal reflections on images that they captured during their experience. A purposive sample of 10 baccalaureate nursing students traveled to Guatemala, where they conducted family and community assessments, engaged in home visits, and provided health education. Data collection involved over 100 photographs and a personal interview with each student. The themes developed from the photographs and interviews provided insight into the activities of an international experience that influence the cognitive, practical, and affective learning of cultural competence. Making home visits and teaching others from a different culture increased students' transcultural self-efficacy. Reflexive photography is a more robust method of self-reflection, especially for visual learners.

  7. In vitro culture of functionally active buffalo hepatocytes isolated by using a simplified manual perfusion method.

    Directory of Open Access Journals (Sweden)

    Santanu Panda

    Full Text Available In farm animals, there is no suitable cell line available to understand liver-specific functions. This has limited our understanding of liver function and metabolism in farm animals. Culturing and maintenance of functionally active hepatocytes is difficult, since they survive no more than few days. Establishing primary culture of hepatocytes can help in studying cellular metabolism, drug toxicity, hepatocyte specific gene function and regulation. Here we provide a simple in vitro method for isolation and short-term culture of functionally active buffalo hepatocytes.Buffalo hepatocytes were isolated from caudate lobes by using manual enzymatic perfusion and mechanical disruption of liver tissue. Hepatocyte yield was (5.3 ± 0.66×107 cells per gram of liver tissue with a viability of 82.3 ± 3.5%. Freshly isolated hepatocytes were spherical with well contrasted border. After 24 hours of seeding onto fibroblast feeder layer and different extracellular matrices like dry collagen, matrigel and sandwich collagen coated plates, hepatocytes formed confluent monolayer with frequent clusters. Cultured hepatocytes exhibited typical cuboidal and polygonal shape with restored cellular polarity. Cells expressed hepatocyte-specific marker genes or proteins like albumin, hepatocyte nuclear factor 4α, glucose-6-phosphatase, tyrosine aminotransferase, cytochromes, cytokeratin and α1-antitrypsin. Hepatocytes could be immunostained with anti-cytokeratins, anti-albumin and anti α1-antitrypsin antibodies. Abundant lipid droplets were detected in the cytosol of hepatocytes using oil red stain. In vitro cultured hepatocytes could be grown for five days and maintained for up to nine days on buffalo skin fibroblast feeder layer. Cultured hepatocytes were viable for functional studies.We developed a convenient and cost effective technique for hepatocytes isolation for short-term culture that exhibited morphological and functional characteristics of active hepatocytes

  8. Comparison among four proposed direct blood culture microbial identification methods using MALDI-TOF MS

    Directory of Open Access Journals (Sweden)

    Ali M. Bazzi

    2017-05-01

    Full Text Available Summary: Matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF mass spectrometry facilitates rapid and accurate identification of pathogens, which is critical for sepsis patients.In this study, we assessed the accuracy in identification of both Gram-negative and Gram-positive bacteria, except for Streptococcus viridans, using four rapid blood culture methods with Vitek MALDI-TOF-MS. We compared our proposed lysis centrifugation followed by washing and 30% acetic acid treatment method (method 2 with two other lysis centrifugation methods (washing and 30% formic acid treatment (method 1; 100% ethanol treatment (method 3, and picking colonies from 90 to 180 min subculture plates (method 4. Methods 1 and 2 identified all organisms down to species level with 100% accuracy, except for Streptococcus viridans, Streptococcus pyogenes, Enterobacter cloacae and Proteus vulgaris. The latter two were identified to genus level with 100% accuracy. Each method exhibited excellent accuracy and precision in terms of identification to genus level with certain limitations. Keywords: MALDI-TOF, Gram-negative, Gram-positive, Sepsis, Blood culture

  9. Hearsay Ethnography: Conversational Journals as a Method for Studying Culture in Action.

    Science.gov (United States)

    Watkins, Susan Cotts; Swidler, Ann

    2009-04-01

    Social scientists have long struggled to develop methods adequate to their theoretical understanding of meaning as collective and dynamic. While culture is widely understood as an emergent property of collectivities, the methods we use keep pulling us back towards interview-situated accounts and an image of culture as located in individual experience. Scholars who seek to access supra-individual semiotic structures by studying public rituals and other collectively-produced texts then have difficulty capturing the dynamic processes through which such meanings are created and changed in situ. To try to capture more effectively the way meaning is produced and re-produced in everyday life, we focus here on conversational interactions-the voices and actions that constitute the relational space among actors. Conversational journals provide us with a method: the analysis of texts produced by cultural insiders who keep journals of who-said-what-to-whom in conversations they overhear or events they participate in during the course of their daily lives. We describe the method, distinguishing it from other approaches and noting its drawbacks. We then illustrate the methodological advantages of conversational journals with examples from our texts. We end with a discussion of the method's potential in our setting as well as in other places and times.

  10. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  11. Sensitivity assessment of direct method for diagnosis of Trichomonas vaginalis in comparison with Dorset Culture media

    Directory of Open Access Journals (Sweden)

    ebrahim badparva

    2010-04-01

    Full Text Available Trichomonas vaginalis is a flagellate protozoan that lives in the genital tract and causes trichomoniasis in women. About 200 million people all over the world are infected with T. vaginalis. There are various methods with different sensitivity and specificity for detection of this parasite, that one of them is direct smear of vaginal secretions which is simpler, rapid and cheaper than other diagnostic methods. Materials and Methods: Demographic data was gathered by a questionnaire which contained different variables. Vaginal secretions samples were taken by spicolum and two swaps that maintained in glucose solution in separate tubes from 160 women referred to health centers of Khorramabad. One of the vaginal samples was examined by direct smear in saline solution and the other was cultured in Dorse medium. Results: Of 160 women suspected of trichomoniasis, 11.8% and 18.75% were positive by direct smear and culture respectively. The sensitivity of the direct method was 63.3%. Our findings indicated that 30% of the infected women belonged to the 31 – 35 age group, which had the most relative frequency of positive cases. Most of the patients (43% were illiterate or had elementary educational level. Conclussion: The sensivity of direct method is 63% in compare to culture ( as a Gold standard , which is ralatively low . Although the efficacy of this test could be imporved by shortening the elapsed time between sampling and examination , use of skilled microscopists , and different samples , but we recommend that more sensitive methods such as culture and PCR should be used .

  12. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  13. Method for automatic localization of MR-visible markers using morphological image processing and conventional pulse sequences: feasibility for image-guided procedures.

    Science.gov (United States)

    Busse, Harald; Trampel, Robert; Gründer, Wilfried; Moche, Michael; Kahn, Thomas

    2007-10-01

    To evaluate the feasibility and accuracy of an automated method to determine the 3D position of MR-visible markers. Inductively coupled RF coils were imaged in a whole-body 1.5T scanner using the body coil and two conventional gradient echo sequences (FLASH and TrueFISP) and large imaging volumes up to (300 mm(3)). To minimize background signals, a flip angle of approximately 1 degrees was used. Morphological 2D image processing in orthogonal scan planes was used to determine the 3D positions of a configuration of three fiducial markers (FMC). The accuracies of the marker positions and of the orientation of the plane defined by the FMC were evaluated at various distances r(M) from the isocenter. Fiducial marker detection with conventional equipment (pulse sequences, imaging coils) was very reliable and highly reproducible over a wide range of experimental conditions. For r(M) method is found to be useful for image-guided procedures. (c) 2007 Wiley-Liss, Inc.

  14. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  15. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  16. Comprehensive Method for Culturing Embryonic Dorsal Root Ganglion Neurons for Seahorse Extracellular Flux XF24 Analysis.

    Science.gov (United States)

    Lange, Miranda; Zeng, Yan; Knight, Andrew; Windebank, Anthony; Trushina, Eugenia

    2012-01-01

    Changes in mitochondrial dynamics and function contribute to progression of multiple neurodegenerative diseases including peripheral neuropathies. The Seahorse Extracellular Flux XF24 analyzer provides a comprehensive assessment of the relative state of glycolytic and aerobic metabolism in live cells making this method instrumental in assessing mitochondrial function. One of the most important steps in the analysis of mitochondrial respiration using the Seahorse XF24 analyzer is plating a uniform monolayer of firmly attached cells. However, culturing of primary dorsal root ganglion (DRG) neurons is associated with multiple challenges, including their propensity to form clumps and detach from the culture plate. This could significantly interfere with proper analysis and interpretation of data. We have tested multiple cell culture parameters including coating substrates, culture medium, XF24 microplate plastics, and plating techniques in order to optimize plating conditions. Here we describe a highly reproducible method to obtain neuron-enriched monolayers of securely attached dissociated primary embryonic (E15) rat DRG neurons suitable for analysis with the Seahorse XF24 platform.

  17. Comprehensive method for culturing embryonic dorsal root ganglion neurons for Seahorse Extracellular Flux XF24 Analysis

    Directory of Open Access Journals (Sweden)

    Miranda L. Lange

    2012-12-01

    Full Text Available Changes in mitochondrial dynamics and function contribute to progression of multiple neurodegenerative diseases including peripheral neuropathies. The Seahorse Extracellular Flux XF24 analyzer provides a comprehensive assessment of the relative state of glycolytic and aerobic metabolism in live cells making this method instrumental in assessing mitochondrial function. One of the most important steps in the analysis of mitochondrial respiration using the Seahorse XF24 analyzer is plating a uniform monolayer of firmly attached cells. However, culturing of primary dorsal root ganglion (DRG neurons is associated with multiple challenges, including their propensity to form clumps and detach from the culture plate. This could significantly interfere with proper analysis and interpretation of data. We have tested multiple cell culture parameters including coating substrates, culture medium, XF24 microplate plastics, and plating techniques in order to optimize plating conditions. Here we describe a highly reproducible method to obtain neuron-enriched monolayers of securely attached dissociated primary embryonic (E15 rat DRG neurons suitable for analysis with the Seahorse XF24 platform.

  18. Safe operation of nuclear power plants - Is safety culture an adequate management method?

    International Nuclear Information System (INIS)

    Piirto, A.

    2012-01-01

    One of the characteristics of a good safety culture is a definable commitment to the improvement of safety behaviours and attitudes at all organisational levels. A second characteristic of an organisation with excellent safety culture is free and open communication. The general understanding has been that safety culture is a part of organisation culture. In addition to safety culture thinking, proactive programmes and displays of proactive work to improve safety are required. This work needs to include, qt a minimum, actions aiming at reducing human errors, the development of human error prevention tools, improvements in training, and the development of working methods and the organisation's activities. Safety depends not only on the technical systems, but also on the organisation. There is a need for better methods and tools for organisational assessment and development. Today there is universal acceptance of the significant impact that management and organisational factors have over the safety significance of complex industrial installations such as nuclear power plants. Many events with significant economic and public impact had causes that have been traced to management deficiencies. The objective of this study is development of new methods to increase safety of nuclear power plant operation. The research has been limited to commercial nuclear power plants that are intended for electrical power generation in Finland. Their production activities, especially operation and maintenance, are primarily reviewed from a safety point of view, as well as human performance and organisational factors perspective. This defines the scope and focus of the study. The research includes studies related to knowledge management and tacit knowledge in the project management context and specific studies related to transfer of tacit knowledge in the maintenance organization and transfer of tacit knowledge between workers of old generation and young generation. The empirical results

  19. Safe operation of nuclear power plants - Is safety culture an adequate management method?

    Energy Technology Data Exchange (ETDEWEB)

    Piirto, A.

    2012-07-01

    One of the characteristics of a good safety culture is a definable commitment to the improvement of safety behaviours and attitudes at all organisational levels. A second characteristic of an organisation with excellent safety culture is free and open communication. The general understanding has been that safety culture is a part of organisation culture. In addition to safety culture thinking, proactive programmes and displays of proactive work to improve safety are required. This work needs to include, qt a minimum, actions aiming at reducing human errors, the development of human error prevention tools, improvements in training, and the development of working methods and the organisation's activities. Safety depends not only on the technical systems, but also on the organisation. There is a need for better methods and tools for organisational assessment and development. Today there is universal acceptance of the significant impact that management and organisational factors have over the safety significance of complex industrial installations such as nuclear power plants. Many events with significant economic and public impact had causes that have been traced to management deficiencies. The objective of this study is development of new methods to increase safety of nuclear power plant operation. The research has been limited to commercial nuclear power plants that are intended for electrical power generation in Finland. Their production activities, especially operation and maintenance, are primarily reviewed from a safety point of view, as well as human performance and organisational factors perspective. This defines the scope and focus of the study. The research includes studies related to knowledge management and tacit knowledge in the project management context and specific studies related to transfer of tacit knowledge in the maintenance organization and transfer of tacit knowledge between workers of old generation and young generation. The empirical

  20. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  1. Comparison of revegetation of a gas pipeline right-of-way in two forested wetland crossings involving conventional methods of pipeline installation and horizontal drilling, Nassau County, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Van Dyke, G.D. [Trinity Christian Coll., Palos Heights, IL (United States). Dept. of Biology; Shem, L.M.; Zimmerman, R.E. [Argonne National Lab., IL (United States)

    1993-10-01

    One year after pipeline installation, vegetation in the right-of-way (ROW) was inventoried at two stream floodplain crossings in Nassau County, Florida. Both sites were forested wetlands composed of Acer rubrum, Fraxinus caroliniana, Liquidamber styraciflua, Nyssa ogecho, Quercus laurifolia, and Taxodium distichum, together with other wetland trees. Pipeline installation across the Brandy Branch floodplain was by conventional ditching and backfill methods. Installation across the Deep Creek floodplain was by horizontal drilling after clearcutting the ROW. The latter method left tree stumps, understory vegetation, and soil layers intact, except for disruptions caused by logging. According to the inventory, vegetation at the drilled site was more diverse (nearly twice as many species occurring in the ROW as at the trenched site) and more robust (no unvegetated exposed soil compared to 15% at the trenched site). Differences between the ROW vegetation at the two sites can be attributed to both site differences and installation technologies used.

  2. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  3. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  4. Intensive care unit environmental surfaces are contaminated by multidrug-resistant bacteria in biofilms: combined results of conventional culture, pyrosequencing, scanning electron microscopy, and confocal laser microscopy.

    Science.gov (United States)

    Hu, H; Johani, K; Gosbell, I B; Jacombs, A S W; Almatroudi, A; Whiteley, G S; Deva, A K; Jensen, S; Vickery, K

    2015-09-01

    Hospital-associated infections cause considerable morbidity and mortality, and are expensive to treat. Organisms causing these infections can be sourced from the inanimate environment around a patient. Could the difficulty in eradicating these organisms from the environment be because they reside in dry surface biofilms? The intensive care unit (ICU) of a tertiary referral hospital was decommissioned and the opportunity to destructively sample clinical surfaces was taken in order to investigate whether multidrug-resistant organisms (MDROs) had survived the decommissioning process and whether they were present in biofilms. The ICU had two 'terminal cleans' with 500 ppm free chlorine solution; items from bedding, surrounds, and furnishings were then sampled with cutting implements. Sections were sonicated in tryptone soya broth and inoculated on to chromogenic plates to demonstrate MDROs, which were confirmed with the Vitek2 system. Genomic DNA was extracted directly from ICU samples, and subjected to polymerase chain reaction (PCR) for femA to detect Staphylococcus aureus and the microbiome by bacterial tag-encoded FLX amplicon pyrosequencing. Confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM) were performed on environmental samples. Multidrug-resistant bacteria were cultured from 52% (23/44) of samples cultured. S. aureus PCR was positive in 50%. Biofilm was demonstrated in 93% (41/44) of samples by CLSM and/or SEM. Pyrosequencing demonstrated that the biofilms were polymicrobial and contained species that had multidrug-resistant strains. Dry surface biofilms containing MDROs are found on ICU surfaces despite terminal cleaning with chlorine solution. How these arise and how they might be removed requires further study. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  5. Studies of Ancient Russian Cultural Objects Using the Neutron Tomography Method

    Directory of Open Access Journals (Sweden)

    Sergey Kichanov

    2018-01-01

    Full Text Available Neutron radiography and tomography is a non-destructive method that provides detailed information about the internal structure of cultural heritage objects. The differences in the neutron attenuation coefficients of constituent elements of the studied objects, as well as the application of modern mathematical algorithms to carry out three-dimensional imaging data analysis, allow one to obtain unique information about the spatial distribution of different phases, the presence of internal defects, or the degree of structural degradation inside valuable cultural objects. The results of the neutron studies of several archaeological objects related to different epochs of the Russian history are reported in order to demonstrate the opportunities provided by the neutron tomography method. The obtained 3D structural volume data, as well as the results of the corresponding data analysis, are presented.

  6. Growth and accumulation of flavan-3-ol in Camellia sinensis through callus culture and suspension culture method

    Directory of Open Access Journals (Sweden)

    Sutini Sutini

    2017-02-01

    Full Text Available This study was aimed to assess flavan-3-ol biomass in C. sinensis through callus cultures and suspension cultures derived from leaf explants. Callus initiation of both cultures were using Murashige and Skoog medium were enriched with plant growth regulators Naphtha-lene Acetic Acid 3.0 mg/L and kinetin 2.0 mg/L. The procedures in this study were: (1 callus initiation by cutting the leaves of C. sinen-sis shoots then planted on Murashige and Skoog medium that were enriched with plant growth regulators, (2 sub callus culture on fresh medium that enriched with the same growth regulators, (3 suspension culture initiation of liquid callus, (4 growth examination of callus and suspension cultures in week 12, (5 examination of qualitative-quantitative content of flavan-3-olin suspension cultures at week 4. The results show that suspension cultures contain biomass flavan-3-ol that increase in the same manner of the increase of callus age and weight

  7. Prevalence of periodontopathogenic bacteria in patients suffering from periodontitis using culture and PCR methods

    Directory of Open Access Journals (Sweden)

    Amir Aliramezani

    2012-01-01

    Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.

  8. The effect of different conventional methods of extraction on Marantodes pumila var. pumila leaves in relation to free radical scavenging activity

    Science.gov (United States)

    Hamid, Noor Huda Abd; Latip, Jalifah; Markom, Masturah

    2018-04-01

    Marantodes pumila is one of the important herbs used in traditional medicine. However, there is no report on the optimum method for the preparation of M. pumila extract enriched with bioactive compounds. Therefore, this study aim to establish the suitable method in the preparation of M. pumila extracts enriched with antioxidative compounds. Different conventional extraction methods such as maceration, reflux and Soxhlet in solvents of different polarities i.e. ethanol, 50 % aqueous ethanol and water were employed to prepare extracts. Constituents of each extract were profiled using RP-HPLC followed by the free radical scavenging assay using 2,2 diphenyl-1-picrylhydrazyl (DPPH) to determine the antioxidant activity. Among all extraction methods, maceration in 50 % aqueous ethanol gave the highest total percentage yield (22.41 %) while all extraction methods were able to extract the marker compounds, gallic acid (GA) and methyl gallate (MGA). The free radical scavenging activity of extracts varied from IC50 11.93 µg/mL (50 % aqueous ethanol via reflux) to 64.15 µg/mL (water via maceration). All extracts showed better scavenging activity as compared to synthetic antioxidant, BHT. The variation in the IC50 values is expected due to the presence of different types and/or concentration of bioactive compounds in each extract. This study may provide a preliminary insight for the preparation of standardized extracts of M. pumila enriched with bioactive compounds.

  9. How guiding coalitions promote positive culture change in hospitals: a longitudinal mixed methods interventional study.

    Science.gov (United States)

    Bradley, Elizabeth H; Brewster, Amanda L; McNatt, Zahirah; Linnander, Erika L; Cherlin, Emily; Fosburgh, Heather; Ting, Henry H; Curry, Leslie A

    2018-03-01

    Quality collaboratives are widely endorsed as a potentially effective method for translating and spreading best practices for acute myocardial infarction (AMI) care. Nevertheless, hospital success in improving performance through participation in collaboratives varies markedly. We sought to understand what distinguished hospitals that succeeded in shifting culture and reducing 30-day risk-standardised mortality rate (RSMR) after AMI through their participation in the Leadership Saves Lives (LSL) collaborative. We conducted a longitudinal, mixed methods intervention study of 10 hospitals over a 2-year period; data included surveys of 223 individuals (response rates 83%-94% depending on wave) and 393 in-depth interviews with clinical and management staff most engaged with the LSL intervention in the 10 hospitals. We measured change in culture and RSMR, and key aspects of working related to team membership, turnover, level of participation and approaches to conflict management. The six hospitals that experienced substantial culture change and greater reductions in RSMR demonstrated distinctions in: (1) effective inclusion of staff from different disciplines and levels in the organisational hierarchy in the team guiding improvement efforts (referred to as the 'guiding coalition' in each hospital); (2) authentic participation in the work of the guiding coalition; and (3) distinct patterns of managing conflict. Guiding coalition size and turnover were not associated with success (p values>0.05). In the six hospitals that experienced substantial positive culture change, staff indicated that the LSL learnings were already being applied to other improvement efforts. Hospitals that were most successful in a national quality collaborative to shift hospital culture and reduce RSMR showed distinct patterns in membership diversity, authentic participation and capacity for conflict management. © Article author(s) (or their employer(s) unless otherwise stated in the text of the

  10. A safety culture assessment by mixed methods at a public maternity and infant hospital in China

    Directory of Open Access Journals (Sweden)

    Listyowardojo TA

    2017-07-01

    Full Text Available Tita Alissa Listyowardojo,1 Xiaoling Yan,2,3 Stephen Leyshon,1 Bobbie Ray-Sannerud,1 Xin Yan Yu,4 Kai Zheng,4 Tao Duan2,3 1Life Sciences Program, Group Technology and Research, DNV GL, Hovik, Norway; 2Quality and Safety Department, Shanghai First Maternity and Infant Hospital, 3Tongji University School of Medicine, Shanghai, 4Healthcare Department, Business Assurance, DNV GL, Beijing, China Objective: To assess safety culture at a public maternity hospital in Shanghai, China, using a sequential mixed methods approach. The study was part of a bigger study looking at the application of the mixed methods approach to assess safety culture in health care in different organizations and countries.Methodology: A mixed methods approach was utilized by first distributing the Safety Attitudes Questionnaire measuring six safety culture dimensions and five independent items to all hospital staff (n=1482 working in 18 departments at a single hospital. Afterward, semistructured interviews were conducted using convenience sampling, where 48 hospital staff from nine departments at the same hospital were individually interviewed.Results: The survey received a response rate of 96%. The survey findings show significant differences between the hospital departments in almost all safety culture dimensions and independent items. Similarly, the interview findings revealed that there were different, competing priorities between departments perceived to result in a reduced quality of collaboration and bottlenecks in care delivery. Another major finding was that staff who worked more hours per week would perceive working conditions significantly more negatively. Issues related to working conditions were also the most common concerns discussed in the interviews, especially the issue on high workload. High workload was also reflected in the fact that 91.45% of survey respondents reported that they worked 40 hours or longer per week. Finally, interview findings complemented

  11. Enlargement of induced variations by combined method of chronic irradiations with callus culture in sugarcane

    International Nuclear Information System (INIS)

    Nagatomi, Shigeki

    1993-01-01

    The present study was conducted to elucidate the effects of gamma ray irradiation and callus culture upon induced variation of the regeneratives. The populations regenerated from young leaf tissue of chronic irradiated plnats grown under a gamma field receiving a total dose of 300 and 100 Gy, showed rather wider variation on quantitative characters than plants from populations of the non-irradiated. This variation extended in both negative and positive directions. Analysis of variance also revealed that variation and heritability in broad sense of most agronomic characters increased significantly among the subclones as the irradiation done rose. Principal component analysis also indicated that the subclones from the irradiated population were more variable than the non-irradiated. Such variation with higher heritability could be transmitted to the following generations by clonal propagation and utilized as genetic sources in mutation breeding. The combined method with chronic irradiation followed by tissue culture is evaluated as an effective method of widening mutation spectrum and increasing mutation frequency in regenerated plants. In addition, this method is valid to improve any crop species which can regenerate plants through callus culture. (author)

  12. Ethnonursing: A Qualitative Research Method for Studying Culturally Competent Care across Disciplines

    Directory of Open Access Journals (Sweden)

    Marilyn R. McFarland PhD, RN, FNP-BC, CTN

    2012-07-01

    Full Text Available Nurse anthropologist, Madeleine Leininger, developed the culture care theory and ethnonursing research method to help researchers study transcultural human care phenomena and discover the knowledge nurses need to provide care in an increasingly multicultural world. The authors propose that the ethnonursing method can be useful for research that addresses providing care in other disciplines, including education, administration, physical, occupational, and speech therapy, social work, pharmacy, medicine, and other disciplines in which research findings have implications for human care and health. The authors discuss the culture care theory and describe the ethnonursing research method's enablers, data analysis phases, and qualitative evaluation criteria. The theory is presented as a guide for using research findings to design culturally competent and congruent care to promote well-being among diverse people, groups, communities, and institutions. Resources include a reference list of key source publications, a discussion of exemplar studies, and samples of a theory-based, open-ended interview guide and data coding system.

  13. Comparison of oxygen saturation levels in patients receiving Technegas by the conventional unassisted method vs. the positive ventilation delivery system (PVDS)

    International Nuclear Information System (INIS)

    Dobson, M.P.; Leiper, C.A.; Lee, K.; Dixson, H.

    2000-01-01

    Full text: The purpose of this study is to compare oxygen saturation levels (SaO 2 ) in 289 patients undergoing conventional lung ventilation scintigraphy (control group) and 27 patients undergoing Positive Ventilation Delivery System (PVDS). The 27 patients where selected as their conventional method of inhalation proved to be inadequate or non-diagnostic. The patients underwent a second ventilation using PVDS, which improved the diagnostic quality of the ventilation image and assisted in clinical management decisions. Some patients in both the PVDS and the control group experienced a transient lowering in their SaO 2 . The mean initial SaO 2 in the control group did not fall below 94.9% and in the PVDS group measured 90.6%. 93% (25/27) of patients in the PVDS group were assessed as non CO 2 retaining, and received oxygen at 10L/min during Technegas inhalation. The mean trough saturation in the PVDS group was 91.7% which was significantly higher than that of the control group (86.9%). No patient in either group experienced any significant complication attributed to the transient tall in SaO 2 during technegas administration. We conclude that oxygen supplied as part of the PVDS system ameliorates the transient reduction in SaO 2 seen during standard Technegas administration. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  14. A NEW APPROACH FOR CULTURING LEMNA MINOR (DUCKWEED) AND STANDARDIZED METHOD FOR USING ATRAZINE AS A REFERENCE TOXICANT

    Science.gov (United States)