WorldWideScience

Sample records for conventional biochemical methods

  1. Study on color difference estimation method of medicine biochemical analysis

    Science.gov (United States)

    Wang, Chunhong; Zhou, Yue; Zhao, Hongxia; Sun, Jiashi; Zhou, Fengkun

    2006-01-01

    The biochemical analysis in medicine is an important inspection and diagnosis method in hospital clinic. The biochemical analysis of urine is one important item. The Urine test paper shows corresponding color with different detection project or different illness degree. The color difference between the standard threshold and the test paper color of urine can be used to judge the illness degree, so that further analysis and diagnosis to urine is gotten. The color is a three-dimensional physical variable concerning psychology, while reflectance is one-dimensional variable; therefore, the estimation method of color difference in urine test can have better precision and facility than the conventional test method with one-dimensional reflectance, it can make an accurate diagnose. The digital camera is easy to take an image of urine test paper and is used to carry out the urine biochemical analysis conveniently. On the experiment, the color image of urine test paper is taken by popular color digital camera and saved in the computer which installs a simple color space conversion (RGB -> XYZ -> L *a *b *)and the calculation software. Test sample is graded according to intelligent detection of quantitative color. The images taken every time were saved in computer, and the whole illness process will be monitored. This method can also use in other medicine biochemical analyses that have relation with color. Experiment result shows that this test method is quick and accurate; it can be used in hospital, calibrating organization and family, so its application prospect is extensive.

  2. Conventional laboratory methods for cyanotoxins.

    Science.gov (United States)

    Lawton, Linda A; Edwards, C

    2008-01-01

    It is clear from the literature that numerous methods are available for most cyanotoxins, although many publications on monitoring data indicate that the favored approach is the use proven, robust methods for individual toxins. The most effective approach is the utilization of a robust rapid screen, where positive samples are followed up by qualitative and quantitative analysis to provide the essential decision making data needed for successful management strategies (Fig. 2). Currently, rapid screens are available for microcystins, saxitoxins and anatoxin-a(s), whilst optimisation and validation is needed, many publications report good correlation with the mouse bioassay and HPLC. There is an urgent need for rapid, simple, and inexpensive assays for cylindrospermopsins, anatoxin-a and BMAA. Although methods exist for analysis of BMAA, the fact that a recent study showed 95% of cyanobacteria producing this, some at levels > 6,000 microg g(-1) dry wt, is of concern and rapid screening followed by robust analysis needed. An ideal approach would be a single method capable of extracting and detecting all cyanotoxins. Several publications describe such approaches using LC-MS, but as expected from a group of compounds with diverse chemistry, there are obvious limitations in recoveries during sample processing, chromatographic performance and sensitivity (Dahlmann et al. 2003, Dell'Aversano et al. 2004, Pietsch et al. 2001). Selection of methods must be based on the application requirements, equipment available and cost. For many organisations it may be more cost effective to out-source the occasional analysis. However, as the incidence of blooms appears to be increasing, the need for more rigorous monitoring is needed, sensible investment is needed to meet recommended guidelines. Most of the methods discussed in this paper are suitable for achieving this goal, although clean-up and concentration is usually necessary for physicochemical methods.

  3. Possibilities and methods for biochemical assessment of radiation injury

    Energy Technology Data Exchange (ETDEWEB)

    Minkova, M [Meditsinska Akademiya, Sofia (Bulgaria). Nauchen Inst. po Rentgenologiya i Radiobiologiya

    1986-01-01

    An extensitive review (77 references) is made of the application of biochemical diagnostic methods for assessment of radiation diseases. A brief characteristics of several biochemical indicators is given: deoxycytidine, thymidine, rho-aminoisocarboxylic acid, DNA-ase, nucleic acids. Influence of such factors as age, sex, season etc. is studied by means of functional biochemical indicators as: creatine, triptophanic metabolites, 5-hydroxy-indolacetic acid, biogenic amines, serum proteins, enzymes, etc.

  4. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  5. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  6. An evaluation of solutions to moment method of biochemical oxygen ...

    African Journals Online (AJOL)

    This paper evaluated selected solutions of moment method in respect to Biochemical Oxygen Demand (BOD) kinetics with the aim of ascertain error free solution. Domestic - institutional wastewaters were collected two - weekly for three months from waste - stabilization ponds in Obafemi Awolowo University, Ile - Ife.

  7. Fragrance analysis using molecular and biochemical methods in ...

    African Journals Online (AJOL)

    For molecular and biochemical analysis of aroma, a mapping population comprising 208 recombinant inbred lines (RILs) derived from a diverse cross between CSR10 and Taraori Basmati through Single seed descent (SSD) method was used. RILs are among the best mapping populations, which provide a novel material ...

  8. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  9. Improved methods for the mathematically controlled comparison of biochemical systems

    Directory of Open Access Journals (Sweden)

    Schwacke John H

    2004-06-01

    Full Text Available Abstract The method of mathematically controlled comparison provides a structured approach for the comparison of alternative biochemical pathways with respect to selected functional effectiveness measures. Under this approach, alternative implementations of a biochemical pathway are modeled mathematically, forced to be equivalent through the application of selected constraints, and compared with respect to selected functional effectiveness measures. While the method has been applied successfully in a variety of studies, we offer recommendations for improvements to the method that (1 relax requirements for definition of constraints sufficient to remove all degrees of freedom in forming the equivalent alternative, (2 facilitate generalization of the results thus avoiding the need to condition those findings on the selected constraints, and (3 provide additional insights into the effect of selected constraints on the functional effectiveness measures. We present improvements to the method and related statistical models, apply the method to a previously conducted comparison of network regulation in the immune system, and compare our results to those previously reported.

  10. Evaluation of the effect of conventionally prepared swarna makshika bhasma on different bio-chemical parameters in experimental animals

    Directory of Open Access Journals (Sweden)

    Sudhaldev Mohapatra

    2011-01-01

    Full Text Available Swarna makshika (chalcopyrite bhasma (SMB has been used for different therapeutic purposes since long in Ayurveda. The present study is conducted to evaluate the effect of conventionally prepared SMB on different bio-chemical parameters in experimental animals, for providing scientific data base for its logical use in clinical practice. The genuine SMB was prepared by following classical techniques of shodhana and marana most commonly used by different Ayurvedic drug manufacturers. Shodhana was done by roasting raw swarna makshika with lemon juice for three days and marana was performed by 11 putas . The experimental animals (rats were divided into two groups. SMB mixed with diluted honey was administered orally in therapeutic dose to Group SMB and diluted honey only was administered to vehicle control Group, for 30 days. The blood samples were collected twice, after 15 days and after 30 days of drug administration and different biochemical investigations were done. Biochemical parameters were chosen based on references from Ayurvedic classics and contemporary medicine. It was observed that Hb% was found significantly increased and LDL and VLDL were found significantly decreased in Group SMB when compared with vehicle control group. This experimental data will help the clinician for the logical use of SMB in different disease conditions with findings like low Hb% and high LDL, VLDL levels.

  11. Simulation methods with extended stability for stiff biochemical Kinetics

    Directory of Open Access Journals (Sweden)

    Rué Pau

    2010-08-01

    Full Text Available Abstract Background With increasing computer power, simulating the dynamics of complex systems in chemistry and biology is becoming increasingly routine. The modelling of individual reactions in (biochemical systems involves a large number of random events that can be simulated by the stochastic simulation algorithm (SSA. The key quantity is the step size, or waiting time, τ, whose value inversely depends on the size of the propensities of the different channel reactions and which needs to be re-evaluated after every firing event. Such a discrete event simulation may be extremely expensive, in particular for stiff systems where τ can be very short due to the fast kinetics of some of the channel reactions. Several alternative methods have been put forward to increase the integration step size. The so-called τ-leap approach takes a larger step size by allowing all the reactions to fire, from a Poisson or Binomial distribution, within that step. Although the expected value for the different species in the reactive system is maintained with respect to more precise methods, the variance at steady state can suffer from large errors as τ grows. Results In this paper we extend Poisson τ-leap methods to a general class of Runge-Kutta (RK τ-leap methods. We show that with the proper selection of the coefficients, the variance of the extended τ-leap can be well-behaved, leading to significantly larger step sizes. Conclusions The benefit of adapting the extended method to the use of RK frameworks is clear in terms of speed of calculation, as the number of evaluations of the Poisson distribution is still one set per time step, as in the original τ-leap method. The approach paves the way to explore new multiscale methods to simulate (biochemical systems.

  12. REMOVAL OF URANIUM FROM DRINKING WATER BY CONVENTIONAL TREATMENT METHODS

    Science.gov (United States)

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. The paper presents treatment technology information on the effectiveness of conventional method...

  13. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  14. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  15. Fragrance analysis using molecular and biochemical methods in ...

    African Journals Online (AJOL)

    admin

    Biochemical analysis of aroma was performed with the 1.7% KOH solution and molecular analysis of aroma was carried out with microsatellite markers present on chromosome 8 (BAD2, BADEX7-5, SCUSSR1) to determine the extent of association between trait, marker and chromosome 8. Among these markers, BAD2 ...

  16. Conventional cable testing methods: strengths, weaknesses and possibilities

    International Nuclear Information System (INIS)

    Reynolds, P.H.

    1988-01-01

    The paper reviews the major conventional methods that can be used to test power plant cables. It assesses their usefulness in diagnosing the condition of the insulation of the cable and then proposes some possible directions for innovation. The methods examined are dc insulation resistance measurement, ac signal injection for continuous monitoring and fault location, and the ac measurement of capacitance and loss angle. Specific subjects considered are the effects of temperature, cable construction and installation, and the validity of insulation resistance or loss angle measurement. The innovative proposals refer to the use of automation in the measurement and of computer-based Expert Systems for the evaluation of the results

  17. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  18. [On necessity to modify biochemical methods for detecting organophosphorus componds in chemical weapons extinction objects (review of literature)].

    Science.gov (United States)

    Prokofieva, D S; Shmurak, V I; Sadovnikov, S V; Gontcharov, N V

    2015-01-01

    The article covers problems of biochemical methods assessing organophosphorus toxic compounds in objects of chemical weapons extinction. The authors present results of works developing new, more specific and selective biochemical methods.

  19. Prospective Evaluation of 68Ga-RM2 PET/MRI in Patients with Biochemical Recurrence of Prostate Cancer and Negative Findings on Conventional Imaging.

    Science.gov (United States)

    Minamimoto, Ryogo; Sonni, Ida; Hancock, Steven; Vasanawala, Shreyas; Loening, Andreas; Gambhir, Sanjiv S; Iagaru, Andrei

    2018-05-01

    68 Ga-labeled DOTA-4-amino-1-carboxymethyl-piperidine-d-Phe-Gln-Trp-Ala-Val-Gly-His-Sta-Leu-NH 2 ( 68 Ga-RM2) is a synthetic bombesin receptor antagonist that targets gastrin-releasing peptide receptor (GRPr). GRPr proteins are highly overexpressed in several human tumors, including prostate cancer (PCa). We present data from the use of 68 Ga-RM2 in patients with biochemical recurrence (BCR) of PCa and negative findings on conventional imaging. Methods: We enrolled 32 men with BCR of PCa, who were 59-83 y old (mean ± SD, 68.7 ± 6.4 y). Imaging started at 40-69 min (mean, 50.5 ± 6.8 min) after injection of 133.2-151.7 MBq (mean, 140.6 ± 7.4 MBq) of 68 Ga-RM2 using a time-of-flight-enabled simultaneous PET/MRI scanner. T1-weighted, T2-weighted, and diffusion-weighted images were acquired. Results: All patients had a rising level of prostate-specific antigen (PSA) (range, 0.3-119.0 ng/mL; mean, 10.1 ± 21.3 ng/mL) and negative findings on conventional imaging (CT or MRI, and a 99m Tc-methylene diphosphonate bone scan) before enrollment. The observed 68 Ga-RM2 PET detection rate was 71.8%. 68 Ga-RM2 PET identified recurrent PCa in 23 of the 32 participants, whereas the simultaneous MRI scan identified findings compatible with recurrent PCa in 11 of the 32 patients. PSA velocity was 0.32 ± 0.59 ng/mL/y (range, 0.04-1.9 ng/mL/y) in patients with negative PET findings and 2.51 ± 2.16 ng/mL/y (range, 0.13-8.68 ng/mL/y) in patients with positive PET findings ( P = 0.006). Conclusion: 68 Ga-RM2 PET can be used for assessment of GRPr expression in patients with BCR of PCa. High uptake in multiple areas compatible with cancer lesions suggests that 68 Ga-RM2 is a promising PET radiopharmaceutical for localization of disease in patients with BCR of PCa and negative findings on conventional imaging. © 2018 by the Society of Nuclear Medicine and Molecular Imaging.

  20. Phytochemical analysis and In-vitro Biochemical Characterization of aqueous and methanolic extract of Triphala, a conventional herbal remedy

    Directory of Open Access Journals (Sweden)

    Romana Parveen

    2018-03-01

    Results revealed the presence of valuable bioactive compounds such as flavonoids, alkaloids, phenols, etc which might be responsible for biochemical activities. Extracts exhibited satisfactory radical-scavenging activity comparable with ascorbic acid. Methanolic extracts demonstrated higher antioxidant activity compared to aqueous extract. Extracts showed promising antibacterial potential against tested strain comparable to ampicillin. Hence, it can be concluded that triphala may be a promising candidate in pharmaceuticals and future medicine.

  1. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  2. An investigation on clinical, radiological and biochemical methods for assessing periodontitis activity

    International Nuclear Information System (INIS)

    Janssen, P.T.M.

    1987-01-01

    In order to recognize in which stage rapidly progressing destruction of periodontal ligament fibers occurs, a number of diagnostic methods are studied in this thesis. It turns out that the actual much utilized clinical methods can not be improved while radiological and biochemical diagnositic methods are much more promising. 106 refs.; 20 figs.; 36 tabs

  3. Validation of EIA sampling methods - bacterial and biochemical analysis

    Digital Repository Service at National Institute of Oceanography (India)

    Sheelu, G.; LokaBharathi, P.A.; Nair, S.; Raghukumar, C.; Mohandass, C.

    to temporal factors. Paired T-test between pre- and post-disturbance samples suggested that the above methods of sampling and variables like TC, protein and TOC could be used for monitoring disturbance....

  4. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  5. Study of goiter in Madagascar using biochemical and nuclear methods

    International Nuclear Information System (INIS)

    Ranaivoharisoa-Ravaoarinjanahary, Lala.

    Physiopathological and etiological characteristics of goiter in Tananarive and Majunga were compared, using the following methods: 131 iodine uptake, thyroid scintigraphy, radioimmunoassay of thyroid hormones, neutron activation analysis of iodine. The results are discussed and differences between goiter in Tananarive and Majunga are emphasized [fr

  6. LUDIC APPROACH OF THE SCIENTIFIC METHOD IN BIOCHEMICAL EDUCATION

    Directory of Open Access Journals (Sweden)

    W.B. Maia

    2008-05-01

    Full Text Available Education in the current times concerns to  the intellectual autonomy, the capacity of decision and the possibilities of the student in making the difference. This work arose due to multi-transdisciplinary perception of an educator’s team from UFPE and UFRJ,  to  whom scientific research means intentional intellectual activity to attend human needs. As an answer to teacher’s questions about student difficulties of learning scientific methodology, it was included a ludic activity into classroom of high school, graduation and postgraduate levels. First of all a CD-ROM entitled: “O Método Científico: Uma Leitura Virtual”  was  made with adobe flash program and it was  used as neurodidactic strategy (auditory and visual stimulus. After thirty minutes of ludic activities, discussions about importance and utility of scientific method took place, and the Science and the Technology as subjects matters arose. So, a democratic and interfacial environment was produced.  As a result of using this didactic  activity it was stimulated curiosity, awakened up attention, developed specific abilities of observation, eased association of ideas and improved capacity of analysis and synthesis in all the groups. Ludic activities in education create possibilities of sociability  (such as consolidation of student’s individuality, and  also  stimulate the interest in the Sciences. In this way, for the development of educational projects focused on paradigms changes that lead to the rise of a new didactic culture,  the use  of diverse interfacial resources becomes necessary.

  7. Evaluation of gemfibrozil effects on a marine fish (Sparus aurata) combining gene expression with conventional endocrine and biochemical endpoints.

    Science.gov (United States)

    Teles, M; Fierro-Castro, C; Na-Phatthalung, P; Tvarijonaviciute, A; Soares, A M V M; Tort, L; Oliveira, M

    2016-11-15

    The information on the potential hazardous effects of gemfibrozil (GEM) on marine fish is extremely scarce. In the current study, molecular, endocrine and biochemical parameters were assessed in Sparus aurata after 96h waterborne exposure to a GEM concentration range. Hepatic mRNA levels of target genes known to be regulated via peroxisome proliferator-activated receptor α (pparα) in mammals, such as apolipoprotein AI (apoa1) and lipoprotein (lpl) were significantly increased, without a concomitant activation of the ppar pathways. GEM (15μgL(-1)) induced an upregulation in mRNA levels of interleukin 1β (il1β), tumour necrosis factor-α (tnfα) and caspase 3 (casp3), suggesting an activation of proinflammatory processes in S. aurata liver. However, mRNA levels of genes related with the antioxidant defence system and cell-tissue repair were unaltered under the tested experimental conditions. Higher levels of GEM induced a cortisol rise, an indication that it is recognized as a stressor by S. aurata. Cortisol levels and the mRNA levels of il1β, tnfα and casp3 may be suggested as potential biomarkers of GEM effects in marine fish. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Systematic methods for synthesis and design of sustainable chemical and biochemical processes

    DEFF Research Database (Denmark)

    Gani, Rafiqul

    Chemical and biochemical process design consists of designing the process that can sustainably manufacture an identified chemical product through a chemical or biochemical route. The chemical product tree is potentially very large; starting from a set of basic raw materials (such as petroleum...... for process intensification, sustainable process design, identification of optimal biorefinery models as well as integrated process-control design, and chemical product design. The lecture will present the main concepts, the decomposition based solution approach, the developed methods and tools together...

  9. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  10. Dosimetry comparison of pelvimetry methods using conventional radiographs and CT

    International Nuclear Information System (INIS)

    Resten, A.; Suissa, M.; Musset, D.; Mausoleo, F.; Valero, M.; Taylor, S.

    2001-01-01

    To determine the fetal and maternal exposure to radiation by use of thermoluminescent dosimeters in order to compare conventional and CT-scan X-ray. Dosimetry was performed with an anthropomorph phantom. Thermoluminescent dosimeters were positioned on the surface and in the depth of the phantom. Digital radiography of the pelvis was performed according to a standard technique. CT-scan of the pelvis was performed according to the Buthiau's technique. With CT, the dose reached 0.31 to 4.95 mGy, with a dose of 2.32 mGy for the fetal gonads. With standard technique, the doses reached 0.03 to 0.39 mGy, with a dose of 0.39 mGy for the fetal gonads. With CT the fetus and the mother were exposed to 1/10. of the total dose delivered using conventional X-rays and the dose distribution was more homogeneous. (author)

  11. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  12. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  13. Biochemical method for fast affinity diagnosis in grape-vine transplantation

    International Nuclear Information System (INIS)

    Lilov, D.

    1977-01-01

    Long term experiments have proved the affinity of cv. Mavroud in transplantations on various root stocks. Best affinity was observed in the combination cv. Mavroud X Riparia tomanteau, followed, in a descending order, by the combinations Mavroud X Mavroud (autotransplantation), Mavroud X Berlandieri X Riparia Kobber SBB and Mavroud X Riparia 33 EM. In view to establish indices for predicting the transplantation affinity a great number of physiological-biochemical and morphological-anatomical studies were carried out. The results obtained showed that a most clearly expressed positive, statistically significant correlation exists between the amount of 15 N transported from the root stock to the scions, shoots and leaves. As a result, a biochemical method for fast affinity diagnosis in grape-vine transplantation has been developed. The reliability of the method has been checked up also with other cultivars. Up to the present no such method was known in grape-vine science and practice. (author)

  14. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  15. 68Ga Bombesin PET/MRI in Patients with Biochemically Recurrent Prostate Cancer and Noncontributory Conventional Imaging

    Science.gov (United States)

    2017-10-01

    flight (TOF)-enabled simultaneous positron emission tomography (PET) / magnetic resonance imaging (MRI) scanner. T1-weighted (T1w), T2 -weighted (T2w...bombesin analog receptor antagonist (RM2) is used as a promising diagnostic method for patients with suspicion of PCa recurrence. Here, we evaluate ... evaluate if 68Ga-RM2 PET/MRI can improve the diagnostic accuracy of recurrent prostate cancer earlier, when PSA level is still low and no disease is seen

  16. A fence barrier method of leading edge cell capture for explorative biochemical research.

    Science.gov (United States)

    Wager, Lucas J; Murray, Rachael Z; Thompson, Erik W; Leavesley, David I

    2017-09-03

    The scratch or wound-healing assay is used ubiquitously for investigating re-epithelialisation and has already revealed the importance of cells comprising the leading edge of healing epithelial wounds. However it is currently limited to studying the effect of known biochemical agents on the tissue of choice. Here we present an adaptation that extends the utility of this model to encompass the collection of cells from the leading edge of migrating epithelial sheets making available explorative biochemical analyses. The method is scalable and does not require expensive apparatus, making it suitable for large and small laboratories alike. We detail the application of our method and exemplify proof of principle data derived from primary human keratinocyte cultures.

  17. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  18. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  19. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  20. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  1. A Critical Analysis of the Conventionally Employed Creep Lifing Methods.

    Science.gov (United States)

    Abdallah, Zakaria; Gray, Veronica; Whittaker, Mark; Perkins, Karen

    2014-04-29

    The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  2. A moment-convergence method for stochastic analysis of biochemical reaction networks.

    Science.gov (United States)

    Zhang, Jiajun; Nie, Qing; Zhou, Tianshou

    2016-05-21

    Traditional moment-closure methods need to assume that high-order cumulants of a probability distribution approximate to zero. However, this strong assumption is not satisfied for many biochemical reaction networks. Here, we introduce convergent moments (defined in mathematics as the coefficients in the Taylor expansion of the probability-generating function at some point) to overcome this drawback of the moment-closure methods. As such, we develop a new analysis method for stochastic chemical kinetics. This method provides an accurate approximation for the master probability equation (MPE). In particular, the connection between low-order convergent moments and rate constants can be more easily derived in terms of explicit and analytical forms, allowing insights that would be difficult to obtain through direct simulation or manipulation of the MPE. In addition, it provides an accurate and efficient way to compute steady-state or transient probability distribution, avoiding the algorithmic difficulty associated with stiffness of the MPE due to large differences in sizes of rate constants. Applications of the method to several systems reveal nontrivial stochastic mechanisms of gene expression dynamics, e.g., intrinsic fluctuations can induce transient bimodality and amplify transient signals, and slow switching between promoter states can increase fluctuations in spatially heterogeneous signals. The overall approach has broad applications in modeling, analysis, and computation of complex biochemical networks with intrinsic noise.

  3. A moment-convergence method for stochastic analysis of biochemical reaction networks

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jiajun [School of Mathematics and Computational Science, Sun Yat-Sen University, Guangzhou 510275 (China); Nie, Qing [Department of Mathematics, University of California at Irvine, Irvine, California 92697 (United States); Zhou, Tianshou, E-mail: mcszhtsh@mail.sysu.edu.cn [School of Mathematics and Computational Science, Sun Yat-Sen University, Guangzhou 510275 (China); Guangdong Province Key Laboratory of Computational Science and School of Mathematics and Computational Science, Sun Yat-Sen University, Guangzhou 510275 (China)

    2016-05-21

    Traditional moment-closure methods need to assume that high-order cumulants of a probability distribution approximate to zero. However, this strong assumption is not satisfied for many biochemical reaction networks. Here, we introduce convergent moments (defined in mathematics as the coefficients in the Taylor expansion of the probability-generating function at some point) to overcome this drawback of the moment-closure methods. As such, we develop a new analysis method for stochastic chemical kinetics. This method provides an accurate approximation for the master probability equation (MPE). In particular, the connection between low-order convergent moments and rate constants can be more easily derived in terms of explicit and analytical forms, allowing insights that would be difficult to obtain through direct simulation or manipulation of the MPE. In addition, it provides an accurate and efficient way to compute steady-state or transient probability distribution, avoiding the algorithmic difficulty associated with stiffness of the MPE due to large differences in sizes of rate constants. Applications of the method to several systems reveal nontrivial stochastic mechanisms of gene expression dynamics, e.g., intrinsic fluctuations can induce transient bimodality and amplify transient signals, and slow switching between promoter states can increase fluctuations in spatially heterogeneous signals. The overall approach has broad applications in modeling, analysis, and computation of complex biochemical networks with intrinsic noise.

  4. Evaluation of biochemical and molecular methods for Lactobacillus reuteri strains differentiation.

    Science.gov (United States)

    Andrea, Bilková; Hana, Kiňová Sepová; Martina, Dubničková; Hyacinta, Májeková; František, Bilka

    2015-03-01

    Several biochemical and molecular methods were used for discrimination of four Lactobacillus reuteri strains isolated from goatling and lamb stomach mucosa. Internal transcribed spacer (ITS)-PCR method and protein analysis by SDS-PAGE and MALDI-TOF showed to be suitable for strain discrimination whereas ITS-PCR/RFLP and enterobacterial repetitive intergenic consensus (ERIC)-PCR were not strain specific. The used methods differentiated tested strains into distinct groups; however, the location of strains in groups varied. Consistency in results was observed in the case of L. reuteri E and L. reuteri KO4m that were clustered into the same groups using all techniques, except of MALDI-TOF MS. The last one grouped goatling strains and lamb isolate into separate clusters. All investigated methods, except of ITS-PCR/RFLP and ERIC-PCR, were assessed as appropriate for distinguishing of L. reuteri strains.

  5. Accessible methods for the dynamic time-scale decomposition of biochemical systems.

    Science.gov (United States)

    Surovtsova, Irina; Simus, Natalia; Lorenz, Thomas; König, Artjom; Sahle, Sven; Kummer, Ursula

    2009-11-01

    The growing complexity of biochemical models asks for means to rationally dissect the networks into meaningful and rather independent subnetworks. Such foregoing should ensure an understanding of the system without any heuristics employed. Important for the success of such an approach is its accessibility and the clarity of the presentation of the results. In order to achieve this goal, we developed a method which is a modification of the classical approach of time-scale separation. This modified method as well as the more classical approach have been implemented for time-dependent application within the widely used software COPASI. The implementation includes different possibilities for the representation of the results including 3D-visualization. The methods are included in COPASI which is free for academic use and available at www.copasi.org. irina.surovtsova@bioquant.uni-heidelberg.de Supplementary data are available at Bioinformatics online.

  6. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  7. Least-squares methods for identifying biochemical regulatory networks from noisy measurements

    Directory of Open Access Journals (Sweden)

    Heslop-Harrison Pat

    2007-01-01

    Full Text Available Abstract Background We consider the problem of identifying the dynamic interactions in biochemical networks from noisy experimental data. Typically, approaches for solving this problem make use of an estimation algorithm such as the well-known linear Least-Squares (LS estimation technique. We demonstrate that when time-series measurements are corrupted by white noise and/or drift noise, more accurate and reliable identification of network interactions can be achieved by employing an estimation algorithm known as Constrained Total Least Squares (CTLS. The Total Least Squares (TLS technique is a generalised least squares method to solve an overdetermined set of equations whose coefficients are noisy. The CTLS is a natural extension of TLS to the case where the noise components of the coefficients are correlated, as is usually the case with time-series measurements of concentrations and expression profiles in gene networks. Results The superior performance of the CTLS method in identifying network interactions is demonstrated on three examples: a genetic network containing four genes, a network describing p53 activity and mdm2 messenger RNA interactions, and a recently proposed kinetic model for interleukin (IL-6 and (IL-12b messenger RNA expression as a function of ATF3 and NF-κB promoter binding. For the first example, the CTLS significantly reduces the errors in the estimation of the Jacobian for the gene network. For the second, the CTLS reduces the errors from the measurements that are corrupted by white noise and the effect of neglected kinetics. For the third, it allows the correct identification, from noisy data, of the negative regulation of (IL-6 and (IL-12b by ATF3. Conclusion The significant improvements in performance demonstrated by the CTLS method under the wide range of conditions tested here, including different levels and types of measurement noise and different numbers of data points, suggests that its application will enable

  8. [Receptor status (ER and PgR) determined with histochemical and biochemical methods in breast carcinoma].

    Science.gov (United States)

    Simone, G; Paradiso, A; Cirillo, R; Mangia, A; Rella, G; Wiesel, S; Petroni, S; De Benedictis, G; De Lena, M

    1991-01-01

    Recently, a method similar to ER.ICA has been proposed for the progesterone receptor (PgR) using two monoclonal antibodies, JZB39 and KD68, specific for human PgR and characterized by a molecular weight of 95 and 120 Kd, respectively. A series of 73 breast cancer patients was studied with regards to ER and PgR using both immunocytochemical (ICA) and biochemical (DCC) assays. Results showed no substantial differences between the two methods when considering common clinical-pathological parameters. Overall agreement between ICA and DCC methods was found: 79% for PgR and 78% for ER. A slight quantitative correlation was also observed between the "score values" of the ICA method and the Fmol content of ER and PgR using the Brave-Pearson test (r = 0.49 for PgR; r = 0.43 for ER). Specificity of PgR.ICA method was 77% for PgR and 72% for ER; sensitivity was 82% and 83%, respectively. The ICA method is a reliable technique to assess PgR presence as well as ER. Further studies are necessary to evaluate the prognostic role of nuclear PgR.

  9. Investigation of Industrialised Building System Performance in Comparison to Conventional Construction Method

    Directory of Open Access Journals (Sweden)

    Othuman Mydin M.A.

    2014-03-01

    Full Text Available Conventional construction methods are still widely practised, although many researches have indicated that this method is less effective compared to the IBS construction method. The existence of the IBS has added to the many techniques within the construction industry. This study is aimed at making comparisons between the two construction approaches. Case studies were conducted at four sites in the state of Penang, Malaysia. Two projects were IBS-based while the remaining two deployed the conventional method of construction. Based on an analysis of the results, it can be concluded that the IBS approach has more to offer compared to the conventional method. Among these advantages are shorter construction periods, reduced overall costs, less labour needs, better site conditions and the production of higher quality components.

  10. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions

    OpenAIRE

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-01-01

    OBJECTIVES Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. MATERIALS AND METHODS Impressions were obtained via two conventional (metal full-arch tray, CI, ...

  11. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... PROGRAM FOR CONSUMER PRODUCTS Test Procedures Pt. 430, Subpt. B, App. I Appendix I to Subpart B of Part... between the center and the corners of the conventional gas oven on the diagonals of a horizontal plane...

  12. Conventional and digital radiographic methods in the detection of simulated external root resorptions: A comparative study

    Directory of Open Access Journals (Sweden)

    C J Sanjay

    2009-01-01

    Full Text Available Objective : To evaluate and compare the efficacy of conventional and digital radiographic methods in the detection of simulated external root resorption cavities and also to evaluate whether the detectability was influenced by resorption cavity sizes. Methods : Thirty-two selected teeth from human dentate mandibles were radiographed in orthoradial, mesioradial and distoradial aspect using conventional film (Insight Kodak F-speed; Eastman Kodak, Rochester, NY and a digital sensor (Trophy RVG advanced imaging system with 0.7mm and 1.0mm deep cavities prepared on their vestibular, mesial and distal surfaces at the cervical, middle and apical thirds. Three dental professionals, an endodontist, a radiologist and a general practitioner, evaluated the images twice with a one-week time interval. Results : No statistical significance was seen in the first observation for both conventional and digital radiographic methods in the detection of simulated external root resorptions and for small and medium cavities but statistical difference was noted in the second observation (P< 0.001 for both the methods. Conclusion : Considering the methodology and the overall results, conventional radiographic method (F-speed performed slightly better than the digital radiographic method in the detection of simulated radiographic method but better consistency was seen with the digital system. Overall size of the resorption cavity had no influence on the performance of both methods and suggests that initial external root resorption lesion is not well-appreciated with both the methods as compared to the advanced lesion.

  13. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  14. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  15. Development of ProCaRS Clinical Nomograms for Biochemical Failure-free Survival Following Either Low-Dose Rate Brachytherapy or Conventionally Fractionated External Beam Radiation Therapy for Localized Prostate Cancer

    Science.gov (United States)

    Warner, Andrew; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Souhami, Luis; Catton, Charles; Lukka, Himu

    2015-01-01

    Purpose: Although several clinical nomograms predictive of biochemical failure-free survival (BFFS) for localized prostate cancer exist in the medical literature, making valid comparisons can be challenging due to variable definitions of biochemical failure, the disparate distribution of prognostic factors, and received treatments in patient populations. The aim of this investigation was to develop and validate clinically-based nomograms for 5-year BFFS using the ASTRO II “Phoenix” definition for two patient cohorts receiving low-dose rate (LDR) brachytherapy or conventionally fractionated external beam radiation therapy (EBRT) from a large Canadian multi-institutional database. Methods and Materials: Patients were selected from the GUROC (Genitourinary Radiation Oncologists of Canada) Prostate Cancer Risk Stratification (ProCaRS) database if they received (1) LDR brachytherapy ≥ 144 Gy (n=4208) or (2) EBRT ≥ 70 Gy  (n=822). Multivariable Cox regression analysis for BFFS was performed separately for each cohort and used to generate clinical nomograms predictive of 5-year BFFS. Nomograms were validated using calibration plots of nomogram predicted probability versus observed probability via Kaplan-Meier estimates. Results: Patients receiving LDR brachytherapy had a mean age of 64 ± 7 years, a mean baseline PSA of 6.3 ± 3.0 ng/mL, 75% had a Gleason 6, and 15% had a Gleason 7, whereas patients receiving EBRT had a mean age of 70 ± 6 years, a mean baseline PSA of 11.6 ± 10.7 ng/mL, 30% had a Gleason 6, 55% had a Gleason 7, and 14% had a Gleason 8-10. Nomograms for 5-year BFFS included age, use and duration of androgen deprivation therapy (ADT), baseline PSA, T stage, and Gleason score for LDR brachytherapy and an ADT (months), baseline PSA, Gleason score, and biological effective dose (Gy) for EBRT. Conclusions: Clinical nomograms examining 5-year BFFS were developed for patients receiving either LDR brachytherapy or conventionally fractionated EBRT and

  16. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  17. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  18. Novel method of dual fiber Bragg gratings integrated in fiber ring laser for biochemical sensors

    Science.gov (United States)

    Bui, H.; Pham, T. B.; Nguyen, V. A.; Pham, V. D.; Do, T. C.; Nguyen, T. V.; Hoang, T. H. C.; Le, H. T.; Pham, V. H.

    2018-05-01

    Optical sensors have been shown to be very effective for measuring the toxic content in liquid and air environments. Optical sensors, which operate based on the wavelength shift of the optical signals, require an expensive spectrometer. In this paper, we propose a new configuration of the optical sensor device for measuring wavelength shift without using a spectrometer. This configuration has a large potential for application in biochemical sensing techniques, and comes with a low cost. This configuration uses dual fiber Bragg gratings (FBGs) integrated in a fiber ring laser structure of erbium-doped fiber, in which one FBG is used as a reference to sweep over the applicable spectrum of the etched-Bragg grating. The etched-FBG as a sensing probe is suitable for bio- and/or chemical sensors. The sensitivity and accuracy of the sensor system can be improved by the narrow linewidth of emission spectra from the laser, the best limit of detection of this sensor is 1.5  ×  10‑4 RIU (RIU: refractive index unit), as achieved by the optical sensor using a high resolution spectrometer. This sensor system has been experimentally investigated to detect different types of organic compounds, gasoline, mixing ratios of organic solvents in gasoline, and nitrate concentration in water samples. The experimental results show that this sensing method could determine different mixing ratios of organic solvents with good repeatability, high accuracy, and rapid response: e.g. for ethanol and/or methanol in gasoline RON 92 (RON: research octane number) of 0%–14% v/v, and nitrate in water samples at a low concentration range of 0–50 ppm. These results suggest that the proposed configuration can construct low-cost and accurate biochemical sensors.

  19. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  1. A high throughput biochemical fluorometric method for measuring lipid peroxidation in HDL.

    Directory of Open Access Journals (Sweden)

    Theodoros Kelesidis

    Full Text Available Current cell-based assays for determining the functional properties of high-density lipoproteins (HDL have limitations. We report here the development of a new, robust fluorometric cell-free biochemical assay that measures HDL lipid peroxidation (HDLox based on the oxidation of the fluorochrome Amplex Red. HDLox correlated with previously validated cell-based (r = 0.47, p<0.001 and cell-free assays (r = 0.46, p<0.001. HDLox distinguished dysfunctional HDL in established animal models of atherosclerosis and Human Immunodeficiency Virus (HIV patients. Using an immunoaffinity method for capturing HDL, we demonstrate the utility of this novel assay for measuring HDLox in a high throughput format. Furthermore, HDLox correlated significantly with measures of cardiovascular diseases including carotid intima media thickness (r = 0.35, p<0.01 and subendocardial viability ratio (r = -0.21, p = 0.05 and physiological parameters such as metabolic and anthropometric parameters (p<0.05. In conclusion, we report the development of a new fluorometric method that offers a reproducible and rapid means for determining HDL function/quality that is suitable for high throughput implementation.

  2. Big (Bio)Chemical Data Mining Using Chemometric Methods: A Need for Chemists.

    Science.gov (United States)

    Tauler, Roma; Parastar, Hadi

    2018-03-23

    This review aims to demonstrate abilities to analyze Big (Bio)Chemical Data (BBCD) with multivariate chemometric methods and to show some of the more important challenges of modern analytical researches. In this review, the capabilities and versatility of chemometric methods will be discussed in light of the BBCD challenges that are being encountered in chromatographic, spectroscopic and hyperspectral imaging measurements, with an emphasis on their application to omics sciences. In addition, insights and perspectives on how to address the analysis of BBCD are provided along with a discussion of the procedures necessary to obtain more reliable qualitative and quantitative results. In this review, the importance of Big Data and of their relevance to (bio)chemistry are first discussed. Then, analytical tools which can produce BBCD are presented as well as some basics needed to understand prospects and limitations of chemometric techniques when they are applied to BBCD are given. Finally, the significance of the combination of chemometric approaches with BBCD analysis in different chemical disciplines is highlighted with some examples. In this paper, we have tried to cover some of the applications of big data analysis in the (bio)chemistry field. However, this coverage is not extensive covering everything done in the field. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The comparative evaluation of patients′ body dry weight under hemodialysis using two methods: Bioelectrical impedance analysis and conventional method

    Directory of Open Access Journals (Sweden)

    Neda Alijanian

    2012-01-01

    Full Text Available Background: Dry weight (DW is an important concept related to patients undergoing hemodialysis. Conventional method seems to be time consuming and operator dependent. Bio impedance analysis (BIA is a new and simple method reported to be an accurate way for estimating DW. In this study, we aimed to compare the conventional estimation of DW with measuring DW by BIA. Materials and Methods: This study involved 130 uremic patients, performed in Isfahan, Iran. DW was calculated by both conventional (CDW and BIA (BIADW method and results were compared based on different grouping factors including sex, underlying cause of renal failure (RF (diabetic RF and non-diabetic RF, body mass index (BMI status, and sessions of hemodialysis. We also calculated the difference between DWs of 2 methods (DW diff = CDW-BIADW. Results: The mean of BIADW was significantly lower than CDW (57.20 ± 1.82 vs 59.36 ± 1.77, P value < 0.001. After grouping cases according to the underlying cause, BMI, sex, and dialysis sessions BIADW was significantly lower than CDW. Conclusion: Based on the combination of problems with CDW measurement which are corrected by BIA, and more clinical reliability of CDW, we concluded that although conventional method is a time-consuming and operator-dependent way to assess DW, DW could be estimated by combining both of these methods by finding the mathematic correlation between these methods.

  4. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  5. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  6. Comparison of two biochemical methods for identifying Corynebacterium pseudotuberculosis isolated from sheep and goats.

    Science.gov (United States)

    Huerta, Belén; Gómez-Gascón, Lidia; Vela, Ana I; Fernández-Garayzábal, José F; Casamayor, Almudena; Tarradas, Carmen; Maldonado, Alfonso

    2013-06-01

    The biochemical pattern of Cowan and Steel (BPCS) was compared with a commercial biochemical strip for the identification of Corynebacterium pseudotuberculosis isolated from small ruminants. On 16S rRNA gene sequencing, 40/78 coryneform isolates from the lymph nodes of sheep and goats with lesions resembling caseous lymphadenitis were identified as C. pseudotuberculosis. The sensitivities of the BPCS and the commercial biochemical strip relative to 16S rRNA sequencing were 80% and 85%, and their specificities were 92.1% and 94.7%, respectively; the level of agreement between the BPCS and the commercial biochemical strip was high (κ=0.82). Likelihood ratios for positive and negative results were 10.0 and 0.22 for the BPCS, and 16.0 and 0.16 for the commercial biochemical strip, respectively. These results indicate that the BPCS and the commercial biochemical strip are both useful for identifying C. pseudotuberculosis in veterinary microbiology laboratories. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Conventional and Alternative Disinfection Methods of Legionella in Water Distribution Systems – Review

    Directory of Open Access Journals (Sweden)

    Pūle Daina

    2016-12-01

    Full Text Available Prevalence of Legionella in drinking water distribution systems is a widespread problem. Outbreaks of Legionella caused diseases occur despite various disinfectants are used in order to control Legionella. Conventional methods like thermal disinfection, silver/copper ionization, ultraviolet irradiation or chlorine-based disinfection have not been effective in the long term for control of biofilm bacteria. Therefore, research to develop more effective disinfection methods is still necessary.

  8. Brachytherapy Improves Biochemical Failure–Free Survival in Low- and Intermediate-Risk Prostate Cancer Compared With Conventionally Fractionated External Beam Radiation Therapy: A Propensity Score Matched Analysis

    International Nuclear Information System (INIS)

    Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George

    2015-01-01

    Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led

  9. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  10. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    International Nuclear Information System (INIS)

    Kouchakzadeh, Ahmad; Tavakoli, Teymur

    2011-01-01

    Highlights: → Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. → Using thermophysical properties of air and matter. → This manner could be utilized in similar dryer for other agricultural products. → Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  11. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    Energy Technology Data Exchange (ETDEWEB)

    Kouchakzadeh, Ahmad [Agri Machinery Engineering, Ilam University, Ilam (Iran, Islamic Republic of); Tavakoli, Teymur [Agri Machinery Engineering, Tarbyat Modares University, Tehran (Iran, Islamic Republic of)

    2011-07-15

    Highlights: {yields} Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. {yields} Using thermophysical properties of air and matter. {yields} This manner could be utilized in similar dryer for other agricultural products. {yields} Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  12. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  13. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  14. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  15. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  16. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  17. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  18. Comparison of biochemical and molecular methods for the identification of bacterial isolates associated with failed loggerhead sea turtle eggs.

    Science.gov (United States)

    Awong-Taylor, J; Craven, K S; Griffiths, L; Bass, C; Muscarella, M

    2008-05-01

    Comparison of biochemical vs molecular methods for identification of microbial populations associated with failed loggerhead turtle eggs. Two biochemical (API and Microgen) and one molecular methods (16s rRNA analysis) were compared in the areas of cost, identification, corroboration of data with other methods, ease of use, resources and software. The molecular method was costly and identified only 66% of the isolates tested compared with 74% for API. A 74% discrepancy in identifications occurred between API and 16s rRNA analysis. The two biochemical methods were comparable in cost, but Microgen was easier to use and yielded the lowest discrepancy among identifications (29%) when compared with both API 20 enteric (API 20E) and API 20 nonenteric (API 20NE) combined. A comparison of API 20E and API 20NE indicated an 83% discrepancy between the two methods. The Microgen identification system appears to be better suited than API or 16s rRNA analysis for identification of environmental isolates associated with failed loggerhead eggs. Most identification methods are not intended for use with environmental isolates. A comparison of identification systems would provide better options for identifying environmental bacteria for ecological studies.

  19. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  20. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  1. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.

    1992-01-01

    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  2. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  3. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  4. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    OpenAIRE

    A Pourkhalili; M Mirlohi; E Rahimi; M Hojatoleslami

    2012-01-01

    Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying a...

  5. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  6. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    Full Text Available Introduction: Conservation tillage system was recommended for soil erosion control in North America for the first time 60 years ago (Wang et al., 2006. Using this tillage system including minimum and zero tillage has been rapidly developed in recent years. Thearea covered by zero tillage in 2006 was 95 million ha all over the world (Dumanski et al., 2006. In addition to saving soil and water resources, conservation tillage system reduces energy consumption and improves energy indices by combining different tillage and planting operations. Results of research conducted in Fars province shows that conservation tillage saves fuel consumption for 77% compared to the conventional system (Afzalinia et al., 2009. Conservation tillage also reduces energy consumption from 23.6 to 42.8% in comparison to the conventional tillage (Rusu, 2005. Since energy indices would be affected by reduced input energies in conservation tillage, this research was conducted to evaluate the effect of different tillage and planting methods on energy inputs and energy indices in irrigated wheat production in Eghlid region. Materials and Methods: This research was performed to evaluate and compare the energy indices in irrigated wheat production under different tillage and planting methods. The study was conducted in the form of a randomized complete block experimental design with five treatments and three replications in Eghlid region. The treatments were included, conventional tillage and seed broadcasting (A, conventional tillage and planting with Machine Barzegar grain drill (B, reduced tillage and seeding with Roto-seeder (C, direct seeding with Jairan Sanaat grain drill (D, and direct seeding with Sfoggia direct drill (E. Experimental plots with 10 by 50 m dimensions were used in this study. Loss crop residues were taken out of the experimental plots and standing crop residues were retained in the plots. In the conventional tillage method, primary tillage was performed

  7. A method to determine the number of nanoparticles in a cluster using conventional optical microscopes

    International Nuclear Information System (INIS)

    Kang, Hyeonggon; Attota, Ravikiran; Tondare, Vipin; Vladár, András E.; Kavuri, Premsagar

    2015-01-01

    We present a method that uses conventional optical microscopes to determine the number of nanoparticles in a cluster, which is typically not possible using traditional image-based optical methods due to the diffraction limit. The method, called through-focus scanning optical microscopy (TSOM), uses a series of optical images taken at varying focus levels to achieve this. The optical images cannot directly resolve the individual nanoparticles, but contain information related to the number of particles. The TSOM method makes use of this information to determine the number of nanoparticles in a cluster. Initial good agreement between the simulations and the measurements is also presented. The TSOM method can be applied to fluorescent and non-fluorescent as well as metallic and non-metallic nano-scale materials, including soft materials, making it attractive for tag-less, high-speed, optical analysis of nanoparticles down to 45 nm diameter

  8. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  9. Ergonomic evaluation of conventional and improved methods of aonla pricking with women workers.

    Science.gov (United States)

    Rai, Arpana; Gandhi, Sudesh; Sharma, D K

    2012-01-01

    Conventional and improved methods of aonla pricking were evaluated ergonomically on an experiment conducted for 20 minute with women workers. The working heart rate, energy expenditure rate, total cardiac cost of work and physiological cost of work with conventional tools varied from 93-102 beats.min-1, 6-7.5 kJ.min-1, 285-470 beats, 14 -23 beats.min-1 while with machine varied from 96-105 beats.min-1, 6.5-8 kJ.min-1 , 336-540 beats, 16-27 beats.min-1 respectively. OWAS score for conventional method was 2 indicating corrective measures in near future while with machine was 1 indicating no corrective measures. Result of Nordic Musculoskeletal Questionnaire revealed that subjects complaint of pain in back, neck, right shoulder and right hand due to unnatural body posture and repetitive movement with hand tool. Moreover pricking was carried out in improper lighting conditions (200-300 lux) resulting into finger injuries from sharp edges of hand tool, whereas with machine no such problems were observed. Output with machine increased thrice than hand pricking in a given time. Machine was found useful in terms of saving time, increased productivity, enhanced safety and comfort as involved improved posture, was easy to handle and operate, thus increasing efficiency of the worker leading to better quality of life.

  10. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  12. Economic feasibility of biochemical processes for the upgrading of crudes and the removal of sulfur, nitrogen, and trace metals from crude oil -- Benchmark cost establishment of biochemical processes on the basis of conventional downstream technologies. Final report FY95

    Energy Technology Data Exchange (ETDEWEB)

    Premuzic, E.T.

    1996-08-01

    During the past several years, a considerable amount of work has been carried out showing that microbially enhanced oil recovery (MEOR) is promising and the resulting biotechnology may be deliverable. At Brookhaven National Laboratory (BNL), systematic studies have been conducted which dealt with the effects of thermophilic and thermoadapted bacteria on the chemical and physical properties of selected types of crude oils at elevated temperatures and pressures. Current studies indicate that during the biotreatment several chemical and physical properties of crude oils are affected. The oils are (1) emulsified; (2) acidified; (3) there is a qualitative and quantitative change in light and heavy fractions of the crudes; (4) there are chemical changes in fractions containing sulfur compounds; (5) there is an apparent reduction in the concentration of trace metals; and (6) the qualitative and quantitative changes appear to be microbial species dependent; and (7) there is a distinction between biodegraded and biotreated oils. The downstream biotechnological crude oil processing research performed thus far is of laboratory scale and has focused on demonstrating the technical feasibility of downstream processing with different types of biocatalysts under a variety of processing conditions. Quantitative economic analysis is the topic of the present project which investigates the economic feasibility of the various biochemical downstream processes which hold promise in upgrading of heavy crudes, such as those found in California, e.g., Monterey-type, Midway Sunset, Honda crudes, and others.

  13. Comparison of Tooth Color Change After Bleaching With Conventional and Different Light-Activated Methods.

    Science.gov (United States)

    Shahabi, Sima; Assadian, Hadi; Mahmoudi Nahavandi, Alireza; Nokhbatolfoghahaei, Hanieh

    2018-01-01

    Introduction: The demand for esthetic dental treatments is increasing in recent years mainly due to improved oral hygiene and better maintenance of oral health and teeth in older individuals. Bleaching of discolored anterior teeth is the most popular among esthetic dental treatments. Even individuals with sound teeth and adequate esthetics seek to have whiter teeth in the anterior region. The aim of this study was to evaluate tooth color changes following conventional in-office bleaching techniques compared to light-activated methods using different light sources. Methods: Seventy sound anterior teeth (devoided of caries and/or fracture), extracted for periodontal and orthodontic reasons were selected and allocated to 7 groups: (A) control, (B) conventional bleaching (C) LED-activated bleaching, (D) KTP laser-activated bleaching, (E) diode laser-activated bleaching, (F) Nd:YAG laser-activated bleaching and (G) CO2 laser-activated bleaching. Colorimetric evaluation was carried out before and after treatment using a spectrophotoradiometer. Data were analyzed by one- and two-way analysis of variance (ANOVA) as well as multiple comparison methods. Results: The results showed that all bleaching procedures were effective in reducing the yellowness index. However, the KTP laser-activated bleaching was significantly more effective than the other techniques in 95% confidence level. It was also seen that CO2 laser activated method has outperformed groups E, F and G and the conventional bleaching without light activation was not effective at all and represented similar results with the control group. Furthermore, the groups E and G had almost the same results in decreasing the yellowness index. Conclusion: The results showed that all bleaching techniques were effective however, the KTP laser-activated bleaching was significantly more efficient, closely followed by the CO2 laser-activated bleaching technique.

  14. Biochemical reasoning for radiation protection and screening methods for radiation sensitivity and potential carcinogenicity

    International Nuclear Information System (INIS)

    Riklis, Emanuel; Emerit, Ingrid

    1994-01-01

    Cells of different genetic characteristics respond differently to agents that modify radiation effects. When the modification is a result of chemical repair, reduction of the amount of damage by radical scavenging, production of hypoxia, or any other such mechanism, then the modification of the response will be the same for all types of cells, but not the same when biological or biochemical parameters are involved, because the differences between the cells affect the final outcome, and the genetic traits obviously become affected by chemical modifying agents. Some of these agents directly affect the repair of deoxyribonucleic acid (DNA) by mechanisms not yet understood. Another agent nicotinamide (NA), is directly linked to a repair pathway. Thus, a system that uses NA as a precursor of nicotinamide adenine dinucleotide (NAD) + , and uses NAD + to produce the polymer polyadenosine diphosphate ribose (PADPR) appears to be an interesting and important factor in the biochemical events that may be linked to improved radioprotection. (author). 36 refs., 5 figs

  15. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  16. Reinforcing the role of the conventional C-arm--a novel method for simplified distal interlocking.

    Science.gov (United States)

    Windolf, Markus; Schroeder, Josh; Fliri, Ladina; Dicht, Benno; Liebergall, Meir; Richards, R Geoff

    2012-01-25

    shot to screw tightened) was on average 22% reduced by guided freehand (p = 0.018). In an experimental setting, the newly developed guided freehand technique for distal interlocking has proven to markedly reduce radiation exposure when compared to the conventional freehand technique. The method utilizes established clinical workflows and does not require cost intensive add-on devices or extensive training. The underlying principle carries potential to assist implant positioning in numerous other applications within orthopedics and trauma from screw insertions to placement of plates, nails or prostheses.

  17. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  18. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  19. A comparison of methods for demonstrating artificial bone lesions; conventional versus computer tomography

    International Nuclear Information System (INIS)

    Heller, M.; Wenk, M.; Jend, H.H.

    1984-01-01

    Conventional tomography (T) and computer tomography (CT) were used for examining 97 artificial bone lesions at various sites. The purpose of the study was to determine how far CT can replace T in the diagnosis of skeletal abnormalities. The results have shown that modern CT, particularly in its high resolution form, equals T and provides additional information (substrate of a lesion, its relationship to neighbouring tissues, simultaneous demonstration of soft tissue etc.). These cannot be shown successfully by T. It follows that CT is indicated as the primary method of examination for lesions of the facial skeleton, skull base, spine, pelvis and, to some extent, extremities. (orig.) [de

  20. Radiation exposure in X-ray angiography and comparisons between digital and conventional methods of imaging

    International Nuclear Information System (INIS)

    Schaberg, J.

    1987-01-01

    The more recent developments and techniques in the field of angiography are examined for associated radiation exposure risks for patients and investigators and then compared to the conventional methods of angiography. It could be shown that digital subtraction angiography is generally associated with a lesser risk of somatic exposure of the patient, provided that the equipment used offers an adjustable useful-beam range and focus. The fact that above-table X-ray tubes are now generally replaced with X-ray systems installed under the examination table permits the relatively high doses, to which investigators are exposed during angiography, to be reduced by a factor of 3. (DG) [de

  1. Review of conventional and novel food processing methods on food allergens.

    Science.gov (United States)

    Vanga, Sai Kranthi; Singh, Ashutosh; Raghavan, Vijaya

    2017-07-03

    With the turn of this century, novel food processing techniques have become commercially very important because of their profound advantages over the traditional methods. These novel processing methods tend to preserve the characteristic properties of food including their organoleptic and nutritional qualities better when compared with the conventional food processing methods. During the same period of time, there is a clear rise in the populations suffering from food allergies, especially infants and children. Though, this fact is widely attributed to the changing livelihood of population in both developed and developing nations and to the introduction of new food habits with advent of novel foods and new processing techniques, their complete role is still uncertain. Under the circumstance, it is very important to understand the structural changes in the protein as food is processed to comprehend whether the specific processing technique (conventional and novel) is increasing or mitigating the allergenicity. Various modern means are now being employed to understand the conformational changes in the protein which can affect the allergenicity. In this review, the processing effects on protein structure and allergenicity are discussed along with the insinuations of recent studies and techniques for establishing a platform to investigate future pathway to reduce or eliminate allergenicity in the population.

  2. Exposure to radiation through the residual activity of waste treated by conventional methods

    International Nuclear Information System (INIS)

    Deckert, A.; Hoppe, G.; John, T.; Thierfeldt, S.

    1993-01-01

    Data obtained by questionnaires provided information on the type, amount, nuclide vector and maximum permissible value of low-level radioactive residues that occur in nuclear installations of due to industrial, scientific and medical uses of radioactive materials and are officially released to be disposed of by conventional methods. The general legal background of waste disposal methods, in particular the official regulations surrounding the waste disposal law, were described. On this basis, parameters and maximum radioactive burdens were specifically defined for garbage dumps for refuse from private households and those for building rubbish. Investigations were carried out into exposure paths that may have a role in the radioactive doses taken up by personnel (inhalation) or the general population (ingestion) through contaminated water. The radiation dose attributable to those exposure paths were expressed in relation to a specific unit activity of waste (1 bq/G). A dose of 10 μ Sv/r was taken as a standard to define a threshold value for each individual nuclide released for conventional waste disposal. It appears reasonable that such values are determined for groups of nuclides. (HP) [de

  3. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  4. Intestinal preparation for colon enema with fosfo-soda fleet versus the conventional method

    International Nuclear Information System (INIS)

    Vecchioli Caldazza, A.; Celi, G.; De Franco, A.; Parrella, A.; Minordi, L.M.; Marano, P.

    1999-01-01

    The authors evaluate the possible optimization of a well-tolerated and versatile method of intestinal preparation able to adequately free the lumen and consequently improve diagnostic results with a lower risk of prolonged hospital stay for incorrectly prepared patients. They examined 40 patients, namely 20 men and 20 women referred to the Institute of radiology of the 'Sacro Cuore' Catholic University of Rome (Italy), Gastrointestinal tract unit, to undergo double contrast colonic enema. The statistical analysis of all data was performed with Wilcoxon test. Intestinal preparation with fosfo-soda fleet appeared to be definitely better than the conventional method relative to tolerance, while providing similarly satisfactory data relative to the other parameters [it

  5. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  6. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  7. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  8. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  9. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  10. Insights into the mechanisms underlying mercury-induced oxidative stress in gills of wild fish (Liza aurata) combining "1H NMR metabolomics and conventional biochemical assays

    International Nuclear Information System (INIS)

    Cappello, Tiziana; Brandão, Fátima; Guilherme, Sofia; Santos, Maria Ana; Maisano, Maria; Mauceri, Angela; Canário, João; Pacheco, Mário; Pereira, Patrícia

    2016-01-01

    Oxidative stress has been described as a key pathway to initiate mercury (Hg) toxicity in fish. However, the mechanisms underlying Hg-induced oxidative stress in fish still need to be clarified. To this aim, environmental metabolomics in combination with a battery of conventional oxidative stress biomarkers were applied to the gills of golden grey mullet (Liza aurata) collected from Largo do Laranjo (LAR), a confined Hg contaminated area, and São Jacinto (SJ), selected as reference site (Aveiro Lagoon, Portugal). Higher accumulation of inorganic Hg and methylmercury was found in gills of fish from LAR relative to SJ. Nuclear magnetic resonance (NMR)-based metabolomics revealed changes in metabolites related to antioxidant protection, namely depletion of reduced glutathione (GSH) and its constituent amino acids, glutamate and glycine. The interference of Hg with the antioxidant protection of gills was corroborated through oxidative stress endpoints, namely the depletion of glutathione peroxidase and superoxide dismutase activities at LAR. The increase of total glutathione content (reduced glutathione + oxidized glutathione) at LAR, in parallel with GSH depletion aforementioned, indicates the occurrence of massive GSH oxidation under Hg stress, and an inability to carry out its regeneration (glutathione reductase activity was unaltered) or de novo synthesis. Nevertheless, the results suggest the occurrence of alternative mechanisms for preventing lipid peroxidative damage, which may be associated with the enhancement of membrane stabilization/repair processes resulting from depletion in the precursors of phosphatidylcholine (phosphocholine and glycerophosphocholine), as highlighted by NMR spectroscopy. However, the observed decrease in taurine may be attributable to alterations in the structure of cell membranes or interference in osmoregulatory processes. Overall, the novel concurrent use of metabolomics and conventional oxidative stress endpoints demonstrated to

  11. Insights into the mechanisms underlying mercury-induced oxidative stress in gills of wild fish (Liza aurata) combining {sup 1}H NMR metabolomics and conventional biochemical assays

    Energy Technology Data Exchange (ETDEWEB)

    Cappello, Tiziana, E-mail: tcappello@unime.it [Department of Biological and Environmental Sciences, University of Messina, 98166 Messina (Italy); Brandão, Fátima, E-mail: fatimabrandao@ua.pt [Department of Biology and CESAM, University of Aveiro, 3810-193 Aveiro (Portugal); Guilherme, Sofia; Santos, Maria Ana [Department of Biology and CESAM, University of Aveiro, 3810-193 Aveiro (Portugal); Maisano, Maria; Mauceri, Angela [Department of Biological and Environmental Sciences, University of Messina, 98166 Messina (Italy); Canário, João [Centro de Química Estrutural, Instítuto Superíor Técnico, Universidade de Lisboa, 1049-001 Lisbon (Portugal); Pacheco, Mário; Pereira, Patrícia [Department of Biology and CESAM, University of Aveiro, 3810-193 Aveiro (Portugal)

    2016-04-01

    Oxidative stress has been described as a key pathway to initiate mercury (Hg) toxicity in fish. However, the mechanisms underlying Hg-induced oxidative stress in fish still need to be clarified. To this aim, environmental metabolomics in combination with a battery of conventional oxidative stress biomarkers were applied to the gills of golden grey mullet (Liza aurata) collected from Largo do Laranjo (LAR), a confined Hg contaminated area, and São Jacinto (SJ), selected as reference site (Aveiro Lagoon, Portugal). Higher accumulation of inorganic Hg and methylmercury was found in gills of fish from LAR relative to SJ. Nuclear magnetic resonance (NMR)-based metabolomics revealed changes in metabolites related to antioxidant protection, namely depletion of reduced glutathione (GSH) and its constituent amino acids, glutamate and glycine. The interference of Hg with the antioxidant protection of gills was corroborated through oxidative stress endpoints, namely the depletion of glutathione peroxidase and superoxide dismutase activities at LAR. The increase of total glutathione content (reduced glutathione + oxidized glutathione) at LAR, in parallel with GSH depletion aforementioned, indicates the occurrence of massive GSH oxidation under Hg stress, and an inability to carry out its regeneration (glutathione reductase activity was unaltered) or de novo synthesis. Nevertheless, the results suggest the occurrence of alternative mechanisms for preventing lipid peroxidative damage, which may be associated with the enhancement of membrane stabilization/repair processes resulting from depletion in the precursors of phosphatidylcholine (phosphocholine and glycerophosphocholine), as highlighted by NMR spectroscopy. However, the observed decrease in taurine may be attributable to alterations in the structure of cell membranes or interference in osmoregulatory processes. Overall, the novel concurrent use of metabolomics and conventional oxidative stress endpoints demonstrated to

  12. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for

  13. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  14. SU-8 Cantilevers for Bio/chemical Sensing; Fabrication, Characterisation and Development of Novel Read-out Methods

    OpenAIRE

    Anja Boisen; Mogens Havsteen-Jakobsen; Gabriela Blagoi; Daniel Haefliger; Søren Dohn; Alicia Johansson; Michael Lillemose; Stephan Keller; Maria Nordström

    2008-01-01

    Here, we present the activities within our research group over the last five years with cantilevers fabricated in the polymer SU-8. We believe that SU-8 is an interesting polymer for fabrication of cantilevers for bio/chemical sensing due to its simple processing and low Young's modulus. We show examples of different integrated read-out methods and their characterisation. We also show that SU-8 cantilevers have a reduced sensitivity to changes in the environmental temperature and pH of the bu...

  15. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  16. Evaluation of osteoporosis using conventional radiographic methods and dual energy x-ray absorptiometry

    International Nuclear Information System (INIS)

    Anburajan, M.

    2001-01-01

    In India, conventional radiographs play a major part in evaluating osteoporosis since advanced bone densitometers are expensive and not widely available. Our aim in this study was to investigate the usefulness of conventional radiographic methods, viz., clavicle and metacarpal radiogrammetry, quantitative vertebral morphometry, Singh's index, hip geometry compared to a sophisticated method, viz., DXA for studying osteoporosis in south Indian men (n=663) and women (n=741). This study provides data on BMD of the proximal femur in normal south Indian females. In women, aged above 65 years, BMD of femoral neck, trochanter, and Ward's triangle decreased by 0.90%, 0.84%, and 1.66% per annum, respectively. In 45 pre- and post-menopausal women without fractures, total hip BMD correlated significantly ( p 2 =0.47), medial cortical thickness of the femoral shaft (r 2 =0.38) and neck (r 2 =0.29), combined cortical thickness (CCT) and %CCT of the clavicle (r 2 =0.54 each), and the second metacarpal (r 2 =0.51 and r 2 =0.53, respectively). On comparing variables studied for osteoporotic women with corresponding values in the premenopausal group, the average difference in SD from the mean was greatest for clavicle radiogrammetry (-3.7 SD for %CCT of the clavicle). An empirical formula for predicting total hip BMD with good sensitivity was derived from a multiple linear regression equation involving three independent variables, viz., CCT, %CCT of the clavicle (measured from the chest radiograph) and the patient's age. This author's equation, with modified weightings, has 82% sensitivity and 94% specificity and a positive and negative predictive value of 88% and 91% respectively. A chest radiograph in combination with the formula would serve as a readily available, inexpensive tool for assessing post-menopausal osteoporosis, especially in developing countries

  17. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  18. Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

    International Nuclear Information System (INIS)

    Cota, P.L.

    1987-01-01

    The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

  19. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  20. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  1. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  2. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  3. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  4. Large-area gold nanohole arrays fabricated by one-step method for surface plasmon resonance biochemical sensing.

    Science.gov (United States)

    Qi, Huijie; Niu, Lihong; Zhang, Jie; Chen, Jian; Wang, Shujie; Yang, Jingjing; Guo, Siyi; Lawson, Tom; Shi, Bingyang; Song, Chunpeng

    2018-04-01

    Surface plasmon resonance (SPR) nanosensors based on metallic nanohole arrays have been widely reported to detect binding interactions in biological specimens. A simple and effective method for constructing nanoscale arrays is essential for the development of SPR nanosensors. In this work, we report a one-step method to fabricate nanohole arrays by thermal nanoimprinting in the matrix of IPS (Intermediate Polymer Stamp). No additional etching process or supporting substrate is required. The preparation process is simple, time-saving and compatible for roll-to-roll process, potentially allowing mass production. Moreover, the nanohole arrays were integrated into detection platform as SPR sensors to investigate different types of biological binding interactions. The results demonstrate that our one-step method can be used to efficiently fabricate large-area and uniform nanohole arrays for biochemical sensing.

  5. Some physiological and biochemical methods for acute and chronic stress evaluation in dairy cows

    Directory of Open Access Journals (Sweden)

    Giuseppe Bertoni

    2010-01-01

    Full Text Available Stress factors are so numerous and so diverse in their strength and duration that the consequences on animal welfare can be quite varied. The first important distinction concerns the characterization of acute and chronic stress conditions. Acute stress is a short-lived negative situation that allows a quick and quite complete recovery of the physiological balance (adaptation, while chronic stress is a long lasting condition from which the subject cannot fully recover (maladaptation. In the latter case, the direct effects of the stress factors (heat, low energy, anxiety, suffering etc., as well as the indirect ones (changes occurring at endocrinological, immune system or function level can be responsible for pre-pathological or pathological consequences which reduce animal welfare. To evaluate the possible chronic stress conditions in single animals or on a farm (in particular a farm of dairy cows, some parameters of the direct or indirect effects can be utilised. They are physiological (mainly hormone changes: cortisol, β-endorphin, behavioural (depression, biochemical (metabolites, acute phase proteins, glycated proteins etc., as well as performance parameters (growing rate, milk yield, fertility, etc.. Special attention has been paid to the interpretation of cortisol levels and to its changes after an ACTH challenge. Despite fervent efforts, well established and accepted indices of chronic stress (distress are currently lacking; but without this objective evaluation, the assessment of animal welfare and, therefore, the optimization of the livestock production, could prove more difficult.

  6. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  7. Artificial neural networks versus conventional methods for boiling water reactor stability monitoring

    International Nuclear Information System (INIS)

    Hagen, T.H.J.J. van der

    1995-01-01

    The application of an artificial neural network (ANN) for boiling water reactor (BWR) stability monitoring was studied. A three-layer perceptron was trained on synthetic autocorrelation functions to estimate the decay ratio and the resonance frequency from measured neutron noise. Training of the ANN was improved by adding noise to the training patterns and by applying nonconventional error definitions in the generalized delta rule. The performance of the developed ANN was compared with those of conventional stability monitoring techniques. Explicit care was taken for generating unbiased test data. It is found that the trained ANN is capable of monitoring the stability of the Dodewaard BWR for four specific cases. By comparing properties such as the false alarm ratio, the alarm failure ratio, and the average time to alarm, it is shown that it performs worse than model-based methods in stability monitoring of exact second-order systems but that it is more robust (better resistant to corruptions of the input data and to deviations of the system at issue from an exact second-order system) than other methods. The latter explains its good performance on the Dodewaard BWR and is promising for the application of an ANN for stability monitoring of other reactors and for other operating conditions

  8. Treatment of waste water by a combined technique of radiation and conventional method

    International Nuclear Information System (INIS)

    Sakumoto, A.; Miyata, T.

    1984-01-01

    Treatment of waste water by radiation in combination with a conventional method such as biological oxidation, coagulation with Fe 2 (SO 4 ) 3 , and ozonation has been studied for reducing necessary dose. Ethylene glycol ethers, polyoxyethylene n-nonyl phenyl ether (NPE), polyvinyl alcohol (PVA), ethylene glycol, phenol, and oxalic acid were used as a model pollutant. The combined use of radiation and biological oxidation markedly improved the removal of TOC in aqueous oxygenated solution of ethylene glycol ethers. The combined use of radiation and coagulation had remarkable effects on the reduction of TOC in aqueous deoxygenated solution of NPE or PVA. The simultaneous use of radiation and ozone gave a synergistic effect on oxidative degradation of organic pollutants. The synergistic effect was suggested to arise from chain reactions having a powerful oxidizing agent (OH radical). The rate of TOC removal by the process depended on dose rate. Aqueous solution of 150 mg/l oxalic acid was treated by the combined use of electron beams and ozone using a new type of irradiation vessel to reduce TOC with G(-TOC) of 87 at 2.3 x 10 7 rad/h. The simultaneous use of radiation and ozone is superior to the removal of TOC by other combined methods and can be applied irrespective of the type of organic matter. (author)

  9. Comparison of Vitek Matrix-assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry Versus Conventional Methods in Candida Identification.

    Science.gov (United States)

    Keçeli, Sema Aşkın; Dündar, Devrim; Tamer, Gülden Sönmez

    2016-02-01

    Candida species are generally identified by conventional methods such as germ tube or morphological appearance on corn meal agar, biochemical methods using API kits and molecular biological methods. Alternative to these methods, rapid and accurate identification methods of microorganisms called matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDİ-TOF MS) has recently been described. In this study, Candida identification results by API Candida kit, API 20C AUX kit and identifications on corn meal agar (CMA) are compared with the results obtained on Vitek-MS. All results were confirmed by sequencing internal transcribed spacer (ITS) regions of rDNA. Totally, 97 Candida strains were identified by germ tube test, CMA, API and Vitek-MS. Vitek-MS results were compatible with 74.2 % of API 20C AUX and 81.4 % of CMA results. The difference between the results of API Candida and API 20C AUX was detected. The ratio of discrepancy between Vitek-MS and API 20C AUX was 25.8 %. Candida species mostly identified as C. famata or C. tropicalis by and not compatible with API kits were identified as C. albicans by Vitek-MS. Sixteen Candida species having discrepant results with Vitek-MS, API or CMA were randomly chosen, and ITS sequence analysis was performed. The results of sequencing were compatible 56.2 % with API 20C AUX, 50 % with CMA and 93.7 % with Vitek-MS. When compared with conventional identification methods, MS results are more reliable and rapid for Candida identification. MS system may be used as routine identification method in clinical microbiology laboratories.

  10. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  11. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  12. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  13. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  14. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Ghoos, Y [UZ Gasthuisberg, Gastrointestinal Pathophysiology, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile); Lawson, F [Clinique Padre Pio, Cotonou (Benin); Muzeke, A [Faculte de Medicine, University of Kinshasa, Kinshasa (Congo); Ndjaye, M F [Cercle Senegalais Gastroenterologie, Dakar (Senegal)

    2000-07-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, {sup 13}CO{sub 2} and H{sub 2} breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  15. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  16. Approximation and inference methods for stochastic biochemical kinetics—a tutorial review

    International Nuclear Information System (INIS)

    Schnoerr, David; Grima, Ramon; Sanguinetti, Guido

    2017-01-01

    Stochastic fluctuations of molecule numbers are ubiquitous in biological systems. Important examples include gene expression and enzymatic processes in living cells. Such systems are typically modelled as chemical reaction networks whose dynamics are governed by the chemical master equation. Despite its simple structure, no analytic solutions to the chemical master equation are known for most systems. Moreover, stochastic simulations are computationally expensive, making systematic analysis and statistical inference a challenging task. Consequently, significant effort has been spent in recent decades on the development of efficient approximation and inference methods. This article gives an introduction to basic modelling concepts as well as an overview of state of the art methods. First, we motivate and introduce deterministic and stochastic methods for modelling chemical networks, and give an overview of simulation and exact solution methods. Next, we discuss several approximation methods, including the chemical Langevin equation, the system size expansion, moment closure approximations, time-scale separation approximations and hybrid methods. We discuss their various properties and review recent advances and remaining challenges for these methods. We present a comparison of several of these methods by means of a numerical case study and highlight some of their respective advantages and disadvantages. Finally, we discuss the problem of inference from experimental data in the Bayesian framework and review recent methods developed the literature. In summary, this review gives a self-contained introduction to modelling, approximations and inference methods for stochastic chemical kinetics. (topical review)

  17. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  18. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  19. Evaluation of Shifted Excitation Raman Difference Spectroscopy and Comparison to Computational Background Correction Methods Applied to Biochemical Raman Spectra.

    Science.gov (United States)

    Cordero, Eliana; Korinth, Florian; Stiebing, Clara; Krafft, Christoph; Schie, Iwan W; Popp, Jürgen

    2017-07-27

    Raman spectroscopy provides label-free biochemical information from tissue samples without complicated sample preparation. The clinical capability of Raman spectroscopy has been demonstrated in a wide range of in vitro and in vivo applications. However, a challenge for in vivo applications is the simultaneous excitation of auto-fluorescence in the majority of tissues of interest, such as liver, bladder, brain, and others. Raman bands are then superimposed on a fluorescence background, which can be several orders of magnitude larger than the Raman signal. To eliminate the disturbing fluorescence background, several approaches are available. Among instrumentational methods shifted excitation Raman difference spectroscopy (SERDS) has been widely applied and studied. Similarly, computational techniques, for instance extended multiplicative scatter correction (EMSC), have also been employed to remove undesired background contributions. Here, we present a theoretical and experimental evaluation and comparison of fluorescence background removal approaches for Raman spectra based on SERDS and EMSC.

  20. Atherosclerosis in Watanabe heritable hyperlipidaemic rabbits. Evaluation by macroscopic, microscopic and biochemical methods and comparison of atherosclerosis variables

    DEFF Research Database (Denmark)

    Hansen, B F; Mortensen, A; Hansen, J F

    1994-01-01

    estimation of aortic atherosclerosis extent and by biochemical analysis of aortic cholesterol content. No noteworthy atherosclerosis was demonstrated within 19 months in heterozygous rabbits. In homozygous rabbits, atherosclerotic lesions were seen from the age of 4 months and progressed with age. All 19......-month-old rabbits had severe atherosclerotic disease. As much as 64% of the variation in atherosclerosis extent/severity could be explained by serum cholesterol and age. A highly significant correlation between the various methods for quantitation of atherosclerosis extent and/or severity...... was demonstrated, suggesting that quantitative microscopy, macroscopic morphometry and determination of aortic cholesterol content may be equally valid as a measure of atherosclerosis in WHHL rabbits and are therefore interchangeable....

  1. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  2. A method for integrating and ranking the evidence for biochemical pathways by mining reactions from text

    Science.gov (United States)

    Miwa, Makoto; Ohta, Tomoko; Rak, Rafal; Rowley, Andrew; Kell, Douglas B.; Pyysalo, Sampo; Ananiadou, Sophia

    2013-01-01

    Motivation: To create, verify and maintain pathway models, curators must discover and assess knowledge distributed over the vast body of biological literature. Methods supporting these tasks must understand both the pathway model representations and the natural language in the literature. These methods should identify and order documents by relevance to any given pathway reaction. No existing system has addressed all aspects of this challenge. Method: We present novel methods for associating pathway model reactions with relevant publications. Our approach extracts the reactions directly from the models and then turns them into queries for three text mining-based MEDLINE literature search systems. These queries are executed, and the resulting documents are combined and ranked according to their relevance to the reactions of interest. We manually annotate document-reaction pairs with the relevance of the document to the reaction and use this annotation to study several ranking methods, using various heuristic and machine-learning approaches. Results: Our evaluation shows that the annotated document-reaction pairs can be used to create a rule-based document ranking system, and that machine learning can be used to rank documents by their relevance to pathway reactions. We find that a Support Vector Machine-based system outperforms several baselines and matches the performance of the rule-based system. The success of the query extraction and ranking methods are used to update our existing pathway search system, PathText. Availability: An online demonstration of PathText 2 and the annotated corpus are available for research purposes at http://www.nactem.ac.uk/pathtext2/. Contact: makoto.miwa@manchester.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23813008

  3. The contribution of photosynthetic pigments to the development of biochemical separation methods: 1900-1980.

    Science.gov (United States)

    Albertsson, Per-Ake

    2003-01-01

    The role of photosynthetic pigments in the development of separation methods in biochemistry during the period 1900-1980 is described beginning with M. Tswett who introduced separation of chlorophylls and carotenoids on columns and coined the term chromatography in 1906. In Uppsala, T. Svedberg developed the ultracentrifuge in the 1920s. A. Tiselius improved electrophoresis in the 1930s and developed chromatography of proteins in the 1940s and 1950s. Others of 'The Uppsala school in separation science' include J. Porath, P. Flodin and S. Hjertén who further developed various gel chromatographic methods. Hjertén introduced free zone electrophoresis in narrow tubes, a forerunner of capillary electrophoresis. Two proteins, phycoerythrin and phycocyanin, were used as test substances in all these methodological studies. Aqueous two-phase partitioning as a separation method was introduced in 1956 by the author. In this work, chloroplast particles were used, and the method was applied for the separation and purification of intact chloroplasts, inside-out thylakoid vesicles and plasma membranes. My research was carried out in cooperation with G. Blomquist, G. Johansson, C. Larsson, B. Andersson and H.-E. Akerlund during a 20-year period, 1960-1980.

  4. A non-invasive diffuse reflectance calibration-free method for absolute determination of exogenous biochemicals concentration in biological tissues

    Science.gov (United States)

    Lappa, Alexander V.; Kulikovskiy, Artem N.; Busarov, Oleg G.

    2014-03-01

    The paper presents a new method for distant non-destructive determination of concentration of light absorbing admixtures in turbid media. In particular, it is intended for non-invasive in vivo control of accumulation in patient tissues of various biochemicals introduced to the patients for chemotherapy, photodynamic therapy or diagnostics. It is require that the admixture absorption spectrum should have a clearly marked peak in the wavelength region where the pure medium one varies regularly. Fluorescence of admixtures is not required. The method uses the local diffuse reflectance spectroscopy with optical fiber probe including one emitting and two reading There are several features in the method: the value to be determined is absolute concentration of admixtures; the method needs no calibration measurements on phantoms; it needs no reference measurements on sample with zero admixture concentration; it uses a two parametric kinetic light propagation model and original algorithms to resolve direct and inverse tasks of radiation transport theory. Experimental testing passed with tissue equivalent phantoms and different admixtures, including a chlorine photosensitizer, showed accuracy under 10% in all cases.

  5. Comparison of mid-infrared transmission spectroscopy with biochemical methods for the determination of macronutrients in human milk.

    Science.gov (United States)

    Silvestre, Dolores; Fraga, Miriam; Gormaz, María; Torres, Ester; Vento, Máximo

    2014-07-01

    The variability of human milk (HM) composition renders analysis of its components essential for optimal nutrition of preterm fed either with donor's or own mother's milk. To fulfil this requirement, various analytical instruments have been subjected to scientific and clinical evaluation. The objective of this study was to evaluate the suitability of a rapid method for the analysis of macronutrients in HM as compared with the analytical methods applied by cow's milk industry. Mature milk from 39 donors was analysed using an infrared human milk analyser (HMA) and compared with biochemical reference laboratory methods. The statistical analysis was based on the use of paired data tests. The use of an infrared HMA for the analysis of lipids, proteins and lactose in HM proved satisfactory as regards the rapidity, simplicity and the required sample volume. The instrument afforded good linearity and precision in application to all three nutrients. However, accuracy was not acceptable when compared with the reference methods, with overestimation of the lipid content and underestimation of the amount of proteins and lactose contents. The use of mid-infrared HMA might become the standard for rapid analysis of HM once standardisation and rigorous and systematic calibration is provided. © 2012 John Wiley & Sons Ltd.

  6. Biochemical nature of familial amyloiditic polyneuropathy and a new diagnostic method by radioimmunoassay

    International Nuclear Information System (INIS)

    Nakazato, M.; Kanagawa, K.; Kurihara, T.

    1986-01-01

    Familial amyloidotic polyneuropathy (FAP) in Japan is clinically similar to that of Portugal. We have reported that amyloid fibril protein isolated from Japanese FAP cases is composed of a prealbumin variant in which a valine residue at position 30 is replaced by a methionine (Tawara et al., 1983). Furthermore, we have clarified that this prealbumin variant is present in the sera of Japanese FAP patients. There has been no definite method to detect this progressive illness before clinical manifestations appear. For the purpose of developing a new, noninvasive diagnostic method, we have established a radioimmunoassay (RIA) using a nonapeptide corresponding to the subsequence (22-30) of the prealbumin variant. The serum levels of the prealbumin variant in normal individuals, FAP patients, asymptomatic members of FAP families, primary and secondary amyloidosis cases are studied. The present RIA serves as a simple and definite method for an early detection of this disease and an appropriate genetic advice can be given to FAP patients and their families

  7. Detection of Clostridium tyrobutyricum using cultivation and biochemical methods and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2007-01-01

    Full Text Available Anaerobic spore-forming bacteria of the genus Clostridium are commonly present in raw milk and some milk products. Their spores can survive pasteurization and can provoke so called late blowing defect in cheese caused by butyric acid fermentation. The only species of the genus Clostridium that is able to provoke late blowing is Clostridium tyrobutyricum.In this work, two cultivation methods for detection of butyric acid producing clostridia in raw and pasteurized milk and in cheese samples were compared. The results show that tube method is suitable for route identification (in concentration 102 CFU/ml or /g of clostridia in milk and cheese. The standard cultivation technique is suitable for more sensitive identification (10 CFU/ml or /g. All presumptive colonies grown anaerobically on selective RCM agar with polymyxine B (500 μg/ml were classified to be of species Clostridium tyrobutyricum using PCR only. The confirmation using API tests were different in 50 % cases. The results show, that described PCR method is suitable for rapid screening of the presence of Clostridium tyrobutyricum in milk and cheese. PCR from one colony is possible to use for the analysis.

  8. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  9. Effect of Chemistry Triangle Oriented Learning Media on Cooperative, Individual and Conventional Method on Chemistry Learning Result

    Science.gov (United States)

    Latisma D, L.; Kurniawan, W.; Seprima, S.; Nirbayani, E. S.; Ellizar, E.; Hardeli, H.

    2018-04-01

    The purpose of this study was to see which method are well used with the Chemistry Triangle-oriented learning media. This quasi experimental research involves first grade of senior high school students in six schools namely each two SMA N in Solok city, in Pasaman and two SMKN in Pariaman. The sampling technique was done by Cluster Random Sampling. Data were collected by test and analyzed by one-way anova and Kruskall Wallish test. The results showed that the high school students in Solok learning taught by cooperative method is better than the results of student learning taught by conventional and Individual methods, both for students who have high initial ability and low-ability. Research in SMK showed that the overall student learning outcomes taught by conventional method is better than the student learning outcomes taught by cooperative and individual methods. Student learning outcomes that have high initial ability taught by individual method is better than student learning outcomes that are taught by cooperative method and for students who have low initial ability, there is no difference in student learning outcomes taught by cooperative, individual and conventional methods. Learning in high school in Pasaman showed no significant difference in learning outcomes of the three methods undertaken.

  10. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  11. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  12. Comparison of muscle/lean mass measurement methods: correlation with functional and biochemical testing.

    Science.gov (United States)

    Buehring, B; Siglinsky, E; Krueger, D; Evans, W; Hellerstein, M; Yamada, Y; Binkley, N

    2018-03-01

    DXA-measured lean mass is often used to assess muscle mass but has limitations. Thus, we compared DXA lean mass with two novel methods-bioelectric impedance spectroscopy and creatine (methyl-d3) dilution. The examined methodologies did not measure lean mass similarly and the correlation with muscle biomarkers/function varied. Muscle function tests predict adverse health outcomes better than lean mass measurement. This may reflect limitations of current mass measurement methods. Newer approaches, e.g., bioelectric impedance spectroscopy (BIS) and creatine (methyl-d3) dilution (D3-C), may more accurately assess muscle mass. We hypothesized that BIS and D3-C measured muscle mass would better correlate with function and bone/muscle biomarkers than DXA measured lean mass. Evaluations of muscle/lean mass, function, and serum biomarkers were obtained in older community-dwelling adults. Mass was assessed by DXA, BIS, and orally administered D3-C. Grip strength, timed up and go, and jump power were examined. Potential muscle/bone serum biomarkers were measured. Mass measurements were compared with functional and serum data using regression analyses; differences between techniques were determined by paired t tests. Mean (SD) age of the 112 (89F/23M) participants was 80.6 (6.0) years. The lean/muscle mass assessments were correlated (.57-.88) but differed (p Lean mass measures were unrelated to the serum biomarkers measured. These three methodologies do not similarly measure muscle/lean mass and should not be viewed as being equivalent. Functional tests assessing maximal muscle strength/power (grip strength and jump power) correlated with all mass measures whereas gait speed was not. None of the selected serum measures correlated with mass. Efforts to optimize muscle mass assessment and identify their relationships with health outcomes are needed.

  13. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  14. Optimization of Biochemical Screening Methods for Volatile and Unstable Sesquiterpenoids Using HS-SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Trine Bundgaard Andersen

    2015-06-01

    Full Text Available HS-SPME-GC-MS has been suggested as a fast and robust analytical platform for the product characterization of sesquiterpene synthases. The choice of fiber and injection temperature can have a significant effect on the observed product profile, due to the chemical rearrangements that can occur on the fiber material. Here we present a systematic study on the effects of fiber choice and injection port temperature on the observed sesquiterpenoid profile of four sesquiterpene synthases expressed in Nicotiana benthamiana. We found that the absorbent material PDMS was much less likely to support acid-induced rearrangement of sesquiterpenoids when compared to the adsorbent materials PDMS/DVB, PDMS/CAR, and PDMS/CAR/DVB. Furthermore, utilizing an injection port temperature at 160 °C almost eliminated the inherent thermal instability of germacrene sesquiterpenoids. Thus, for fast screening of sesquiterpene synthases, the results suggest that PDMS fibers and an injection temperature of 160 °C provide a fast and reproducible HS-SPME GC-MS method when using H2 as carrier gas.

  15. Physiological and Biochemical Responses of Rats Fed Detoxified Jojoba Meal Through Radiation Processing and Other Methods

    International Nuclear Information System (INIS)

    Farag, M.; Diaa El-Din, H.; El-Shennawy, H. M.

    2004-01-01

    The present of toxic cyano glucosides makes the jojoba meal, rich in protein, unacceptable for animal's feed. Irradiation jojoba meal at 25, 50, and 75 kGy, heat, microwave, fermented raw and fermented irradiated jojoba meal at 75 kGy were investigated for inactivation of glucosinolates. Raw jojoba meal contains 0.702%. Proceeding jojoba meal by above mentioned methods reducing the activity of glucosinolates by 8.26, 13.96, 20.66, 11.97, 5.27, 10.26 and 24.79%, respectively. The present study has investigated the effect of supplementation of 38.5% of raw jojoba meal and processed meals in the food of growing male Albino rats for four weeks on mortality rate, body and organs weight evaluation as well as the effect on blood chemistry. The present work concluded that the combination between the irradiation of jojoba meal at 75 kGy and the fermentation process by using Fusarium moniliforme reduced the bioactive antinutrional factors, glucosinolate compounds, present naturally in the meal under investigation. Also, the results confirm that the glucosinolates content of jojoba meal after irradiation process at 75 kGy is still high and has considerable biological effects on the animals fed such meals, during the experimental period (four weeks). Therefore, it seems that higher radiation dose is required to minimize glucosinolates in jojoba meal. (authors)

  16. Treatment of children with Helicobacter infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); Lawson, W [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absoptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    There is a large interest about Heliobacter pylori infection in childhood nowadays. The prevalence of infection is very high in developing countries and this is extremely correlated to the living conditions with consequences on the future health of children. Contamination mode is not well known but environment factors are involved. We used {sup 13}C Urea Breath Test to assess the prevalence rate in beninese asymptomatic children aged 7-11 years old (about 86%). We evaluated the influence of either conventional or probiotics therapy in eradicating Hp infection and some relationships with growth parameters. We concluded that conventional therapy or use of probiotics might improve infection status and probably influence growth factors in childhood. (author)

  17. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  18. Comparative study on flow rate measurement by nuclear and conventional methods in selected rivers at Ulu Langat district, Selangor

    Energy Technology Data Exchange (ETDEWEB)

    Wan Mohamad Tahir, Wan Zakaria; Mohamad, Daud; Hamzah, Abdul Razak; Yusuf, Johari Mohamad; Aziz Wan Mohamad, Wan Abdul

    1986-06-01

    A radiotracer technique using Tc-99 to measure flows of small rivers was introduced in Malaysia. Three rivers in the Ulu Langat District were selected for a comparative study on flow rate determination by conventional and radioisotope methods. Radioisotopic approach, comprising injection procedures, calibration, mixing length and safety aspects are discussed. The results measured by radioisotope method are compared to the Drainage and Irrigation Department's (DID's) discharge curves data collected from 1980 to 1982 which is calibrated using a current meter. The results are comparable and fall within the range obtained by conventional method. Related to this study, a comprehensive work on stream gauging of moderate and high flow rates using both methods is proposed to be carried out directly.

  19. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  20. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  1. Effect of amaranth dye on the growth and properties of conventional and SR method grown KAP single crystals

    Science.gov (United States)

    Babu Rao, G.; P., Rajesh; Ramasamy, P.

    2018-04-01

    The 0.1 mol% amaranth added KAP single crystals were grown from aqueous solutions by both slow evaporation solution technique and Sankaranarayanan-Ramasamy method. The single crystal having dimension of 45 mm length and 12 mm diameter was grown with growth rate of 1.5 mm/day using SR method. 87 % transmittance is obtained for SR method grown amaranth added KAP single crystal. The high intense luminescence at 661 nm is obtained from amaranth added conventional and SR method grown KAP single crystal. The amaranth added KAP single crystal possesses good mechanical and laser damage threshold stability.

  2. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  3. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  4. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  5. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  6. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  7. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  8. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  9. Reconstructing biochemical pathways from time course data.

    Science.gov (United States)

    Srividhya, Jeyaraman; Crampin, Edmund J; McSharry, Patrick E; Schnell, Santiago

    2007-03-01

    Time series data on biochemical reactions reveal transient behavior, away from chemical equilibrium, and contain information on the dynamic interactions among reacting components. However, this information can be difficult to extract using conventional analysis techniques. We present a new method to infer biochemical pathway mechanisms from time course data using a global nonlinear modeling technique to identify the elementary reaction steps which constitute the pathway. The method involves the generation of a complete dictionary of polynomial basis functions based on the law of mass action. Using these basis functions, there are two approaches to model construction, namely the general to specific and the specific to general approach. We demonstrate that our new methodology reconstructs the chemical reaction steps and connectivity of the glycolytic pathway of Lactococcus lactis from time course experimental data.

  10. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  11. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.

    1983-01-01

    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  12. Comparative Analysis of Conventional Method with Activity Based Costing in PT Mulia Sejati Gallery

    OpenAIRE

    Erena, Irma Nadia; Gani, Engelwati

    2016-01-01

    The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data ana...

  13. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  14. Experimental Evolution of Diverse Strains as a Method for the Determination of Biochemical Mechanisms of Action for Novel Pyrrolizidinone Antibiotics.

    Science.gov (United States)

    Beabout, Kathryn; McCurry, Megan D; Mehta, Heer; Shah, Akshay A; Pulukuri, Kiran Kumar; Rigol, Stephan; Wang, Yanping; Nicolaou, K C; Shamoo, Yousif

    2017-11-10

    The continuing rise of multidrug resistant pathogens has made it clear that in the absence of new antibiotics we are moving toward a "postantibiotic" world, in which even routine infections will become increasingly untreatable. There is a clear need for the development of new antibiotics with truly novel mechanisms of action to combat multidrug resistant pathogens. Experimental evolution to resistance can be a useful tactic for the characterization of the biochemical mechanism of action for antibiotics of interest. Herein, we demonstrate that the use of a diverse panel of strains with well-annotated reference genomes improves the success of using experimental evolution to characterize the mechanism of action of a novel pyrrolizidinone antibiotic analog. Importantly, we used experimental evolution under conditions that favor strongly polymorphic populations to adapt a panel of three substantially different Gram-positive species (lab strain Bacillus subtilis and clinical strains methicillin-resistant Staphylococcus aureus MRSA131 and Enterococcus faecalis S613) to produce a sufficiently diverse set of evolutionary outcomes. Comparative whole genome sequencing (WGS) between the susceptible starting strain and the resistant strains was then used to identify the genetic changes within each species in response to the pyrrolizidinone. Taken together, the adaptive response across a range of organisms allowed us to develop a readily testable hypothesis for the mechanism of action of the CJ-16 264 analog. In conjunction with mitochondrial inhibition studies, we were able to elucidate that this novel pyrrolizidinone antibiotic is an electron transport chain (ETC) inhibitor. By studying evolution to resistance in a panel of different species of bacteria, we have developed an enhanced method for the characterization of new lead compounds for the discovery of new mechanisms of action.

  15. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  16. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  17. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  18. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  20. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  1. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Ndiaye, M F; Mbengue, M; Mbaye, P S; Diouf, S [Societe Senegalaise de Gasto-enterologie et d' hepatologie, Dakar (Senegal); Ghoos, Y [Labo. Digestie Absorptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    Helicobacter pylori infection is one of the most common bacterial infection (82 %) in Senegal where malnutrition is common in children (25 %). Our aims were to definite prevalence of H. pylori, to determine the relationship between Hp infection and undernourishment and to verify the efficiency of treatment with probiotic. In some studies a positive effect of Saccharomyces boulardii has been demonstrated against H. pylori. We have included healthy children 7 to 10 years of age. 108 out of 129 (84%) were H. pylori-positive by breath-test. Two groups were randomised. Group A was treated with ten days' standard triple therapy (Omeprazole 1 mg Kg/day in single day gift, Amoxycillin 50 mg/kg/two times per day and Clarithromycin 250 mg two times per day). Group B received probiotic (250 mg of Saccharomyces boulardii with 5g Inulin three times per day) for 3 months. Evaluation of treatment was done one month after the end of therapy. Seventy one children out of 110 (64.5%) had digestive symptoms in their medical history. The main signs were recurrent abdominal pain in 64 cases. BMI were less than 18.50 in all the children with H. pylori infection without other nutritional abnormaly. Eight children were eradicated after treatment seven in the group under conventional treatment (58%) and one in the group under probiotics (6%). We concluded that prevalence of H. pylori infection is very high in young children as of the 7 years' age in urban as in rural environments. Symptoms are not specific. No significant difference in the nutritional state is observed between H. pylori-positive and H. pylori-negative children. Treatment by probiotics does not seem to give efficient results for eradication of H. pylori. (author)

  2. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  3. SU-8 cantilevers for bio/chemical sensing; Fabrication, characterisation and development of novel read-out methods

    DEFF Research Database (Denmark)

    Nordström, M.; Keller, Stephan Urs; Lillemose, Michael

    2008-01-01

    Here, we present the activities within our research group over the last five years with cantilevers fabricated in the polymer SU-8. We believe that SU-8 is an interesting polymer for fabrication of cantilevers for bio/chemical sensing due to its simple processing and low Young's modulus. We show...

  4. A non-conventional watershed partitioning method for semi-distributed hydrological modelling: the package ALADHYN

    Science.gov (United States)

    Menduni, Giovanni; Pagani, Alessandro; Rulli, Maria Cristina; Rosso, Renzo

    2002-02-01

    The extraction of the river network from a digital elevation model (DEM) plays a fundamental role in modelling spatially distributed hydrological processes. The present paper deals with a new two-step procedure based on the preliminary identification of an ideal drainage network (IDN) from contour lines through a variable mesh size, and the further extraction of the actual drainage network (AND) from the IDN using land morphology. The steepest downslope direction search is used to identify individual channels, which are further merged into a network path draining to a given node of the IDN. The contributing area, peaks and saddles are determined by means of a steepest upslope direction search. The basin area is thus partitioned into physically based finite elements enclosed by irregular polygons. Different methods, i.e. the constant and variable threshold area methods, the contour line curvature method, and a topologic method descending from the Hortonian ordering scheme, are used to extract the ADN from the IDN. The contour line curvature method is shown to provide the most appropriate method from a comparison with field surveys. Using the ADN one can model the hydrological response of any sub-basin using a semi-distributed approach. The model presented here combines storm abstraction by the SCS-CN method with surface runoff routing as a geomorphological dispersion process. This is modelled using the gamma instantaneous unit hydrograph as parameterized by river geomorphology. The results are implemented using a project-oriented software facility for the Analysis of LAnd Digital HYdrological Networks (ALADHYN).

  5. Using of a combined approach by biochemical and image analysis to develop a new method to estimate seed maturity stage for Bordeaux area grapevine

    Directory of Open Access Journals (Sweden)

    Amélie RABOT

    2017-03-01

    Full Text Available Aim: The importance of phenolic maturity (depending on tannins and anthocyans of the grape is crucial at harvest and determines the final quality of wine. The work presented here aims to characterize the evolution of phenolic maturity of seeds for 3 varieties combining macroscopic analysis and biochemical analyzes of these tannins at phenological stages of interest. Methods and results: Using R software for macroscopic analyzes have been shown that the color varies dramatically (from green to dark brown in the two months between the bunch closure and maturity. Biochemical analysis (HPLC measurement shows that tannins in seeds are increasing from bunch closure to early veraison and decrease after this step until maturity. Conclusion: All together these results have shown that the color variation is correlated to the tannins content in the seeds. Significance of the study: Nowadays, no easy ways of prediction of phenolic maturity are known. The aim of this work is to use these results (usually considered independently to have an knowledge of seed level of phenolic maturity necessary without biochemical analysis to establish a date of great harvest for the most favorable conditions for the extraction of tannins required for the organoleptic quality of a wine .The originality of this work is to use the combined visual seeds and its biochemical composition in tannins (correlation established by CPA. Forward, these results will help to develop a decision support tool based on simply system to acquiring seed image easily usable by winemakers.

  6. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  7. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  8. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

  9. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  10. A comparison of new and conventional methods for quantification of tooth color

    NARCIS (Netherlands)

    Burgt, van der T.P.; Bosch, ten J.J.; Borsboom, P.C.F.; Kortsmit, W.J.P.M.

    1990-01-01

    Tooth color is caused by volume reflection, that is, passage of incident light through the tooth followed by backward emergence. This passage is concurrent with sideward displacement of photons that, in effect, influences the result of usual instrumental methods of determining tooth color. This

  11. Near infrared spectrometry for faecal fat measurement: comparison with conventional gravimetric and titrimetric methods.

    Science.gov (United States)

    Benini, L; Caliari, S; Guidi, G C; Vaona, B; Talamini, G; Vantini, I; Scuro, L A

    1989-01-01

    This investigation was aimed at comparing a new method for measuring faecal fat excretion, carried out with a semi-automated instrument by using near infrared analysis (NIRA), with the traditional titrimetric (Van de Kamer) and gravimetric (Sobel) methods. Near infrared analysis faecal fat was assayed on the three day stool collection from 118 patients (68 chronic pancreatitis, 19 organic diseases of the gastrointestinal tract, 19 alcoholic liver disease, 12 functional gastrointestinal disorders). A strict linear correlation was found between NIRA and both the titrimetric (r = 0.928, p less than 0.0001) and the gravimetric (r = 0.971, p less than 0.0001) methods. On homogenised faeces, a mean coefficient of variation of 2.1 (SD 1.71)% was found. Before homogenisation (where a mean coefficient of variation of 7% was found) accurate results were obtained when the mean of five measurements was considered. In conclusion, the assay of faecal fat excretion by the near infrared reflessometry appears a simple, rapid and reliable method for measuring steatorrhoea. PMID:2583563

  12. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  13. Evaluation of head and neck cancer with 18F-FDG PET: a comparison with conventional methods

    International Nuclear Information System (INIS)

    Kresnik, E.; Mikosch, P.; Gallowitsch, H.J.; Heinisch, M.; Unterweger, O.; Kumnig, G.; Gomez, I.; Lind, P.; Kogler, D.; Wieser, S.; Gruenbacher, G.; Raunik, W.

    2001-01-01

    The aim of this study was to evaluate the usefulness of 18 F-FDG PET in the diagnosis and staging of primary and recurrent malignant head and neck tumours in comparison with conventional imaging methods [including ultrasonography, radiography, computed tomography (CT) and magnetic resonance imaging (MRI)], physical examination, panendoscopy and biopsies in clinical routine. A total of 54 patients (13 female, 41 male, age 61.3±12 years) were investigated retrospectively. Three groups were formed. In group I, 18 F-FDG PET was performed in 15 patients to detect unknown primary cancers. In group II, 24 studies were obtained for preoperative staging of proven head and neck cancer. In group III, 18 F-FDG PET was used in 15 patients to monitor tumour recurrence after radiotherapy and/or chemotherapy. In all patients, imaging was obtained at 70 min after the intravenous administration of 180 MBq 18 F-FDG. In 11 of the 15 patients in group I, the primary cancer could be found with 18 F-FDG, yielding a detection rate of 73.3%. In 4 of the 15 patients, CT findings were also suggestive of the primary cancer but were nonetheless equivocal. In these patients, 18 F-FDG showed increased 18 F-FDG uptake by the primary tumour, which was confirmed by histology. One patient had recurrence of breast carcinoma that could not be detected with 18 F-FDG PET, but was detected by CT. In three cases, the primary cancer could not be found with any imaging method. Among the 24 patients in group II investigated for staging purposes, 18 F-FDG PET detected a total of 13 local and three distant lymph node metastases, whereas the conventional imaging methods detected only nine local and one distant lymph node metastases. The results of 18 F-FDG PET led to an upstaging in 5/24 (20.8%) patients. The conventional imaging methods were false positive in 5/24 (20.8%). There was one false positive result using 18 F-FDG PET. Among the 15 patients of group III with suspected recurrence after radiotherapy

  14. A Review on the Role of Vibrational Spectroscopy as An Analytical Method to Measure Starch Biochemical and Biophysical Properties in Cereals and Starchy Foods

    Directory of Open Access Journals (Sweden)

    D. Cozzolino

    2014-12-01

    Full Text Available Starch is the major component of cereal grains and starchy foods, and changes in its biophysical and biochemical properties (e.g., amylose, amylopectin, pasting, gelatinization, viscosity will have a direct effect on its end use properties (e.g., bread, malt, polymers. The use of rapid and non-destructive methods to study and monitor starch properties, such as gelatinization, retrogradation, water absorption in cereals and starchy foods, is of great interest in order to improve and assess their quality. In recent years, near infrared reflectance (NIR and mid infrared (MIR spectroscopy have been explored to predict several quality parameters, such as those generated by instrumental methods commonly used in routine analysis like the rapid visco analyser (RVA or viscometers. In this review, applications of both NIR and MIR spectroscopy to measure and monitor starch biochemical (amylose, amylopectin, starch and biophysical properties (e.g., pasting properties will be presented and discussed.

  15. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  16. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  17. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  18. Comparison of conventional versus Hybrid knife peroral endoscopic myotomy methods for esophageal achalasia: a case-control study.

    Science.gov (United States)

    Tang, Xiaowei; Gong, Wei; Deng, Zhiliang; Zhou, Jieqiong; Ren, Yutang; Zhang, Qiang; Chen, Zhenyu; Jiang, Bo

    2016-01-01

    Peroral endoscopic myotomy (POEM) has been developed to treat achalasia as a novel less invasive modality. We aimed to compare the efficacy and safety of conventional knife versus Hybrid knife (HK) during POEM procedure. Between June 2012 and July 2014, 31 patients underwent POEM using HK in our department (HK group), and 36 patients underwent POEM using conventional method (injection needle and triangular tip [TT] knife, TT group). Procedure-related parameters, symptom relief, adverse events were compared between two groups. There were no significant differences in the age, sex and other baseline characteristics between the two groups. The mean procedural time was significantly shorter in HK group than TT group (53.0 ± 17.2 vs. 67.6 ± 28.4 min, p = 0.015). The mean frequency of devices exchange was 4.7 ± 1.7 in HK group and 10.9 ± 1.8 in TT group (p = 0.000). No serious adverse events occurred postoperatively in both groups. At one-year follow-up, a total of 94% treatment success was achieved in all patients (93.5% in HK group and 94.4% in TT group, p = 0.877). HK in POEM can shorten the procedural time, and achieve similar treatment success compared to conventional TT knife.

  19. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  20. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  1. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  2. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods.

    Science.gov (United States)

    Alavi, Shiva; Kachuie, Marzie

    2017-01-01

    This study was conducted to assess the hardness of orthodontic brackets produced by metal injection molding (MIM) and conventional methods and different orthodontic wires (stainless steel, nickel-titanium [Ni-Ti], and beta-titanium alloys) for better clinical results. A total of 15 specimens from each brand of orthodontic brackets and wires were examined. The brackets (Elite Opti-Mim which is produced by MIM process and Ultratrimm which is produced by conventional brazing method) and the wires (stainless steel, Ni-Ti, and beta-titanium) were embedded in epoxy resin, followed by grinding, polishing, and coating. Then, X-ray energy dispersive spectroscopy (EDS) microanalysis was applied to assess their elemental composition. The same specimen surfaces were repolished and used for Vickers microhardness assessment. Hardness was statistically analyzed with Kruskal-Wallis test, followed by Mann-Whitney test at the 0.05 level of significance. The X-ray EDS analysis revealed different ferrous or co-based alloys in each bracket. The maximum mean hardness values of the wires were achieved for stainless steel (SS) (529.85 Vickers hardness [VHN]) versus the minimum values for beta-titanium (334.65 VHN). Among the brackets, Elite Opti-Mim exhibited significantly higher VHN values (262.66 VHN) compared to Ultratrimm (206.59 VHN). VHN values of wire alloys were significantly higher than those of the brackets. MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  3. Comparison of conventional and nuclear-medical examination methods in the field of nephro-urology

    International Nuclear Information System (INIS)

    Pfannenstiel, P.

    1975-07-01

    Main part of this study is a further simplification of the 131 I-hippuran total body clearance, a method which was first described by Oberhausen (1968). As a result of the study the clearance can now be calculated with only one scintillation detector after i.v. injection of 131 I-hippuran. Essential for this simplification is the exact localisation of the detector at the right or left shoulder region of the patient. The unilateral clearance is calculated from the total body clearance in conjunction with the simultaneously registered isotope renogram. This method was routinely applied to 4,138 patients during November 15th 1971 and March 31st 1975. In special groups of patients sequential renal studies with the gamma-camera, renal rectilinear scans, xenon-133-washout curves from the kidneys and radioimmuno-assays of angiotensin were performed for comparison. All data were analysed in view of other clinical and radiological data. Recommendations for rational procedures in diagnosis and control of therapy of the most common nephro-urological disorders were derived from a joint study of 16 hospitals analysing 1,979 cases. (orig.) [de

  4. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau

    1997-01-01

    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  5. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    deviations (RSDs) of 2.3−3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate......, and falcarinol in year 1 were 222, 30, and 94 μg of falcarindiol equiv/g of dry weight, respectively, and 3−15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year−year variation was observed for falcarindiol-3-acetate....

  6. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  7. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  8. Expanded image database of pistachio x-ray images and classification by conventional methods

    Science.gov (United States)

    Keagy, Pamela M.; Schatzki, Thomas F.; Le, Lan Chau; Casasent, David P.; Weber, David

    1996-12-01

    In order to develop sorting methods for insect damaged pistachio nuts, a large data set of pistachio x-ray images (6,759 nuts) was created. Both film and linescan sensor images were acquired, nuts dissected and internal conditions coded using the U.S. Grade standards and definitions for pistachios. A subset of 1199 good and 686 insect damaged nuts was used to calculate and test discriminant functions. Statistical parameters of image histograms were evaluated for inclusion by forward stepwise discrimination. Using three variables in the discriminant function, 89% of test set nuts were correctly identified. Comparable data for 6 human subjects ranged from 67 to 92%. If the loss of good nuts is held to 1% by requiring a high probability to discard a nut as insect damaged, approximately half of the insect damage present in clean pistachio nuts may be detected and removed by x-ray inspection.

  9. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  10. A Sensitive Method for Examining Whole Cell Biochemical Composition in Single Cells of Filamentous Fungi using Synchrotron FTIR Spectromicroscopy

    International Nuclear Information System (INIS)

    Konstantin, J.; Gough, K.; Julian, R.; Kaminskyj, S.

    2008-01-01

    Cell function is related to cell composition. The asexual state of filamentous fungi (molds and mildews) has two main life cycle stages: vegetative hyphae for substrate colonization and nutrient acquisition, and asexual spores for survival and dispersal. Hyphal composition changes over a few tens of microns during growth and maturation; spores are different from hyphae. Most biochemical analyses are restricted to studying a few components at high spatial resolution (e.g. histochemistry) or many compounds at low spatial resolution (e.g. GC-MS). Synchrotron FTIR spectromicroscopy can be used to study fungal cell biology by fingerprinting varieties of carbohydrates, proteins, and lipids at about 6 microm spatial resolution. FTIR can distinguish fungal species and changes during hyphal growth, and reveals that even fungi grown under optimal vs mildly stressed conditions exhibit dramatic biochemical changes without obvious morphological effects. Here we compare hypha and spore composition of two fungi, Neurospora and Rhizopus. There are clear biochemical changes when Neurospora hyphae commit to spore development, during spore maturation and following germination, many of which are consistent with results from molecular genetics, but have not been shown before at high spatial resolution. Rhizopus spores develop within a fluid-containing sporangium that becomes dry at maturity. Rhizopus spores had similar protein content and significantly more carbohydrate than the sporangial fluid, both of which are novel findings.

  11. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  12. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  13. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  14. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  15. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  16. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  17. Familiarity Vs Trust: A Comparative Study of Domain Scientists' Trust in Visual Analytics and Conventional Analysis Methods.

    Science.gov (United States)

    Dasgupta, Aritra; Lee, Joon-Yong; Wilson, Ryan; Lafrance, Robert A; Cramer, Nick; Cook, Kristin; Payne, Samuel

    2017-01-01

    Combining interactive visualization with automated analytical methods like statistics and data mining facilitates data-driven discovery. These visual analytic methods are beginning to be instantiated within mixed-initiative systems, where humans and machines collaboratively influence evidence-gathering and decision-making. But an open research question is that, when domain experts analyze their data, can they completely trust the outputs and operations on the machine-side? Visualization potentially leads to a transparent analysis process, but do domain experts always trust what they see? To address these questions, we present results from the design and evaluation of a mixed-initiative, visual analytics system for biologists, focusing on analyzing the relationships between familiarity of an analysis medium and domain experts' trust. We propose a trust-augmented design of the visual analytics system, that explicitly takes into account domain-specific tasks, conventions, and preferences. For evaluating the system, we present the results of a controlled user study with 34 biologists where we compare the variation of the level of trust across conventional and visual analytic mediums and explore the influence of familiarity and task complexity on trust. We find that despite being unfamiliar with a visual analytic medium, scientists seem to have an average level of trust that is comparable with the same in conventional analysis medium. In fact, for complex sense-making tasks, we find that the visual analytic system is able to inspire greater trust than other mediums. We summarize the implications of our findings with directions for future research on trustworthiness of visual analytic systems.

  18. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Brunser, O; Cruchet, S; Gotteland, M; Verbeke, S [Gastroenterology Unit, Institute of Nutrition and Food Technology (INTA), University of Chile, Santiago (Chile)

    2000-07-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The {sup 13}C-urea breath test ({sup 13}C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the {sup 13}C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics.

  20. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  1. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  2. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  3. Characterization and stability studies of a novel liposomal cyclosporin A prepared using the supercritical fluid method: comparison with the modified conventional Bangham method

    Directory of Open Access Journals (Sweden)

    Karn PR

    2013-01-01

    Full Text Available Pankaj Ranjan Karn,1,3 Wonkyung Cho,1,3 Hee-Jun Park,1,3 Jeong-Sook Park,3 Sung-Joo Hwang1,21Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 2College of Pharmacy, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 3College of Pharmacy, Chungnam National University, Yuseong-gu, Daejeon, Republic of KoreaAbstract: A novel method to prepare cyclosporin A encapsulated liposomes was introduced using supercritical fluid of carbon dioxide (SCF-CO2 as an antisolvent. To investigate the strength of the newly developed SCF-CO2 method compared with the modified conventional Bangham method, particle size, zeta potential, and polydispersity index (PDI of both liposomal formulations were characterized and compared. In addition, entrapment efficiency (EE and drug loading (DL characteristics were analyzed by reversed-phase high-performance liquid chromatography. Significantly larger particle size and PDI were revealed from the conventional method, while EE (% and DL (% did not exhibit any significant differences. The SCF-CO2 liposomes were found to be relatively smaller, multilamellar, and spherical with a smoother surface as determined by transmission electron microscopy. SCF-CO2 liposomes showed no significant differences in their particle size and PDI after more than 3 months, whereas conventional liposomes exhibited significant changes in their particle size. The initial yield (%, EE (%, and DL (% of SCF-CO2 liposomes and conventional liposomes were 90.98 ± 2.94, 92.20 ± 1.36, 20.99 ± 0.84 and 90.72 ± 2.83, 90.24 ± 1.37, 20.47 ± 0.94, respectively, which changed after 14 weeks to 86.65 ± 0.30, 87.63 ± 0.72, 18.98 ± 0.22 and 75.04 ± 8.80, 84.59 ± 5.13, 15.94 ± 2.80, respectively. Therefore, the newly developed SCF-CO2 method could be a better alternative compared with the conventional method and may provide a promising approach for large-scale production of liposomes

  4. NON-CONVENTIONAL MACHINING PROCESSES SELECTION USING MULTI-OBJECTIVE OPTIMIZATION ON THE BASIS OF RATIO ANALYSIS METHOD

    Directory of Open Access Journals (Sweden)

    MILOŠ MADIĆ

    2015-11-01

    Full Text Available The role of non-conventional machining processes (NCMPs in today’s manufacturing environment has been well acknowledged. For effective utilization of the capabilities and advantages of different NCMPs, selection of the most appropriate NCMP for a given machining application requires consideration of different conflicting criteria. The right choice of the NCMP is critical to the success and competitiveness of the company. As the NCMP selection problem involves consideration of different conflicting criteria, of different relative importance, the multi-criteria decision making (MCDM methods are very useful in systematical selection of the most appropriate NCMP. This paper presents the application of a recent MCDM method, i.e., the multi-objective optimization on the basis of ratio analysis (MOORA method to solve NCMP selection which has been defined considering different performance criteria of four most widely used NCMPs. In order to determine the relative significance of considered quality criteria a pair-wise comparison matrix of the analytic hierarchy process was used. The results obtained using the MOORA method showed perfect correlation with those obtained by the technique for order preference by similarity to ideal solution (TOPSIS method which proves the applicability and potentiality of this MCDM method for solving complex NCMP selection problems.

  5. Molecular and Biochemical Methods Useful for the Epigenetic Characterization of Chromatin-Associated Proteins in Bivalve Molluscs

    Directory of Open Access Journals (Sweden)

    Ciro Rivera-Casas

    2017-08-01

    Full Text Available Bivalve molluscs constitute a ubiquitous taxonomic group playing key functions in virtually all ecosystems, and encompassing critical commercial relevance. Along with a sessile and filter-feeding lifestyle in most cases, these characteristics make bivalves model sentinel organisms routinely used for environmental monitoring studies in aquatic habitats. The study of epigenetic mechanisms linking environmental exposure and specific physiological responses (i.e., environmental epigenetics stands out as a very innovative monitoring strategy, given the role of epigenetic modifications in acclimatization and adaptation. Furthermore, the heritable nature of many of those modifications constitutes a very promising avenue to explore the applicability of epigenetic conditioning and selection in management and restoration strategies. Chromatin provides a framework for the study of environmental epigenetic responses. Unfortunately, chromatin and epigenetic information are very limited in most non-traditional model organisms and even completely lacking in most environmentally and ecologically relevant organisms. The present work aims to provide a comprehensive and reproducible experimental workflow for the study of bivalve chromatin. First, a series of guidelines for the molecular isolation of genes encoding chromatin-associated proteins is provided, including information on primers suitable for conventional PCR, Rapid Amplification of cDNA Ends (RACE, genome walking and quantitative PCR (qPCR experiments. This section is followed by the description of methods specifically developed for the analysis of histone and SNBP proteins in different bivalve tissues, including protein extraction, purification, separation and immunodetection. Lastly, information about available antibodies, their specificity and performance is also provided. The tools and protocols described here complement current epigenetic analyses (usually limited to DNA methylation by incorporating

  6. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  7. Methods in the use of GC/C/IRMS for the analysis of biochemical and pollutant isotope signatures of compounds

    International Nuclear Information System (INIS)

    Macko, S.A.; Engel, M.H.

    2001-01-01

    The potential for application of GC/C/IRMS analysis to any multitude of environmental, ecological or biochemical research areas is only beginning to be realized. Extension of compound-specific isotope analytical data derived from modern organisms and settings to yield interpretations of ancient depositional environments certainly appears possible. Further application of GC/C/IRMS approaches to understand the cycling of carbon and nitrogen, the identification and alteration of pollutants, or resolve metabolic relationships between compounds in living or extinct organisms are all within the scope of future research. (author)

  8. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  9. The comparison of assessment of pigeon semen motility and sperm concentration by conventional methods and the CASA system (HTM IVOS).

    Science.gov (United States)

    Klimowicz, M D; Nizanski, W; Batkowski, F; Savic, M A

    2008-07-01

    The aim of these experiments was to compare conventional, microscopic methods of evaluating pigeon sperm motility and concentration to those measured by computer-assisted sperm analysis (CASA system). Semen was collected twice a week from two groups of pigeons, each of 40 males (group I: meat-type breed; group II: fancy pigeon) using the lumbo-sacral and cloacal region massage method. Ejaculates collected in each group were diluted 1:100 in BPSE solution and divided into two equal samples. One sample was examined subjectively by microscope and the second one was analysed using CASA system. The sperm concentration was measured by CASA using the anti-collision (AC) system and fluorescent staining (IDENT). There were not any significant differences between the methods of evaluation of sperm concentration. High positive correlations in both groups were observed between the sperm concentration estimated by Thom counting chamber and AC (r=0.87 and r=0.91, respectively), and between the sperm concentration evaluated by Thom counting chamber and IDENT (r=0.85 and r=0.90, respectively). The mean values for CASA measurement of proportion of motile spermatozoa (MOT) and progressive movement (PMOT) were significantly lower than the values estimated subjectively in both groups of pigeons (pCASA system is very rapid, objective and sensitive method in detecting subtle motility characteristics as well as sperm concentration and is recommended for future research into pigeon semen.

  10. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  11. Storage stability of margarines produced from enzymatically interesterified fats compared to those prepared by conventional methods - Chemical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Pedersen, Lars Saaby

    2006-01-01

    margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25øC for 12wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by the conventional methods (chemical interesterification and physical blending......In this study, four margarine hardstocks were produced, two from enzymatically interesterified fats at 80 and 100% conversion, one from chemically randomized fat and one from physically mixed fat. These four hardstocks, blended with 50% sunflower oil, were mainly used for the production of table...... interesterified fat had higher PV in weeks4, 8 and10 than the margarines produced from the enzymatically interesterified fats and the physically blended fat. These differences were not caused by different contents of tocopherols in the hardstocks. The differences between the processes for chemical and enzymatic...

  12. Comparison of porcelain bond strength of different metal frameworks prepared by using conventional and recently introduced fabrication methods.

    Science.gov (United States)

    Kaleli, Necati; Saraç, Duygu

    2017-07-01

    Most studies evaluating dental laser sintering systems have focused on the marginal accuracy of the restorations. However, the bond strength at the metal-ceramic interface is another important factor that affects the survival of restorations, and currently, few studies focus on this aspect. The purpose of this in vitro study was to compare the porcelain bond strength of cobalt-chromium (Co-Cr) metal frameworks prepared by using the conventional lost-wax technique, milling, direct metal laser sintering (DMLS), and laser cusing, a direct process powder-bed system. A total of 96 metal frameworks (n=24 in each group) were prepared by using conventional lost-wax (group C), milling (group M), DMLS (group LS), and direct process powder-bed (group LC) methods according to International Organization for Standardization standard ISO 9693-1. After porcelain application, a 3-point bend test was applied to each specimen by using a universal testing machine. Data were statistically analyzed using 1-way ANOVA and Tukey honest significant difference tests (α=.05). Failure types at the metal-ceramic interfaces were examined using stereomicroscopy. Additionally, 1 specimen from each group was prepared for scanning electron microscopy analysis to evaluate the surface topography of metal frameworks. The mean bond strength was 38.08 ±3.82 MPa for group C, 39.29 ±3.51 MPa for group M, 40.73 ±3.58 MPa for group LS, and 41.24 ±3.75 MPa for group LC. Statistically significant differences were observed among the 4 groups (P=.016). All groups, except for LS, exhibited adhesive and mixed type bond failure. Both of the laser sintering methods were found to be successful in terms of metal-ceramic bond strength. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  13. Biochemical and Biophysical Methods for Analysis of Poly(ADP-Ribose) Polymerase 1 and Its Interactions with Chromatin

    Energy Technology Data Exchange (ETDEWEB)

    Chassé, Maggie H.; Muthurajan, Uma M.; Clark, Nicholas J.; Kramer, Michael A.; Chakravarthy, Srinivas; Irving, Thomas; Luger, Karolin [Children; (IIT); (Colorado); (Amgen)

    2018-01-18

    Poly (ADP-Ribose) Polymerase I (PARP-1) is a first responder to DNA damage and participates in the regulation of gene expression. The interaction of PARP-1 with chromatin and DNA is complex and involves at least two different modes of interaction. In its enzymatically inactive state, PARP-1 binds native chromatin with similar affinity as it binds free DNA ends. Automodification of PARP-1 affects interaction with chromatin and DNA to different extents. Here we describe a series of biochemical and biophysical techniques to quantify and dissect the different binding modes of PARP-1 with its various substrates. The techniques listed here allow for high throughput and quantitative measurements of the interaction of different PARP-1 constructs (inactive and automodified) with chromatin and DNA damage models.

  14. Biochemical fingerprinting of water coliform bacteria, a new method for measuring phenotypic diversity and for comparing different bacterial populations.

    Science.gov (United States)

    Kühn, I; Allestam, G; Stenström, T A; Möllby, R

    1991-01-01

    A simple, automated microplate system for biochemical characterization of water isolates can be used to obtain fingerprints of the bacterial flora from various water samples. Mathematical models for calculating the diversities and similarities between bacterial populations are described for such fingerprints. The diversity may give information on whether an indigenous or allochthonous flora is present, and the similarities between bacterial populations, as calculated by using a population similarity coefficient (Sp), may indicate contaminations between different water samples. The system was demonstrated on coliform bacterial populations from various water samples, with or without suspected intercontamination. For unrelated water samples, the Sps were close to 0, whereas repeated samples of the same source showed Sps of 0.64 to 0.74. The Sp values from several water samples were also clustered to form a dendrogram, thus indicating the relative similarities between the bacterial populations to confirm suspected common sources of pollution. PMID:1781680

  15. SU-8 Cantilevers for Bio/chemical Sensing; Fabrication, Characterisation and Development of Novel Read-out Methods

    Directory of Open Access Journals (Sweden)

    Anja Boisen

    2008-03-01

    Full Text Available Here, we present the activities within our research group over the last five yearswith cantilevers fabricated in the polymer SU-8. We believe that SU-8 is an interestingpolymer for fabrication of cantilevers for bio/chemical sensing due to its simple processingand low Young’s modulus. We show examples of different integrated read-out methodsand their characterisation. We also show that SU-8 cantilevers have a reduced sensitivity tochanges in the environmental temperature and pH of the buffer solution. Moreover, weshow that the SU-8 cantilever surface can be functionalised directly with receptormolecules for analyte detection, thereby avoiding gold-thiol chemistry.

  16. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  17. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  18. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  19. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  1. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  2. Microstructural and Mechanical Properties of Porous 60NiTi Prepared by Conventional Press-and-sinter Method

    Directory of Open Access Journals (Sweden)

    Khanlari Khashayar

    2017-01-01

    Full Text Available An intermetallic nickel-titanium alloy, 60NiTi, comprised of approximately 60 wt.% Ni and 40 wt.% Ti, contains a broad combination of physical and mechanical properties such as high hardness, low elastic modulus, resistance to aqueous corrosion and good biocompatibility. These unique combinations make this alloy an attractive candidate for medical components such as implants and prosthesis, where biocompatible materials with high hardness and low stiffness are typically used. The conventional press-and-sinter method which represents the least complex, most flexible and economic powder metallurgy method was used to produce porous 60NiTi parts suitable for biomedical applications. The effect of sintering holding time on the microstructure and mechanical properties is investigated. The structure of the as sintered parts is quite porous which is beneficial based on the medical point of view. The ultimate compressive strength of the samples is higher than that of the compact human bone and can, therefore, meet the strength demand of implants for general bone replacement applications.

  3. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  4. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  5. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  6. Ouroboros - Playing A Biochemical

    Directory of Open Access Journals (Sweden)

    D. T. Rodrigues

    2014-08-01

    Full Text Available Ouroboros: Playing A Biochemical RODRIGUES,D.T.1,2;GAYER, M.C.1,2; ESCOTO, D.F.1; DENARDIN, E.L.G.2, ROEHRS, R.1,2 1Interdisciplinary Research Group on Teaching Practice, Graduate Program in Biochemistry, Unipampa, RS, Brazil 2Laboratory of Physicochemical Studies and Natural Products, Post Graduate Program in Biochemistry, Unipampa, RS, Brazil Introduction: Currently, teachers seek different alternatives to enhance the teaching-learning process. Innovative teaching methodologies are increasingly common tools in educational routine. The use of games, electronic or conventional, is an effective tool to assist in learning and also to raise the social interaction between students. Objective: In this sense our work aims to evaluate the card game and "Ouroboros" board as a teaching and learning tool in biochemistry for a graduating class in Natural Sciences. Materials and methods: The class gathered 22 students of BSc in Natural Sciences. Each letter contained a question across the board that was drawn to a group to answer within the allotted time. The questions related concepts of metabolism, organic and inorganic chemical reactions, bioenergetics, etc.. Before the game application, students underwent a pre-test with four issues involving the content that was being developed. Soon after, the game was applied. Then again questions were asked. Data analysis was performed from the ratio of the number of correct pre-test and post-test answers. Results and discussion: In the pre-test 18.1% of the students knew all issues, 18.1% got 3 correct answers, 40.9% answered only 2 questions correctly and 22.7% did not hit any. In post-test 45.4% answered all the questions right, 31.8% got 3 questions and 22.7% got 2 correct answers. The results show a significant improvement of the students about the field of content taught through the game. Conclusion: Generally, traditional approaches of chemistry and biochemistry are abstract and complex. Thus, through games

  7. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  8. Comparison on extraction yield of sennoside A and sennoside B from senna (Cassia angustifolia) using conventional and non conventional extraction techniques and their quantification using a validated HPLC-PDA detection method.

    Science.gov (United States)

    Dhanani, Tushar; Singh, Raghuraj; Reddy, Nagaraja; Trivedi, A; Kumar, Satyanshu

    2017-05-01

    Senna is an important medicinal plant and is used in many Ayurvedic formulations. Dianthraquinone glucosides are the main bioactive phytochemicals present in leaves and pods of senna. The extraction efficiency in terms of yield and composition of the extract of senna prepared using both conventional (cold percolation at room temperature and refluxing) and non conventional (ultrasound and microwave assisted solvent extraction as well as supercritical fluid extraction) techniques were compared in the present study. Also a rapid reverse phase HPLC-PDA detection method was developed and validated for the simultaneous determination of sennoside A and sennoside B in the different extracts of senna leaves. Ultrasound and microwave assisted solvent extraction techniques were more effective in terms of yield and composition of the extracts compared to cold percolation at room temperature and refluxing methods of extraction.

  9. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  10. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  11. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  12. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  13. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  14. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  15. Biochemical Profile of Heritage and Modern Apple Cultivars and Application of Machine Learning Methods To Predict Usage, Age, and Harvest Season.

    Science.gov (United States)

    Anastasiadi, Maria; Mohareb, Fady; Redfern, Sally P; Berry, Mark; Simmonds, Monique S J; Terry, Leon A

    2017-07-05

    The present study represents the first major attempt to characterize the biochemical profile in different tissues of a large selection of apple cultivars sourced from the United Kingdom's National Fruit Collection comprising dessert, ornamental, cider, and culinary apples. Furthermore, advanced machine learning methods were applied with the objective to identify whether the phenolic and sugar composition of an apple cultivar could be used as a biomarker fingerprint to differentiate between heritage and mainstream commercial cultivars as well as govern the separation among primary usage groups and harvest season. A prediction accuracy of >90% was achieved with the random forest method for all three models. The results highlighted the extraordinary phytochemical potency and unique profile of some heritage, cider, and ornamental apple cultivars, especially in comparison to more mainstream apple cultivars. Therefore, these findings could guide future cultivar selection on the basis of health-promoting phytochemical content.

  16. POSITIONING ANALYSIS OF ISLAMIC BANK vis-àvis CONVENTIONAL BANK IN INDONESIA USING PARAMETRIC SFA AND DFA METHODS15

    Directory of Open Access Journals (Sweden)

    Ir Ascarya

    2014-03-01

    Full Text Available This study will measure and compare the efficiency of Conventional and Islamic banks in Indonesia using parametric approach stochastic frontier approach (SFA and distribution free approach (DFA. These measurements will provide comprehensive and robust results of efficiency of individual bank compare to its peer group. The results using parametric SFA show that in 2002, conventional banks (0.79 were slightly more efficient than Islamic banks (0.77, while in 2003, the efficiency of Islamic banks improved to 0.84 and the efficiency of conventional banks worsen to 0.76, so that Islamic banks have become more efficient than conventional banks. Conventional and Islamic banks have been improving and converged to the highest level of efficiency (1.00 since 2004. The DFA results show that conventional banks (0.89 are only slightly more efficient than Islamic banks (0.87. Conventional public bank (0.93 is the most efficient, while Islamic regional bank (0.84 is the least efficient. Moreover, efficient banks (conventional and Islamic do not always have lower OCOI (operating costs divided by operating income, while banks with better OCOI usually are more profitable (have better return on assets or ROA. Therefore, technically, Islamic banks have shown their readiness to compete head to head with their conventional counterparts. However, other aspects, such as, number of networks and branches, service quality, convenience, products and services provided, human resources, and pricing, should have become the next priorities for improvements.JEL Classification : C10, C33, G21, G28Keywords : Islamic Banking, Efficiency, Stochastic Frontier Approach, Distribution Free Approach

  17. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of diagnosis of >50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  18. Conventional versus molecular methods for diagnosis of tuberculosis in a tertiary care center: A study from Punjab

    Directory of Open Access Journals (Sweden)

    Shavi Nagpal

    2016-01-01

    Full Text Available Background: A fast and accurate diagnosis is necessary to control and eliminate tuberculosis (TB. There have been various studies evaluating the efficacy of polymerase chain reaction (PCR testing in clinical practice. Most of these studies have found PCR as a useful tool to diagnose TB and more so for the extra-pulmonary cases. Aims and Objectives: The aim of the study was to evaluate the results of TB by real-time PCR versus the conventional methods of diagnosis in a tertiary care center in Punjab. Materials and Methods: This study was done in a tertiary care center of Punjab to look for the results of clinical samples tested for TB using PCR, Ziehl–Neelsen staining and culture on Lowenstein–Jensen medium. 16S rRNA gene was used for Mycobacterium tuberculosis detection in PCR. This study included all samples tested for TB from July 2015 to October 2015. Results: A total of 214 samples were tested for TB using smear microscopy, culture and PCR (including 194 [90.6%] extra-pulmonary and 20 [9.3%] pulmonary samples. These included 76 cerebrospinal fluid, 30 pleural fluid, 42 tissues, 17 ascitic fluid, 13 urine, 15 bronchoalveolar lavage (BAL, 16 pus, and 5 sputum samples. Smear microscopy was positive in a total of 4 samples out of 214 (1.8%, which included 2 sputum, 1 tissue, and 1 ascitic fluid samples, while culture was positive for 6 samples (2.8% which included 2 sputum, 1 pus, 1 BAL, 1 tissue, and 1 ascitic fluid sample. The TB PCR results were positive in a total of 71 (33.1% samples out of 214. In addition, three samples also tested positive for Mycobacteria other than TB. Conclusion: PCR is a very rapid and accurate diagnostic tool for early detection of TB in particularly for extrapulmonary TB.

  19. A vector/parallel method for a three-dimensional transport model coupled with bio-chemical terms

    NARCIS (Netherlands)

    B.P. Sommeijer (Ben); J. Kok (Jan)

    1995-01-01

    textabstractA so-called fractional step method is considered for the time integration of a three-dimensional transport-chemical model in shallow seas. In this method, the transport part and the chemical part are treated separately by appropriate integration techniques. This separation is motivated

  20. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  1. Biochemical and physicochemical analysis of fish protein isolate recovered from red snapper (Lutjanus sp.) by-product using isoelectric solubilization/precipitation method

    Science.gov (United States)

    Pramono, H.; Pujiastuti, D. Y.; Sahidu, A. M.

    2018-04-01

    The effect of acid- and alkali-process on biochemical and physicochemical characteristics of fish protein isolate from red snapper (Lutjanus sp) by-product was evaluated. Protein recovered by alkali process (16.79%) was higher compared to acid process (13.75%). Reduction of lipid content and total volatile basic nitrogen (TVB-N) exhibited in both treatments indicated both process improved fish protein isolate recovered from red snapper by-product. In addition, the increasing of water holding capacity and oil binding capacity were observed. However, high peroxide value of fish protein isolate was showed in both treatment. This finding indicated that acid and alkali process can be used as a useful method to recover proteins from red snapper by-product. Alkali process gave a protein isolate with better overall quality compared to acid process.

  2. Biochemical methane potential prediction of plant biomasses: Comparing chemical composition versus near infrared methods and linear versus non-linear models.

    Science.gov (United States)

    Godin, Bruno; Mayer, Frédéric; Agneessens, Richard; Gerin, Patrick; Dardenne, Pierre; Delfosse, Philippe; Delcarte, Jérôme

    2015-01-01

    The reliability of different models to predict the biochemical methane potential (BMP) of various plant biomasses using a multispecies dataset was compared. The most reliable prediction models of the BMP were those based on the near infrared (NIR) spectrum compared to those based on the chemical composition. The NIR predictions of local (specific regression and non-linear) models were able to estimate quantitatively, rapidly, cheaply and easily the BMP. Such a model could be further used for biomethanation plant management and optimization. The predictions of non-linear models were more reliable compared to those of linear models. The presentation form (green-dried, silage-dried and silage-wet form) of biomasses to the NIR spectrometer did not influence the performances of the NIR prediction models. The accuracy of the BMP method should be improved to enhance further the BMP prediction models. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Development of On-Line High Performance Liquid Chromatography (HPLC)-Biochemical Detection Methods as Tools in the Identification of Bioactives

    Science.gov (United States)

    Malherbe, Christiaan J.; de Beer, Dalene; Joubert, Elizabeth

    2012-01-01

    Biochemical detection (BCD) methods are commonly used to screen plant extracts for specific biological activities in batch assays. Traditionally, bioactives in the most active extracts were identified through time-consuming bio-assay guided fractionation until single active compounds could be isolated. Not only are isolation procedures often tedious, but they could also lead to artifact formation. On-line coupling of BCD assays to high performance liquid chromatography (HPLC) is gaining ground as a high resolution screening technique to overcome problems associated with pre-isolation by measuring the effects of compounds post-column directly after separation. To date, several on-line HPLC-BCD assays, applied to whole plant extracts and mixtures, have been published. In this review the focus will fall on enzyme-based, receptor-based and antioxidant assays. PMID:22489144

  4. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  5. Assessment of nutritional status of the patient with cancer of the stomach by means of selected methods of anthropometric, biochemical and immunological

    Directory of Open Access Journals (Sweden)

    Monika Pierzak

    2018-04-01

    Full Text Available Introduction: Nutritional status is a medical condition that results from the customary intake of food absorbed and the use of its component nutrients or non-nutrients. Malnutrition is a problem faced by therapeutic teams around the world. This condition affects approximately 20-50% of patients hospitalized au deepens 30-90% of patients during hospital treatment. Aim: Assessment of nutritional status of a patient with gastric cancer using selected methods of anthropometric, biochemical and immunological research. Material and methods: The patient admitted in the surgery ward elective 64 years, diagnosis of gastric cancer according to the TNM classification type T3N1MO for treatment. A patient with a history of three cycles of neoadjuvant chemotherapy. Results: Taking into account the results of the questionnaire NRS-2002, interview, physical examination, symptoms, anthropometric measurements, biochemical and immunological studies can assess the nutritional status of the patient is not valid. The patient is malnourished. Taking into account the recommendation ESPEN (Europan Society for Paraenteral and enteral nutrition and nutritional status of the patient has become necessary to incorporate nutritional therapy. The patient was included in parenteral nutritional therapy. Conclusions: Malnutrition is a medical condition rarely recognized, in consequence of which comes to many dangerous health complications discouraging and even the life of the patient. There are several types of malnutrition. Often, patients with cancer, particularly cancer of the gastrointestinal tract, resulting in prolonged malnutrition, cachexia occurs. Cachexia is a syndrome due to systemic inflammatory response which is a response to the presence of the disease in the body. Recognized malnutrition should be treated. After identifying the patient at risk of malnutrition or who is in the disease state of malnutrition, are introduced nutritional therapy. Evaluation of nutrition

  6. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  7. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  8. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    Full Text Available Introduction: Continuing growth in human population and consumptionmeans that the global demand for food will increase for at least another 40 years and that the world needs 70-100% more food by 2050. Environmental issues such as climate change, depletion of naturalresources and biodiversity loss increasingly threaten the welfare ofhuman civilization. Confronting these threats requires, among otherthings, behavioral changes in citizens, governments and companies.Farmers and other producers are responding to consumer concerns about pesticides by creating new marketing opportunities for products grown with environmentally sound practices. Environmental economists are increasingly interested in better understanding of how people cognitively organize their beliefs and attitudes towards environmental change in order to identify key motives and barriers that stimulate or prevent action.The purpose of the presentinvestigation is to evaluate the consumers’ preferences and factors affecting their choice for conventional, healthy and organic cucumbers in Isfahan, Iran. Materials and Methods: Data were collected on a sample of 230consumers in 2013 by using the proportionate stratification samplingmethod through face-to-face interviews based on a comprehensive structured questionnaire. Before the survey, the reliability and validity of the questionnaire were initially evaluated in a pre-test study, respectively, by using Cronbach’s alpha coefficient and Kaiser-Meyer-Olkin (KMO criteria. Individual preferences were uncovered in choice experiment method (CEM by a contingent ranking experiment. In a contingent ranking experiment, respondents are required to rank a set of alternative options, characterized by a number of attributes, which are offered at different levels across the options.Data were analyzed by multinomial logit models. The approach consists of modeling utility, that isto say the net benefit a consumer obtains from selecting a

  9. Alternative Methods for the Detection of Emerging Marine Toxins: Biosensors, Biochemical Assays and Cell-Based Assays

    Directory of Open Access Journals (Sweden)

    Laia Reverté

    2014-11-01

    Full Text Available The emergence of marine toxins in water and seafood may have a considerable impact on public health. Although the tendency in Europe is to consolidate, when possible, official reference methods based on instrumental analysis, the development of alternative or complementary methods providing functional or toxicological information may provide advantages in terms of risk identification, but also low cost, simplicity, ease of use and high-throughput analysis. This article gives an overview of the immunoassays, cell-based assays, receptor-binding assays and biosensors that have been developed for the screening and quantification of emerging marine toxins: palytoxins, ciguatoxins, cyclic imines and tetrodotoxins. Their advantages and limitations are discussed, as well as their possible integration in research and monitoring programs.

  10. Alternative Methods for the Detection of Emerging Marine Toxins: Biosensors, Biochemical Assays and Cell-Based Assays

    Science.gov (United States)

    Reverté, Laia; Soliño, Lucía; Carnicer, Olga; Diogène, Jorge; Campàs, Mònica

    2014-01-01

    The emergence of marine toxins in water and seafood may have a considerable impact on public health. Although the tendency in Europe is to consolidate, when possible, official reference methods based on instrumental analysis, the development of alternative or complementary methods providing functional or toxicological information may provide advantages in terms of risk identification, but also low cost, simplicity, ease of use and high-throughput analysis. This article gives an overview of the immunoassays, cell-based assays, receptor-binding assays and biosensors that have been developed for the screening and quantification of emerging marine toxins: palytoxins, ciguatoxins, cyclic imines and tetrodotoxins. Their advantages and limitations are discussed, as well as their possible integration in research and monitoring programs. PMID:25431968

  11. BISEN: Biochemical simulation environment

    NARCIS (Netherlands)

    Vanlier, J.; Wu, F.; Qi, F.; Vinnakota, K.C.; Han, Y.; Dash, R.K.; Yang, F.; Beard, D.A.

    2009-01-01

    The Biochemical Simulation Environment (BISEN) is a suite of tools for generating equations and associated computer programs for simulating biochemical systems in the MATLAB® computing environment. This is the first package that can generate appropriate systems of differential equations for

  12. High-dose biotin therapy leading to false biochemical endocrine profiles: validation of a simple method to overcome biotin interference.

    Science.gov (United States)

    Piketty, Marie-Liesse; Prie, Dominique; Sedel, Frederic; Bernard, Delphine; Hercend, Claude; Chanson, Philippe; Souberbielle, Jean-Claude

    2017-05-01

    High-dose biotin therapy is beneficial in progressive multiple sclerosis (MS) and is expected to be adopted by a large number of patients. Biotin therapy leads to analytical interference in many immunoassays that utilize streptavidin-biotin capture techniques, yielding skewed results that can mimic various endocrine disorders. We aimed at exploring this interference, to be able to remove biotin and avoid misleading results. We measured free triiodothyronine (fT3), free thyroxine (fT4), thyroid-stimulating hormone (TSH), parathyroid homrone (PTH), 25-hydroxyvitamin D (25OHD), follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin, C-peptide, cortisol (Roche Diagnostics assays), biotin and its main metabolites (liquid chromatography tandem mass spectrometry) in 23 plasmas from MS patients and healthy volunteers receiving high-dose biotin, and in 39 biotin-unsupplemented patients, before and after a simple procedure (designated N5) designed to remove biotin by means of streptavidin-coated microparticles. We also assayed fT4, TSH and PTH in the 23 high-biotin plasmas using assays not employing streptavidin-biotin binding. The biotin concentration ranged from 31.7 to 1160 µg/L in the 23 high-biotin plasmas samples. After the N5 protocol, the biotin concentration was below the detection limit in all but two samples (8.3 and 27.6 μg/L). Most hormones results were abnormal, but normalized after N5. All results with the alternative methods were normal except two slight PTH elevations. In the 39 biotin-unsupplemented patients, the N5 protocol did not affect the results for any of the hormones, apart from an 8.4% decrease in PTH. We confirm that most streptavidin-biotin hormone immunoassays are affected by high biotin concentrations, leading to a risk of misdiagnosis. Our simple neutralization method efficiently suppresses biotin interference.

  13. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Biochemical characterization of an autoradiographic method for studying excitatory amino acid receptors using L-[3H]glutamate

    International Nuclear Information System (INIS)

    Cincotta, M.; Summers, R.J.; Beart, P.M.

    1989-01-01

    A method was developed for radiolabeling excitatory amino acid receptors of rat brain with L-[ 3 H]glutamate. Effective labeling of glutamate receptors in slide-mounted 10-microns sections was obtained using a low incubation volume (0.15 ml) and rapid washing: a procedure where high ligand concentrations were achieved with minimal waste. Saturation experiments using [ 3 H]glutamate revealed a single binding site of micromolar affinity. The Bmax was trebled in the presence of Ca2+ (2.5 mM) and Cl- (20 mM) with no change in the Kd. Binding was rapid, saturable, stereospecific, and sensitive to glutamate receptor agonists. The proportions of [ 3 H]glutamate binding sensitive to N-methyl-D-aspartate (NMDA), kainate, and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) were 34, 54, and 51%, respectively. NMDA inhibited binding at a distinct subset of L-[ 3 H]glutamate sites, whereas AMPA and kainate competed for some common sites. Labeling of sections with L-[ 3 H]glutamate in the presence of the selective agonists allowed autoradiographic visualization of glutamate receptor subtypes in brain tissue

  15. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    Science.gov (United States)

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  16. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  17. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  18. Accuracy and precision of 3 intraoral scanners and accuracy of conventional impressions: A novel in vivo analysis method.

    Science.gov (United States)

    Nedelcu, R; Olsson, P; Nyström, I; Rydén, J; Thor, A

    2018-02-01

    To evaluate a novel methodology using industrial scanners as a reference, and assess in vivo accuracy of 3 intraoral scanners (IOS) and conventional impressions. Further, to evaluate IOS precision in vivo. Four reference-bodies were bonded to the buccal surfaces of upper premolars and incisors in five subjects. After three reference-scans, ATOS Core 80 (ATOS), subjects were scanned three times with three IOS systems: 3M True Definition (3M), CEREC Omnicam (OMNI) and Trios 3 (TRIOS). One conventional impression (IMPR) was taken, 3M Impregum Penta Soft, and poured models were digitized with laboratory scanner 3shape D1000 (D1000). Best-fit alignment of reference-bodies and 3D Compare Analysis was performed. Precision of ATOS and D1000 was assessed for quantitative evaluation and comparison. Accuracy of IOS and IMPR were analyzed using ATOS as reference. Precision of IOS was evaluated through intra-system comparison. Precision of ATOS reference scanner (mean 0.6 μm) and D1000 (mean 0.5 μm) was high. Pairwise multiple comparisons of reference-bodies located in different tooth positions displayed a statistically significant difference of accuracy between two scanner-groups: 3M and TRIOS, over OMNI (p value range 0.0001 to 0.0006). IMPR did not show any statistically significant difference to IOS. However, deviations of IOS and IMPR were within a similar magnitude. No statistical difference was found for IOS precision. The methodology can be used for assessing accuracy of IOS and IMPR in vivo in up to five units bilaterally from midline. 3M and TRIOS had a higher accuracy than OMNI. IMPR overlapped both groups. Intraoral scanners can be used as a replacement for conventional impressions when restoring up to ten units without extended edentulous spans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. The environmental impact of coal technology: Politics and methods of achieving an international convention to protect the earth's atmosphere

    International Nuclear Information System (INIS)

    1992-01-01

    Particular attention will be paid to the following points during the international Round Table discussions: Technology transfer and political opportunities for the environmentally-compatible use of coal in developing and transitional countries who rely on coal to meet their energy needs. Supporting this challenge for the international community of coal-based energy conservation in these countries, particularly through development aid. To increasingly accept our collective responsibility for energy considerations and environmental effects, based on a better understanding of the countries' differing limits and obligations in achieving the goal of a convention to protect the earth's atmosphere. (orig.) [de

  20. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  1. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  2. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  3. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well.

  4. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    Full Text Available Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other

  5. Biochemical Hypermedia: Galactose Metabolism.

    Directory of Open Access Journals (Sweden)

    J.K. Sugai

    2013-05-01

    Full Text Available Introduction: Animations of biochemical processes and virtual laboratory environments lead to true molecular simulations. The use of interactive software’s in education can improve cognitive capacity, better learning and, mainly, it makes information acquisition easier. Material and Methods: This work presents the development of a biochemical hypermedia to understanding of the galactose metabolism. It was developed with the help of concept maps, ISIS Draw, ADOBE Photoshop and FLASH MX Program. Results and Discussion: A step by step animation process shows the enzymatic reactions of galactose conversion to glucose-1-phosphate (to glycogen synthesis, glucose-6-phosphate (glycolysis intermediary, UDP-galactose (substrate to mucopolysaccharides synthesis and collagen’s glycosylation. There are navigation guide that allow scrolling the mouse over the names of the components of enzymatic reactions of via the metabolism of galactose. Thus, explanatory text box, chemical structures and animation of the actions of enzymes appear to navigator. Upon completion of the module, the user’s response to the proposed exercise can be checked immediately through text box with interactive content of the answer. Conclusion: This hypermedia was presented for undergraduate students (UFSC who revealed that it was extremely effective in promoting the understanding of the theme.

  6. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  7. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  8. Identification of oligo-N-glycolylneuraminic acid residues in mammal-derived glycoproteins by a newly developed immunochemical reagent and biochemical methods.

    Science.gov (United States)

    Sato, C; Kitajima, K; Inoue, S; Inoue, Y

    1998-01-30

    The occurrence of the alpha2-->8-linked oligomeric form of N-glycolylneuraminic acid (oligo-Neu5Gc) residues in mammalian glycoproteins was unequivocally demonstrated using a newly developed anti-oligo/poly-Neu5Gc monoclonal antibody as well as by chemical and biochemical methods. First, the antibody, designated mAb.2-4B, which specifically recognized oligo/poly-Neu5Gc with a degree of polymerization of >2, was developed by establishing a hybridoma cell line from P3U1 myeloma cells fused with splenocytes from an MRL autoimmune mouse immunized with dipalmitoylphosphatidylethanolamine-conjugated oligo/poly-Neu5Gc. Second, oligo-Neu5Gc was shown to occur in glycoproteins derived from pig spleen by Western blot analysis using mAb.2-4B, which was also confirmed by fluorometric high performance liquid chromatographic analysis of the product of periodate oxidation/reduction/acid hydrolysis of the purified glycopeptide fractions and by TLC and 600-MHz 1H NMR spectroscopic analysis of their mild acid hydrolysates. Finally, the ubiquitous occurrence of oligo-Neu5Gc chains as glycoproteinaceous components in Wistar rat tissue was immunochemically indicated. This is the first example demonstrating the diversity in oligo/poly-Sia structure in mammalian glycoproteins, where only poly-N-acetylneuraminic acid is known to occur. Such diversity in oligo/poly-Sia structure also implicates a diverged array of biological functions of this glycan unit in glycoproteins.

  9. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  10. Comparing Amazon's Mechanical Turk Platform to Conventional Data Collection Methods in the Health and Medical Research Literature.

    Science.gov (United States)

    Mortensen, Karoline; Hughes, Taylor L

    2018-04-01

    The goal of this article is to conduct an assessment of the peer-reviewed primary literature with study objectives to analyze Amazon.com 's Mechanical Turk (MTurk) as a research tool in a health services research and medical context. Searches of Google Scholar and PubMed databases were conducted in February 2017. We screened article titles and abstracts to identify relevant articles that compare data from MTurk samples in a health and medical context to another sample, expert opinion, or other gold standard. Full-text manuscript reviews were conducted for the 35 articles that met the study criteria. The vast majority of the studies supported the use of MTurk for a variety of academic purposes. The literature overwhelmingly concludes that MTurk is an efficient, reliable, cost-effective tool for generating sample responses that are largely comparable to those collected via more conventional means. Caveats include survey responses may not be generalizable to the US population.

  11. An elemental concentration open source database for Hogdahl-Convention and Westcott-Formalism based on K0-INAA method in Malaysia

    International Nuclear Information System (INIS)

    Yavar, A.R.; Sukiman Sarmani; Tan, C.Y.; Rafie, N.N.; Lim, S.W.E.; Khoo, K.S.

    2012-01-01

    An electronic database has been developed and implemented for K 0 -INAA method in Malaysia. Databases are often developed according to national requirements. This database contains constant nuclear data for k 0 -INAA method. Hogdahl-convention and Westcott-formalism as 3 separate command user interfaces. It has been created using Microsoft Access 2007 under a Windows operating system. This database saves time and the quality of results can be assured when the calculation of neutron flux parameters and concentration of elements by k 0 -INAA method are utilised. An evaluation of the database was conducted by IAEA Soil7 where the results published which showed a high level of consistency. (Author)

  12. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  13. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  14. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  15. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  16. Comparison of type and frequency of chromosome aberrations by conventional and G-staining methods in Hiroshima atomic bomb survivors

    International Nuclear Information System (INIS)

    Ohtaki, Kazuo; Shimba, Hachiro; Sofuni, Toshio; Awa, A.A.

    1982-07-01

    Somatic chromosomes derived from cultured lymphocytes of 23 atomic bomb survivors of Hiroshima were analyzed to determine the type and frequency of radiation-induced structural aberrations, using in sequence the ordinary staining method (O-method) and the trypsin G-banding method (G-method). Of 896 cells examined, 342 were found to contain induced aberrations, including 31 cells in which the precise identification of the type of aberrations was not possible even by the G-method. The number of chromosome aberrations observed was 376 in the 311 cells where aberrant precise identification was possible. The majority (288 or 76.6%) were intra- or inter-chromosomal symmetric exchanges due to a two-break event, while only 24 were found to be asymmetric exchanges (dicentrics, rings, and interstitial deletions). Further, there were 28 aberrations showing acentric fragments and terminal deletions, and the remaining 36 were complex intra- and inter-chromosomal exchanges involving three or more breaks which result in insertions and double translocations. A comparative karyotype analysis of the same metaphases examined by the sequential 0- And G-methods was carried out independently on 361 aberrations, mostly of the symmetric type. It was found that 78 (21.6%) of the 361 were detected only by the G-method; among these were 14 paracentric inversions, 48 reciprocal interchanges of chromosome segments with either equal length (11) or unequal length (37), 14 minor deletions and 2 complex rearrangements, all of which were nevertheless judged to fall within the normal range of variation by theO-method. In contrast, 25 aberrations detected in O-method chromosomes which were overcontracted or twisted, were shown to have normal banding patterns by the G-method. (author)

  17. Preparation of nickel and Ni_3Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    International Nuclear Information System (INIS)

    Li, Pingyun; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-01-01

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N_2 atmosphere. Ni and Ni_3Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni_3Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni_3Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N_2 protecting atmosphere. The Ni and Ni_3Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni_3Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni_3Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni_3Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  18. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  19. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  20. Comparison of conventional, model-based quantitative planar, and quantitative SPECT image processing methods for organ activity estimation using In-111 agents

    International Nuclear Information System (INIS)

    He, Bin; Frey, Eric C

    2006-01-01

    Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based

  1. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  2. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  3. BIOCHEMICAL NUTRITIONAL PROFILE OF LIVER CIRRHOSIS PATIENTS WITH HEPATOCELLULAR CARCINOMA

    Directory of Open Access Journals (Sweden)

    Gabriela Zanatta PORT

    2014-03-01

    Full Text Available Context Liver cirrhosis patients with hepatocellular carcinoma present nutritional alterations and metabolic disorders that negatively impact the prognosis. Objective The objective is to identify alterations in the metabolism of macro and micronutrients among liver cirrhosis patients with and without hepatocellular carcinoma and their relation to the Child-Turcote-Pugh score and Barcelona Clinic Liver Cancer staging. Methods Analytical transversal study, with 31 hepatocellular carcinoma patients and 48 liver cirrhosis patients. Laboratorial exams were carried out. The existence of an association between the biochemical parameters and the disease severity as well as the presence of hepatocellular carcinoma was assessed. Results The metabolic-nutritional profile of liver cirrhosis patients caused by the hepatitis C virus and hepatocellular carcinoma showed alterations, specifically the lipid (total cholesterol, HDL and triglycerides, protein (albumin, creatinine and uric acid, iron (transferrin, iron and ferritin saturation, hematocrit and hemoglobin, zinc and B12 vitamin profiles. There is a relation between nutritional biochemical markers and the Child-Turcote-Pugh, as well as Barcelona Clinic Liver Cancer staging. Conclusions Considering the existence of alterations in the metabolism of nutrients in liver cirrhosis patients with and without hepatocellular carcinoma, and also that conventional nutritional assessment methods present limitations for this population, the biochemical laboratorial exams are valid to complement the diagnosis of the nutritional state in a quick and practical manner.

  4. Method for Derivatization and Detection of Chemical Weapons Convention Related Sulfur Chlorides via Electrophilic Addition with 3-Hexyne.

    Science.gov (United States)

    Goud, D Raghavender; Pardasani, Deepak; Purohit, Ajay Kumar; Tak, Vijay; Dubey, Devendra Kumar

    2015-07-07

    Sulfur monochloride (S2Cl2) and sulfur dichloride (SCl2) are important precursors of the extremely toxic chemical warfare agent sulfur mustard and classified, respectively, into schedule 3.B.12 and 3.B.13 of the Chemical Weapons Convention (CWC). Hence, their detection and identification is of vital importance for verification of CWC. These chemicals are difficult to detect directly using chromatographic techniques as they decompose and do not elute. Until now, the use of gas chromatographic approaches to follow the derivatized sulfur chlorides is not reported in the literature. The electrophilic addition reaction of sulfur monochloride and sulfur dichloride toward 3-hexyne was explored for the development of a novel derivatization protocol, and the products were subjected to gas chromatography-mass spectrometric (GC-MS) analysis. Among various unsaturated reagents like alkenes and alkynes, symmetrical alkyne 3-hexyne was optimized to be the suitable derivatizing agent for these analytes. Acetonitrile was found to be the suitable solvent for the derivatization reaction. The sample preparation protocol for the identification of these analytes from hexane spiked with petrol matrix was also optimized. Liquid-liquid extraction followed by derivatization was employed for the identification of these analytes from petrol matrix. Under the established conditions, the detection and quantification limits are 2.6 μg/mL, 8.6 μg/mL for S2Cl2 and 2.3 μg/mL, 7.7 μg/mL for SCl2, respectively, in selected ion monitoring (SIM) mode. The calibration curve had a linear relationship with y = 0.022x - 0.331 and r(2) = 0.992 for the working range of 10 to 500 μg/mL for S2Cl2 and y = 0.007x - 0.064 and r(2) = 0.991 for the working range of 10 to 100 μg/mL for SCl2, respectively. The intraday RSDs were between 4.80 to 6.41%, 2.73 to 6.44% and interday RSDs were between 2.20 to 7.25% and 2.34 to 5.95% for S2Cl2 and SCl2, respectively.

  5. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  6. A comparison between the conventional manual ROI method and an automatic algorithm for semiquantitative analysis of SPECT studies

    International Nuclear Information System (INIS)

    Pagan, L; Novi, B; Guidarelli, G; Tranfaglia, C; Galli, S; Lucchi, G; Fagioli, G

    2011-01-01

    In this study, the performance of a free software for automatic segmentation of striatal SPECT brain studies (BasGanV2 - www.aimn.it) and a standard manual Region Of Interest (ROI) method were compared. The anthropomorphic Alderson RSD phantom, filled with solutions at different concentration of 123 I-FP-CIT with Caudate-Putamen to Background ratios between 1 and 8.7 and Caudate to Putamen ratios between 1 and 2, was imaged on a Philips-Irix triple head gamma camera. Images were reconstructed using filtered back-projection and processed with both BasGanV2, that provides normalized striatal uptake values on volumetric anatomical ROIs, and a manual method, based on average counts per voxel in ROIs drawn in a three-slice section. Caudate-Putamen/Background and Caudate/Putamen ratios obtained with the two methods were compared with true experimental ratios. Good correlation was found for each method; BasGanV2, however, has higher R index (BasGan R mean = 0.95, p mean = 0.89, p 123 I-FP-CIT SPECT data with, moreover, the advantage of the availability of a control subject's database.

  7. Comparative evaluation of the efficacy of chemomechanical caries removal agent (Papacarie and conventional method of caries removal: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jawa D

    2010-06-01

    Full Text Available Painless dentistry, minimal intervention and thus giving comfort, relief and solace and instill positive attitude toward dental treatments, are some of the factors justifying the specialty of pediatric dentistry. Thus, this in vitro study was undertaken to compare the efficacy of a new chemomechanical caries removal agent, Papacarie (Formula and Acao, with conventional slow-speed rotary instrument (bur. Papacarie is a new formulation and has the main active ingredient papain, an endoprotein with bactericidal, bacteriostatic and anti-inflammatory actions. Twenty extracted human molar teeth with deep dentine caries and no enamel coverage were selected for the study. After the preparation of the teeth and removal of the caries with the respective methods, they were decalcified, dehydrated and embedded in paraffin blocks for histologic studies. Serial sections of 5 μm thickness were examined for the presence of bacteria under light microscope. Though complete removal of caries was achieved significantly in both the methods, there was less marked destruction of dentinal tubules in chemomechanical caries removal method by Papacarie. Thus, Papacarie is recommended as an efficient, easy to perform, comfortable and less destructive solution for the patient seeking an alternative to the conventional method.

  8. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method.

    Science.gov (United States)

    Aminsobhani, Mohsen; Razmi, Hasan; Nozari, Solmaz

    2015-07-01

    Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method. Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi) rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey's post hoc test. There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05). Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique. According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  9. Efficacy of adding the Kinesio Taping method to guideline-endorsed conventional physiotherapy in patients with chronic nonspecific low back pain: a randomised controlled trial.

    Science.gov (United States)

    Added, Marco Aurélio Nemitalla; Costa, Leonardo Oliveira Pena; Fukuda, Thiago Yukio; de Freitas, Diego Galace; Salomão, Evelyn Cassia; Monteiro, Renan Lima; Costa, Lucíola da Cunha Menezes

    2013-10-24

    Chronic nonspecific low back pain is a significant health condition with high prevalence worldwide and it is associated with enormous costs to society. Clinical practice guidelines show that many interventions are available to treat patients with chronic low back pain, but the vast majority of these interventions have a modest effect in reducing pain and disability. An intervention that has been widespread in recent years is the use of elastic bandages called Kinesio Taping. Although Kinesio Taping has been used extensively in clinical practice, current evidence does not support the use of this intervention; however these conclusions are based on a small number of underpowered studies. Therefore, questions remain about the effectiveness of the Kinesio Taping method as an additional treatment to interventions, such as conventional physiotherapy, that have already been recommended by the current clinical practice guidelines in robust and high-quality randomised controlled trials. We aim to determine the effectiveness of the addition of the use of Kinesio Taping in patients with chronic nonspecific low back pain who receive guideline-endorsed conventional physiotherapy. One hundred and forty-eight patients will be randomly allocated to receive either conventional physiotherapy, which consists of a combination of manual therapy techniques, general exercises, and specific stabilisation exercises (Guideline-Endorsed Conventional Physiotherapy Group) or to receive conventional physiotherapy with the addition of Kinesio Taping to the lumbar spine (Conventional Physiotherapy plus Kinesio Taping Group) over a period of 5 weeks (10 sessions of treatment). Clinical outcomes (pain intensity, disability and global perceived effect) will be collected at baseline and at 5 weeks, 3 months, and 6 months after randomisation. We will also collect satisfaction with care and adverse effects after treatment. Data will be collected by a blinded assessor. All statistical analysis will be

  10. Analysis of Longitudinal Studies With Repeated Outcome Measures: Adjusting for Time-Dependent Confounding Using Conventional Methods.

    Science.gov (United States)

    Keogh, Ruth H; Daniel, Rhian M; VanderWeele, Tyler J; Vansteelandt, Stijn

    2018-05-01

    Estimation of causal effects of time-varying exposures using longitudinal data is a common problem in epidemiology. When there are time-varying confounders, which may include past outcomes, affected by prior exposure, standard regression methods can lead to bias. Methods such as inverse probability weighted estimation of marginal structural models have been developed to address this problem. However, in this paper we show how standard regression methods can be used, even in the presence of time-dependent confounding, to estimate the total effect of an exposure on a subsequent outcome by controlling appropriately for prior exposures, outcomes, and time-varying covariates. We refer to the resulting estimation approach as sequential conditional mean models (SCMMs), which can be fitted using generalized estimating equations. We outline this approach and describe how including propensity score adjustment is advantageous. We compare the causal effects being estimated using SCMMs and marginal structural models, and we compare the two approaches using simulations. SCMMs enable more precise inferences, with greater robustness against model misspecification via propensity score adjustment, and easily accommodate continuous exposures and interactions. A new test for direct effects of past exposures on a subsequent outcome is described.

  11. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  12. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  13. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  14. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  15. Integrated functional modeling method for NPP plant DiD risk monitor and its application for conventional PWR

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, Hidekazu; Yang, Ming; Zhang, Zhijian [Harbin Engineering University, Harbin (China)

    2014-08-15

    The development of a new risk monitor system is introduced in this paper, which can be applied not only to severe accident prevention in daily operation but also to serve as to mitigate the radiological hazard just after severe accident happens and long term management of post-severe accident consequences. The summary of the fundamental method is summarized on how to configure the Plant Defense in-Depth (Did) Risk Monitor by object-oriented software system based on functional modeling approach. Following the authors??preceding preliminary study for AP1000, the way of realizing the proposed method of configuring the plant Did risk monitor was investigated for a safety-enhanced Japanese PWR design to meet with the tight anti-severe accident requirements set by national regulation in Japan after Fukushima Daiichi accident. The result of this example practice of the presented preliminary study for Japanese PWR was for the level 4 of the Did in case of beyond design basis accident, that is, loss of all AC power + RCP seal LOCA, against the former case of AP1000 for level 3 Did in case of large LOCA.

  16. Clinical value of FDG hybrid-PET in staging and restaging of malignant lymphoma. Compared with conventional diagnostic methods

    International Nuclear Information System (INIS)

    Pichler, R.; Maschek, W.; Hatzl-Griesenhofer, M.; Huber, H.; Wimmer, G.; Wahl, G.; Fridrik, M.

    2000-01-01

    Aim of the present retrospective study was to validate the clinical value of F-18-FDG PET imaging in lymphoma patients with a dual head camera modified for coincidence detection. Staging before and after oncological treatment was compared with a conservative diagnostic approach. Methods: 48 patients (28 non-Hodgkin lymphoma, 20 Hodgkin's disease) received FDG-Hybrid-PET scans. Pretherapeutic staging was realized in 28 patients, 9 of them had control studies after they had completed therapy. Totally 29 persons were examined for posttherapeutic restaging. Computed tomography imaging and lymph node sonography was performed in all cases. Results were validated by clinical follow-up, in three cases a recidive was proven by biopsy. Results: CT and ultrasound detected 77 lesions in 28 patients compared with 100 visualized by PET, but this difference in pretherapeutic staging did not reach significance at p>0.05 by Fisher's t-test. Hybrid-PET obtained a sensitivity of 93%, a specifity of 79%, a positive of 82% and a negative predictive value of 92% for detection of residual disease. The values for CT+US were 87%, 64%, 72% and 88% respectively. Conclusion: FDG Hybrid-PET is as or even more accurate than standard morphologic diagnostic methods for prestaging in malignant lymphoma. Additionally, there is a substancial benefit for therapy monitoring of residual disease using coincidence detection PET with a 3/4-inch crystal gamma camera. (orig.) [de

  17. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  18. Analysis of reverse heat transfer for conventional and optimized lubri-cooling methods during tangential surface grinding of ABNT 1020 steel

    Directory of Open Access Journals (Sweden)

    Henrique Cotait Razuk

    Full Text Available Abstract A numerical thermal model was developed to evaluate the heat flux which is conducted to a rectangular workpiece of steel plate ABNT 1020, thus making it possible to compute the maximum temperature in the grinding surface, taking into account the rectangular distribution of heat flux, the thermal properties of the grinding wheel conventional Al2O3, the piece to be machined and the lubri-refrigerating fluid. The finite volume method was employed for the discretization of the direct thermal problem from the heat diffusion equation associated with the two-dimensional problem of heat conduction in transient regime. The inverse thermal problem was solved by the Golden Section technique. The thermal flux, when compared to the conventional technique of method of application fluid, was reduced by 84.0% in the practices performed with cutting depth of 30µm, at 74.0% in practices with cutting depth of 45µm and 61.2% in the aggressive practices of 60µm, thus demonstrating the applicability of the optimized method for fluid application.

  19. Assessment of adiposity in psoriatic patients by dual energy X-ray absorptiometry compared to conventional methods*

    Science.gov (United States)

    Diniz, Michelle dos Santos; Bavoso, Nádia Couto; Kakehasi, Adriana Maria; Lauria, Márcio Weissheimer; Soares, Maria Marta Sarquis; Machado-Pinto, Jackson

    2016-01-01

    BACKGROUND Obesity is considered a chronic low-grade inflammatory disease that shares mediators of inflammation with psoriasis, such as TNF-α and IL-6. The relationship between these two conditions involves factors such as predisposition and response to therapy, in addition to an association with cardiovascular disease. OBJECTIVES The aim of the present study was to investigate the prevalence of adiposity as determined by body mass index (BMI), waist circumference (WC), and dual energy X-ray absorptiometry (DXA) evaluation in patients with psoriasis. METHODS BMI, WC and body composition by DXA were measured in 42 psoriatic patients without joint complaints and in 41 control patients using standard procedures. In the comparison between cases and controls, we used Pearson’s Χ2 test or Fisher’s exact test, and the nonparametric Mann-Whitney test. The difference between the diverse classification methods for obesity was evaluated using McNemar’s test. To test the level of agreement between those variables, we used the weighted kappa coefficient. RESULTS There was no difference in the prevalence of obesity among cases and controls. Both BMI and WC had low agreement with measures of body fat evaluated by DXA. With the use of DXA scanning, prevalence of overweight and obesity in patients with psoriasis was 83.3%, which constitutes a strong evidence of the need for intervention on this metabolic parameter. CONCLUSION Dual energy X-ray absorptiometry was more capable of identifying obesity compared with BMI and WC both in psoriatic and control patients. PMID:27192512

  20. Biochemical and kinetic characterization of geranylgeraniol 18 ...

    African Journals Online (AJOL)

    Suchart

    2015-07-22

    Jul 22, 2015 ... biochemical characterization of GGOH 18-hydroxylase activity in the microsomal fraction from C. .... method as previously described (Chanama et al., 2009). Briefly, 30 g of frozen ..... Catalytic properties of the plant cytochrome.

  1. A study on evaluating validity of SNR calculation using a conventional two region method in MR images applied a multichannel coil and parallel imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwan Woo; Son, Soon Yong [Dept. of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Min, Jung Whan [Dept. of Radiological Technology, Shingu University, Sungnam (Korea, Republic of); Kwon, Kyung Tae [Dept. of Radiological Technology, Dongnam Health University, Suwon (Korea, Republic of); Yoo, Beong Gyu; Lee, Jong Seok [Dept. of Radiotechnology, Wonkwang Health Science University, Iksan (Korea, Republic of)

    2015-12-15

    The purpose of this study was to investigate the problems of a signal to noise ratio measurement using a two region measurement method that is conventionally used when using a multi-channel coil and a parallel imaging technique. As a research method, after calculating the standard SNR using a single channel head coil of which coil satisfies three preconditions when using a two region measurement method, we made comparisons and evaluations after calculating an SNR by using a two region measurement method of which method is problematic because it is used without considering the methods recommended by reputable organizations and the preconditions at the time of using a multi-channel coil and a parallel imaging technique. We found that a two region measurement method using a multi-channel coil and a parallel imaging technique shows the highest relative standard deviation, and thus shows a low degree of precision. In addition, we found out that the difference of SNR according to ROI location was very high, and thus a spatial noise distribution was not uniform. Also, 95% confidence interval through Blend-Altman plot is the widest, and thus the conformity degree with a two region measurement method using the standard single channel head coil is low. By directly comparing an AAPM method, which serves as a standard of a performance evaluation test of a magnetic resonance imaging device under the same image acquisition conditions, an NEMA method which can accurately determine the noise level in a signal region and the methods recommended by manufacturers of a magnetic resonance imaging device, there is a significance in that we quantitatively verified the inaccurate problems of a signal to noise ratio using a two region measurement method when using a multi-channel coil and a parallel imaging technique of which method does not satisfy the preconditions that researchers could overlook.

  2. A study on modeling nitrogen dioxide concentrations using land-use regression and conventionally used exposure assessment methods

    Science.gov (United States)

    Choi, Giehae; Bell, Michelle L.; Lee, Jong-Tae

    2017-04-01

    The land-use regression (LUR) approach to estimate the levels of ambient air pollutants is becoming popular due to its high validity in predicting small-area variations. However, only a few studies have been conducted in Asian countries, and much less research has been conducted on comparing the performances and applied estimates of different exposure assessments including LUR. The main objectives of the current study were to conduct nitrogen dioxide (NO2) exposure assessment with four methods including LUR in the Republic of Korea, to compare the model performances, and to estimate the empirical NO2 exposures of a cohort. The study population was defined as the year 2010 participants of a government-supported cohort established for bio-monitoring in Ulsan, Republic of Korea. The annual ambient NO2 exposures of the 969 study participants were estimated with LUR, nearest station, inverse distance weighting, and ordinary kriging. Modeling was based on the annual NO2 average, traffic-related data, land-use data, and altitude of the 13 regularly monitored stations. The final LUR model indicated that area of transportation, distance to residential area, and area of wetland were important predictors of NO2. The LUR model explained 85.8% of the variation observed in the 13 monitoring stations of the year 2009. The LUR model outperformed the others based on leave-one out cross-validation comparing the correlations and root-mean square error. All NO2 estimates ranged from 11.3-18.0 ppb, with that of LUR having the widest range. The NO2 exposure levels of the residents differed by demographics. However, the average was below the national annual guidelines of the Republic of Korea (30 ppb). The LUR models showed high performances in an industrial city in the Republic of Korea, despite the small sample size and limited data. Our findings suggest that the LUR method may be useful in similar settings in Asian countries where the target region is small and availability of data is

  3. Evaluation of conventional and alternative monitoring methods for a recreational marine beach with nonpoint source of fecal contamination.

    Science.gov (United States)

    Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E

    2010-11-01

    The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.

  4. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  5. Preparation and study of tramadol imprinted micro-and nanoparticles by precipitation polymerization: microwave irradiation and conventional heating method.

    Science.gov (United States)

    Seifi, Mahmoud; Hassanpour Moghadam, Maryam; Hadizadeh, Farzin; Ali-Asgari, Safa; Aboli, Jafar; Mohajeri, Seyed Ahmad

    2014-08-25

    In the present work a series of tramadole imprinted micro- and nanoparticles were prepared and study their recognition properties. Methacrylic acid (MAA), as a functional monomer, ethylene glycol dimethacrylate (EGDMA) as a cross-linker and different solvents (chloroform, toluene and acetonitrile (ACN)) were used for the preparation of molecularly imprinted polymers (MIPs) and non-imprinted polymers (NIPs). Several factors such as template/monomer molar ratio, volume of polymerization solvent, total monomers/solvent volume ratio, polymerization condition (heating or microwave irradiation) were also investigated. Particle size of the polymers, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), rebinding, selectivity tests and release study were applied for evaluation of the polymers. The optimized polymers with smaller particle size and superior binding properties were obtained in acetonitrile under heating method. MIPA4 with a size of 42.6 nm and a binding factor (BF) of 6.79 was selected for selectivity and release tests. The polymerization was not successful in acetonitrile and toluene under microwave irradiation. The MIPA4 could selectively adsorb tramadol, compared to imipramine, naltrexone and gabapentin. The data showed that tramadol release from MIPA4 was significantly slower than that of its non-imprinted polymer. Therefore, MIP nanoparticles with high selectivity, binding capacity and ability to control tramadol release could be obtained in precipitation polymerization with optimized condition. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Clinical and anatomic pathology effects of serial blood sampling in rat toxicology studies, using conventional or microsampling methods.

    Science.gov (United States)

    Caron, Alexis; Lelong, Christine; Bartels, T; Dorchies, O; Gury, T; Chalier, Catherine; Benning, Véronique

    2015-08-01

    As a general practice in rodent toxicology studies, satellite animals are used for toxicokinetic determinations, because of the potential impact of serial blood sampling on toxicological endpoints. Besides toxicological and toxicokinetic determinations, blood samples obtained longitudinally from a same animal may be used for the assessment of additional parameters (e.g., metabolism, pharmacodynamics, safety biomarkers) to maximize information that can be deduced from rodents. We investigated whether removal of up to 6 × 200 μL of blood over 24h can be applied in GLP rat toxicology studies without affecting the scientific outcome. 8 week-old female rats (200-300 g) were dosed for up to 1 month with a standard vehicle and subjected or not (controls) to serial blood sampling for sham toxicokinetic/ancillary determinations, using miniaturized methods allowing collection of 6 × 50, 100 or 200 μL over 24h. In-life endpoints, clinical pathology parameters and histopathology of organs sensitive to blood volume reduction were evaluated at several time points after completion of sampling. In sampled rats, minimal and reversible changes in red blood cell mass (maximally 15%) and subtle variations in liver enzymes, fibrinogen and neutrophils were not associated with any organ/tissue macroscopic or microscopic correlate. Serial blood sampling (up to 6 × 200 μL over 24h) is compatible with the assessment of standard toxicity endpoints in adult rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  8. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  9. Method for automatic localization of MR-visible markers using morphological image processing and conventional pulse sequences: feasibility for image-guided procedures.

    Science.gov (United States)

    Busse, Harald; Trampel, Robert; Gründer, Wilfried; Moche, Michael; Kahn, Thomas

    2007-10-01

    To evaluate the feasibility and accuracy of an automated method to determine the 3D position of MR-visible markers. Inductively coupled RF coils were imaged in a whole-body 1.5T scanner using the body coil and two conventional gradient echo sequences (FLASH and TrueFISP) and large imaging volumes up to (300 mm(3)). To minimize background signals, a flip angle of approximately 1 degrees was used. Morphological 2D image processing in orthogonal scan planes was used to determine the 3D positions of a configuration of three fiducial markers (FMC). The accuracies of the marker positions and of the orientation of the plane defined by the FMC were evaluated at various distances r(M) from the isocenter. Fiducial marker detection with conventional equipment (pulse sequences, imaging coils) was very reliable and highly reproducible over a wide range of experimental conditions. For r(M) method is found to be useful for image-guided procedures. (c) 2007 Wiley-Liss, Inc.

  10. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  11. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  12. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  13. Comparison of revegetation of a gas pipeline right-of-way in two forested wetland crossings involving conventional methods of pipeline installation and horizontal drilling, Nassau County, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Van Dyke, G.D. [Trinity Christian Coll., Palos Heights, IL (United States). Dept. of Biology; Shem, L.M.; Zimmerman, R.E. [Argonne National Lab., IL (United States)

    1993-10-01

    One year after pipeline installation, vegetation in the right-of-way (ROW) was inventoried at two stream floodplain crossings in Nassau County, Florida. Both sites were forested wetlands composed of Acer rubrum, Fraxinus caroliniana, Liquidamber styraciflua, Nyssa ogecho, Quercus laurifolia, and Taxodium distichum, together with other wetland trees. Pipeline installation across the Brandy Branch floodplain was by conventional ditching and backfill methods. Installation across the Deep Creek floodplain was by horizontal drilling after clearcutting the ROW. The latter method left tree stumps, understory vegetation, and soil layers intact, except for disruptions caused by logging. According to the inventory, vegetation at the drilled site was more diverse (nearly twice as many species occurring in the ROW as at the trenched site) and more robust (no unvegetated exposed soil compared to 15% at the trenched site). Differences between the ROW vegetation at the two sites can be attributed to both site differences and installation technologies used.

  14. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  15. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  16. The effect of different conventional methods of extraction on Marantodes pumila var. pumila leaves in relation to free radical scavenging activity

    Science.gov (United States)

    Hamid, Noor Huda Abd; Latip, Jalifah; Markom, Masturah

    2018-04-01

    Marantodes pumila is one of the important herbs used in traditional medicine. However, there is no report on the optimum method for the preparation of M. pumila extract enriched with bioactive compounds. Therefore, this study aim to establish the suitable method in the preparation of M. pumila extracts enriched with antioxidative compounds. Different conventional extraction methods such as maceration, reflux and Soxhlet in solvents of different polarities i.e. ethanol, 50 % aqueous ethanol and water were employed to prepare extracts. Constituents of each extract were profiled using RP-HPLC followed by the free radical scavenging assay using 2,2 diphenyl-1-picrylhydrazyl (DPPH) to determine the antioxidant activity. Among all extraction methods, maceration in 50 % aqueous ethanol gave the highest total percentage yield (22.41 %) while all extraction methods were able to extract the marker compounds, gallic acid (GA) and methyl gallate (MGA). The free radical scavenging activity of extracts varied from IC50 11.93 µg/mL (50 % aqueous ethanol via reflux) to 64.15 µg/mL (water via maceration). All extracts showed better scavenging activity as compared to synthetic antioxidant, BHT. The variation in the IC50 values is expected due to the presence of different types and/or concentration of bioactive compounds in each extract. This study may provide a preliminary insight for the preparation of standardized extracts of M. pumila enriched with bioactive compounds.

  17. Comparison of oxygen saturation levels in patients receiving Technegas by the conventional unassisted method vs. the positive ventilation delivery system (PVDS)

    International Nuclear Information System (INIS)

    Dobson, M.P.; Leiper, C.A.; Lee, K.; Dixson, H.

    2000-01-01

    Full text: The purpose of this study is to compare oxygen saturation levels (SaO 2 ) in 289 patients undergoing conventional lung ventilation scintigraphy (control group) and 27 patients undergoing Positive Ventilation Delivery System (PVDS). The 27 patients where selected as their conventional method of inhalation proved to be inadequate or non-diagnostic. The patients underwent a second ventilation using PVDS, which improved the diagnostic quality of the ventilation image and assisted in clinical management decisions. Some patients in both the PVDS and the control group experienced a transient lowering in their SaO 2 . The mean initial SaO 2 in the control group did not fall below 94.9% and in the PVDS group measured 90.6%. 93% (25/27) of patients in the PVDS group were assessed as non CO 2 retaining, and received oxygen at 10L/min during Technegas inhalation. The mean trough saturation in the PVDS group was 91.7% which was significantly higher than that of the control group (86.9%). No patient in either group experienced any significant complication attributed to the transient tall in SaO 2 during technegas administration. We conclude that oxygen supplied as part of the PVDS system ameliorates the transient reduction in SaO 2 seen during standard Technegas administration. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  18. Study of the magnetic microstructure of high-coercivity sintered SmCo5 permanent magnets with the conventional Bitter pattern technique and the colloid-SEM method

    International Nuclear Information System (INIS)

    Szmaja, Witold

    2007-01-01

    The magnetic microstructure of high-coercivity sintered SmCo 5 permanent magnets was studied with the conventional Bitter pattern technique, and also for the first time with the colloid-scanning electron microscopy (colloid-SEM) method. Both techniques were supported by digital image acquisition, enhancement and analysis. Thanks to this, it was possible to obtain high-contrast and clear images of the magnetic microstructure and to analyze them in detail, and consequently also to achieve improvements over earlier results. In the thermally demagnetized state the grains were composed of magnetic domains. On the surface perpendicular to the alignment axis, the main domains forming a maze pattern and surface reverse spikes were observed. Investigations on the surface parallel to the alignment axis, especially by the colloid-SEM technique, provided a detailed insight into the orientation of grains. The alignment of grains was good, but certainly not perfect; there were also strongly misaligned grains, although generally very rare. In most cases the domain structures within grains were independent of their neighbors, but in some cases (not so rare) the domain walls were observed to continue through the grain boundaries, indicating significant magnetostatic interaction between neighboring grains. Studies of the behavior of the magnetic microstructure under the influence of an external magnetic field, performed for the first time on the surface parallel to the alignment axis (with the conventional Bitter pattern method), showed that the domain walls move easily within the grains and that the magnetization reversal mechanism is mainly related to the nucleation and growth of reverse domains, i.e. that sintered SmCo 5 magnets are nucleation-dominated systems. Groupwise magnetization reversal of adjacent magnetically coupled grains was observed, an unfavorable effect for high-coercivity magnets. Images obtained by the colloid-SEM technique and the conventional Bitter pattern

  19. Conventional method for the calculation of the global energy cost of buildings; Methode conventionnelle de calcul du cout global energetique des batiments

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-05-01

    A working group driven by Electricite de France (EdF), Chauffage Fioul and Gaz de France (GdF) companies has been built with the sustain of several building engineering companies in order to clarify the use of the method of calculation of the global energy cost of buildings. This global cost is an economical decision help criterion among others. This press kit presents, first, the content of the method (input data, calculation of annual expenses, calculation of the global energy cost, display of results and limitations of the method). Then it fully describes the method and its appendixes necessary for its implementation: economical and financial context, general data of the project in progress, environmental data, occupation and comfort level, variants, investment cost of energy systems, investment cost for the structure linked with the energy system, investment cost for other invariant elements of the structure, calculation of consumptions (space heating, hot water, ventilation), maintenance costs (energy systems, structure), operation and exploitation costs, tariffs and consumption costs and taxes, actualized global cost, annualized global cost, comparison between variants. The method is applied to a council building of 23 flats taken as an example. (J.S.)

  20. Ascertaining year of birth/age at death in forensic cases: A review of conventional methods and methods allowing for absolute chronology

    DEFF Research Database (Denmark)

    Lynnerup, Niels; Kjeldsen, H; Zweihoff, R

    2010-01-01

    Based on an actual case, where we were able to ascertain the year of birth of three dead babies found in a deep-freezer to within 1–2 years (1986, 1988 and 2004, respectively), we review the current state of forensic age determination/year of birth determination. The age of an individual (year...... of birth) is often a fundamental piece of data in connection with forensic identification of unidentified bodies. The methods most often used are based on determining various morphological, age-related, changes on the skeleton (or teeth, although odontological methods are not reviewed in this paper...

  1. Biochemical characterization of cholesterol-reducing Eubacterium.

    OpenAIRE

    Mott, G E; Brinkley, A W; Mersinger, C L

    1980-01-01

    We characterized two isolates of cholesterol-reducing Eubacterium by conducting conventional biochemical tests and by testing various sterols and glycerolipids as potential growth factors. In media containing cholesterol and plasmenylethanolamine, the tests for nitrate reduction, indole production, and gelatin and starch hydrolyses were negative, and no acid was produced from any of 22 carbohydrates. Both isolates hydrolyzed esculin to esculetin, indicating beta-glycosidase activity. In addit...

  2. 'Augmented reality' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    Energy Technology Data Exchange (ETDEWEB)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria); radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Steininger, P. [radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Dept. of Medical Computer Science and Technology, Univ. for Health Sciences, Hall i. T. (Austria); Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria)

    2008-02-15

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  3. Storage stability study for margarines produced by enzymatically interesterified fats compared to the margarines by the conventional methods I. Physical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Adler-Nissen, Jens

    2005-01-01

    was more similar to that of the physically mixed fat than that of the margarine from the chemically randomized fat, which had less color. Crystal transformation was accelerated at high storage temperature. Crystal size was not only related to the types of crystals, but also to the driving force......In this study, margarine hardstocks were produced from two enzymatically interesterified fats at conversion degrees of 80 and 100%, a chemically randomized fat and a physically mixed fat, respectively. These four hardstocks blended with 50% of sunflower oil were mainly used for the production...... of table margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25 7C during 12 wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by conventional methods and to selected commercial products. The changes...

  4. Influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions.

    Science.gov (United States)

    Carbajal Mejía, Jeison B; Wakabayashi, Kazumichi; Nakamura, Takashi; Yatani, Hirofumi

    2017-09-01

    Direct (intraoral) and indirect (desktop) digital scanning can record abutment tooth preparations despite their geometry. However, little peer-reviewed information is available regarding the influence of abutment tooth geometry on the accuracy of digital methods of obtaining dental impressions. The purpose of this in vitro study was to evaluate the influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions in terms of trueness and precision. Crown preparations with known total occlusal convergence (TOC) angles (-8, -6, -4, 0, 4, 8, 12, 16, and 22 degrees) were digitally created from a maxillary left central incisor and printed in acrylic resin. Each of these 9 reference models was scanned with a highly accurate reference scanner and saved in standard tessellation language (STL) format. Then, 5 conventional polyvinyl siloxane (PVS) impressions were made from each reference model, which was poured with Type IV dental stone scanned using both the reference scanner (group PVS) and the desktop scanner and exported as STL files. Additionally, direct digital impressions (intraoral group) of the reference models were made, and the STL files were exported. The STL files from the impressions obtained were compared with the original geometry of the reference model (trueness) and within each test group (precision). Data were analyzed using 2-way ANOVA with the post hoc least significant difference test (α=.05). Overall trueness values were 19.1 μm (intraoral scanner group), 23.5 μm (desktop group), and 26.2 μm (PVS group), whereas overall precision values were 11.9 μm (intraoral), 18.0 μm (PVS), and 20.7 μm (desktop). Simple main effects analysis showed that impressions made with the intraoral scanner were significantly more accurate than those of the PVS and desktop groups when the TOC angle was less than 8 degrees (Pimpression and the TOC angle on the precision of single-tooth dental impressions (F=2

  5. Clinical target volume localization using conventional methods (anatomy and palpation) and ultrasonography in early breast cancer post-operative external irradiation

    International Nuclear Information System (INIS)

    Valdagni, Riccardo; Italia, Corrado; Montanaro, Paolo; Ciocca, Mario; Morandi, Giovanni; Salvadori, Bruno

    1997-01-01

    Purpose: To evaluate the accuracy of three methods, anatomy (A), palpation (P) and ultrasounds (US) in localizing the clinical target volume (CTV) in patients (pts) with early breast cancer (EBC) undergoing breast external irradiation as part of conservation therapy. Material and methods: One hundred consecutive pts with EBC (T is 1%, T 1 78%, T 2 21%, N- 68%, N+ 32%), treated with conservation surgery and breast irradiation with opposed tangential portals, were prospectively analyzed. Anatomically, palpatory or ultrasound defined field borders for CTV localizations were determined in the same position thanks to the utilization of a vacuum-formed cellulose acetate immobilization cast, removed during CTV definitions. Results: P and US CTV localizations have been found to coincide on the four margins (superior, inferior, medial, lateral) in only(1(100)) pts, while no pt showed identical A and US CTV localizations. Only (31(397)) (8%) field measurements with A, and(98(395)) (25%) with P corresponded to US border definition. If mean and median values of each field border were considered, the CTV was generally over-estimated with P appearing more accurate than A in a gross definition of the target (P < 0.01). However, a geographical miss of at least one field border of CTV occurred in 55% of pts with A and in 36% of pts with P. The most critical margin to be defined with conventional methods was the superior one: an underestimation of the cranial border of CTV with A was observed in 51% and with P in 22% of pts (22% and 8%, respectively, when an underestimation by more than 1.5 cm was considered). When pre-menopausal and peri/post-menopausal groups of pts were separately analyzed, conventional methods were highly inaccurate to define the superior border in younger pts, in which a geographical miss was noted with A in 62% and with P in 35% of cases (P < 0.05). When an underestimation of more than 1.5 cm was evaluated, these values were reduced to 33% and 12

  6. Effect of altitude on biochemical composition and quality of green arabica coffee beans can be affected by shade and postharvest processing method.

    Science.gov (United States)

    Worku, Mohammed; de Meulenaer, Bruno; Duchateau, Luc; Boeckx, Pascal

    2018-03-01

    Although various studies have assessed altitude, shade and postharvest processing effects on biochemical content and quality of coffee beans, data on their interactions are scarce. The individual and interactive effects of these factors on the caffeine, chlorogenic acids (CGA) and sucrose contents as well as physical and sensory qualities of green coffee beans from large plantations in southwestern Ethiopia were evaluated. Caffeine and CGA contents decreased with increasing altitude; they respectively declined 0.12 and 1.23gkg -1 100m -1 . Sucrose content increased with altitude; however, the altitude effect was significant for wet-processed beans (3.02gkg -1 100m -1 ), but not for dry-processed beans (0.36g kg -1 100m -1 ). Similarly, sucrose content increased with altitude with much stronger effect for coffee grown without shade (2.11gkg -1 100m -1 ) compared to coffee grown under shade (0.93gkg -1 100m -1 ). Acidity increased with altitude when coffee was grown under shade (0.22 points 100m -1 ), but no significant altitude effect was observed on coffee grown without shade. Beans grown without shade showed a higher physical quality score for dry (37.2) than for wet processing (29.1). These results generally underline the complex interaction effects between altitude and shade or postharvest processing on biochemical composition and quality of green arabica coffee beans. Copyright © 2017. Published by Elsevier Ltd.

  7. Development of next generation code system as an engineering modeling language (5). Investigation on restructuring method of conventional codes into two-layer system

    International Nuclear Information System (INIS)

    Yokoyama, Kenji

    2006-10-01

    A proposed method for gradually restructuring to the two-level system of next generation analysis system by reusing the conventional analysis system, called 'incremental method', was applied and evaluated. The following functions were selected for the evaluation: Neutron diffusion calculation for the three-dimensional XYZ system based on finite differential method, and input utilities of the cross-section data file used in the conventional system. In order to evaluate the effect of the restructuring, 'Module Coupling Index (MCI)' and 'McCabe's Cyclomatic Complexity (MCC)' were used for quantifying the quality of the modular design and the complexity of the program sequence of each module. Although MCIs of each module before restructuring were mainly 6 - 7 degrees, it was possible to reduce them to under 4 degrees in most module by restructuring with the incremental method. And, it is found that the modules under 4 degrees of MCI can be easily combined with different programming languages, which are necessary for building the two-layer system. In the meantime, MCCs in most module before restructuring were over 20 and some were over 50. The incremental method could reduce them to under 10 when C++ was used, and reduce them to under 20 when FORTRAN was used. It is correspondent to reduction of the error frequency occurred in its modification from 20 - 40% to 5 - 10%. The total number of MCC could be reduced to 1/3 when C++ was used, and to 1/2 when FORTRAN was used. By using the restructured functions in the present study and some previously developed functions, a reactor analysis tool was systematized and applied to criticality analysis of the Experimental Fast Reactor 'JOYO' MR-I. In addition, the following two functionality expansion tests were performed: To add cross section direct perturbation functionality, and to add control rod criticality position search functionality. In the tests, both the functionality expansions were carried out satisfying the condition

  8. On-line high-performance liquid chromatography-ultraviolet-nuclear magnetic resonance method of the markers of nerve agents for verification of the Chemical Weapons Convention.

    Science.gov (United States)

    Mazumder, Avik; Gupta, Hemendra K; Garg, Prabhat; Jain, Rajeev; Dubey, Devendra K

    2009-07-03

    This paper details an on-flow liquid chromatography-ultraviolet-nuclear magnetic resonance (LC-UV-NMR) method for the retrospective detection and identification of alkyl alkylphosphonic acids (AAPAs) and alkylphosphonic acids (APAs), the markers of the toxic nerve agents for verification of the Chemical Weapons Convention (CWC). Initially, the LC-UV-NMR parameters were optimized for benzyl derivatives of the APAs and AAPAs. The optimized parameters include stationary phase C(18), mobile phase methanol:water 78:22 (v/v), UV detection at 268nm and (1)H NMR acquisition conditions. The protocol described herein allowed the detection of analytes through acquisition of high quality NMR spectra from the aqueous solution of the APAs and AAPAs with high concentrations of interfering background chemicals which have been removed by preceding sample preparation. The reported standard deviation for the quantification is related to the UV detector which showed relative standard deviations (RSDs) for quantification within +/-1.1%, while lower limit of detection upto 16mug (in mug absolute) for the NMR detector. Finally the developed LC-UV-NMR method was applied to identify the APAs and AAPAs in real water samples, consequent to solid phase extraction and derivatization. The method is fast (total experiment time approximately 2h), sensitive, rugged and efficient.

  9. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Directory of Open Access Journals (Sweden)

    Martin Boeker

    Full Text Available BACKGROUND: When compared with more traditional instructional methods, Game-based e-learning (GbEl promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. OBJECTIVES: To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. METHODS: A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group and 69 subjects for conventional training with a written script-based approach (script group. Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. RESULTS: The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis. Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. CONCLUSIONS: Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on

  10. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Marijke [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Open University Netherlands, Heerlen (Netherlands); Reijnders, Lucas [Open University Netherlands, Heerlen (Netherlands); Oost, Nathalie R. van [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Peijnenburg, Willie J.G.M. [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: wjgm.peijnenburg@rivm.nl

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl{sub 2} and 0.43 M HNO{sub 3}, digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl{sub 2} correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl{sub 2}. A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C{sub E} (effective concentration) measured by a DGT-device, CaCl{sub 2} extracted zinc and the zinc content in the pore water of all soils. The correlation with C{sub E} was not significant for lupine, neither for spiked soils, nor for field soils (p {<=} 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods.

  11. The effect of restricted milk feeding through conventional or step-down methods with or without forage provision in starter feed on performance of Holstein bull calves.

    Science.gov (United States)

    Daneshvar, D; Khorvash, M; Ghasemi, E; Mahdavi, A H; Moshiri, B; Mirzaei, M; Pezeshki, A; Ghaffari, M H

    2015-08-01

    The objective of the current study was to examine whether step-down (STP) milk feeding method together with forage provision would improve performance, rumen fermentation, nutrient digestibility, blood metabolites, and structural growth of calves. Holstein bull calves ( = 40) were randomly assigned to 1 of 4 treatments in a completely randomized design with a 2 × 2 factorial arrangement. Treatments were 1) conventional (COV) milk feeding without forage provision (COV-NF), 2) COV milk feeding with forage provision, 3) STP milk feeding without forage provision, and 4) STP milk feeding with forage provision. Calves in the COV method ( = 20) received 5.5 L/d milk until d 56 of age followed by 2 L/d milk from d 56 to 59 of age. Calves in the STP method ( = 20) received 7 L/d milk until d 35, 4 L/d milk from d 35 to 48, and 2 L/d milk from d 50 to 59 of age. All the calves received the starter ration from d 3 of the study until d 74 of age. Forage-supplemented calves ( = 10/milk feeding method) received 15% alfalfa hay mixed with finely ground starter as a total mixed ration. All calves were weaned on d 60 of age and remained in the study until d 74. Regardless of the milk feeding method, the final BW (92.54 vs. 83.14 kg/d), starter intake (0.90 vs. 0.65 kg/d), total DMI (1.43 vs. 1.17 kg/d), and ADG (0.73 vs. 0.60 kg/d) were greater ( calves than those that received no forage during the preweaning, postweaning, and overall periods. Milk feeding method had no effect on ruminal pH, total VFA, acetate, or acetate:propionate ratio as well as body measurements. Ruminal pH and the molar proportions of acetate were greater ( calves than those that received no forage during the pre- and postweaning periods. Regardless of forage provision, STP methods increased ( feeding methods and forage provision with respect to BW, DMI, G:F, apparent nutrient digestibility (DM, OM, and CP), and body measurements. The interaction of milk feeding method and forage provision was significant

  12. Bacteriemia por Campylobacter fetus aislado mediante métodos convencionales de una paciente inmunocomprometida Bacteremia due to Campylobacter fetus isolated by conventional methods from an immunocompromised patient

    Directory of Open Access Journals (Sweden)

    G. Epifane

    2007-03-01

    her pancytopenia.Thirteen days later she developed high-grade fever. Samples were taken for blood and urine cultures and antibiotic treatment with clindamycin and ciprofloxacin was instituted. Blood culture bottles were subcultivated at 48 hours in chocolate agar. After 24 hours of incubation at 35 °C in a 5% CO2 atmosphere (candle jars, tiny colonies developed. Gram stain showed spiral-shaped gram-negative rods in both samples. The strain was identified as Campylobacter fetus by conventional biochemical tests. The antibiotic therapy was switched to clindamycin and gentamicin. The patient evolved favorably with negative blood cultures after a 5 day- treatment.

  13. Quantification of incisal tooth wear in upper anterior teeth: conventional vs new method using toolmakers microscope and a three-dimensional measuring technique.

    Science.gov (United States)

    Al-Omiri, Mahmoud K; Sghaireen, Mohd G; Alzarea, Bader K; Lynch, Edward

    2013-12-01

    This study aimed to quantify tooth wear in upper anterior teeth using a new CAD-CAM Laser scanning machine, tool maker microscope and conventional tooth wear index. Fifty participants (25 males and 25 females, mean age = 25 ± 4 years) were assessed for incisal tooth wear of upper anterior teeth using Smith and Knight clinical tooth wear index (TWI) on two occasions, the study baseline and 1 year later. Stone dies for each tooth were prepared and scanned using the CAD-CAM Laser Cercon System. Scanned images were printed and examined under a toolmaker microscope to quantify tooth wear and then the dies were directly assessed under the microscope to measure tooth wear. The Wilcoxon Signed Ranks Test was used to analyze the data. TWI scores for incisal edges were 0-3 and were similar at both occasions. Score 4 was not detected. Wear values measured by directly assessing the dies under the toolmaker microscope (range = 113 - 150 μm, mean = 130 ± 20 μm) were significantly more than those measured from Cercon Digital Machine images (range=52-80 μm, mean = 68 ± 23 μm) and both showed significant differences between the two occasions. Wear progression in upper anterior teeth was effectively detected by directly measuring the dies or the images of dies under toolmaker microscope. Measuring the dies of worn dentition directly under tool maker microscope enabled detection of wear progression more accurately than measuring die images obtained with Cercon Digital Machine. Conventional method was the least sensitive for tooth wear quantification and was unable to identify wear progression in most cases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Science.gov (United States)

    Boeker, Martin; Andel, Peter; Vach, Werner; Frankenschmidt, Alexander

    2013-01-01

    When compared with more traditional instructional methods, Game-based e-learning (GbEl) promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl) instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group) and 69 subjects for conventional training with a written script-based approach (script group). Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis). Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on learning. Game-based e-learning can be used as an effective teaching

  15. Measures of Biochemical Sociology

    Science.gov (United States)

    Snell, Joel; Marsh, Mitchell

    2008-01-01

    In a previous article, the authors introduced a new sub field in sociology that we labeled "biochemical sociology." We introduced the definition of a sociology that encompasses sociological measures, psychological measures, and biological indicators Snell & Marsh (2003). In this article, we want to demonstrate a research strategy that would assess…

  16. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik [Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Suh, Jin Suck; Kim, Ah Hyun [Dept. of Radiology and Research Institute of Radiological Science, Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Ryu, Jeong Ah [Dept. of Radiology, Guri Hospital, Hanyang University College of Medicine, Guri (Korea, Republic of); Park, Jeong Seon [Dept. of Radiology, Hanyang University Hospital, Hanyang University College of Medicine, Seoul (Korea, Republic of)

    2012-09-15

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  17. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    International Nuclear Information System (INIS)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik; Suh, Jin Suck; Kim, Ah Hyun; Ryu, Jeong Ah; Park, Jeong Seon

    2012-01-01

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  18. Comparisons between conventional, ultrasound-assisted and microwave-assisted methods for extraction of anthraquinones from Heterophyllaea pustulata Hook f. (Rubiaceae).

    Science.gov (United States)

    Barrera Vázquez, M F; Comini, L R; Martini, R E; Núñez Montoya, S C; Bottini, S; Cabrera, J L

    2014-03-01

    This work reports a comparative study about extraction methods used to obtain anthraquinones (AQs) from stems and leaves of Heterophyllae pustulata Hook (Rubiáceae). One of the conventional procedures used to extract these metabolites from a vegetable matrix is by successive Soxhlet extractions with solvents of increasing polarity: starting with hexane to eliminate chlorophylls and fatty components, following by benzene and finally ethyl acetate. However, this technique shows a low extraction yield of total AQs, and consumes large quantities of solvent and time. Ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE) have been investigated as alternative methods to extract these compounds, using the same sequence of solvents. It was found that UAE increases the extraction yield of total AQs and reduces the time and amount of solvent used. Nevertheless, the combination UAE with benzene, plus MAE with ethyl acetate at a constant power of 900 W showed the best results. A higher yield of total AQs was obtained in less time and using the same amount of solvent that UAE. The optimal conditions for this latter procedure were UAE with benzene at 50 °C during 60 min, followed by MAE at 900 W during 15 min using ethyl acetate as extraction solvent. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Comparative analysis of the toxic effects of natural toxins and harmful substances produced by conventional processing methods or by irradiation and of toxicity tests

    International Nuclear Information System (INIS)

    Dahlhelm, H.; Arndt, K.; Groeger, G.; Schreiber, G.A.; Boegl, K.W.

    1994-01-01

    In this review, tasks and methods of food toxicology as well as the application of the different toxicity tests for the risk assessment of food ingredients are described. Particular reference is made to short-term genotoxicity tests. Enzymatic digestion and extraction methods for complex foodstuffs which are used in the toxicological testing of foods in in vitro systems are described. Radiolytic products which result from irradiation of foods or components of foodstuffs and corresponding results of toxicity testing are reviewed. Foodstuffs irradiated with doses of up to 10 kGy are regarded as toxicologically safe. A survey of the toxicologically tested irradiated foodstuffs as well as the applied maximum doses are given in tables at the end of chapter 8. Among the great number of toxicological studies of irradiated foods those are especially mentioned which have given rise to discussions on the health risks involved. In addition, the difficulties associated with the testing of toxicity of irradiated foodstuffs in feeding experiments are discussed. Short-term tests used to establish the benotoxicity of irradiated foods and essential results of toxicological testing are also presented in tables. An overview is given of the occurrence, frequency and health risks of natural toxins in foods and harmful substances produced by conventional methods of cooking and preservation, in order to enable a comparison with the health risks of irradiated foods. The relevance of animal experiments and in vitro investigations for the prediction of toxic effects of harmful substances of foodstuffs in man is discussed in the final chapter. (VHE) [de

  20. RMBNToolbox: random models for biochemical networks

    Directory of Open Access Journals (Sweden)

    Niemi Jari

    2007-05-01

    Full Text Available Abstract Background There is an increasing interest to model biochemical and cell biological networks, as well as to the computational analysis of these models. The development of analysis methodologies and related software is rapid in the field. However, the number of available models is still relatively small and the model sizes remain limited. The lack of kinetic information is usually the limiting factor for the construction of detailed simulation models. Results We present a computational toolbox for generating random biochemical network models which mimic real biochemical networks. The toolbox is called Random Models for Biochemical Networks. The toolbox works in the Matlab environment, and it makes it possible to generate various network structures, stoichiometries, kinetic laws for reactions, and parameters therein. The generation can be based on statistical rules and distributions, and more detailed information of real biochemical networks can be used in situations where it is known. The toolbox can be easily extended. The resulting network models can be exported in the format of Systems Biology Markup Language. Conclusion While more information is accumulating on biochemical networks, random networks can be used as an intermediate step towards their better understanding. Random networks make it possible to study the effects of various network characteristics to the overall behavior of the network. Moreover, the construction of artificial network models provides the ground truth data needed in the validation of various computational methods in the fields of parameter estimation and data analysis.

  1. On the Adaptive Design Rules of Biochemical Networks in Evolution

    Directory of Open Access Journals (Sweden)

    Bor-Sen Chen

    2007-01-01

    Full Text Available Biochemical networks are the backbones of physiological systems of organisms. Therefore, a biochemical network should be sufficiently robust (not sensitive to tolerate genetic mutations and environmental changes in the evolutionary process. In this study, based on the robustness and sensitivity criteria of biochemical networks, the adaptive design rules are developed for natural selection in the evolutionary process. This will provide insights into the robust adaptive mechanism of biochemical networks in the evolutionary process. We find that if a mutated biochemical network satisfies the robustness and sensitivity criteria of natural selection, there is a high probability for the biochemical network to prevail during natural selection in the evolutionary process. Since there are various mutated biochemical networks that can satisfy these criteria but have some differences in phenotype, the biochemical networks increase their diversities in the evolutionary process. The robustness of a biochemical network enables co-option so that new phenotypes can be generated in evolution. The proposed robust adaptive design rules of natural selection gain much insight into the evolutionary mechanism and provide a systematic robust biochemical circuit design method of biochemical networks for biotechnological and therapeutic purposes in the future.

  2. The use of hogdahl convention k0 neutron activation analysis (NAA) standardization method and atomic absortion spectroscopy (ASS) for determination of toxic elements in foodstuffs

    International Nuclear Information System (INIS)

    Ahiamadie, H.

    2008-06-01

    Copper, cadmium, tin, chromium, arsenic, antimony, vanadium and mercury contents were determined in various foodstuffs (Mussa paradisiaca (plantains), Manihot esculentus (cassavas), Vantosoma sagittifolium (cocoyam). Vantosoma sagittifolium leaves (kontomire), Lycopersicum esculentus (tomatoes), Capsicum species (peppers), Solanum melongena (garden eggs), Nbelmoschus esculentus (okro), and Colocasia esculenta (kooko or taro)) produced in the Wassa West District, Ghana. These plants are the basis of human nutrition in the study area. These elements were determined using Hogdahl convention k 0 Instrumental Neutron Activation Analysis (NAA) Standardization Method and Atomic Absorption Spectroscopy (AAS). The elements in the various foodstuffs and their concentration ranges were Cu (16.87-180.06) mg/kg, As (2.68-9.84) µg/g, Cd (0.63-5.64) µg/g, Hg (0.01-67) ng/g, Cr (0.03-3.66) µg/g, Sb (1.1- 18.6) ng/g, Sn (3.4-58.4) ng/g, and V (12-99) ng/g. The study showed that there are high levels of toxic elements in the foodstuffs grown in the mining areas as compared to that of the non-mining area (i.e., control area). This could be attributed to gold mines pollution. Compared to the World Health Organization (WHO) permissible levels of toxic elements in foods, Cu, Cr and Hg were above the permissible levels whereas the concentrations of As, Cd. Sb, Sn and V fall within the permissible levels. (au)

  3. Evaluation of conventional therapeutic methods versus maggot therapy in the evolution of healing of tegumental injuries in Wistar rats with and without diabetes mellitus.

    Science.gov (United States)

    Masiero, Franciéle Souza; Thyssen, Patricia Jacqueline

    2016-06-01

    Larval therapy consists on the application of sterilized carrion flies larvae, reared in laboratory, on acute, chronic, and/or infected wounds in order to promote healing. Conventional methods for treating injuries include mechanical debridement or silver-based dressings; however, they are not always effective for wound healing. Larval therapy is a feasible and safe treatment for therapeutic application and, in many cases, the only and the most recommended alternative for difficult healing injuries. Thus, this study aimed to evaluate the competence of Cochliomyia macellaria F. (Diptera: Calliphoridae) as a suitable species for therapeutic application and evaluate time and effectiveness of the types of treatments most commonly used to treat integumental injuries. C. macellaria eggs were obtained from colonies established in laboratory and sterilized prior to application. Twenty-five larvae were applied for each centimeter squared of lesion. Lesions were induced in 24 Wistar rats; type 1 diabetes mellitus was induced in 12 of them. Animals were divided in four groups with three individuals each, being denominated: larval therapy, larval therapy associated with foam dressing with silver release, mechanical debridement with foam dressing silver and control group, without treatment. All treatments were applied once and held for 24 h. Medical application of larvae was found to be safe, as only dead tissue was removed, and efficient to accelerate healing process when compared to other treatments.

  4. Discerning Silk Produced by Bombyx mori from Those Produced by Wild Species Using an Enzyme-Linked Immunosorbent Assay Combined with Conventional Methods.

    Science.gov (United States)

    You, Qiushi; Li, Qingqing; Zheng, Hailing; Hu, Zhiwen; Zhou, Yang; Wang, Bing

    2017-09-06

    Recently, much interest has been paid to the separation of silk produced by Bombyx mori from silk produced by other species and tracing the beginnings of silk cultivation from wild silk exploitation. In this paper, significant differences between silks from Bombyx mori and other species were found by microscopy and spectroscopy, such as morphology, secondary structure, and amino acid composition. For further accurate identification, a diagnostic antibody was designed by comparing the peptide sequences of silks produced by Bombyx mori and other species. The results of the noncompetitive indirect enzyme-linked immunosorbent assay (ELISA) indicated that the antibody that showed good sensitivity and high specificity can definitely discern silk produced by Bombyx mori from silk produced by wild species. Thus, the antibody-based immunoassay has the potential to be a powerful tool for tracing the beginnings of silk cultivation. In addition, combining the sensitive, specific, and convenient ELISA technology with other conventional methods can provide more in-depth and accurate information for species identification.

  5. Evaluation of the effect of salts on chemical, structural, textural, sensory and heating properties of cheese: Contribution of conventional methods and spectral ones.

    Science.gov (United States)

    Loudiyi, M; Aït-Kaddour, A

    2018-03-21

    Chemical composition, sensory characteristics, textural and functional properties are among the most important characteristics, which directly relates to the global quality of cheese and to consumer acceptability. A number of factors including milk composition, processing conditions and salt content, influences these properties. The past decades many investigations were performed on the possibilities to reduce salt content of cheese due to its adverse health effects, the current lifestyle and the awareness of the consumers for nutrition quality products. Due to the multiple potential effects of reducing NaCl (simple reduction or substitution) on cheese attributes, it is of utmost importance to identify and understand those effects in order to control the global quality and safety of the final product. In the present review a collection of the different results and conclusions drawn after studying the effect of salts by conventional (e.g. wet chemistry) and instrumental (e.g. spectral) methods on chemical, structural, textural, sensory and heating properties of cheese are presented.

  6. Biochemical changes during aging of soybean seed

    Directory of Open Access Journals (Sweden)

    Balešević-Tubić Svetlana

    2009-01-01

    Full Text Available Biochemical changes that occur in the seed as a result of ageing are very significant for seed quality and longevity. Because of its characteristic composition, processes occurring in the seed of oil crops during storage will be typical as well. Six soybean varieties developed in Institute of field and vegetable crops Novi Sad, submitted to accelerated and natural aging, under controlled and conventional storage conditions were used in these trials. The content of malondialdehyde, superoxide dismutase and peroxidase activities were studied. The biochemical processes i.e. lipid peroxidation, as well as the decrease in supeoxide dismutase and peroxidase activities (especially pronounced by applied accelerated aging were caused by both type of aging. The degree of seed damage and the ability of seed to resist the negative consequences of aging were influenced, beside duration of aging period, by type of storage and characteristics of soybean varieties. .

  7. Optical Slot-Waveguide Based Biochemical Sensors

    Directory of Open Access Journals (Sweden)

    Carlos Angulo Barrios

    2009-06-01

    Full Text Available Slot-waveguides allow light to be guided and strongly confined inside a nanometer-scale region of low refractive index. Thus stronger light-analyte interaction can be obtained as compared to that achievable by a conventional waveguide, in which the propagating beam is confined to the high-refractive-index core of the waveguide. In addition, slot-waveguides can be fabricated by employing CMOS compatible materials and technology, enabling miniaturization, integration with electronic, photonic and fluidic components in a chip, and mass production. These advantages have made the use of slot-waveguides for highly sensitive biochemical optical integrated sensors an emerging field. In this paper, recent achievements in slot-waveguide based biochemical sensing will be reviewed. These include slot-waveguide ring resonator based refractometric label-free biosensors, label-based optical sensing, and nano-opto-mechanical sensors.

  8. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

    Science.gov (United States)

    Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

    2014-03-07

    The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

  9. Are the Conventional Commercial Yeast Identification Methods Still Helpful in the Era of New Clinical Microbiology Diagnostics? A Meta-Analysis of Their Accuracy.

    Science.gov (United States)

    Posteraro, Brunella; Efremov, Ljupcho; Leoncini, Emanuele; Amore, Rosarita; Posteraro, Patrizia; Ricciardi, Walter; Sanguinetti, Maurizio

    2015-08-01

    Accurate identification of pathogenic species is important for early appropriate patient management, but growing diversity of infectious species/strains makes the identification of clinical yeasts increasingly difficult. Among conventional methods that are commercially available, the API ID32C, AuxaColor, and Vitek 2 systems are currently the most used systems in routine clinical microbiology. We performed a systematic review and meta-analysis to estimate and to compare the accuracy of the three systems, in order to assess whether they are still of value for the species-level identification of medically relevant yeasts. After adopting rigorous selection criteria, we included 26 published studies involving Candida and non-Candida yeasts that were tested with the API ID32C (674 isolates), AuxaColor (1,740 isolates), and Vitek 2 (2,853 isolates) systems. The random-effects pooled identification ratios at the species level were 0.89 (95% confidence interval [CI], 0.80 to 0.95) for the API ID32C system, 0.89 (95% CI, 0.83 to 0.93) for the AuxaColor system, and 0.93 (95% CI, 0.89 to 0.96) for the Vitek 2 system (P for heterogeneity, 0.255). Overall, the accuracy of studies using phenotypic analysis-based comparison methods was comparable to that of studies using molecular analysis-based comparison methods. Subanalysis of studies conducted on Candida yeasts showed that the Vitek 2 system was significantly more accurate (pooled ratio, 0.94 [95% CI, 0.85 to 0.99]) than the API ID32C system (pooled ratio, 0.84 [95% CI, 0.61 to 0.99]) and the AuxaColor system (pooled ratio, 0.76 [95% CI, 0.67 to 0.84]) with respect to uncommon species (P for heterogeneity, 0.05). Nonetheless, clinical microbiologists should reconsider the usefulness of these systems, particularly in light of new diagnostic tools such as matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, which allow for considerably shortened turnaround times and/or avoid the requirement

  10. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Science.gov (United States)

    Chao, Qiao-Ting; Lee, Tai-Fen; Teng, Shih-Hua; Peng, Li-Yun; Chen, Ping-Hung; Teng, Lee-Jene; Hsueh, Po-Ren

    2014-01-01

    We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) systems (Bruker Biotyper and Vitek MS) and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID) with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex) levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database), Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar) systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis) were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD) system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD) system, 39 (43.8%), including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5%) by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati) isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii complex

  11. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Directory of Open Access Journals (Sweden)

    Qiao-Ting Chao

    Full Text Available We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS systems (Bruker Biotyper and Vitek MS and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database, Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD system, 39 (43.8%, including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5% by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii

  12. All-Optical Method to Assess Stromal Concentration of Riboflavin in Conventional and Accelerated UV-A Irradiation of the Human Cornea.

    Science.gov (United States)

    Lombardo, Giuseppe; Micali, Norberto Liborio; Villari, Valentina; Serrao, Sebastiano; Lombardo, Marco

    2016-02-01

    We investigated the concentration of riboflavin in human donor corneas during corneal cross-linking using two-photon optical microscopy and spectrophotometry. Eight corneal tissues were de-epithelialized and soaked with 20% dextran-enriched 0.1% riboflavin solution for 30 minutes. After stromal soaking, three tissues were irradiated using a 3 mW/cm2 UV-A device for 30 minutes and three tissues irradiated using a 10 mW/cm2 device for 9 minutes. Two additional tissues were used as positive controls. A Ti:sapphire laser at 810 nm was used to perform two-photon emission fluorescence (TPEF) and second harmonic generation axial scanning measurements in all specimens before and after stromal soaking and after UV-A irradiation. In addition, spectrophotometry was used to collect the absorbance spectra of each tissue at the same time intervals. Analysis of the absorbance spectra and TPEF signals provided measures of the concentration depth profile of riboflavin in corneal stroma. After stromal soaking, the average peak concentration of riboflavin (0.020% ± 0.001%) was found between a stromal depth of 100 and 250 μm; the concentration of riboflavin was almost constant up to 320 ± 53 μm depth, then decreased toward the endothelium, though riboflavin was still enriched in the posterior stroma (0.016%% ± 0.001%). After conventional and accelerated UV-A irradiation, the concentration of riboflavin decreased uniformly 87% ± 2% and 67% ± 3% (P riboflavin in corneal stroma. The method can assist with the assessment of novel riboflavin formulations and different UV-A irradiation protocols.

  13. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  14. Quantitative proteomics by 2DE and MALDI MS/MS uncover the effects of organic and conventional cropping methods on vegetable products

    DEFF Research Database (Denmark)

    Nawrocki, Arkadiusz; Thorup-Kristensen, Kristian; Jensen, Ole Nørregaard

    2011-01-01

    overexpressed in conventionally grown cabbage. Proteins involved in metabolism of carbohydrates, polypeptides and secondary metabolites were affected by different cropping regimes in carrots. The proteomes of conventionally grown vegetables varied from organically grown vegetables to a larger extent than...... of slurry, in accordance to regulations of organic farming and O2, in which nutrient supply was based mainly on autumn green manures. Proteins were extracted from lyophilized plant tissues into a buffer containing high concentrations of urea/thiourea, two detergents and reducing agent. This approach allowed...... short handling times of fresh plant materials. In the case of cabbage samples, the abundance levels of 58 out of more than 1300 quantified protein spots varied significantly between conventional farming and any of the organic cropping systems. Proteome profiles were also very similar between carrot root...

  15. Study of two novel large-field-of-view image intensifiers versus conventional chest radiography with use of FROC methods and simulated pulmonary nodules

    International Nuclear Information System (INIS)

    Winter, L.H.L.; Chakraborty, D.P.; Van Waes, P.F.G.M.; Puylaert, C.B.A.J.

    1989-01-01

    Two novel large-field-of-view image intensifier (LFOV 1.1) tubes have been introduced whose image area makes them suitable for chest imaging. Both modalities present a 100-mm hard-copy image to the radiologist. A pulmonary nodule performance experiment was done to compare the diagnostic accuracy of these tubes with conventional full-size chest images. The data were analyzed with the maximum-likelihood FROCFIT program. The relative ranking in terms of decreasing A1 values was TLX, Siemens 43-cm mode, conventional radiography, and Siemens 57-cm mode

  16. an improved solution of first order kinetics for biochemical oxygen ...

    African Journals Online (AJOL)

    DELL

    Accuracies of these methods were evaluated using relative error, Akaike ... Keywords: Wastewater, Environmental Engineering, Biochemical Oxygen Demand Kinetic Parameters,. Statistical ... evaluating organic pollution level and quality of wastewaters. ... compounds ...... method can be applied on electronic devices, and.

  17. Opportunities for utilization of non-conventional energy sources for biomass pretreatment.

    Science.gov (United States)

    Singh, Rawel; Krishna, Bhavya B; Kumar, Jitendra; Bhaskar, Thallada

    2016-01-01

    The increasing concerns over the depletion of fossil resources and its associated geo-political issues have driven the entire world to move toward sustainable forms of energy. Pretreatment is the first step in any biochemical conversion process for the production of valuable fuels/chemicals from lignocellulosic biomass to eliminate the lignin and produce fermentable sugars by hydrolysis. Conventional techniques have several limitations which can be addressed by using them in tandem with non-conventional methods for biomass pretreatment. Electron beam and γ (gamma)-irradiation, microwave and ultrasound energies have certain advantages over conventional source of energy and there is an opportunity that these energies can be exploited for biomass pretreatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    Directory of Open Access Journals (Sweden)

    Meng-Ting Huang

    2015-02-01

    Conclusion: The percentages of DNA intact spermatozoa between the PVP-sperm and HA-sperm groups were not significantly different. In an ICSI procedure, a well-trained embryologist will have the same ability to choose sperm with intact DNA by conventional microscopic selection as with HA-bound spermatozoa selection.

  19. Multi-method comparison of carrot quality from a conventional and three organic cropping systems with increasing levels of nutrient recycling

    DEFF Research Database (Denmark)

    Paoletti, Flavio; Raffo´, Antonio; Kristensen, Hanne Lakkenborg

    2012-01-01

    BACKGROUND: There is a need to advance the study of the effects of organic and conventional systems on product quality. In particular, little is known about the importance of different farming practices concerning nutrient cycling and the use of external inputs within organic farming for the qual...

  20. Chemical Weapons Convention

    National Research Council Canada - National Science Library

    1997-01-01

    On April 29, 1997, the Convention on the Prohibition of the Development, Production, Stockpiling, and Use of Chemical Weapons and on Their Destruction, known as the Chemical Weapons Convention (CWC...

  1. An improved solution of first order kinetics for biochemical oxygen ...

    African Journals Online (AJOL)

    This paper evaluated selected Biochemical Oxygen Demand first order kinetics methods. Domesticinstitutional wastewaters were collected twice in a month for three months from the Obafemi Awolowo University, Ile-Ife waste stabilization ponds. Biochemical Oxygen Demand concentrations at different days were determined ...

  2. The Hague Judgments Convention

    DEFF Research Database (Denmark)

    Nielsen, Peter Arnt

    2011-01-01

    The Hague Judgments Convention of 2005 is the first global convention on international jurisdiction and recognition and enforcement of judgments in civil and commercial matters. The author explains the political and legal background of the Convention, its content and certain crucial issues during...

  3. Ultrasound-assisted phase-transfer catalysis method in an aqueous medium to promote the Knoevenagel reaction: advantages over the conventional and microwave-assisted solvent-free/catalyst-free method.

    Science.gov (United States)

    De-la-Torre, Pedro; Osorio, Edison; Alzate-Morales, Jans H; Caballero, Julio; Trilleras, Jorge; Astudillo-Saavedra, Luis; Brito, Iván; Cárdenas, Alejandro; Quiroga, Jairo; Gutiérrez, Margarita

    2014-09-01

    Given the broad spectrum of uses of acrylonitrile derivatives as fluorescent probes, AChE inhibitors, and others, it is necessary to find easy, efficient and simple methods to synthesize and diversify these compounds. We report the results of a comparative study of the effects of three techniques on the reactions between heterocyclic aldehydes and 2-(benzo[d]thiazol-2-yl)acetonitrile: stirring; ultrasound coupled to PTC conditions (US-PTC); and MW irradiation (MWI) under solvent and catalyst-free conditions. The effects of conditions on reaction parameters were evaluated and compared in terms of reaction time, yield, purity and outcomes. The US-PTC method is more efficient than the MWI and conventional methods. The reaction times were considerably shorter, with high yields (>90%) and good levels of purity. In addition, X-ray diffraction analysis and quantum mechanical calculations, at the level of density functional theory (DFT), ratify obtaining acrylonitrile isomers with E configurations. The crystal structure of 3c is stabilized by weak C-Ho⋯N intermolecular interactions (Ho⋯NC=2.45 Å, Co⋯NC=3.348(3) Å, Ho⋯NC=162°), forming centrosymmetric ring R2(2) (20) along the crystallographic a axis. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Implantable biochemical fuel cell

    Energy Technology Data Exchange (ETDEWEB)

    Richter, G; Rao, J R

    1978-01-05

    Implantable biochemical fuel cells for the operation of heart pacemakers or artificial hearts convert oxidisable body substances such as glucose on the anode side and reduce the oxygen contained in body fluids at the cathode. The anode and cathode are separated by membranes which are impermeable to albumen and blood corpuscles in body fluids. A chemical shortcircuit cannot occur in practice if, according to the invention, one or more selective oxygen electrodes with carbon as catalyst are arranged so that the mixture which diffuses into the cell from body fluids during operation reaches the fuel cell electrode through the porous oxygen electrode. The membranes used must be permeable to water. Cellulose, polymerised polyvinyl alcohol or an ion exchanger with a buffering capacity between pH5 and 8 act as permeable materials.

  5. Synthesis of Biochemical Applications on Flow-Based Microfluidic Biochips using Constraint Programming

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2012-01-01

    Microfluidic biochips are replacing the conventional biochemical analyzers and are able to integrate the necessary functions for biochemical analysis on-chip. In this paper we are interested in flow-based biochips, in which the flow of liquid is manipulated using integrated microvalves. By combin...

  6. Preliminary report: prescription of prism-glasses by the Measurement and Correction Method of H.-J. Haase or by conventional orthoptic examination: a multicenter, randomized, double-blind, cross-over study

    NARCIS (Netherlands)

    Simonsz, H. J.; van Els, J.; Ruijter, J. M.; Bakker, D.; Spekreijse, H.

    2001-01-01

    In a multicenter, randomized, double-blind, cross-over study in the Netherlands, the effectiveness of (prism-)glasses prescribed by the Measurement and Correction Method of H.-J. Haase (MKH) was compared to that of glasses prescribed by conventional orthoptic examination. Nine pairs of

  7. Characterizing multistationarity regimes in biochemical reaction networks.

    Directory of Open Access Journals (Sweden)

    Irene Otero-Muras

    Full Text Available Switch like responses appear as common strategies in the regulation of cellular systems. Here we present a method to characterize bistable regimes in biochemical reaction networks that can be of use to both direct and reverse engineering of biological switches. In the design of a synthetic biological switch, it is important to study the capability for bistability of the underlying biochemical network structure. Chemical Reaction Network Theory (CRNT may help at this level to decide whether a given network has the capacity for multiple positive equilibria, based on their structural properties. However, in order to build a working switch, we also need to ensure that the bistability property is robust, by studying the conditions leading to the existence of two different steady states. In the reverse engineering of biological switches, knowledge collected about the bistable regimes of the underlying potential model structures can contribute at the model identification stage to a drastic reduction of the feasible region in the parameter space of search. In this work, we make use and extend previous results of the CRNT, aiming not only to discriminate whether a biochemical reaction network can exhibit multiple steady states, but also to determine the regions within the whole space of parameters capable of producing multistationarity. To that purpose we present and justify a condition on the parameters of biochemical networks for the appearance of multistationarity, and propose an efficient and reliable computational method to check its satisfaction through the parameter space.

  8. Effect of irradiation and storage post-irradiation of black pepper (Piper nigrum L.) on counts of microorganisms hygienic indicator using methods of conventional analysis and PETRIFILMTM plates

    International Nuclear Information System (INIS)

    Jaimes, Marcial Ibo Silva

    1988-01-01

    Fifteen samples of ground black pepper (Piper nigrum L.) purchased in Sao Paulo local stores, were submitted to irradiation in doses of 3, 6 and 10 kGy. All irradiated samples, including non-irradiated controls, were submitted to counts of yeasts and molds, aerobes (APC), coliforms and mesophilic aerobic spore formers (MASC), using conventional plate count methods and PETRIFILM TM plates. For yeasts and molds count, acidified potato dextrose agar (PDA) an PETRIFILM TM PFYM plates were used. For aerobes, plate count agar (PCA) and PETRIFILM TM PFAC plates were used. Violet red bile agar (VRBA) and PETRIFILM TM PFEC plates were employed for enumeration of coliforms. Counts of these groups of microorganisms obtained through the traditional plating procedures did not differ significantly from those using the corresponding PETRIFILM TM plates. In samples submitted to irradiation, a dose of 10 kGy caused a decrease of the yeasts and molds count from 10 4 -10 5 to less than 10 cfu/g. The same dose caused a decrease of the aerobic counts from 10 7 -10 8 to 10 2 -10 3 cfu/g, of coliforms from 10 4 -10 5 to less than 10 cfu/g and MASC from 10 6 -10 7 cfu/g to 10-10 2 cfu/g. The introduction of a injury repair step in the counting procedure resulted in a 32 to 89% increase in the number of coliforms. However, this additional step did not improve significantly the counts of MASC. After 270 days of storage of samples irradiated with 3 kGy, a decrease in the yeasts and molds population from 10 3 to 20 cfu/g was observed. The APC population in these samples was reduced from 5,0x10 6 to 2,4x10 4 cfu/g; in those irradiated with 6 kGy the reduction was from 4,0x10 4 to 5,0x10 3 cfu/g and in those irradiated with 10 kGy the counts were reduced from 30 to less than 10 cfu/g. After the same time of storage, the coliform population in non irradiated samples decreased from 2,8x10 5 to 1,5x10 4 cfu/g and from 9,1x10 3 to 20 cfu/g in those irradiated with 3 kGy. Similarly, the MASC

  9. Conventional imaging in paediatric uroradiology

    International Nuclear Information System (INIS)

    Riccabona, M.; Lindbichler, F.; Sinzig, M.

    2002-01-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options

  10. Conventional imaging in paediatric uroradiology

    Energy Technology Data Exchange (ETDEWEB)

    Riccabona, M. E-mail: michael.riccabona@kfunigraz.ac.at; Lindbichler, F.; Sinzig, M

    2002-08-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options.

  11. Synthesis and Biochemical effects of magnetite nanoparticle by surfactant-free electrochemical method in an aqueous system:the current density effect

    Directory of Open Access Journals (Sweden)

    Mousa Aliahmad

    2016-07-01

    Full Text Available Obejective(s: In this research, magnetite nanoparticles with an average size of 23-36 nm were successfully synthesized via surfactant-free electrochemical method using iron as the anode and water as the electrolyte in a closed aqueous system in the presence of NaOH at room temperature. Methods: The effect of the current density on product formation and particle size was investigated. Particle size was controlled by adjusting the current density. It was found that particle size decreases by decreasing the current density. In addition, the effect of current density  on the structural and optical properties of nanostructures were studied by X-ray diffraction, Field emission scanning electron microscopy, Fourier transformed infrared, and vibrating sample magnetometer techniques.  Results: The results obtained from the magnetization property study of samples at room temperature showed coactivity and saturation manetization of 0-100 Oe and 27.2- 40.5 emu. g-1, respectively. Finally, the results of biological activity study of nanoparticles on liver and kidney function in male wistar rats demonstrated that oral administration of NPs caused significant alterations to the levels of aspartate transaminase, alanine transaminase, and alkaline phosphatase in serum. Conclusions: No significant changes were detected in the groups treated with 10 and 100 ppm/ day nanostructure (P>0.05. There was a significant increase in the serum level of creatinine and blood urea nitrogen level (p

  12. Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods.

    Science.gov (United States)

    Santos, M C; Golt, C; Joerger, R D; Mechor, G D; Mourão, Gerson B; Kung, L

    2017-02-01

    The objective of this study was to identify species of yeasts in samples of high moisture corn (HMC) and corn silage (CS) collected from farms throughout the United States. Samples were plated and colonies were isolated for identification using DNA analysis. Randomly selected colonies were also identified by fatty acid methyl esters (FAME) and by physiological substrate profiling (ID 32C). For CS, Candida ethanolica, Saccharomyces bulderi, Pichia anomala, Kazachstania unispora, and Saccharomyces cerevisiae were the predominant yeasts. Pichia anomala, Issatchenkia orientalis, S. cerevisiae, and Pichia fermentans were the prevalent species in HMC. The 3 identification methods were in agreement at the species level for 16.6% of the isolates and showed no agreement for 25.7%. Agreement in species identification between ID 32C and DNA analysis, FAME and ID 32C, and FAME and DNA analysis was 41.1, 14.4, and 2.2%, respectively. Pichia anomala and I. orientalis were able to grow on lactic acid, whereas S. cerevisiae metabolized sugars (galactose, sucrose, and glucose) but failed to use lactic acid. The yeast diversity in CS and HMC varied due to type of feed and location. Differences in species assignments were seen among methods, but identification using substrate profiling generally corresponded with that based on DNA analysis. These findings provide information about the species that may be expected in silages, and this knowledge may lead to interventions that control unwanted yeasts. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Comparison of the protective roles of L-carnitine and amifostine against radiation-induced acute ovarian damage by histopathological and biochemical methods

    Directory of Open Access Journals (Sweden)

    Vuslat Yurut-Caloglu

    2015-01-01

    Full Text Available Purpose: The aim of this study was to compare the radioprotective efficacies of L-carnitine (LC and amifostine against radiation-induced acute ovarian damage. Materials and Methods: Forty-five, 3-month-old Wistar albino rats were randomly assigned to six groups. Control (CONT, n = 7; irradiation alone RT: radiation therapy (RT, n = 8; amifostine plus irradiation (AMI + RT, n = 8; LC plus irradiation (LC + RT, n = 8; LC and sham irradiation (LC, n = 7; and amifostine and sham irradiation (AMI, n = 7. The rats in the AMI + RT, LC + RT and RT groups were irradiated with a single dose of 20 Gy to the whole abdomen. LC (300 mg/kg and amifostine (200 mg/kg was given intraperitoneally 30 min before irradiation. Five days after irradiation, both antral follicles and corpus luteum in the right ovaries were counted, and tissue levels of malondialdehyde (MDA and advanced oxidation protein product (AOPP were measured. Results: Irradiation significantly decreased antral follicles and corpus luteum (P: 0.005 and P 0.05. The level of MDA and AOPP significantly increased after irradiation (P = 0.001 and P 0.005. The levels of both MDA and AOPP were also similar when LC + RT is compared with AMI + RT group (P > 0.005. Conclusions: L-carnitine and amifostine have a noteworthy and similar radioprotective effect against radiation-induced acute ovarian toxicity.

  14. Comparison of conventional liquid chromatography-tandem mass spectrometry versus microflow liquid chromatography-tandem mass spectrometry within the framework of full method validation for simultaneous quantification of 40 antidepressants and neuroleptics in whole blood.

    Science.gov (United States)

    Steuer, Andrea E; Poetzsch, Michael; Koenig, Magdalena; Tingelhoff, Eva; Staeheli, Sandra N; Roemmelt, Andreas T; Kraemer, Thomas

    2015-02-13

    Microflow liquid chromatography (MFLC) coupled to mass spectrometry (MS) is claimed to improve analysis throughput, reduce matrix effects and lower mobile phase consumption. This statement was checked within the framework of method validation of a multi-analyte procedure in clinical and forensic toxicology employing MFLC-MS/MS and conventional LC-MS/MS. 200 μL whole blood were spiked with 50 μL internal standard mixture and extracted by protein precipitation. The concentrated extract was separated into two vials. One was analyzed using a Thermo Fisher Ultimate liquid chromatography system coupled to an ABSciex 5500 QTrap mass spectrometer (LC-MS/MS) and one by an ABSciex Eksigent Microflow LC system coupled to an ABSciex 4500 linear ion trap quadrupole MS (MFLC-MS/MS). Both methods were fully validated and compared in terms of selectivity, stability, limits, calibration model, recovery (RE), matrix effects (ME), bias, imprecision and beta tolerance interval for 40 antidepressants and neuroleptics including 9 metabolites. Both methods had comparable LODs, LOQs and calibration models with some exceptions. The MFLC system showed slightly higher coefficients of variation (CVs) in the RE experiments. ME were reproducible in both systems but with lower CVs in the conventional LC system. Acceptance criteria for imprecision and bias were fulfilled for 32 analytes on the LC and for 28 analytes on the MFLC system. Beta tolerance intervals indicated better reproducibility in terms of narrower intervals for the conventional LC system. The advantages of the MFLC system were low mobile phase consumption, short run time, and better peak separation. The systems were comparable in terms of peak interference, LOD, ME, bias and imprecision. The advantages of the conventional LC system were more data points per peak, linear calibration models, stable retention times and better beta tolerance intervals. Due to higher robustness, the conventional LC system was finally chosen for

  15. Anthropometric and Biochemical Profiles of Black South African ...

    African Journals Online (AJOL)

    Rev Dr Olaleye

    Anthropometric and biochemical profiles were determined according to standard methods. From the ... Email: bejufemi@yahoo.co.uk ... 995 plots, Pahameng 1 711, Joe Slovo 1 359, and. Botchabela 2 ...... York: John Wiley & Sons, Inc. Steyn K ...

  16. Psoriatic arthritis: An assessment of clinical, biochemical and ...

    African Journals Online (AJOL)

    , epidemiological, clinical and radiological studies of South African (SA) patients are scarce. Objectives. To assess clinical, biochemical and radiological features in a single-centre SA cohort. Methods. We conducted a prospective assessment ...

  17. First cytogenetic analysis of Ichthyoelephas humeralis (Günther, 1860 by conventional and molecular methods with comments on the karyotypic evolution in Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Mauro Nirchio Tursellino

    2016-11-01

    Full Text Available We used conventional cytogenetic techniques (Giemsa, C-banding, Ag-NOR, and fluorescent in situ hybridization (FISH with 5S and 18S rDNA probes to investigate the karyotype and cytogenetic characteristics of Ichthyoelephas humeralis (Günther, 1860 from Ecuador. The specimens studied have a karyotype with 2n=54 biarmed chromosomes (32 M + 22 SM and C-positive heterochromatin located on the centromeric, pericentromeric, interstitial, and terminal regions of some chromosomes. The nucleolus organizer regions occurred terminally on the long arm of chromosome pair 2. FISH confirmed the presence of only one 18S rDNA cluster with nonsyntenic localization with the 5S rDNA. Cytogenetic data allow us to refute the earlier morphological hypothesis of a sister relationship between Semaprochilodus Fowler, 1941 and Ichthyoelephas Posada Arango, 1909 and support the molecular proposal that Ichthyoelephas is a sister group to the monophyletic clade containing Prochilodus Agassiz, 1829 and Semaprochilodus.

  18. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients.

    Science.gov (United States)

    Huang, Meng-Ting; Kuo-Kuang Lee, Robert; Lu, Chung-Hao; Chen, Ying-Jie; Li, Sheng-Hsiang; Hwu, Yuh-Ming

    2015-02-01

    To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient centrifugation (DGC), polyvinylpyrrolidone (PVP)-microscopic selection, and HA-binding selection to determine sperm DNA integrity. Percentages of DNA intact spermatozoa with green fluorescence were significantly higher in both PVP-microscopic selected spermatozoa (82.1 ± 24.0%) and HA-bound spermatozoa (83.9 ± 21.1%) than in spermatozoa prepared by DGC (66.8 ± 24.0%). However, there was no significant difference between the PVP-sperm and HA-sperm groups. When the percentage of green fluorescent spermatozoa prepared by DGC fell initially below 68%, both PVP-microscopic and HA-binding selection failed to select over 90% spermatozoa with intact DNA for ICSI in the male infertility group. Compared to control males with normal sperm parameters (99.3 ± 1.8%), the proportion of green fluorescence sperm after HA-binding selection from couples with male infertility (83.9 ± 21.1%) did not reach the range of > 99% reported by Yagci et al. The percentages of DNA intact spermatozoa between the PVP-sperm and HA-sperm groups were not significantly different. In an ICSI procedure, a well-trained embryologist will have the same ability to choose sperm with intact DNA by conventional microscopic selection as with HA-bound spermatozoa selection. Copyright © 2014. Published by Elsevier B.V.

  19. Spray-combustion process characterization in a common rail diesel engine fuelled with butanol-diesel blends by conventional methods and optical diagnostics

    Directory of Open Access Journals (Sweden)

    Simona Silvia Merola

    2014-04-01

    Full Text Available The target of a sustainable mobility has led to investigate advanced combustion modes and fuels technologies. On the other side, the increasing global energy demand and the decreasing fossil-energy resources are enhancing the interest in the use of renewable alternative fuels for compression ignition engines with the target of near-zero emission levels. Although performance and emissions of alternative-fuel within light-duty diesel engines have been extensively investigated, results of fuel chemical composition impact on combustion by integrated optical methodologies are lacking. In order to meet this challenge, one of the main objectives of the research efforts is to characterize the combustion and species evolution. In this investigation, conventional tests and optical diagnostics were employed to enhance the comprehension of the combustion process and chemical markers in a common rail compression ignition engine powered by butanol-diesel blends. The investigation was focused on the effect of the injection strategy and blend composition on in-cylinder spray combustion and soot formation, through UV-visible digital imaging and natural emission spectroscopy. Experiments were performed in an optically accessible single cylinder high swirl compression ignition engine, equipped with a common rail multi-jets injection system. UV-visible emission spectroscopy was used to follow the evolution of the combustion process chemical markers. Spectral features of OH were identified and followed during the spray combustion process examining different pilot-main dwell timings. Soot spectral evidence in the visible wavelength range was correlated to soot engine out emissions. In this work, conventional and optical data related to diesel fuel blended with 40 % of n-butanol will be presented.

  20. Enzyme and biochemical producing fungi

    DEFF Research Database (Denmark)

    Lübeck, Peter Stephensen; Lübeck, Mette; Nilsson, Lena

    2010-01-01

    factories for sustainable production of important molecules. For developing fungi into efficient cell factories, the project includes identification of important factors that control the flux through the pathways using metabolic flux analysis and metabolic engineering of biochemical pathways....

  1. Influence of Kosher (Shechita) and conventional slaughter ...

    African Journals Online (AJOL)

    Influence of Kosher (Shechita) and conventional slaughter techniques on shear force, drip and cooking loss of beef. ... South African Journal of Animal Science ... force values for meat samples from cattle slaughtered by the Kosher method compared to those from cattle slaughtered by the conventional slaughter method.

  2. Comparison of conventional DCE-MRI and a novel golden-angle radial multicoil compressed sensing method for the evaluation of breast lesion conspicuity.

    Science.gov (United States)

    Heacock, Laura; Gao, Yiming; Heller, Samantha L; Melsaether, Amy N; Babb, James S; Block, Tobias K; Otazo, Ricardo; Kim, Sungheon G; Moy, Linda

    2017-06-01

    To compare a novel multicoil compressed sensing technique with flexible temporal resolution, golden-angle radial sparse parallel (GRASP), to conventional fat-suppressed spoiled three-dimensional (3D) gradient-echo (volumetric interpolated breath-hold examination, VIBE) MRI in evaluating the conspicuity of benign and malignant breast lesions. Between March and August 2015, 121 women (24-84 years; mean, 49.7 years) with 180 biopsy-proven benign and malignant lesions were imaged consecutively at 3.0 Tesla in a dynamic contrast-enhanced (DCE) MRI exam using sagittal T1-weighted fat-suppressed 3D VIBE in this Health Insurance Portability and Accountability Act-compliant, retrospective study. Subjects underwent MRI-guided breast biopsy (mean, 13 days [1-95 days]) using GRASP DCE-MRI, a fat-suppressed radial "stack-of-stars" 3D FLASH sequence with golden-angle ordering. Three readers independently evaluated breast lesions on both sequences. Statistical analysis included mixed models with generalized estimating equations, kappa-weighted coefficients and Fisher's exact test. All lesions demonstrated good conspicuity on VIBE and GRASP sequences (4.28 ± 0.81 versus 3.65 ± 1.22), with no significant difference in lesion detection (P = 0.248). VIBE had slightly higher lesion conspicuity than GRASP for all lesions, with VIBE 12.6% (0.63/5.0) more conspicuous (P < 0.001). Masses and nonmass enhancement (NME) were more conspicuous on VIBE (P < 0.001), with a larger difference for NME (14.2% versus 9.4% more conspicuous). Malignant lesions were more conspicuous than benign lesions (P < 0.001) on both sequences. GRASP DCE-MRI, a multicoil compressed sensing technique with high spatial resolution and flexible temporal resolution, has near-comparable performance to conventional VIBE imaging for breast lesion evaluation. 3 Technical Efficacy: Stage 3 J. MAGN. RESON. IMAGING 2017;45:1746-1752. © 2016 International Society for Magnetic Resonance in Medicine.

  3. Convention on nuclear safety

    International Nuclear Information System (INIS)

    1994-01-01

    The Convention on Nuclear Safety was adopted on 17 June 1994 by Diplomatic Conference convened by the International Atomic Energy Agency at its Headquarters from 14 to 17 June 1994. The Convention will enter into force on the ninetieth day after the date of deposit with the Depository (the Agency's Director General) of the twenty-second instrument of ratification, acceptance or approval, including the instruments of seventeen States, having each at leas one nuclear installation which has achieved criticality in a reactor core. The text of the Convention as adopted is reproduced in the Annex hereto for the information of all Member States

  4. A novel method of placing right ventricular leads in patients with persistent left superior vena cava using a conventional j stylet.

    Science.gov (United States)

    Mora, Guillermo

    2014-03-01

    Locating pacemaker electrodes can become complicated by congenital abnormalities such as persistent left superior vena cava (LSVC). To evaluate a technique for the implanting of ventricular electrode in patients with persistent LSVC. The study was carried out from June 2001 to June 2010 involving all patients who were admitted to the Hospital Universitario Mayor, Instituto de Corazon de Bogota and Hospital Universitario Clinica San Rafael (Bogota-Colombia) for implanting pacemakers or cardiac defibrillators. LSVC was diagnosed by fluoroscopic observation (anterior-posterior view) of the course of the stylet. Four steps were followed: 1) Move the electrode with a straight stylet to the right atrium. 2) Change the straight stylet by a conventional J stylet and push the electrode to the lateral or anterolateral wall of the right atrium. 3) Remove the guide 3-5 cm and 4) Push the electrode which crosses the tricuspid valve into the right ventricle and finally deploy the active fixation mechanism. A total of 1198 patients were admitted for pacemaker or cardiac defibrillator implant during the 9-year study period, 1114 received a left subclavian venous approach. There were 573 males and 541 females. Persistent LSVC was found in five patients (0.45%) Fluoroscopy time for implanting the ventricular electrode ranged from 60 to 250 seconds, 40 to 92 minutes being taken to complete the whole procedure. We present a simple and rapid technique for electrode placement in patients with LSVC using usual J guide and active fixation electrodes with high success.

  5. A novel treatment modality in patients with premature ejaculation resistant to conventional methods: the neuromodulation of dorsal penile nerves by pulsed radiofrequency.

    Science.gov (United States)

    Basal, Seref; Goktas, Serdar; Ergin, Atilla; Yildirim, Ibrahim; Atim, Abdulkadir; Tahmaz, Lutfi; Dayanc, Murat

    2010-01-01

    Premature ejaculation (PE) is the most common sexual problem experienced by men, and it affects 20%-30% of them. Pulsed radiofrequency (PRF) neuromodulation has been shown to be an effective treatment for a wide range of pain conditions. We used PRF to treat PE by desensitizing dorsal penile nerves in patients resistant to conventional treatments. Fifteen patients with a lifelong history of PE, defined as an intravaginal ejaculatory latency time (IELT) of IELT and sexual satisfaction score (SSS; for patients and their partners) were obtained. The mean IELTs before and 3 weeks after procedure were 18.5 +/- 17.9 and 139.9 +/- 55.1 seconds, respectively. Side effects did not occur. Mean SSSs of patients before and after treatment were 1.3 +/- 0.3 and 4.6 +/- 0.5, and mean SSSs of partners before and after treatment were 1.3 +/- 0.4 and 4.4 +/- 0.5, respectively. In all cases, IELT and SSS were significantly increased (P < .05). None of the patients or their wives reported any treatment failure during the follow-up period. The mean follow-up time was 8.3 +/- 1.9 months. It is early to conclude that this new treatment modality might be used widely for the treatment of PE; however, because it is an innovative modality, placebo-controlled studies (eg, sham procedure), with larger numbers of patients and including assessment of penile sensitivity (eg, biothesiometry), are needed.

  6. Lack of concordance between a rapid bedside and conventional laboratory method of cardiac troponin testing: impact on risk stratification of patients suspected of acute coronary syndrome.

    NARCIS (Netherlands)

    Cramer, G.E.; Kievit, P.C.; Brouwer, M.A.; Keijzer, M.H. de; Luijten, H.E.; Verheugt, F.W.A.

    2007-01-01

    OBJECTIVES: This study was designed to test the usefulness of a bedside assay as compared to a laboratory method of troponin testing to predict adverse cardiac outcome of chest pain patients. METHODS: We studied 358 ER visits of patients suspected of a non ST-elevation acute coronary syndrome. cTnI

  7. Definitions of biochemical failure in prostate cancer following radiation therapy

    International Nuclear Information System (INIS)

    Taylor, Jeremy M.G.; Griffith, Kent A.; Sandler, Howard M.

    2001-01-01

    Purpose: The American Society for Therapeutic Radiology and Oncology (ASTRO) published a consensus panel definition of biochemical failure following radiation therapy for prostate cancer. In this paper, we develop a series of alternative definitions of biochemical failure. Using data from 688 patients, we evaluated the sensitivity and specificity of the various definitions, with respect to a defined 'clinically meaningful' outcome. Methods and Materials: The ASTRO definition of biochemical failure requires 3 consecutive rises in prostate-specific antigen (PSA). We considered several modifications to the standard definition: to require PSA rises of a certain magnitude, to consider 2 instead of 3 rises, to require the final PSA value to be greater than a fixed cutoff level, and to define biochemical failure based on the slope of PSA over 1, 1.5, or 2 years. A clinically meaningful failure is defined as local recurrence, distant metastases, initiation of unplanned hormonal therapy, unplanned radical prostatectomy, or a PSA>25 later than 6 months after radiation. Results: Requiring the final PSA in a series of consecutive rises to be larger than 1.5 ng/mL increased the specificity of biochemical failure. For a fixed specificity, defining biochemical failure based on 2 consecutive rises, or the slope over the last year, could increase the sensitivity by up to approximately 20%, compared to the ASTRO definition. Using a rule based on the slope over the previous year or 2 rises leads to a slightly earlier detection of biochemical failure than does the ASTRO definition. Even with the best rule, only approximately 20% of true failures are biochemically detected more than 1 year before the clinically meaningful event time. Conclusion: There is potential for improvement in the ASTRO consensus definition of biochemical failure. Further research is needed, in studies with long follow-up times, to evaluate the relationship between various definitions of biochemical failure and

  8. Minamata Convention on Mercury

    Science.gov (United States)

    On November 6, 2013 the United States signed the Minamata Convention on Mercury, a new multilateral environmental agreement that addresses specific human activities which are contributing to widespread mercury pollution

  9. Biochemical Network Stochastic Simulator (BioNetS: software for stochastic modeling of biochemical networks

    Directory of Open Access Journals (Sweden)

    Elston Timothy C

    2004-03-01

    Full Text Available Abstract Background Intrinsic fluctuations due to the stochastic nature of biochemical reactions can have large effects on the response of biochemical networks. This is particularly true for pathways that involve transcriptional regulation, where generally there are two copies of each gene and the number of messenger RNA (mRNA molecules can be small. Therefore, there is a need for computational tools for developing and investigating stochastic models of biochemical networks. Results We have developed the software package Biochemical Network Stochastic Simulator (BioNetS for efficientlyand accurately simulating stochastic models of biochemical networks. BioNetS has a graphical user interface that allows models to be entered in a straightforward manner, and allows the user to specify the type of random variable (discrete or continuous for each chemical species in the network. The discrete variables are simulated using an efficient implementation of the Gillespie algorithm. For the continuous random variables, BioNetS constructs and numerically solvesthe appropriate chemical Langevin equations. The software package has been developed to scale efficiently with network size, thereby allowing large systems to be studied. BioNetS runs as a BioSpice agent and can be downloaded from http://www.biospice.org. BioNetS also can be run as a stand alone package. All the required files are accessible from http://x.amath.unc.edu/BioNetS. Conclusions We have developed BioNetS to be a reliable tool for studying the stochastic dynamics of large biochemical networks. Important features of BioNetS are its ability to handle hybrid models that consist of both continuous and discrete random variables and its ability to model cell growth and division. We have verified the accuracy and efficiency of the numerical methods by considering several test systems.

  10. Comparative evaluation of matrix-assisted laser desorption ionisation-time of flight mass spectrometry and conventional phenotypic-based methods for identification of clinically important yeasts in a UK-based medical microbiology laboratory.

    Science.gov (United States)

    Fatania, Nita; Fraser, Mark; Savage, Mike; Hart, Jason; Abdolrasouli, Alireza

    2015-12-01

    Performance of matrix-assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-TOF MS) was compared in a side-by side-analysis with conventional phenotypic methods currently in use in our laboratory for identification of yeasts in a routine diagnostic setting. A diverse collection of 200 clinically important yeasts (19 species, five genera) were identified by both methods using standard protocols. Discordant or unreliable identifications were resolved by sequencing of the internal transcribed spacer region of the rRNA gene. MALDI-TOF and conventional methods were in agreement for 182 isolates (91%) with correct identification to species level. Eighteen discordant results (9%) were due to rarely encountered species, hence the difficulty in their identification using traditional phenotypic methods. MALDI-TOF MS enabled rapid, reliable and accurate identification of clinically important yeasts in a routine diagnostic microbiology laboratory. Isolates with rare, unusual or low probability identifications should be confirmed using robust molecular methods. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  11. Comparison of the CoaguChek XS handheld coagulation analyzer and conventional laboratory methods measuring international normalised ratio (INR) values during the time to therapeutic range after mechanical valve surgery.

    Science.gov (United States)

    Bardakci, Hasmet; Altıntaş, Garip; Çiçek, Omer Faruk; Kervan, Umit; Yilmaz, Sevinc; Kaplan, Sadi; Birincioglu, Cemal Levent

    2013-05-01

    To compare the international normalised ratio (INR) value of patients evaluated using the CoaguChek XS versus conventional laboratory methods, in the period after open-heart surgery for mechanical valve replacement until a therapeutic range is achieved using vitamin K antagonists (VKA) together with low molecular weight heparin (LMWH). One hundred and five patients undergoing open-heart surgery for mechanical valve replacement were enrolled. Blood samples were collected from patients before surgery, and on the second and fifth postoperative days, simultaneously for both the point of care device and conventional laboratory techniques. Patients were administered VKA together with LMWH at therapeutic doses (enoxaparin 100 IU/kg twice daily) subcutaneously, until an effective range was achieved on approximately the fifth day after surgery. The mean INR values using the CoaguChek XS preoperatively and on the second and fifth days postoperatively were 1.20 (SD ± 0.09), 1.82 (SD ± 0.45), and 2.55 (SD ± 0.55), respectively. Corresponding results obtained using conventional laboratory techniques were 1.18 (SD ± 0.1), 1.81 (SD ± 0.43), and 2.51 (SD ± 0.58). The correlation coefficient was r = 0.77 preoperatively, r = 0.981 on postoperative day 2, and r = 0.983 on postoperative day 5. Results using the CoaguChek XS Handheld Coagulation Analyzer correlated strongly with conventional laboratory methods, in the bridging period between open-heart surgery for mechanical valve replacement and the achievement of a therapeutic range on warfarin and LMWH. © 2013 Wiley Periodicals, Inc.

  12. Biochem-Env, a plateform of environmental biochemistry for research

    OpenAIRE

    GRONDIN, VIRGINIE; Nelieu, Sylvie; Crouzet, Olivier; Hedde, Mickaël; Mougin, Christian

    2016-01-01

    As a service of the research infrastructure AnaEE-France (http://www.anaee-france.fr/fr/), the platform Biochem-Env (http://www.biochemenv.fr) offers skills and innovative analytical tools for biochemical characterizations of soils, sediments, and micro-macro-organisms living in terrestrial and aquatic ecosystems. The platform provides methods validated according to Quality Guidelines, i.e. to measure global soil enzymatic activities. Our robot-supported protocols allow great number of enzyme...

  13. Efficacy of low-pressure foam cleaning compared to conventional cleaning methods in the removal of bacteria from surfaces associated with convenience food.

    Science.gov (United States)

    Lambrechts, A A; Human, I S; Doughari, J H; Lues, J F R

    2014-09-01

    Food borne illnesses and food poisoning are cause for concern globally. The diseases are often caused by food contamination with pathogenic bacteria due largely to poor sanitary habits or storage conditions. Prevalence of some bacteria on cleaned and sanitised food contact surfaces from eight convenience food plants in Gauteng (South Africa) was investigated with the view to evaluate the efficacy of the cleaning methods used with such food contact surfaces. The microbial load of eight convenience food manufacturing plants was determined by sampling stainless steel food contact surfaces after they had been cleaned and sanitised at the end of a day's shift. Samples were analysed for Total Plate Count (TPC), Escherichia coli, Salmonella species, Staphylococcus aureus and Listeria species. Results showed that 59 % of the total areas sampled for TPC failed to comply with the legal requirements for surfaces, according to the Foodstuffs, Cosmetics and Disinfectants Act ( 0.05) in terms of Listeria species isolates obtained from both cleaning methods. The LPF method proved to be the superior cleaning option for lowering TPC counts. Regardless of cleaning method used, pathogens continued to flourish on various surfaces, including dry stainless steel, posing a contamination hazard for a considerable period depending on the contamination level and type of pathogen. Intensive training for proper chemical usage and strict procedural compliance among workers for efficient cleaning procedures is recommended.

  14. A Comparative Study of Two Methods of Instruction in a University Animal Biology Course: Audio-Tutorial with Conventional Lecture-Laboratory.

    Science.gov (United States)

    Rowsey, Robert Ellis

    In this comparative study of instructional methods involving university students, pre- and posttest data were collected from achievement and attitude instruments as well as from opinion questionnaires. The major findings included: (1) students taught via audio-tutorial instruction demonstrated significantly greater achievement gain; (2) the number…

  15. Characteristic comparison of triglyceride-rich remnant lipoprotein measurement between a new homogenous assay (RemL-C and a conventional immunoseparation method (RLP-C

    Directory of Open Access Journals (Sweden)

    Saikawa Shinichi

    2008-05-01

    Full Text Available Abstract Background Increased serum remnant lipoproteins are supposed to predict cardiovascular disease in addition to increased LDL. A new homogenous assay for remnant lipoprotein-cholesterol (RemL-C has been developed as an alternative to remnant-like particle-cholesterol (RLP-C, an immunoseparation assay, widely used for the measurement of remnant lipoprotein cholesterol. Methods We evaluated the correlations and data validation between the 2 assays in 83 subjects (49 men and 34 women without diabetes, hypertension and medications for hyperlipidemia, diabetes, and hypertension, and investigated the characteristics of remnant lipoproteins obtained by the two methods (RLP-C and RemL-C and their relationships with IDL-cholesterol determined by our developed HPLC method. Results A positive correlation was significantly found between the two methods (r = 0.853, 95%CI 0.781–0.903, p RLP-C level. RemL-C (r = 0.339, 95%CI 0.152–0.903; p = 0.0005 significantly correlated with IDL-cholesterol, but not RLP-C (r = 0.17, 95%CI -0.047–0.372; p = 0.1237 in all the samples (n = 83. Conclusion These results suggest that there is generally a significant correlation between RemL-C and RLP-C. However, RemL-C assay is likely to reflect IDL more closely than RLP-C.

  16. "La Palabra Es Salud" (The Word Is Health): Combining Mixed Methods and CBPR to Understand the Comparative Effectiveness of Popular and Conventional Education

    Science.gov (United States)

    Wiggins, Noelle; Hughes, Adele; Rodriguez, Adriana; Potter, Catherine; Rios-Campos, Teresa

    2014-01-01

    Increasing recognition of the role of social conditions in health has led to calls for methods that can be used to change social conditions. Popular education has demonstrated great promise as a methodology that can be used to address the underlying social and structural determinants of health. To date, most studies of popular education have used…

  17. Measurement of regional cerebral blood flow using one-point venous blood sampling and causality model. Evaluation by comparing with conventional continuous arterial blood sampling method

    International Nuclear Information System (INIS)

    Mimura, Hiroaki; Sone, Teruki; Takahashi, Yoshitake

    2008-01-01

    Optimal setting of the input function is essential for the measurement of regional cerebral blood flow (rCBF) based on the microsphere model using N-isopropyl-4-[ 123 I]iodoamphetamine ( 123 I-IMP), and usually the arterial 123 I-IMP concentration (integral value) in the initial 5 min is used for this purpose. We have developed a new convenient method in which 123 I-IMP concentration in arterial blood sample is estimated from that in venous blood sample. Brain perfusion single photon emission computed tomography (SPECT) with 123 I-IMP was performed in 110 cases of central nervous system disorders. The causality was analyzed between the various parameters of SPECT data and the ratio of octanol-extracted arterial radioactivity concentration during the first 5 min (Caoct) to octanol-extracted venous radioactivity concentration at 27 min after intravenous injection of 123 I-IMP (Cvoct). A high correlation was observed between the measured and estimated values of Caoct/Cvoct (r=0.856) when the following five parameters were included in the regression formula: radioactivity concentration in venous blood sampled at 27 min (Cv), Cvoct, Cvoct/Cv, and total brain radioactivity counts that were measured by a four-head gamma camera 5 min and 28 min after 123 I-IMP injection. Furthermore, the rCBF values obtained using the input parameters estimated by this method were also highly correlated with the rCBF values measured using the continuous arterial blood sampling method (r=0.912). These results suggest that this method would serve as the new, convenient and less invasive method of rCBF measurement in clinical setting. (author)

  18. Guidelines for the verification and validation of expert system software and conventional software: Volume 4, Evaluation of knowledge base certification methods. Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    Objective is the formulation of guidelines for the V ampersand V of expert systems for use in nuclear power applications. This activity is concerned with the development and testing of various methods for assuring the quality of knowledge bases. The testing procedure used was that of behavioral experiment, the first known such evaluation of any of V ampersand V activity; the value lies in the capability to provide empirical evidence for or against the effectiveness of plausible methods in helping people find problems in knowledge bases. The three-day experiment included 20 participants from three nuclear utilities, the Nuclear Regulatory Commission's Technical training Center, University of Maryland, EG ampersand G Idaho, and SAIC. The study used two real nuclear expert systems: a boiling water reactor emergency operating procedures tracking system and a pressurized water reactor safety assessment systems. Ten participants were assigned to each of the expert systems. All participants were trained in and then used a sequence of four different V ampersand V methods selected as being the best and most appropriate. These methods either involved the analysis and tracing of requirements to elements in the knowledge base or direct inspection of the knowledge base for various kinds of errors. Half of the subjects within each system group used the best annual variant of the V ampersand V methods (the control group), while the other half were supported by the results of applying real or simulated automated tools to the knowledge bases (the experimental group). The four groups of participants were similar in nuclear engineering and software experience characteristics. It is concluded that the use of tools in static knowledge base certification results in significant improvement in detecting all types of defects, avoiding false alarms, and completing the effort in less time. The simulated knowledge-checking tool, based on supplemental engineering information about the systems

  19. Guidelines for the verification and validation of expert system software and conventional software: Evaluation of knowledge base certification methods. Volume 4

    International Nuclear Information System (INIS)

    Miller, L.A.; Hayes, J.E.; Mirsky, S.M.

    1995-03-01

    This report presents the results of the Knowledge Base Certification activity of the expert systems verification and validation (V ampersand V) guideline development project which is jointly funded by the US Nuclear Regulatory Commission and the Electric Power Research Institute. The ultimate objective is the formulation of guidelines for the V ampersand V of expert systems for use in nuclear power applications. This activity is concerned with the development and testing of various methods for assuring the quality of knowledge bases. The testing procedure used was that of behavioral experiment, the first known such evaluation of any type of V ampersand V activity. The value of such experimentation is its capability to provide empirical evidence for -- or against -- the effectiveness of plausible methods in helping people find problems in knowledge bases. The three-day experiment included 20 participants from three nuclear utilities, the Nuclear Regulatory Commission's Technical training Center, the University of Maryland, EG ampersand G Idaho, and SAIC. The study used two real nuclear expert systems: a boiling water reactor emergency operating procedures tracking system and a pressurized water reactor safety assessment systems. Ten participants were assigned to each of the expert systems. All participants were trained in and then used a sequence of four different V ampersand V methods selected as being the best and most appropriate for study on the basis of prior evaluation activities. These methods either involved the analysis and tracing of requirements to elements in the knowledge base (requirements grouping and requirements tracing) or else involved direct inspection of the knowledge base for various kinds of errors. Half of the subjects within each system group used the best manual variant of the V ampersand V methods (the control group), while the other half were supported by the results of applying real or simulated automated tools to the knowledge bases

  20. Climate change convention

    International Nuclear Information System (INIS)

    Russell, D.

    1992-01-01

    Principles that guide Canada's Green Plan with respect to global warming are outlined. These include respect for nature, meeting environmental goals in an economically beneficial manner, efficient use of resources, shared responsibilities, federal leadership, and informed decision making. The policy side of the international Framework Convention on Climate Change is then discussed and related to the Green Plan. The Convention has been signed by 154 nations and has the long-term objective of stabilizing anthropogenic greenhouse gas concentrations in the atmosphere at levels that prevent dangerous interference with the climate system. Some of the Convention's commitments toward achieving that objective are only applicable to the developed countries. Five general areas of commitment are emissions reductions, assistance to developing countries, reporting requirements, scientific and socioeconomic research, and education. The most controversial area is that of limiting emissions. The Convention has strong measures for public accountability and is open to future revisions. Canada's Green Plan represents one country's response to the Convention commitments, including a national goal to stabilize greenhouse gas emissions at the 1990 level by the year 2000

  1. Determination of boron in graphite, boron carbide and glass by ICP-MS, ICP-OES and conventional wet chemical methods

    International Nuclear Information System (INIS)

    Venkatesh, K.; Kamble, Granthali S.; Venkatesh, Manisha; Kumar, Sanjukta A.; Reddy, A.V.R.

    2014-01-01

    Boron is an important element of interest in nuclear reactor materials due to its high neutron absorption cross section (σ 0 =3837 barns for 10 B). In the present paper, R and D work and routinely used methods have been described for the analysis of case samples (1) Graphite where boron is present at trace levels, (2) Boron Carbide having boron concentration of about 80% and (3) Glass containing 4-6 % boron. (author)

  2. Explorations into Chemical Reactions and Biochemical Pathways.

    Science.gov (United States)

    Gasteiger, Johann

    2016-12-01

    A brief overview of the work in the research group of the present author on extracting knowledge from chemical reaction data is presented. Methods have been developed to calculate physicochemical effects at the reaction site. It is shown that these physicochemical effects can quite favourably be used to derive equations for the calculation of data on gas phase reactions and on reactions in solution such as aqueous acidity of alcohols or carboxylic acids or the hydrolysis of amides. Furthermore, it is shown that these physicochemical effects are quite effective for assigning reactions into reaction classes that correspond to chemical knowledge. Biochemical reactions constitute a particularly interesting and challenging task for increasing our understanding of living species. The BioPath.Database is a rich source of information on biochemical reactions and has been used for a variety of applications of chemical, biological, or medicinal interests. Thus, it was shown that biochemical reactions can be assigned by the physicochemical effects into classes that correspond to the classification of enzymes by the EC numbers. Furthermore, 3D models of reaction intermediates can be used for searching for novel enzyme inhibitors. It was shown in a combined application of chemoinformatics and bioinformatics that essential pathways of diseases can be uncovered. Furthermore, a study showed that bacterial flavor-forming pathways can be discovered. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The use of microbead-based spoligotyping for Mycobacterium tuberculosis complex to evaluate the quality of the conventional method: Providing guidelines for Quality Assurance when working on membranes

    Directory of Open Access Journals (Sweden)

    Garzelli Carlo

    2011-04-01

    Full Text Available Abstract Background The classical spoligotyping technique, relying on membrane reverse line-blot hybridization of the spacers of the Mycobacterium tuberculosis CRISPR locus, is used world-wide (598 references in Pubmed on April 8th, 2011. However, until now no inter-laboratory quality control study had been undertaken to validate this technique. We analyzed the quality of membrane-based spoligotyping by comparing it to the recently introduced and highly robust microbead-based spoligotyping. Nine hundred and twenty-seven isolates were analyzed totaling 39,861 data points. Samples were received from 11 international laboratories with a worldwide distribution. Methods The high-throughput microbead-based Spoligotyping was performed on CTAB and thermolyzate DNA extracted from isolated Mycobacterium tuberculosis complex (MTC strains coming from the genotyping participating centers. Information regarding how the classical Spoligotyping method was performed by center was available. Genotype discriminatory analyses were carried out by comparing the spoligotypes obtained by both methods. The non parametric U-Mann Whitney homogeneity test and the Spearman rank correlation test were performed to validate the observed results. Results Seven out of the 11 laboratories (63 %, perfectly typed more than 90% of isolates, 3 scored between 80-90% and a single center was under 80% reaching 51% concordance only. However, this was mainly due to discordance in a single spacer, likely having a non-functional probe on the membrane used. The centers using thermolyzate DNA performed as well as centers using the more extended CTAB extraction procedure. Few centers shared the same problematic spacers and these problematic spacers were scattered over the whole CRISPR locus (Mostly spacers 15, 14, 18, 37, 39, 40. Conclusions We confirm that classical spoligotyping is a robust method with generally a high reliability in most centers. The applied DNA extraction procedure (CTAB

  4. Ultrasonic-energy enhance the ionic liquid-based dual microextraction to preconcentrate the lead in ground and stored rain water samples as compared to conventional shaking method.

    Science.gov (United States)

    Nizamani, Sooraj; Kazi, Tasneem G; Afridi, Hassan I

    2018-01-01

    An efficient preconcentration technique based on ultrasonic-assisted ionic liquid-based dual microextraction (UA-ILDµE) method has been developed to preconcentrate the lead (Pb +2 ) in ground and stored rain water. In the current proposed method, Pb +2 was complexed with a chelating agent (dithizone), whereas an ionic liquid (1-butyl-3-methylimidazolium hexafluorophosphate) was used for extraction purpose. The ultrasonic irradiation and electrical shaking system were applied to enhance the dispersion and extraction of Pb +2 complex in aqueous samples. For second phase, dual microextraction (DµE phase), the enriched Pb +2 complex in ionic liquid, extracted back into the acidic aqueous solution and finally determined by flame atomic absorption spectrometry. Some major analytical parameters that influenced the extraction efficiency of developed method, such as pH, concentration of ligand, volume of ionic liquid and samples, time of shaking in thermostatic electrical shaker and ultrasonic bath, effect of back extracting HNO 3 volume, matrix effect, centrifugation time and rate were optimized. At the sample volume of 25mL, the calculated preconcentration factor was 62.2. The limit of detection of proposed procedure for Pb +2 ions was found to be 0.54μgL -1 . The validation of developed method was performed by the analysis of certified sample of water SRM 1643e and standard addition method in a real water sample. The extraction recovery of Pb +2 was enhanced≥2% with shaking time of 80s in ultrasonic bath as compared to used thermostatic electrical shaker, where for optimum recovery up to 10min was required. The developed procedure was successfully used for the enrichment of Pb +2 in ground and stored rain water (surface water) samples of an endemic region of Pakistan. The resulted data indicated that the ground water samples were highly contaminated with Pb +2 , while some of the surface water samples were also have higher values of Pb +2 than permissible limit of

  5. Potential biochemical markers for selection of disease resistance in Vigna radiata

    International Nuclear Information System (INIS)

    Badere, R.S.; Koche, D.K.; Choudhary, A.D.; Pawar, S.E.

    2001-01-01

    The Vigna radiata (L.) Wilczek (Green gram), a major pulse crop is prone to damaging diseases caused by Erysiphe polygoni, Cercospora canescens and Rhizoctonia sp. Therefore, the development of multiple resistance is a major breeding objective in green gram. Resistance to powdery mildew has already been developed, however, there are no reports on the development of resistance to Cercospora in green gram. Owing to limitation of conventional screening methods, the improvement for multiple disease resistance is inadequate, in this crop. It needs an efficient and quick selection method, for screening the plant population at an early stage. It is well established that the resistant interaction, in plants, involves accumulation of antibiotic compound phytoalexin (Genestein in Vigna radiata) and induction of enzymes such as β-1,3 gulcanase and Chitinases. These compounds are not only induced by pathogens but also pathogen-derived elicitors. These biochemical compounds can be used as resistance indicative biochemical markers for screening the natural or mutagen induced genetic diversity in populations of Vigna radiata in non-destructive manner. It, however, needs a systematic study of plant defense response. This paper deals with the response of resistant and susceptible cultivars of vigna radiata to Cercospora elicitor and development of non-destructive selection method for disease resistance. (author)

  6. Biochemical reactions of the organism

    International Nuclear Information System (INIS)

    Fedorova, A.V.

    1984-01-01

    Effects of mercury, strontium chloride, GMDA, trichlorfon as well as some radionuclides ( 89 Sr, 137 Cs, 203 Hg) were studied on rats. Changes in biochemical parameters (histamine content, activity of cholinesterase and histaminase) are noted. Most noticeable changes were observed in enzymatic activity. Distortion of enzymatic systems and accumulation of intermediate exchange and decay products of tissues in excess quantities affecting other systems can be the reason for changes in the organism. The observed changes in biochemical parameters should be necessarily taken into account at hygienic regulations of harmful effects of enviroment

  7. A method for optimization of patient dose estimation in conventional radiology; Un metodo per l'ottimizzazione della stima della dose al paziente nella radiologia tradizionale

    Energy Technology Data Exchange (ETDEWEB)

    Tofani, A.; Del Corona, A. [Azienda Unita' Sanitaria Locale 6, Livorno (Italy). Unita' Ospedaliera di Fisica Sanitaria; Niespolo, A. [Azienda Ospedaliera Pisana, Pisa (Italy). Unita' Ospedaliera di Fisica Sanitaria

    2000-05-01

    The method recommended by Report no. 34 (1982) of the International Commission on Radiological Protection (ICRP) for patient dose computation in diagnostic radiology is based on tabulated dosimetric data obtained from Monte Carlo simulations on anthropomorphic phantoms described by simple mathematical functions. When computing the dose absorbed by an adult patient, this method suffers from two main limitations: first, the geometrical parameters and in particular focus to film distance and film size are fixed, which makes the dosimetric data of limited use when the examination geometry differs form the ICRP standard. In addition, when patient size and mass differ considerably from the corresponding quantities of the mathematically described phantom (the so-called reference man, with a height of 174 cm and a mass of 70.9 Kg) the ICRP method may lead to great errors in dose estimate. The aim of the present paper is to indicate a method to overcome the above limitations. The algorithm proposed in this work is based on the method suggested by Huda Gkanatsios in order to compute the effective dose through a linear first of the energy imparted per unit dose-area product a function of the half value thickness and by using a fit coefficients depending on both phantom thickness and peak voltage. It was devised a procedure to normalize the dose computed with this methods with respect to the equivalent effective dose obtained with the ICRP method. Therefore it was determined the dependence of the absorbed dose on focus-to-film distance, film size and patient anatomy. It was found that for each value of patient mass the dose dependence on film size can be approximated by a polynomial function, while the dose dependence on focus-to-film distance can be approximated by a power law. If the above parameters vary in a limited range close to the ICRP standard, a linear fit can be performed without introducing a considerable error. The linear fit coefficients, on the other hand, were

  8. Kinetic modeling of the biosorption of Cd2+ ions from aqueous solutions onto Eichhornia crassipes roots using potentiometry: low-cost alternative to conventional methods

    Directory of Open Access Journals (Sweden)

    Carolina Martínez-Sánchez

    2013-01-01

    Full Text Available This work presents the use of potentiometric measurements for kinetic studies of biosorption of Cd2+ ions from aqueous solutions on Eichhornia crassipes roots. The open circuit potential of the Cd/Cd2+ electrode of the first kind was measured during the bioadsorption process. The amount of Cd2+ ions accumulated was determined in real time. The data were fit to different models, with the pseudo-second-order model proving to be the best in describing the data. The advantages and limitations of the methodology proposed relative to the traditional method are discussed.

  9. Method

    Directory of Open Access Journals (Sweden)

    Ling Fiona W.M.

    2017-01-01

    Full Text Available Rapid prototyping of microchannel gain lots of attention from researchers along with the rapid development of microfluidic technology. The conventional methods carried few disadvantages such as high cost, time consuming, required high operating pressure and temperature and involve expertise in operating the equipment. In this work, new method adapting xurography method is introduced to replace the conventional method of fabrication of microchannels. The novelty in this study is replacing the adhesion film with clear plastic film which was used to cut the design of the microchannel as the material is more suitable for fabricating more complex microchannel design. The microchannel was then mold using polymethyldisiloxane (PDMS and bonded with a clean glass to produce a close microchannel. The microchannel produced had a clean edge indicating good master mold was produced using the cutting plotter and the bonding between the PDMS and glass was good where no leakage was observed. The materials used in this method is cheap and the total time consumed is less than 5 hours where this method is suitable for rapid prototyping of microchannel.

  10. method

    Directory of Open Access Journals (Sweden)

    L. M. Kimball

    2002-01-01

    Full Text Available This paper presents an interior point algorithm to solve the multiperiod hydrothermal economic dispatch (HTED. The multiperiod HTED is a large scale nonlinear programming problem. Various optimization methods have been applied to the multiperiod HTED, but most neglect important network characteristics or require decomposition into thermal and hydro subproblems. The algorithm described here exploits the special bordered block diagonal structure and sparsity of the Newton system for the first order necessary conditions to result in a fast efficient algorithm that can account for all network aspects. Applying this new algorithm challenges a conventional method for the use of available hydro resources known as the peak shaving heuristic.

  11. Prenatal prediction of postnatal large-for-date neonates using a simplified method at MR imaging: comparison with conventional 2D ultrasound estimates.

    Science.gov (United States)

    Kadji, Caroline; Cannie, Mieke M; De Angelis, Ricardo; Camus, Margaux; Klass, Magdalena; Fellas, Stéphanie; Cecotti, Vera; Dütemeyer, Vivien; Jani, Jacques C

    2017-05-15

    To evaluate the performance of a simple method of estimating fetal weight (EFW) using MR imaging as compared with 2D US in the prediction of large-for-date neonates. Written informed consent was obtained for this EC-approved study. Between March 2011 and May 2016, 2 groups of women with singleton pregnancies were evaluated: women that underwent US-EFW and MR-EFW within 48 h before delivery and those undergoing these evaluations between 35 + 0 weeks and 37 + 6 weeks of gestation. US-EFW was based on Hadlock et al. and MR-EFW on the formula described by Backer et al. Planimetric measurement of the fetal body volume (FBV) needed for MR-EFW was performed using a semi-automated method and the time required for measurement was noted. Our outcome measure was performance in prediction of large-for-date neonates by MR imaging versus US-EFW using receiver-operating characteristic (ROC) curves. 270 women were included in the first part of the study with 48 newborns (17.8%) of birthweight ≥90 th centile and 30 (11.1%) ≥95 th centile. Eighty-three women were included in the second part with 9 newborns (10.8%) of birthweight ≥95 th centile. The median time needed for FBV planimetric measurements in all 353 fetuses was 3.5 (range; 1.5-5.5) min. The area under the ROC curve for prediction of postnatal large-for-date neonates by prenatal MR imaging performed within 48 h before delivery was significantly better than by US (difference between the AUROC = 0.085, P < 0.001; standard error = 0.020 for birthweight ≥90 th centile and 0.036, P = 0.01; standard error = 0.014 for birthweight ≥95 th centile). Similarly, MR-EFW was better than US-EFW, with both performed remote from delivery, in predicting birthweight ≥ 95 th centile (difference between the AUROC = 0.077, P = 0.045; standard error = 0.039). MR planimetry using our purpose-designed semi-automated method is not time-consuming. MR-EFW performed immediately prior to

  12. Tritium and OSPAR convention

    International Nuclear Information System (INIS)

    2009-01-01

    The missions and the organisation of the OSPAR convention on protection of the NE Atlantic marine environment are given. The OSPAR strategy for the radioactive substances is stated. The results of work programme of the radioactive Substances committee are described and the consensus reached by contracting parties on the appropriate arrangements for this radionuclide is presented. (authors)

  13. Revised C++ coding conventions

    CERN Document Server

    Callot, O

    2001-01-01

    This document replaces the note LHCb 98-049 by Pavel Binko. After a few years of practice, some simplification and clarification of the rules was needed. As many more people have now some experience in writing C++ code, their opinion was also taken into account to get a commonly agreed set of conventions

  14. Global climate convention

    International Nuclear Information System (INIS)

    Simonis, U.E.

    1991-01-01

    The effort of negotiate a global convention on climate change is one of mankind's great endeavours - and a challenge to economists and development planners. The inherent linkages between climate and the habitability of the earth are increasingly well recognized, and a convention could help to ensure that conserving the environment and developing the economy in the future must go hand in hand. Due to growing environmental concern the United Nations General Assembly has set into motion an international negotiating process for a framework convention on climate change. One the major tasks in these negotiations is how to share the duties in reducing climate relevant gases, particularly carbon dioxide (CO 2 ), between the industrial and the developing countries. The results and proposals could be among the most far-reaching ever for socio-economic development, indeed for global security and survival itself. While the negotiations will be about climate and protection of the atmosphere, they will be on fundamental global changes in energy policies, forestry, transport, technology, and on development pathways with low greenhouse gas emissions. Some of these aspects of a climate convention, particularly the distributional options and consequences for the North-South relations, are addressed in this chapter. (orig.)

  15. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp consumed in Brazil

    Directory of Open Access Journals (Sweden)

    Elenilda J. Pereira

    2016-03-01

    Full Text Available Background: The cowpea (Vigna unguiculata L. Wap. is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. Objectives: The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Methods: Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. Results: When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Conclusions: Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  16. PR2ALIGN: a stand-alone software program and a web-server for protein sequence alignment using weighted biochemical properties of amino acids.

    Science.gov (United States)

    Kuznetsov, Igor B; McDuffie, Michael

    2015-05-07

    Alignment of amino acid sequences is the main sequence comparison method used in computational molecular biology. The selection of the amino acid substitution matrix best suitable for a given alignment problem is one of the most important decisions the user has to make. In a conventional amino acid substitution matrix all elements are fixed and their values cannot be easily adjusted. Moreover, most existing amino acid substitution matrices account for the average (dis)similarities between amino acid types and do not distinguish the contribution of a specific biochemical property to these (dis)similarities. PR2ALIGN is a stand-alone software program and a web-server that provide the functionality for implementing flexible user-specified alignment scoring functions and aligning pairs of amino acid sequences based on the comparison of the profiles of biochemical properties of these sequences. Unlike the conventional sequence alignment methods that use 20x20 fixed amino acid substitution matrices, PR2ALIGN uses a set of weighted biochemical properties of amino acids to measure the distance between pairs of aligned residues and to find an optimal minimal distance global alignment. The user can provide any number of amino acid properties and specify a weight for each property. The higher the weight for a given property, the more this property affects the final alignment. We show that in many cases the approach implemented in PR2ALIGN produces better quality pair-wise alignments than the conventional matrix-based approach. PR2ALIGN will be helpful for researchers who wish to align amino acid sequences by using flexible user-specified alignment scoring functions based on the biochemical properties of amino acids instead of the amino acid substitution matrix. To the best of the authors' knowledge, there are no existing stand-alone software programs or web-servers analogous to PR2ALIGN. The software is freely available from http://pr2align.rit.albany.edu.

  17. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp) consumed in Brazil.

    Science.gov (United States)

    Pereira, Elenilda J; Carvalho, Lucia M J; Dellamora-Ortiz, Gisela M; Cardoso, Flávio S N; Carvalho, José L V

    2016-01-01

    The cowpea (Vigna unguiculata L. Wap.) is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  18. Circadian Clocks: Unexpected Biochemical Cogs.

    Science.gov (United States)

    Mori, Tetsuya; Mchaourab, Hassane; Johnson, Carl Hirschie

    2015-10-05

    A circadian oscillation can be reconstituted in vitro from three proteins that cycles with a period of ∼ 24 h. Two recent studies provide surprising biochemical answers to why this remarkable oscillator has such a long time constant and how it can switch effortlessly between alternating enzymatic modes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Circadian Clocks: Unexpected Biochemical Cogs

    OpenAIRE

    Mori, Tetsuya; Mchaourab, Hassane; Johnson, Carl Hirschie

    2015-01-01

    A circadian oscillation can be reconstituted in vitro from three proteins that cycles with a period of ~24 h. Two recent studies provide surprising biochemical answers to why this remarkable oscillator has such a long time constant and how it can switch effortlessly between alternating enzymatic modes.

  20. Identifying optimal models to represent biochemical systems.

    Directory of Open Access Journals (Sweden)

    Mochamad Apri

    Full Text Available Biochemical systems involving a high number of components with intricate interactions often lead to complex models containing a large number of parameters. Although a large model could describe in detail the mechanisms that underlie the system, its very large size may hinder us in understanding the key elements of the system. Also in terms of parameter identification, large models are often problematic. Therefore, a reduced model may be preferred to represent the system. Yet, in order to efficaciously replace the large model, the reduced model should have the same ability as the large model to produce reliable predictions for a broad set of testable experimental conditions. We present a novel method to extract an "optimal" reduced model from a large model to represent biochemical systems by combining a reduction method and a model discrimination method. The former assures that the reduced model contains only those components that are important to produce the dynamics observed in given experiments, whereas the latter ensures that the reduced model gives a good prediction for any feasible experimental conditions that are relevant to answer questions at hand. These two techniques are applied iteratively. The method reveals the biological core of a model mathematically, indicating the processes that are likely to be responsible for certain behavior. We demonstrate the algorithm on two realistic model examples. We show that in both cases the core is substantially smaller than the full model.

  1. The impact of conventional dietary intake data coding methods on foods typically consumed by low-income African-American and White urban populations.

    Science.gov (United States)

    Mason, Marc A; Fanelli Kuczmarski, Marie; Allegro, Deanne; Zonderman, Alan B; Evans, Michele K

    2015-08-01

    Analysing dietary data to capture how individuals typically consume foods is dependent on the coding variables used. Individual foods consumed simultaneously, like coffee with milk, are given codes to identify these combinations. Our literature review revealed a lack of discussion about using combination codes in analysis. The present study identified foods consumed at mealtimes and by race when combination codes were or were not utilized. Duplicate analysis methods were performed on separate data sets. The original data set consisted of all foods reported; each food was coded as if it was consumed individually. The revised data set was derived from the original data set by first isolating coded foods consumed as individual items from those foods consumed simultaneously and assigning a code to designate a combination. Foods assigned a combination code, like pancakes with syrup, were aggregated and associated with a food group, defined by the major food component (i.e. pancakes), and then appended to the isolated coded foods. Healthy Aging in Neighborhoods of Diversity across the Life Span study. African-American and White adults with two dietary recalls (n 2177). Differences existed in lists of foods most frequently consumed by mealtime and race when comparing results based on original and revised data sets. African Americans reported consumption of sausage/luncheon meat and poultry, while ready-to-eat cereals and cakes/doughnuts/pastries were reported by Whites on recalls. Use of combination codes provided more accurate representation of how foods were consumed by populations. This information is beneficial when creating interventions and exploring diet-health relationships.

  2. Analysis of the average poly-cyclic aromatic unit in a meta-anthracite coal using conventional x-ray powder diffraction and intensity separation methods

    International Nuclear Information System (INIS)

    Wertz, D.L.; Bissell, M.

    1994-01-01

    X-ray characterizations of coals and coal products have occurred for many years. Hirsch and Cartz measured the diffraction from several coals over the reciprocal space region from s = 0.12 angstrom -1 to 7.5 angstrom -1 where s = (4π/λ) sinΘ. In these studies, a 9 cm powder camera was used to study the high angle region, and a transmission type focusing camera equipped with a LiF monochromator was used for the low angle measurements. They reported that the height of the graphene peak measured for each coal is proportional to the % carbon in the coals. Hirsch also suggested that the ontyberem anthracite has a lamellar diameter of ca. 16 angstrom corresponding to an aromatic lamellae of ca. C 87 . For coals with lower carbon content, Hirsch proposed much smaller lamellae; C 19 for a coal with 80% carbon, and C 24 for a coal with 89% carbon. The subject coal for this study is a meta-anthracite which was derived from the Portsmouth, RI mine. The Narragansett Basin contains anthracite and meta-anthracite coals of Pennsylvanian Age. The Basin was a techtonically active non-marine coal-forming basin which has been impacted by several tectonic events. Because of the importance placed by coal scientists no correctly characterizing the nature of the micro-level structural cluster(s) in coals and because of improvements in both x-ray experimentation capabilities and computing power, we have measured the x-ray diffraction and scattering produced from irradiation of this meta-anthracite coal which contains about 94% aromatic carbon. The goal of our study is to determine the intra-planar, and where possible, inter-planar structural details of coals. To accomplish this goal we have utilized the methods normally used for the molecular analysis of non-crystalline condensed phases such as liquids, solutions, and amorphous solids. Reported herein are the results obtained from the high angle x-ray analysis of this coal

  3. Advantages of liquid nitrogen freezing of Penaeus monodon over conventional plate freezing

    OpenAIRE

    Chakrabarti, R.; Chaudhury, D.R.

    1987-01-01

    Liquid nitrogen frozen products are biochemically and organoleptically superior to conventional plate frozen products but beneficial effect of liquid nitrogen freezing over conventional plate freezing can exist only up to 59 days at a commercial storage temperature of -18°C.

  4. Modelling biochemical networks with intrinsic time delays: a hybrid semi-parametric approach

    Directory of Open Access Journals (Sweden)

    Oliveira Rui

    2010-09-01

    Full Text Available Abstract Background This paper presents a method for modelling dynamical biochemical networks with intrinsic time delays. Since the fundamental mechanisms leading to such delays are many times unknown, non conventional modelling approaches become necessary. Herein, a hybrid semi-parametric identification methodology is proposed in which discrete time series are incorporated into fundamental material balance models. This integration results in hybrid delay differential equations which can be applied to identify unknown cellular dynamics. Results The proposed hybrid modelling methodology was evaluated using two case studies. The first of these deals with dynamic modelling of transcriptional factor A in mammalian cells. The protein transport from the cytosol to the nucleus introduced a delay that was accounted for by discrete time series formulation. The second case study focused on a simple network with distributed time delays that demonstrated that the discrete time delay formalism has broad applicability to both discrete and distributed delay problems. Conclusions Significantly better prediction qualities of the novel hybrid model were obtained when compared to dynamical structures without time delays, being the more distinctive the more significant the underlying system delay is. The identification of the system delays by studies of different discrete modelling delays was enabled by the proposed structure. Further, it was shown that the hybrid discrete delay methodology is not limited to discrete delay systems. The proposed method is a powerful tool to identify time delays in ill-defined biochemical networks.

  5. Conventions and Institutional Logics

    DEFF Research Database (Denmark)

    Westenholz, Ann

    Two theoretical approaches – Conventions and Institutional Logics – are brought together and the similarities and differences between the two are explored. It is not the intention to combine the approaches, but I would like to open both ‘boxes’ and make them available to each other with the purpose...... of creating a space for dialog. Both approaches were developed in the mid-1980s as a reaction to rational-choice economic theory and collectivistic sociological theory. These two theories were oversimplifying social life as being founded either in actor-micro level analyses or in structure-macro level...... analyses. The theoretical quest of both Conventions and Institutional Logics has been to understand the increasing indeterminacy, uncertainty and ambiguity in people’s lives where a sense of reality, of value, of moral, of feelings is not fixed. Both approaches have created new theoretical insights...

  6. Manado Convention Centre (Megastructures)

    OpenAIRE

    Anggianto, Rio M; Rate, Johannes Van

    2013-01-01

    Proyek Manado Convention Center ini pada dasarnya merupakan wadah atau sarana komunikasi antara dua pihak dengan penerapkan berbagai metode komunikasi langsung tatap muka baik itu dari perorangan terhadap kelompok, kelompok terhadap kelompok atau kelompok terhadap masyarakat. Dan pada era kini hal ini menjadi suatu kebutuhan yang dianganggap penting. Kota Manado seringkali menjadi tuan rumah suatu konverensi dengan jumlah peserta yang tergolong besar karena cakupannya sampai manca negara....

  7. The conventional quark picture

    International Nuclear Information System (INIS)

    Dalitz, R.H.

    1976-01-01

    For baryons, mesons and deep inelastic phenomena the ideas and the problems of the conventional quark picture are pointed out. All observed baryons fit in three SU(3)-multiplets which cluster into larger SU(6)-multiplets. No mesons are known which have quantum numbers inconsistent with belonging to a SU(3) nonet or octet. The deep inelastic phenomena are described in terms of six structure functions of the proton. (BJ) [de

  8. Pin count-aware biochemical application compilation for mVLSI biochips

    DEFF Research Database (Denmark)

    Lander Raagaard, Michael; Pop, Paul

    2015-01-01

    Microfluidic biochips are replacing the conventional biochemical analyzers and are able to integrate the necessary functions for biochemical analysis on-chip. In this paper we are interested in flow-based biochips, in which the fluidic flow manipulated using integrated microvalves, which are cont...... a biochemical application. We focus on the compilation task, where the strategy is to delay operations, without missing their deadlines, such that the sharing of control signals is maximized. The evaluation shows a significant reduction in the number of control pins required....

  9. Immunological methods for the detection and determination of connective tissue proteoglycans

    DEFF Research Database (Denmark)

    Caterson, B; Baker, J R; Christner, J E

    1982-01-01

    In this paper we report the use of immunological methods for specifically detecting and determining proteoglycan in cartilage and other connective tissues. Antibodies (polyclonal and monoclonal) have been raised against specific components of cartilage proteoglycan aggregates (i.e., proteoglycan...... surrounding invaginating hair follicles. These immunological procedures are currently being used to complement conventional biochemical analyses of proteoglycans found in different connective tissue matrices....

  10. Biochemical and Heamatological Indices of Broiler Chickens fed ...

    African Journals Online (AJOL)

    SH

    investigate the implications of feeding broiler chickens with mucuna bean processed by simple domestic methods on performance, haematological and biochemical parameters. Materials and Methods. Sample preparation: The raw Mucuna pruriens beans used in this study were purchased from International Institute of.

  11. Biochemical Process Development and Integration | Bioenergy | NREL

    Science.gov (United States)

    Biochemical Process Development and Integration Biochemical Process Development and Integration Our conversion and separation processes to pilot-scale integrated process development and scale up. We also Publications Accounting for all sugar produced during integrated production of ethanol from lignocellulosic

  12. Biochemical markers of bone turnover

    International Nuclear Information System (INIS)

    Kim, Deog Yoon

    1999-01-01

    Biochemical markers of bone turnover has received increasing attention over the past few years, because of the need for sensitivity and specific tool in the clinical investigation of osteoporosis. Bone markers should be unique to bone, reflect changes of bone less, and should be correlated with radiocalcium kinetics, histomorphometry, or changes in bone mass. The markers also should be useful in monitoring treatment efficacy. Although no bone marker has been established to meet all these criteria, currently osteocalcin and pyridinium crosslinks are the most efficient markers to assess the level of bone turnover in the menopausal and senile osteoporosis. Recently, N-terminal telopeptide (NTX), C-terminal telopeptide (CTX) and bone specific alkaline phosphatase are considered as new valid markers of bone turnover. Recent data suggest that CTX and free deoxypyridinoline could predict the subsequent risk of hip fracture of elderly women. Treatment of postmenopausal women with estrogen, calcitonin and bisphosphonates demonstrated rapid decrease of the levels of bone markers that correlated with the long-term increase of bone mass. Factors such as circadian rhythms, diet, age, sex, bone mass and renal function affect the results of biochemical markers and should be appropriately adjusted whenever possible. Each biochemical markers of bone turnover may have its own specific advantages and limitations. Recent advances in research will provide more sensitive and specific assays

  13. Biochemical toxicology of environmental agents

    International Nuclear Information System (INIS)

    Bruin, A. de

    1976-01-01

    A thorough and up-to-date account of the molecular-biological aspects of harmful agents - both chemical and physical - is given. This current treatise is principally intended to serve as an informative reference work for researchers in various areas of the field. In the pursuit of this aim, a devision of the entire field into 42 chapters has been made. Each chapter starts with a short introductory account dealing with the biochemical essentials of the particular subject. Radiation effects are discussed briefly at the end of each treatise. In order to make the treatise useful as a source book, a substantial collection of pertinent literature references is provided which are numbered in order of citation in the text. Initial chapters are devoted to the metabolic fate of the major classes of xenobiotic compounds. Peripheral topics, closely related to metabolism and dealing with modification of xenobiotic-metabolizing ability, as well as interaction phenomena follow (chs. 5-8). Subjects that draw heavily on the practical field of occupational hygiene are dealt with in chapters 9 and 10. The systematic treatment of how chemical and physical agents interact with the various biochemical and enzymatic systems they encounter during their passage through the organism occupies quantitatively the main part of the book (chs. 11-36). Finally, radiation biochemistry is discussed from the viewpoint of its high degree of scientific advancement, and secondly because the type of biochemical changes produced in vivo by X-rays closely parallel those evoked by chemical agents

  14. Strategic interaction and conventions

    Directory of Open Access Journals (Sweden)

    Espinosa, María Paz

    2012-03-01

    Full Text Available The scope of the paper is to review the literature that employs coordination games to study social norms and conventions from the viewpoint of game theory and cognitive psychology. We claim that those two alternative approaches are in fact complementary, as they provide different insights to explain how people converge to a unique system of self-fulfilling expectations in presence of multiple, equally viable, conventions. While game theory explains the emergence of conventions relying on efficiency and risk considerations, the psychological view is more concerned with frame and labeling effects. The interaction between these alternative (and, sometimes, competing effects leads to the result that coordination failures may well occur and, even when coordination takes place, there is no guarantee that the convention eventually established will be the most efficient.

    El objetivo de este artículo es presentar la literatura que emplea los juegos de coordinación para el estudio de normas y convenciones sociales, que se han analizado tanto desde el punto de vista de la teoría de juegos como de la psicología cognitiva. Argumentamos en este trabajo que estos dos enfoques alternativos son en realidad complementarios, dado que ambos contribuyen al entendimiento de los procesos mediante los cuales las personas llegan a coordinarse en un único sistema de expectativas autorrealizadas, en presencia de múltiples convenciones todas ellas igualmente viables. Mientras que la teoría de juegos explica la aparición de convenciones basándose en argumentos de eficiencia y comportamientos frente al riesgo, el enfoque de la psicología cognitiva utiliza en mayor medida consideraciones referidas al entorno y naturaleza de las decisiones. La interacción entre estos efectos diferentes (y en ocasiones, rivales desemboca con frecuencia en fallos de coordinación y, aun cuando la coordinación se produce, no hay garantía de que la convención en vigor sea la m

  15. Digitization of conventional radiographs

    International Nuclear Information System (INIS)

    Wenz, W.; Buitrago-Tellez, C.; Blum, U.; Hauenstein, K.H.; Gufler, H.; Meyer, E.; Ruediger, K.

    1992-01-01

    The diagnostic value of a digitization system for analogue films based on a charge-coupled-device (CCD) scanner with adjustable resolution of 2.5 or 5 lp/mm was assessed. Some 110 skeletal radiographs, 50 contrast studies, including 25 of patients with Crohn's disease, and 70 abdominal plain films before and after successful lithotripsy for renal stones were digitized. Receiver operating characteristic (ROC) studies showed improved detection of cortical and trabecular defects with contrast-optimized digitized films. Edge enhancement algorithms yielded no additional information. Inflammatory lesions of Crohn's disease were detected equally well by conventional films and digitized images. A statistically significant improvement (p [de

  16. Conventional RF system design

    International Nuclear Information System (INIS)

    Puglisi, M.

    1994-01-01

    The design of a conventional RF system is always complex and must fit the needs of the particular machine for which it is planned. It follows that many different design criteria should be considered and analyzed, thus exceeding the narrow limits of a lecture. For this reason only the fundamental components of an RF system, including the generators, are considered in this short seminar. The most common formulas are simply presented in the text, while their derivations are shown in the appendices to facilitate, if desired, a more advanced level of understanding. (orig.)

  17. Conventional magnets. Pt. 1

    International Nuclear Information System (INIS)

    Marks, N.

    1994-01-01

    The design and construction of conventional, steel-cored, direct-current magnets are discussed. Laplace's equation and the associated cylindrical harmonic solutions in two dimensions are established. The equations are used to define the ideal pole shapes and required excitation for dipole, quadrupole and sextupole magnets. Standard magnet geometries are then considered and criteria determining the coil design are presented. The use of codes for predicting flux density distributions and the iterative techniques used for pole face design are then discussed. This includes a description of the use of two-dimensional codes to generate suitable magnet end geometries. Finally, standard constructional techniques for cores and coils are described. (orig.)

  18. Comparison of biomarker based Matrix Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) and conventional methods in the identification of clinically relevant bacteria and yeast.

    Science.gov (United States)

    Kassim, Ali; Pflüger, Valentin; Premji, Zul; Daubenberger, Claudia; Revathi, Gunturu

    2017-05-25

    MALDI-TOF MS is an analytical method that has recently become integral in the identification of microorganisms in clinical laboratories. It relies on databases that majorly employ pattern recognition or fingerprinting. Biomarker based databases have also been developed and there is optimism that these may be superior to pattern recognition based databases. This study compared the performance of ribosomal biomarker based MALDI-TOF MS and conventional methods in the identification of selected bacteria and yeast. The study was a cross sectional study identifying clinically relevant bacteria and yeast isolated from varied clinical specimens submitted to a clinical laboratory. The identification of bacteria using conventional Vitek 2™ automated system, serotyping and MALDI-TOF MS was performed as per standard operating procedures. Comparison of sensitivities were then carried out using Pearson Chi-Square test and p-value of bacteria and Gram positive bacteria to the species level. For the Gram positive bacteria, significant difference was observed in the identification of Coagulase negative Staphylococci (p = 0.000) and Enterococcus (p = 0.008). Significant difference was also observed between serotyping and MALDI-TOF MS (p = 0.005) and this was attributed to the lack of identification of Shigella species by MALDI-TOF MS. There was no significant difference observed in the identification of yeast however some species of Candida were unidentified by MALDI-TOF MS. Biomarker based MALDI-TOF MS had good performance in a clinical laboratory setting with high sensitivities in the identification of clinically relevant microorganisms.

  19. Higher-Than-Conventional Radiation Doses in Localized Prostate Cancer Treatment: A Meta-analysis of Randomized, Controlled Trials

    International Nuclear Information System (INIS)

    Viani, Gustavo Arruda; Stefano, Eduardo Jose; Afonso, Sergio Luis

    2009-01-01

    Purpose: To determine in a meta-analysis whether the outcomes in men with localized prostate cancer treated with high-dose radiotherapy (HDRT) are better than those in men treated with conventional-dose radiotherapy (CDRT), by quantifying the effect of the total dose of radiotherapy on biochemical control (BC). Methods and Materials: The MEDLINE, EMBASE, CANCERLIT, and Cochrane Library databases, as well as the proceedings of annual meetings, were systematically searched to identify randomized, controlled studies comparing HDRT with CDRT for localized prostate cancer. To evaluate the dose-response relationship, we conducted a meta-regression analysis of BC ratios by means of weighted linear regression. Results: Seven RCTs with a total patient population of 2812 were identified that met the study criteria. Pooled results from these RCTs showed a significant reduction in the incidence of biochemical failure in those patients with prostate cancer treated with HDRT (p 2 gastrointestinal toxicity after HDRT than after CDRT. In the subgroup analysis, patients classified as being at low (p = 0.007), intermediate (p < 0.0001), and high risk (p < 0.0001) of biochemical failure all showed a benefit from HDRT. The meta-regression analysis also detected a linear correlation between the total dose of radiotherapy and biochemical failure (BC = -67.3 + [1.8 x radiotherapy total dose in Gy]; p = 0.04). Conclusions: Our meta-analysis showed that HDRT is superior to CDRT in preventing biochemical failure in low-, intermediate-, and high-risk prostate cancer patients, suggesting that this should be offered as a treatment for all patients, regardless of their risk status.

  20. High-throughput identification of bacteria and yeast by matrix-assisted laser desorption ionization-time of flight mass spectrometry in conventional medical microbiology laboratories.

    Science.gov (United States)

    van Veen, S Q; Claas, E C J; Kuijper, Ed J

    2010-03-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is suitable for high-throughput and rapid diagnostics at low costs and can be considered an alternative for conventional biochemical and molecular identification systems in a conventional microbiological laboratory. First, we evaluated MALDI-TOF MS using 327 clinical isolates previously cultured from patient materials and identified by conventional techniques (Vitek-II, API, and biochemical tests). Discrepancies were analyzed by molecular analysis of the 16S genes. Of 327 isolates, 95.1% were identified correctly to genus level, and 85.6% were identified to species level by MALDI-TOF MS. Second, we performed a prospective validation study, including 980 clinical isolates of bacteria and yeasts. Overall performance of MALDI-TOF MS was significantly better than conventional biochemical systems for correct species identification (92.2% and 83.1%, respectively) and produced fewer incorrect genus identifications (0.1% and 1.6%, respectively). Correct species identification by MALDI-TOF MS was observed in 97.7% of Enterobacteriaceae, 92% of nonfermentative Gram-negative bacteria, 94.3% of staphylococci, 84.8% of streptococci, 84% of a miscellaneous group (mainly Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella [HACEK]), and 85.2% of yeasts. MALDI-TOF MS had significantly better performance than conventional methods for species identification of staphylococci and genus identification of bacteria belonging to HACEK group. Misidentifications by MALDI-TOF MS were clearly associated with an absence of sufficient spectra from suitable reference strains in the MALDI-TOF MS database. We conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria (except for pneumococci and viridans streptococci) and yeasts in a medical microbiological laboratory.

  1. Biochemical characterization of cholesterol-reducing Eubacterium.

    Science.gov (United States)

    Mott, G E; Brinkley, A W; Mersinger, C L

    1980-12-01

    We characterized two isolates of cholesterol-reducing Eubacterium by conducting conventional biochemical tests and by testing various sterols and glycerolipids as potential growth factors. In media containing cholesterol and plasmenylethanolamine, the tests for nitrate reduction, indole production, and gelatin and starch hydrolyses were negative, and no acid was produced from any of 22 carbohydrates. Both isolates hydrolyzed esculin to esculetin, indicating beta-glycosidase activity. In addition to plasmenylethanolamine, five other lipids which contain an alkenyl ether residue supported growth of Eubacterium strain 403 in a lecithin-cholesterol base medium. Of six steroids tested, cholesterol, cholest-4-en-3-one, cholest-4-en-3 beta-ol (allocholesterol), and androst-5-en-3 beta-ol-17-one supported growth of Eubacterium strain 403. All four steroids were reduced to the 3 beta-ol, 5 beta-H products. The delta 5 steroids cholest-5-en-3 alpha-ol (epicholesterol) and 22,23-bisnor-5-cholenic acid-3-beta-ol were not reduced and did not support growth of the Eubacterium strain.

  2. Technical Efficiency Performance of Conventional Banks

    OpenAIRE

    Endri, Endri

    2012-01-01

    This study aims to measure the performance of the technical efficiency of the conventional commercial banks during the period 2008-2009 by using non-parametric method of Data Envelopment Analysis (DEA). Test results showed that the total of all conventional commercial banks during the period 2008-2009 has not shown that optimal performance in which the level of technical efficiency is still below 100 percent. Appalling conditions, the efficiency of national banks experienced a decline of 73.5...

  3. Biochemical Abnormalities in Batten's Syndrome

    DEFF Research Database (Denmark)

    Clausen, Jytte Lene; Nielsen, Gunnar Gissel; Jensen, Gunde Egeskov

    1978-01-01

    The present data indicate that a group of ten patients with Batten's syndrome showed reduced activity of erythrocyte glutathione (GSH) peroxidase (Px) (glutathione: H2O2 oxidoreductase, EC 1.1.1.9.) using H2O2 as peroxide donor. Assay of erythrocyte GSHPx using H2O2, cumene hydroperoxide and t......-butyl hydroperoxide as donors also makes it possible biochemically to divide Batten's syndrome into two types: (1) one type with decreased values when H2O2 and cumene hydroperoxide are used, and (2) one type with increased values when t-butyl hydroperoxide is used. Furthermore an increased content of palmitic, oleic...

  4. Slot-waveguide biochemical sensor.

    Science.gov (United States)

    Barrios, Carlos A; Gylfason, Kristinn B; Sánchez, Benito; Griol, Amadeu; Sohlström, H; Holgado, M; Casquel, R

    2007-11-01

    We report an experimental demonstration of an integrated biochemical sensor based on a slot-waveguide microring resonator. The microresonator is fabricated on a Si3N4-SiO2 platform and operates at a wavelength of 1.3 microm. The transmission spectrum of the sensor is measured with different ambient refractive indices ranging from n=1.33 to 1.42. A linear shift of the resonant wavelength with increasing ambient refractive index of 212 nm/refractive index units (RIU) is observed. The sensor detects a minimal refractive index variation of 2x10(-4) RIU.

  5. Thermodynamic analysis of biochemical systems

    International Nuclear Information System (INIS)

    Yuan, Y.; Fan, L.T.; Shieh, J.H.

    1989-01-01

    Introduction of the concepts of the availability (or exergy), datum level materials, and the dead state has been regarded as some of the most significant recent developments in classical thermodynamics. Not only the available energy balance but also the material and energy balances of a biological system may be established in reference to the datum level materials in the dead state or environment. In this paper these concepts are illustrated with two examples of fermentation and are shown to be useful in identifying sources of thermodynamic inefficiency, thereby leading naturally to the rational definition of thermodynamic efficiency of a biochemical process

  6. Effects of limited access dressing in chronic wounds: A biochemical and histological study

    Directory of Open Access Journals (Sweden)

    Thittamaranahalli Muguregowda Honnegowda

    2015-01-01

    Full Text Available Background: Negative pressure wound therapy has emerged as an attractive treatment modality for the management and healing of chronic ulcers. Though numerous clinical studies are available, there is a lack of biochemical and histological studies evaluating the healing of chronic wounds. Materials and Methods: In the present study, a total 60 patients were divided into two groups: Limited access dressing (LAD group (n = 30 and conventional dressing group (n = 30. Various biochemical parameters such as hydroxyproline, total protein and antioxidants such as reduced glutathione (GSH, glutathione peroxidase (GPx, catalase (CAT and oxidative biomarker malondialdhyde (MDA are measured in the granulation tissue. Histologically amount of inflammatory infiltrate, angiogenesis, and collagen deposition are studied to assess wound healing. Results: Patients treated with LAD have shown significant increase in the mean (±standard deviation hydroxyproline (77.3 ± 30.1 vs. 32.3 ± 16.18; P = 0.026, total protein (13.89 ± 9.0 vs. 8.9 ± 4.59; P = 0.004, GSH (7.4 ± 1.91 vs. 5.1 ± 1.28; P = 0.039, GPx (122.3 ± 59.3 vs. 88.7 ± 34.11; P = 0.030, CAT (1.80 ± 1.14 vs. 0.9 ± 0.71; P = 0.002 and decrease in MDA (13.4 ± 5.5 vs. 8.6 ± 3.8; P = 0.004. Histological study showed comparatively fewer inflammatory cells, increased and well organised collagen bundles, and more angiogenesis in the LAD group when compared with that with conventional dressing after 10 days of treatment. Conclusion: In the present study, we have found beneficial effect of newer intermittent negative pressure therapy in combination with moist environment (LAD on chronic wound healing by increasing collagen deposition and angiogenesis; and reducing oxidative stress and inflammatory infiltrate.

  7. Advanced nanoimprint patterning for functional electronics and biochemical sensing

    Science.gov (United States)

    Wang, Chao

    Nano-fabrication has been widely used for a variety of disciplines, including electronics, material science, nano-optics, and nano-biotechnology. This dissertation focuses on nanoimprint lithography (NIL) based novel nano-patterning techniques for fabricating functional structures, and discusses their applications in advanced electronics and high-sensitivity molecular sensing. In this dissertation, examples of using nano-fabricated structures for promising electronic applications are presented. For instance, 10 nm and 18 nm features are NIL-fabricated for Si/SiGe heterojunction tunneling transistors and graphene nano-ribbon transistors, using shadow evaporation and line-width shrinking techniques, respectively. An ultrafast laser melting based method is applied on flexible plastic substrates to correct defects of nano-features. Nano-texturing of sapphire substrate is developed to improve the light extraction of GaN light emitting diodes (LEDs) by 70 %. A novel multi-layer nano-patterned Si-mediated catalyst is discovered to grow straight and uniform Si nanowires with optimized properties in size, location, and crystallization on amorphous SiO2 substrate. Nano-structures are also functionalized into highly sensitive bio-chemical sensors. Plasmonic nano-bar antenna arrays are demonstrated to effectively sense infrared molecules >10 times better than conventional plasmonic sensors. As small as 20 nm wide nano-channel fluidic devices are developed to linearize and detect DNA molecules for potential DNA sequencing. An integrated fluidic system is built to incorporate plasmonic nano-structures for 30X-enhanced fluorescence detection of large DNA molecules.

  8. Diagnosis Of Inherited Neurometabolic Disorders : A Biochemical Approach

    Directory of Open Access Journals (Sweden)

    Christopher R

    1999-01-01

    Full Text Available The past two decades have witnessed a rapid increase in the knowledge of the inherited neurometabolic disorders. The precise diagnosis of these disorders which is a challenge to the physician can be best accomplished by biochemical methods. Screening of clinically selected patients with simple chemical urine tests and routine blood chemistry investigations followed by measurement of specific metabolites and assay of the relevant enzymes confirms the diagnosis in most cases. Biochemical diagnosis of inherited neurometabolic disorders although expensive is rapid and confirmatory and therefore aids in treatment and further prevention of these rare disorders.

  9. Effect of Probiotics on Serum Biochemical and Blood Constituents in ...

    African Journals Online (AJOL)

    Purpose: To examine the effects of two commercial probiotics (Toyocerin and CloSTAT) on serum enzyme activities, and hematological and biochemical indices of broiler chickens challenged with Salmonella enterica serovars Typhimurium (ST). Methods: The chicks received one of the following treatments at 0 day of age: ...

  10. Pattern Of Biochemical Derangements Seen In Chronic Renal ...

    African Journals Online (AJOL)

    Objective: To study the pattern of biochemical derangements in advanced renal failure patients. Subjects and Methods: Ninety adult patients [54 males and 36 females] were recruited from the renal clinic of the University of Nigeria Teaching Hospital (UNTH) Enugu over a period of one year. History and physical ...

  11. Effect of natural growth promoters on immunity, and biochemical and ...

    African Journals Online (AJOL)

    biochemical and haematological parameters of broiler chickens. Syed Muddassar ... acids, phytobiotics, and their combinations) as feed additives in poultry feed. Methods: Different feed ... by nutrition, season, climate change, age, sex, type of birds and ... glucose, cholesterol, triglyceride, high density lipoprotein (HDL), low ...

  12. Haematological and biochemical values of 10 green iguanas (Iguana iguana).

    Science.gov (United States)

    Divers, S J; Redmayne, G; Aves, E K

    1996-03-02

    Ten clinically healthy green iguanas (Iguana iguana) imported from South America were examined, and haematological and biochemical measurements were made on samples of blood. This paper describes the methods of blood sampling, handling and laboratory analysis, and presents the results as a set of normal blood ranges for the green iguana.

  13. Biochemical response of normal albino rats to the addition of ...

    African Journals Online (AJOL)

    Experiments were conducted to determine the biochemical effect of Hibiscus cannabinus and Murraya koenigii extracts on normal albino rats using standard methods. Analyses carried out indicated that the aqueous leaf extract of H. cannabinus and M. koenigii exhibited significant hypolipideamic activity in normal rats.

  14. Differential response of biochemical parameters to EMS and MMS ...

    African Journals Online (AJOL)

    (1964) and biochemical estimations from the liver was done by the method of Sinha (1972) for catalase, Van der Vies (1954) for glycogen and Uchiyama and Mihara (1978) for MDA. Results: The study has revealed that EMS and MMS induced a dose dependent increase in chromosomal aberrations of chromatid type in the ...

  15. Association of Biochemical Markers, Hepatitis C Virus and Diabetes ...

    African Journals Online (AJOL)

    Purpose: To investigate the association between Hepatitis C Virus (HCV) infection and diabetes mellitus (DM), and the effects of these pathological conditions on some biochemical markers in Pakistanis. Methods: A total number of 4717 chronic HCV patients were enrolled in this study out of which 4250 were positive with ...

  16. ESD and the Rio Conventions

    Science.gov (United States)

    Sarabhai, Kartikeya V.; Ravindranath, Shailaja; Schwarz, Rixa; Vyas, Purvi

    2012-01-01

    Chapter 36 of Agenda 21, a key document of the 1992 Earth Summit, emphasised reorienting education towards sustainable development. While two of the Rio conventions, the Convention on Biological Diversity (CBD) and the United Nations Framework Convention on Climate Change (UNFCCC), developed communication, education and public awareness (CEPA)…

  17. INVESTIGATIONS ON BIOCHEMICAL PURIFICATION OF GROUND WATER FROM HYDROGEN SULFIDE

    Directory of Open Access Journals (Sweden)

    Yu. P. Sedlukho

    2015-01-01

    Full Text Available The paper considers problems and features of biochemical removal of hydrogen sulfide from ground water. The analysis of existing methods for purification of ground water from hydrogen sulfide has been given in the paper. The paper has established shortcomings of physical and chemical purification of ground water. While using aeration methods for removal of hydrogen sulfide formation of colloidal sulfur that gives muddiness and opalescence to water occurs due to partial chemical air oxidation. In addition to this violation of sulfide-carbonate equilibrium taking place in the process of aeration due to desorption of H2S and CO2, often leads to clogging of degasifier nozzles with formed CaCO3 that causes serious operational problems. Chemical methods require relatively large flow of complex reagent facilities, storage facilities and transportation costs.In terms of hydrogen sulfide ground water purification the greatest interest is given to the biochemical method. Factors deterring widespread application of the biochemical method is its insufficient previous investigation and necessity to execute special research in order to determine optimal process parameters while purifying groundwater of a particular water supply source. Biochemical methods for oxidation of sulfur compounds are based on natural biological processes that ensure natural sulfur cycle. S. Vinogradsky has established a two-stage mechanism for oxidation of hydrogen sulfide with sulfur bacteria (Beggiatoa. The first stage presupposes oxidation of hydrogen sulphide to elemental sulfur which is accumulating in the cytoplasm in the form of globules. During the second stage sulfur bacteria begin to oxidize intracellular sulfur to sulfuric acid due to shortage of hydrogen sulfide.The paper provides the results of technological tests of large-scale pilot plants for biochemical purification of groundwater from hydrogen sulfide in semi-industrial conditions. Dependences of water quality

  18. Analysis of Biochemical Control and Prognostic Factors in Patients Treated With Either Low-Dose Three-Dimensional Conformal Radiation Therapy or High-Dose Intensity-Modulated Radiotherapy for Localized Prostate Cancer

    International Nuclear Information System (INIS)

    Vora, Sujay A.; Wong, William W.; Schild, Steven E.; Ezzell, Gary A.; Halyard, Michele Y.

    2007-01-01

    Purpose: To identify prognostic factors and evaluate biochemical control rates for patients with localized prostate cancer treated with either high-dose intensity-modulated radiotherapy (IMRT) or conventional-dose three-dimensional conformal radiotherapy 3D-CRT. Methods: Four hundred sixteen patients with a minimum follow-up of 3 years (median, 5 years) were included. Two hundred seventy-one patients received 3D-CRT with a median dose of 68.4 Gy (range, 66-71 Gy). The next 145 patients received IMRT with a median dose of 75.6 Gy (range, 70.2-77.4 Gy). Biochemical control rates were calculated according to both American Society for Therapeutic Radiology and Oncology (ASTRO) consensus definitions. Prognostic factors were identified using both univariate and multivariate analyses. Results: The 5-year biochemical control rate was 60.4% for 3D-CRT and 74.1% for IMRT (p < 0.0001, first ASTRO Consensus definition). Using the ASTRO Phoenix definition, the 5-year biochemical control rate was 74.4% and 84.6% with 3D-RT and IMRT, respectively (p = 0.0326). Univariate analyses determined that PSA level, T stage, Gleason score, perineural invasion, and radiation dose were predictive of biochemical control. On multivariate analysis, dose, Gleason score, and perineural invasion remained significant. Conclusion: On the basis of both ASTRO definitions, dose, Gleason score, and perineural invasion were predictive of biochemical control. Intensity-modulated radiotherapy al