WorldWideScience

Sample records for control region sequences

  1. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  2. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  3. High Sequence Variations in Mitochondrial DNA Control Region among Worldwide Populations of Flathead Mullet Mugil cephalus

    Directory of Open Access Journals (Sweden)

    Brian Wade Jamandre

    2014-01-01

    Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.

  4. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  5. Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

    Science.gov (United States)

    Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.

    2014-01-01

    Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

  6. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

    Science.gov (United States)

    Wu, Liang; Yang, Jinzeng

    2012-01-01

    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species

  7. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  8. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... chain reaction (PCR). Japanese Spanish ... mainly covered general ecology and fishery biology. No study concerning the ... Conserved sequence blocks and the repeat units are indicated by boxes. performed using the exact ...

  9. Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

    Science.gov (United States)

    Pearce, J.M.

    2006-01-01

    Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

  10. Electricity sequence control

    International Nuclear Information System (INIS)

    Shin, Heung Ryeol

    2010-03-01

    The contents of the book are introduction of control system, like classification and control signal, introduction of electricity power switch, such as push-button and detection switch sensor for induction type and capacitance type machinery for control, solenoid valve, expression of sequence and type of electricity circuit about using diagram, time chart, marking and term, logic circuit like Yes, No, and, or and equivalence logic, basic electricity circuit, electricity sequence control, added condition, special program control about choice and jump of program, motor control, extra circuit on repeat circuit, pause circuit in a conveyer, safety regulations and rule about classification of electricity disaster and protective device for insulation.

  11. Constraining controls on carbonate sequences with high-resolution chronostratigraphy: Upper Miocene, Cabo de Gata region, SE Spain

    Science.gov (United States)

    Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.

    2001-01-01

    A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in

  12. Geographic structure and demographic history of Iranian brown bear (Ursus arctos based on mtDNA control region sequences

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Ashrafzadeh

    2015-12-01

    Full Text Available In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187 and high values of Fst (range=0.728-0.972 among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran was found to be around 19000 BP.

  13. Genetic relationships among some subspecies of the Peregrine Falcon (Falco peregrinus L.), inferred from mitochondrial DNA control-region sequences

    Science.gov (United States)

    White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.

    2013-01-01

    The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.

  14. Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

    Science.gov (United States)

    Montesino, Marta; Prieto, Lourdes

    2012-01-01

    Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

  15. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii) in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Science.gov (United States)

    Li, Yanhe; Guo, Xianwu; Chen, Liping; Bai, Xiaohui; Wei, Xinlan; Zhou, Xiaoyun; Huang, Songqian; Wang, Weimin

    2015-01-01

    Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC) in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA) were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China. PMID:26132567

  16. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  17. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  18. Quantitative controls on location and architecture of carbonate depositional sequences: upper miocene, cabo de gata region, se Spain

    Science.gov (United States)

    Franseen, E.K.; Goldstein, R.H.; Farr, M.R.

    1998-01-01

    Sequence stratigraphy, pinning-point relative sea-level curves, and magnetostratigraphy provide the quantitative data necessary to understand how rates of sea-level change and different substrate paleoslopes are dominant controls on accumulation rate, carbonate depositional sequence location, and internal architecture. Five third-order (1-10 my) and fourth-order (0.1-1.0 my) upper Miocene carbonate depositional sequences (DS1A, DS1B, DS2, DS3, TCC) formed with superimposed higher-frequency sea-level cycles in an archipelago setting in SE Spain. Overall, our study indicates when areas of high substrate slope (> 15??) are in shallow water, independent of climate, the location and internal architecture of carbonate deposits are not directly linked to sea-level position but, instead, are controlled by location of gently sloping substrates and processes of bypass. In contrast, if carbonate sediments are generated where substrates of low slope ( 15.6 cm/ky to ??? 2 cm/ky and overall relative sea level rose at rates of 17-21.4 cm/ky. Higher frequency sea-level rates were about 111 to more than 260 cm/ky, producing onlapping, fining- (deepening-) upward cycles. Decreasing accumulation rates resulted from decreasing surface area for shallow-water sediment production, drowning of shallow-water substrates, and complex sediment dispersal related to the archipelago setting. Typical systems tract and parasequence development should not be expected in "bypass ramp" settings; facies of onlapping strata do not track base level and are likely to be significantly different compared to onlapping strata associated with coastal onlap. Basal and upper DS2 reef megabreccias (indicating the transition from cool to warmer climatic conditions) were eroded from steep upslope positions and redeposited downslope onto areas of gentle substrate during rapid sea-level falls (> 22.7 cm/ky) of short duration. Such rapid sea-level falls and presence of steep slopes are not conducive to formation of

  19. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    Science.gov (United States)

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  20. Population structure of the African savannah elephant inferred from mitochondrial control region sequences and nuclear microsatellite loci

    DEFF Research Database (Denmark)

    Nyakaana, S; Arctander, P; Siegismund, H R

    2002-01-01

    Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...

  1. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  2. Loss of genetic variability in a hatchery strain of Senegalese sole (Solea senegalensis revealed by sequence data of the mitochondrial DNA control region and microsatellite markers

    Directory of Open Access Journals (Sweden)

    Pablo Sánchez

    2012-06-01

    Full Text Available Comparisons of the levels of genetic variation within and between a hatchery F1 (FAR, n=116 of Senegalese sole, Solea senegalensis, and its wild donor population (ATL, n = 26, both native to the SW Atlantic coast of the Iberian peninsula, as well as between the wild donor population and a wild western Mediterranean sample (MED, n=18, were carried out by characterizing 412 base pairs of the nucleotide sequence of the mitochondrial DNA control region I, and six polymorphic microsatellite loci. FAR showed a substantial loss of genetic variability (haplotypic diversity, h=0.49±0.066; nucleotide diversity, π=0.006±0.004; private allelic richness, pAg=0.28 to its donor population ATL (h=0.69±0.114; π=0.009±0.006; pAg=1.21. Pairwise FST values of microsatellite data were highly significant (P < 0.0001 between FAR and ATL (0.053 and FAR and MED (0.055. The comparison of wild samples revealed higher values of genetic variability in MED than in ATL, but only with mtDNA CR-I sequence data (h=0.948±0.033; π=0.030±0.016. However, pairwise ΦST and FST values between ATL and MED were highly significant (P < 0.0001 with mtDNA CR-I (0.228 and with microsatellite data (0.095, respectively. While loss of genetic variability in FAR could be associated with the sampling error when the broodstock was established, the results of parental and sibship inference suggest that most of these losses can be attributed to a high variance in reproductive success among members of the broodstock, particularly among females.

  3. Robustness analysis of chiller sequencing control

    International Nuclear Information System (INIS)

    Liao, Yundan; Sun, Yongjun; Huang, Gongsheng

    2015-01-01

    Highlights: • Uncertainties with chiller sequencing control were systematically quantified. • Robustness of chiller sequencing control was systematically analyzed. • Different sequencing control strategies were sensitive to different uncertainties. • A numerical method was developed for easy selection of chiller sequencing control. - Abstract: Multiple-chiller plant is commonly employed in the heating, ventilating and air-conditioning system to increase operational feasibility and energy-efficiency under part load condition. In a multiple-chiller plant, chiller sequencing control plays a key role in achieving overall energy efficiency while not sacrifices the cooling sufficiency for indoor thermal comfort. Various sequencing control strategies have been developed and implemented in practice. Based on the observation that (i) uncertainty, which cannot be avoided in chiller sequencing control, has a significant impact on the control performance and may cause the control fail to achieve the expected control and/or energy performance; and (ii) in current literature few studies have systematically addressed this issue, this paper therefore presents a study on robustness analysis of chiller sequencing control in order to understand the robustness of various chiller sequencing control strategies under different types of uncertainty. Based on the robustness analysis, a simple and applicable method is developed to select the most robust control strategy for a given chiller plant in the presence of uncertainties, which will be verified using case studies

  4. Keragaman Spesies Ikan Tuna di Pasar Ikan Kedonganan Bali dengan Analisis Sekuen Kontrol Daerah Mitokondria DNA (SPECIES DIVERSITY OF TUNA FISH USING MITOCHONDRIAL DNA CONTROL REGION SEQUENCE ANALYSIS AT KEDONGANAN FISH MARKET

    Directory of Open Access Journals (Sweden)

    Daud Steven Triyomi Hariyanto

    2015-10-01

    Full Text Available Tuna is an export commodity which has very high economic value. However, some tuna speciesare threatened with extinction. The purpose of this study was to identify the tuna species that aresold in Kedonganan Fish Market. The research method was polymerase chain reaction technique(PCR using the marker sequence mitochondrial DNA control region. Samples were obtained fromthe Fish Market tuna Kedonganan, Kuta, Badung, Bali. The total number of samples are 28specimens. Sequence from each sample was obtained through sequencing techniques. Sequencesobtained were run in BLAST (Basic Local Alignment Search Tool and subsequently analyzed withMEGA 5 for species confirmation. Three species of tuna that are identified in the Kedonganan FishMarket is: Thunnus albacares, T. obesus, and Katsuwonus pelamis. All three species have highgenetic variation HD = 1. This study needed to be continued with more number of samples todetermine the species of tuna sold in Kedonganan Fish Market.

  5. Time Separation Between Events in a Sequence: a Regional Property?

    Science.gov (United States)

    Muirwood, R.; Fitzenz, D. D.

    2013-12-01

    understand the rate controlling processes that determine such sequences per tectonic region and fluid/heat flow provinces.

  6. Ballooning mode second stability region for sequences of tokamak equilibria

    International Nuclear Information System (INIS)

    Sugiyama, L.; Mark, J.W.K.

    A numerical study of several sequences of tokamak equilibria derived from two flux conserving sequences confirms the tendency of high n ideal MHD ballooning modes to stabilize for values of the plasma beta greater than a second critical beta, for sufficiently favorable equilibria. The major stabilizing effect of increasing the inverse rotational transform profile q(Psi) for equilibria with the same flux surface geometry is shown. The unstable region shifts toward larger shear d ln q/d ln γ and the width of the region measured in terms of the poloidal beta or a pressure gradient parameter, for fixed shear, decreases. The smaller aspect ratio sequences are more sensitive to changes in q and have less stringent limits on the attainable value of the plasma beta in the high beta stable region. Finally, the disconnected mode approximation is shown to provide a reasonable description of the second high beta stability boundary

  7. Using a sequence characterized amplified region (SCAR) marker for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.

  8. Targeted sequencing of large genomic regions with CATCH-Seq.

    Directory of Open Access Journals (Sweden)

    Kenneth Day

    Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.

  9. Levels of integration in cognitive control and sequence processing in the prefrontal cortex.

    Science.gov (United States)

    Bahlmann, Jörg; Korb, Franziska M; Gratton, Caterina; Friederici, Angela D

    2012-01-01

    Cognitive control is necessary to flexibly act in changing environments. Sequence processing is needed in language comprehension to build the syntactic structure in sentences. Functional imaging studies suggest that sequence processing engages the left ventrolateral prefrontal cortex (PFC). In contrast, cognitive control processes additionally recruit bilateral rostral lateral PFC regions. The present study aimed to investigate these two types of processes in one experimental paradigm. Sequence processing was manipulated using two different sequencing rules varying in complexity. Cognitive control was varied with different cue-sets that determined the choice of a sequencing rule. Univariate analyses revealed distinct PFC regions for the two types of processing (i.e. sequence processing: left ventrolateral PFC and cognitive control processing: bilateral dorsolateral and rostral PFC). Moreover, in a common brain network (including left lateral PFC and intraparietal sulcus) no interaction between sequence and cognitive control processing was observed. In contrast, a multivariate pattern analysis revealed an interaction of sequence and cognitive control processing, such that voxels in left lateral PFC and parietal cortex showed different tuning functions for tasks involving different sequencing and cognitive control demands. These results suggest that the difference between the process of rule selection (i.e. cognitive control) and the process of rule-based sequencing (i.e. sequence processing) find their neuronal underpinnings in distinct activation patterns in lateral PFC. Moreover, the combination of rule selection and rule sequencing can shape the response of neurons in lateral PFC and parietal cortex.

  10. An ongoing earthquake sequence near Dhaka, Bangladesh, from regional recordings

    Science.gov (United States)

    Howe, M.; Mondal, D. R.; Akhter, S. H.; Kim, W.; Seeber, L.; Steckler, M. S.

    2013-12-01

    Earthquakes in and around the syntaxial region between the continent-continent collision of the Himalayan arc and oceanic subduction of the Sunda arc result primarily from the convergence of India and Eurasia-Sunda plates along two fronts. The northern front, the convergence of the Indian and Eurasian plates, has produced the Himalayas. The eastern front, the convergence of the Indian and Sunda plates, ranges from ocean-continent subduction at the Andaman Arc and Burma Arc, and transitions to continent-continent collision to the north at the Assam Syntaxis in northeast India. The India-Sunda convergence at the Burma Arc is extremely oblique. The boundary-normal convergence rate is ~17 mm/yr while the boundary-parallel rate is ~45 mm/yr including the well-known Sagaing strike-slip fault, which accommodates about half the shear component. This heterogeneous tectonic setting produces multiple earthquake sources that need to be considered when assessing seismic hazard and risk in this region. The largest earthquakes, just as in other subduction systems, are expected to be interplate events that occur on the low-angle megathrusts, such as the Mw 9.2 2004 Sumatra-Andaman earthquake and the 1762 earthquake along the Arakan margin. These earthquakes are known to produce large damage over vast areas, but since they account for large fault motions they are relatively rare. The majority of current seismicity in the study area is intraplate. Most of the seismicity associated with the Burma Arc subduction system is in the down-going slab, including the shallow-dipping part below the megathrust flooring the accretionary wedge. The strike of the wedge is ~N-S and Dhaka lies at its outer limit. One particular source relevant to seismic risk in Dhaka is illuminated by a multi-year sequence of earthquakes in Bangladesh less than 100 km southeast of Dhaka. The population in Dhaka (now at least 15 million) has been increasing dramatically due to rapid urbanization. The vulnerability

  11. Accommodation and supply—a dual control on stratigraphic sequences

    Science.gov (United States)

    Schlager, Wolfgang

    1993-07-01

    It is widely accepted that both eustatic and tectonically controlled regional changes of sea level have contributed to the record of stratigraphic sequences. I suggest that environmental change be added as a third, autonomous control. Sedimentologic principles clearly indicate that sequences and their systems tracts are controlled by the interplay of two rates —the rate of change in accommodation (space available for sedimentation) and the rate of sediment supply. Sea level has direct control on accommodation, but its influence on sediment supply is remote and easily overshadowed by environmental factors. For instance, the record of the most recent sea-level rise is a transgressive systems tract where supply is low; it is a prograding highstand systems tract in deltas where the supply is high. Examples of sequence boundaries generated by changes in sediment supply include tectonically driven shifts in sediment input into basins, changes in ocean currents, pulsating supply from failure of submarine slopes and drowning of carbonate platforms by environmental stress. Furthermore, the stratigraphic sequences in fluviatile continental basins are physically removed from sea-level induced changes in accommodation and must have formed by changes in the rate and pattern of supply. Subaerial exposure of marine sediments at the sequence boundary is a most important criterion for recognizing sea level cycles as opposed to supply cycles. Other criteria include downstepping of shelf breaks and characteristic patterns in the spacing of time lines within sequences. Some third-order cycles (ca. 0.5-3 Ma duration) meet these criteria, others do not. Cycle-stacking patterns and the shifting facies belts on cratons indicate that many second- and third-order cycles lack pronounced exposure unconformities and represent gradual changes superimposed on more rapid, shorter oscillations. Seismic data yield poor images of these gradational changes because they lack resolution. Seismic

  12. Molecular Identification and Historic Demography of the Marine Tucuxi (Sotalia guianensis at the Amazon River’s Mouth by Means of Mitochondrial Control Region Gene Sequences and Implications for Conservation

    Directory of Open Access Journals (Sweden)

    Joseph Mark Shostell

    2013-09-01

    Full Text Available In 2005, three fishermen, with artisan fishing vessels and drift gillnets, accidentally captured around 200 dolphins between Vigia and Salinópolis in the Amazon River estuary. The dolphins died and they then prepared their vaginas and penises in order to sell them in the Ver-ao-Peso market in the city of Belem within the Brazilian state of Pará. We randomly sampled a minimal quantity of tissue of these sexual organs from 78 of these 200 dolphins and we determined the following results after sequencing 689 base pairs (bp from the mitochondrial control region gene: (1 96.15% (75/78 of these dolphins belonged to the species Sotalia guianensis. The other species detected were Steno brenadensis, Stenella coeruleoalba and Tursiops truncatus; (2 The levels of gene diversity found in this sample of S. guianensis were high (33 haplotypes, haplotype diversity of 0.917 and nucleotide diversity of 0.0045 compared to gene diversities found in other Brazilian S. guianensis locations; (3 All the population genetics methods employed indicated a clear population expansion in this population. This population expansion could have begun 400,000 years ago; (4 The haplotype divergence within this population could have begun around 2.1 millions of years ago (MYA, with posterior splits around 2.0–1.8 MYA, 1.7–1.8 MYA, 1–1.5 MYA, 0.6–0.8 MYA, 0.4–0.2 MYA and 0.16–0.02 MYA, all during the Pleistocene.

  13. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  14. A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

    Science.gov (United States)

    Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

    1996-10-01

    The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

  15. Artificial Intelligence Controls Tape-Recording Sequence

    Science.gov (United States)

    Schwuttke, Ursula M.; Otamura, Roy M.; Zottarelli, Lawrence J.

    1989-01-01

    Developmental expert-system computer program intended to schedule recording of large amounts of data on limited amount of magnetic tape. Schedules recording using two sets of rules. First set incorporates knowledge of locations for recording of new data. Second set incorporates knowledge about issuing commands to recorder. Designed primarily for use on Voyager Spacecraft, also applicable to planning and sequencing in industry.

  16. Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.

    Directory of Open Access Journals (Sweden)

    You-Wang Lu

    Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.

  17. The complementarity-determining region sequences in IgY antivenom hypervariable regions

    Directory of Open Access Journals (Sweden)

    David Gitirana da Rocha

    2017-08-01

    Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

  18. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

    Science.gov (United States)

    2012-01-01

    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence

  19. Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

    Science.gov (United States)

    Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

    2013-01-01

    Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

  20. Automation tools for accelerator control a network based sequencer

    International Nuclear Information System (INIS)

    Clout, P.; Geib, M.; Westervelt, R.

    1991-01-01

    In conjunction with a major client, Vista Control Systems has developed a sequencer for control systems which works in conjunction with its realtime, distributed Vsystem database. Vsystem is a network-based data acquisition, monitoring and control system which has been applied successfully to both accelerator projects and projects outside this realm of research. The network-based sequencer allows a user to simply define a thread of execution in any supported computer on the network. The script defining a sequence has a simple syntax designed for non-programmers, with facilities for selectively abbreviating the channel names for easy reference. The semantics of the script contains most of the familiar capabilities of conventional programming languages, including standard stream I/O and the ability to start other processes with parameters passed. The script is compiled to threaded code for execution efficiency. The implementation is described in some detail and examples are given of applications for which the sequencer has been used

  1. Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

    Directory of Open Access Journals (Sweden)

    Siya Liu

    2017-09-01

    Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

  2. Optimal sensorimotor control in eye movement sequences.

    Science.gov (United States)

    Munuera, Jérôme; Morel, Pierre; Duhamel, Jean-René; Deneve, Sophie

    2009-03-11

    Fast and accurate motor behavior requires combining noisy and delayed sensory information with knowledge of self-generated body motion; much evidence indicates that humans do this in a near-optimal manner during arm movements. However, it is unclear whether this principle applies to eye movements. We measured the relative contributions of visual sensory feedback and the motor efference copy (and/or proprioceptive feedback) when humans perform two saccades in rapid succession, the first saccade to a visual target and the second to a memorized target. Unbeknownst to the subject, we introduced an artificial motor error by randomly "jumping" the visual target during the first saccade. The correction of the memory-guided saccade allowed us to measure the relative contributions of visual feedback and efferent copy (and/or proprioceptive feedback) to motor-plan updating. In a control experiment, we extinguished the target during the saccade rather than changing its location to measure the relative contribution of motor noise and target localization error to saccade variability without any visual feedback. The motor noise contribution increased with saccade amplitude, but remained <30% of the total variability. Subjects adjusted the gain of their visual feedback for different saccade amplitudes as a function of its reliability. Even during trials where subjects performed a corrective saccade to compensate for the target-jump, the correction by the visual feedback, while stronger, remained far below 100%. In all conditions, an optimal controller predicted the visual feedback gain well, suggesting that humans combine optimally their efferent copy and sensory feedback when performing eye movements.

  3. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

    Science.gov (United States)

    Nagar, Anurag; Hahsler, Michael

    2013-01-01

    Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to

  4. Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

    flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

  5. On generalized fixed sequence procedures for controlling the FWER.

    Science.gov (United States)

    Qiu, Zhiying; Guo, Wenge; Lynch, Gavin

    2015-12-30

    Testing a sequence of pre-ordered hypotheses to decide which of these can be rejected or accepted while controlling the familywise error rate (FWER) is of importance in many scientific studies such as clinical trials. In this paper, we first introduce a generalized fixed sequence procedure whose critical values are defined by using a function of the numbers of rejections and acceptances, and which allows follow-up hypotheses to be tested even if some earlier hypotheses are not rejected. We then construct the least favorable configuration for this generalized fixed sequence procedure and present a sufficient condition for the FWER control under arbitrary dependence. Based on the condition, we develop three new generalized fixed sequence procedures controlling the FWER under arbitrary dependence. We also prove that each generalized fixed sequence procedure can be described as a specific closed testing procedure. Through simulation studies and a clinical trial example, we compare the power performance of these proposed procedures with those of the existing FWER controlling procedures. Finally, when the pairwise joint distributions of the true null p-values are known, we further improve these procedures by incorporating pairwise correlation information while maintaining the control of the FWER. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  6. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  7. Exome sequencing generates high quality data in non-target regions

    Directory of Open Access Journals (Sweden)

    Guo Yan

    2012-05-01

    Full Text Available Abstract Background Exome sequencing using next-generation sequencing technologies is a cost efficient approach to selectively sequencing coding regions of human genome for detection of disease variants. A significant amount of DNA fragments from the capture process fall outside target regions, and sequence data for positions outside target regions have been mostly ignored after alignment. Result We performed whole exome sequencing on 22 subjects using Agilent SureSelect capture reagent and 6 subjects using Illumina TrueSeq capture reagent. We also downloaded sequencing data for 6 subjects from the 1000 Genomes Project Pilot 3 study. Using these data, we examined the quality of SNPs detected outside target regions by computing consistency rate with genotypes obtained from SNP chips or the Hapmap database, transition-transversion (Ti/Tv ratio, and percentage of SNPs inside dbSNP. For all three platforms, we obtained high-quality SNPs outside target regions, and some far from target regions. In our Agilent SureSelect data, we obtained 84,049 high-quality SNPs outside target regions compared to 65,231 SNPs inside target regions (a 129% increase. For our Illumina TrueSeq data, we obtained 222,171 high-quality SNPs outside target regions compared to 95,818 SNPs inside target regions (a 232% increase. For the data from the 1000 Genomes Project, we obtained 7,139 high-quality SNPs outside target regions compared to 1,548 SNPs inside target regions (a 461% increase. Conclusions These results demonstrate that a significant amount of high quality genotypes outside target regions can be obtained from exome sequencing data. These data should not be ignored in genetic epidemiology studies.

  8. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  9. Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model

    DEFF Research Database (Denmark)

    Gao, Rui; Liu, Yanxia; Gjesing, Anette Marianne Prior

    2014-01-01

    Monogenic diabetes is a genetic disease often caused by mutations in genes involved in beta-cell function. Correct sub-categorization of the disease is a prerequisite for appropriate treatment and genetic counseling. Target-region capture sequencing is a combination of genomic region enrichment...... and next generation sequencing which might be used as an efficient way to diagnose various genetic disorders. We aimed to develop a target-region capture sequencing platform to screen 117 selected candidate genes involved in metabolism for mutations and to evaluate its performance using monogenic diabetes...

  10. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    Directory of Open Access Journals (Sweden)

    Claros M Gonzalo

    2010-06-01

    Full Text Available Abstract Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used

  11. Generation of control sequences for a pilot-disassembly system

    Science.gov (United States)

    Seliger, Guenther; Kim, Hyung-Ju; Keil, Thomas

    2002-02-01

    Closing the product and material cycles has emerged as a paradigm for industry in the 21st century. Disassembly plays a key role in a life cycle economy since it enables the recovery of resources. A partly automated disassembly system should adapt to a large variety of products and different degrees of devaluation. Also the amounts of products to be disassembled can vary strongly. To cope with these demands an approach to generate on-line disassembly control sequences will be presented. In order to react on these demands the technological feasibility is considered within a procedure for the generation of disassembly control sequences. Procedures are designed to find available and technologically feasible disassembly processes. The control system is formed by modularised and parameterised control units in the cell level within the entire control architecture. In the first development stage product and process analyses at the sample product washing machine were executed. Furthermore a generalized disassembly process was defined. Afterwards these processes were structured in primary and secondary functions. In the second stage the disassembly control at the technological level was investigated. Factors were the availability of the disassembly tools and the technological feasibility of the disassembly processes within the disassembly system. Technical alternative disassembly processes are determined as a result of availability of the tools and technological feasibility of processes. The fourth phase was the concept for the generation of the disassembly control sequences. The approach will be proved in a prototypical disassembly system.

  12. Design and control of integrated chromatography column sequences.

    Science.gov (United States)

    Andersson, Niklas; Löfgren, Anton; Olofsson, Marianne; Sellberg, Anton; Nilsson, Bernt; Tiainen, Peter

    2017-07-01

    To increase the productivity in biopharmaceutical production, a natural step is to introduce integrated continuous biomanufacturing which leads to fewer buffer and storage tanks, smaller sizes of integrated unit operations, and full automation of the operation. The main contribution of this work is to illustrate a methodology for design and control of a downstream process based on integrated column sequences. For small scale production, for example, pre-clinical studies, integrated column sequences can be implemented on a single chromatography system. This makes for a very efficient drug development platform. The proposed methodology is composed of four steps and is governed by a set of tools, that is presented, that makes the transition from batch separations to a complete integrated separation sequence as easy as possible. This methodology, its associated tools and the physical implementation is presented and illustrated on a case study where the target protein is separated from impurities through an integrated four column sequence. This article shows that the design and control of an integrated column sequence was successfully implemented for a tertiary protein separation problem. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:923-930, 2017. © 2017 American Institute of Chemical Engineers.

  13. Speed Control of Multiphase Cage Induction Motors Incorporating Supply Sequence

    Directory of Open Access Journals (Sweden)

    Drozdowski Piotr

    2014-12-01

    Full Text Available The subject of this paper is the control possibility of the multiphase cage induction motors having number of phases greater than 3. These motors have additional properties for speed control that distinguish them from the standard 3 phase motors: operation at various sequences of supplying voltages due to the inverter control and possible operation with few open-circuited phases. For each supply sequence different no load speeds at the same frequency can be obtained. This feature extends the motor application for miscellaneous drive demands including vector or scalar control. This depends mainly on the type of the stator winding for a given number of phases, since the principle of motor operation is based on co-operation of higher harmonics of magnetic field. Examples of operation are presented for a 9-phase motor, though general approach has been discussed. This motor was fed by a voltage source inverter at field oriented control with forced currents. The mathematical model of the motor was reduced to the form incorporating all most important physical features and appropriate for the control law formulation. The operation was illustrated for various supply sequences for “healthy” motor and for the motor operating at one phase broken. The obtained results have shown that parasitic influence of harmonic fields interaction has negligible influence on motor operation with respect to the useful coupling for properly designed stator winding.

  14. Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Sergey I Nikolaev

    Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.

  15. Tracking TCRβ sequence clonotype expansions during antiviral therapy using high-throughput sequencing of the hypervariable region

    Directory of Open Access Journals (Sweden)

    Mark W Robinson

    2016-04-01

    Full Text Available To maintain a persistent infection viruses such as hepatitis C virus (HCV employ a range of mechanisms that subvert protective T cell responses. The suppression of antigen-specific T cell responses by HCV hinders efforts to profile T cell responses during chronic infection and antiviral therapy. Conventional methods of detecting antigen-specific T cells utilise either antigen stimulation (e.g. ELISpot, proliferation assays, cytokine production or antigen-loaded tetramer staining. This limits the ability to profile T cell responses during chronic infection due to suppressed effector function and the requirement for prior knowledge of antigenic viral peptide sequences. Recently high-throughput sequencing (HTS technologies have been developed for the analysis of T cell repertoires. In the present study we have assessed the feasibility of HTS of the TCRβ complementarity determining region (CDR3 to track T cell expansions in an antigen-independent manner. Using sequential blood samples from HCV-infected individuals undergoing anti-viral therapy we were able to measure the population frequencies of >35,000 TCRβ sequence clonotypes in each individual over the course of 12 weeks. TRBV/TRBJ gene segment usage varied markedly between individuals but remained relatively constant within individuals across the course of therapy. Despite this stable TRBV/TRBJ gene segment usage, a number of TCRβ sequence clonotypes showed dramatic changes in read frequency. These changes could not be linked to therapy outcomes in the present study however the TCRβ CDR3 sequences with the largest fold changes did include sequences with identical TRBV/TRBJ gene segment usage and high joining region homology to previously published CDR3 sequences from HCV-specific T cells targeting the HLA-B*0801-restricted 1395HSKKKCDEL1403 and HLA-A*0101–restricted 1435ATDALMTGY1443 epitopes. The pipeline developed in this proof of concept study provides a platform for the design of

  16. Modelling and control design for SHARON/Anammox reactor sequence

    DEFF Research Database (Denmark)

    Valverde Perez, Borja; Mauricio Iglesias, Miguel; Sin, Gürkan

    2012-01-01

    metabolism against fast chemical reaction and mass transfer. Likewise, the analysis of the dynamics contributed to establish qualitatively the requirements for control of the reactors, both for regulation and for optimal operation. Work in progress on quantitatively analysing different control structure......With the perspective of investigating a suitable control design for autotrophic nitrogen removal, this work presents a complete model of the SHARON/Anammox reactor sequence. The dynamics of the reactor were explored pointing out the different scales of the rates in the system: slow microbial...

  17. Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Christiansen, Gunna

    1994-01-01

    of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...

  18. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  19. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  20. Sequence Ready Characterization of the Pericentromeric Region of 19p12

    Energy Technology Data Exchange (ETDEWEB)

    Evan E. Eichler

    2006-08-31

    Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy to generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence

  1. Lymphatic filariasis control in Tanga Region, Tanzania

    DEFF Research Database (Denmark)

    Simonsen, Paul Erik; Derua, Yahya A.; Magesa, Stephen M.

    2014-01-01

    BackgroundLymphatic filariasis (LF) control started in Tanga Region of Tanzania in 2004, with annual ivermectin/albendazole mass drug administration (MDA). Since then, the current project has monitored the effect in communities and schools in rural areas of Tanga District. In 2013, after 8 rounds...

  2. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  3. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  4. Quality Control of the Traditional Patent Medicine Yimu Wan Based on SMRT Sequencing and DNA Barcoding

    Science.gov (United States)

    Jia, Jing; Xu, Zhichao; Xin, Tianyi; Shi, Linchun; Song, Jingyuan

    2017-01-01

    Substandard traditional patent medicines may lead to global safety-related issues. Protecting consumers from the health risks associated with the integrity and authenticity of herbal preparations is of great concern. Of particular concern is quality control for traditional patent medicines. Here, we establish an effective approach for verifying the biological composition of traditional patent medicines based on single-molecule real-time (SMRT) sequencing and DNA barcoding. Yimu Wan (YMW), a classical herbal prescription recorded in the Chinese Pharmacopoeia, was chosen to test the method. Two reference YMW samples were used to establish a standard method for analysis, which was then applied to three different batches of commercial YMW samples. A total of 3703 and 4810 circular-consensus sequencing (CCS) reads from two reference and three commercial YMW samples were mapped to the ITS2 and psbA-trnH regions, respectively. Moreover, comparison of intraspecific genetic distances based on SMRT sequencing data with reference data from Sanger sequencing revealed an ITS2 and psbA-trnH intergenic spacer that exhibited high intraspecific divergence, with the sites of variation showing significant differences within species. Using the CCS strategy for SMRT sequencing analysis was adequate to guarantee the accuracy of identification. This study demonstrates the application of SMRT sequencing to detect the biological ingredients of herbal preparations. SMRT sequencing provides an affordable way to monitor the legality and safety of traditional patent medicines. PMID:28620408

  5. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T

    OpenAIRE

    Choudhary, M.; Kaplan, Samuel

    2000-01-01

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...

  6. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    International Nuclear Information System (INIS)

    Sun, Y.L.

    2015-01-01

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  7. Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

    Science.gov (United States)

    Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

    2017-11-23

    Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

  8. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Directory of Open Access Journals (Sweden)

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  9. Characterization and evolution of the mitochondrial DNA control region in hornbills (Bucerotiformes).

    Science.gov (United States)

    Delport, Wayne; Ferguson, J Willem H; Bloomer, Paulette

    2002-06-01

    We determined the mitochondrial DNA control region sequences of six Bucerotiformes. Hornbills have the typical avian gene order and their control region is similar to other avian control regions in that it is partitioned into three domains: two variable domains that flank a central conserved domain. Two characteristics of the hornbill control region sequence differ from that of other birds. First, domain I is AT rich as opposed to AC rich, and second, the control region is approximately 500 bp longer than that of other birds. Both these deviations from typical avian control region sequence are explainable on the basis of repeat motifs in domain I of the hornbill control region. The repeat motifs probably originated from a duplication of CSB-1 as has been determined in chicken, quail, and snowgoose. Furthermore, the hornbill repeat motifs probably arose before the divergence of hornbills from each other but after the divergence of hornbills from other avian taxa. The mitochondrial control region of hornbills is suitable for both phylogenetic and population studies, with domains I and II probably more suited to population and phylogenetic analyses, respectively.

  10. Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions

    Directory of Open Access Journals (Sweden)

    Marcela Coelho

    2016-09-01

    Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and  3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.

  11. Amelioration of the cooling load based chiller sequencing control

    International Nuclear Information System (INIS)

    Huang, Sen; Zuo, Wangda; Sohn, Michael D.

    2016-01-01

    Highlights: • We developed a new approach for the optimal load distribution for chillers. • We proposed a new approach to optimize the number of operating chillers. • We provided a holistic solution to address chiller sequencing control problems. - Abstract: Cooling Load based Control (CLC) for the chiller sequencing is a commonly used control strategy for multiple-chiller plants. To improve the energy efficiency of these chiller plants, researchers proposed various CLC optimization approaches, which can be divided into two groups: studies to optimize the load distribution and studies to identify the optimal number of operating chillers. However, both groups have their own deficiencies and do not consider the impact of each other. This paper aims to improve the CLC by proposing three new approaches. The first optimizes the load distribution by adjusting the critical points for the chiller staging, which is easier to be implemented than existing approaches. In addition, by considering the impact of the load distribution on the cooling tower energy consumption and the pump energy consumption, this approach can achieve a better energy saving. The second optimizes the number of operating chillers by modulating the critical points and the condenser water set point in order to achieve the minimal energy consumption of the entire chiller plant that may not be guaranteed by existing approaches. The third combines the first two approaches to provide a holistic solution. The proposed three approaches were evaluated via a case study. The results show that the total energy consumption saving for the studied chiller plant is 0.5%, 5.3% and 5.6% by the three approaches, respectively. An energy saving of 4.9–11.8% can be achieved for the chillers at the cost of more energy consumption by the cooling towers (increases of 5.8–43.8%). The pumps’ energy saving varies from −8.6% to 2.0%, depending on the approach.

  12. Cellular specificity of HIV-1 replication can be controlled by LTR sequences

    International Nuclear Information System (INIS)

    Reed-Inderbitzin, Edward; Maury, Wendy

    2003-01-01

    Two well-established determinants of retroviral tropism are envelope sequences that regulate entry and LTR sequences that can regulate viral expression in a cell-specific manner. Studies with human immunodeficiency virus-1 (HIV-1) have demonstrated that tropism of this virus maps primarily to variable envelope sequences. Studies have demonstrated that T cell and macrophage-specific transcription factor binding motifs exist in the upstream region of the LTR U3; however, the ability of the core enhancer/promoter proximal elements (two NF-κB and three Sp1 sites) to function well in macrophages and T cells have led many to conclude that HIV LTR sequences are not primary determinants of HIV tropism. To determine if cellular specificity could be imparted to HIV by the core enhancer elements, the enhancer/promoter proximal region of the HIV LTR was substituted with motifs that control gene expression in a myeloid-specific manner. The enhancer region from equine infectious anemia virus (EIAV) when substituted for the HIV enhancer/promoter proximal region was found to drive expression in a macrophage-specific manner and was responsive to HIV Tat. The addition of a 5' methylation-dependent binding site (MDBP) and a promoter proximal Sp1 motif increased expression without altering cellular specificity. Spacing between the promoter proximal region and the TATA box was also found to influence LTR activity. Infectivity studies using chimeric LTRs within the context of a dual-tropic infectious molecular clone established that these LTRs directed HIV replication and production of infectious virions in macrophages but not primary T cells or T cell lines. This investigation demonstrates that cellular specificity can be imparted onto HIV-1 replication at the level of viral transcription and not entry

  13. Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

    Science.gov (United States)

    Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

    2013-01-01

    To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

  14. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  15. Hydraulic fracturing and the Crooked Lake Sequences: Insights gleaned from regional seismic networks

    Science.gov (United States)

    Schultz, Ryan; Stern, Virginia; Novakovic, Mark; Atkinson, Gail; Gu, Yu Jeffrey

    2015-04-01

    Within central Alberta, Canada, a new sequence of earthquakes has been recognized as of 1 December 2013 in a region of previous seismic quiescence near Crooked Lake, ~30 km west of the town of Fox Creek. We utilize a cross-correlation detection algorithm to detect more than 160 events to the end of 2014, which is temporally distinguished into five subsequences. This observation is corroborated by the uniqueness of waveforms clustered by subsequence. The Crooked Lake Sequences have come under scrutiny due to its strong temporal correlation (>99.99%) to the timing of hydraulic fracturing operations in the Duvernay Formation. We assert that individual subsequences are related to fracturing stimulation and, despite adverse initial station geometry, double-difference techniques allow us to spatially relate each cluster back to a unique horizontal well. Overall, we find that seismicity in the Crooked Lake Sequences is consistent with first-order observations of hydraulic fracturing induced seismicity.

  16. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  17. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  18. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Directory of Open Access Journals (Sweden)

    Debnath Bhattacharyya

    2013-01-01

    Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.

  19. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Science.gov (United States)

    Mandal, Bijoy Kumar; Kim, Tai-hoon

    2013-01-01

    We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

  20. The monitoring and control of task sequences in human and non-human primates

    Directory of Open Access Journals (Sweden)

    Theresa M Desrochers

    2016-01-01

    Full Text Available Our ability to plan and execute a series of tasks leading to a desired goal requires remarkable coordination between sensory, motor, and decision-related systems. Prefrontal cortex is thought to play a central role in this coordination, especially when actions must be assembled extemporaneously and cannot be programmed as a rote series of movements. A central component of this flexible behavior is the moment-by-moment allocation of working memory and attention. The ubiquity of sequence planning in our everyday lives belies the neural complexity that supports this capacity, and little is known about how frontal cortical regions orchestrate the monitoring and control of sequential behaviors. For example, it remains unclear if and how sensory cortical areas, which provide essential driving inputs for behavior, are modulated by the frontal cortex during these tasks. Here we review what is known about moment-to-moment monitoring as it relates to visually guided, rule-driven behaviors that change over time. We highlight recent human work that shows how the rostrolateral prefrontal cortex (RLPFC participates in monitoring during task sequences. Neurophysiological data from monkeys suggests that monitoring may be accomplished by neurons that respond to items within the sequence and may in turn influence the tuning properties of neurons in posterior sensory areas. Understanding the interplay between proceduralized or habitual acts and supervised control of sequences is key to our understanding of sequential task execution. A crucial bridge will be the use of experimental protocols that allow for the examination of the functional homology between monkeys and humans. We illustrate how task sequences may be parceled into components and examined experimentally, thereby opening future avenues of investigation into the neural basis of sequential monitoring and control.

  1. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  2. Controlling the bond scission sequence of oxygenates for energy applications

    Science.gov (United States)

    Stottlemyer, Alan L.

    intermediates was observed on the Pt and Pt/WC surfaces. For CH3OH decomposition, DFT calculations suggested that the bond scission sequence could be controlled using monolayer coverage of Pt on WC. The Ni/Pt bimetallic system was studied as an example for using oxygenates as a hydrogen source. There are two well characterized surface structures for the Ni/Pt system: the surface configuration, in which the Ni atoms reside primarily on the surface of the Pt bulk, and the subsurface configuration, in which the second atomic layer is enriched in Ni atoms and the surface is enriched in Pt atoms. These configurations are denoted NiPtPt and PtNiPt, respectively. DFT results revealed that trends established for the Ni/Pt(111) system extend to the Ni/Pt(100) analogue. TPD studies revealed that the NiPtPt surface was more active for oxygenate reforming than the Pt or PtNiPt surfaces. HREELS confirmed the presence of strongly bound reaction intermediates, including aldehyde-like species, and suggested that the first decomposition step was likely O-H bond scission. Thus, the binding energies of the deprotonated reaction intermediates are important parameters in controlling the decomposition pathways of oxygenates. These studies have demonstrated that the bond scission sequence of oxygenate decomposition can be controlled using bimetallic and transition metal carbide catalysts. While this study has focused on oxygenate decomposition for energy applications, the principles and methodology applied herein are universally applicable to the development of novel and marketable value-added products. The value in such a methodology is in the combination of both calculations to predict catalytic and chemical properties, and experiments to fine-tune theoretical predictions.

  3. Randomness control of vehicular motion through a sequence of traffic signals at irregular intervals

    International Nuclear Information System (INIS)

    Nagatani, Takashi

    2010-01-01

    We study the regularization of irregular motion of a vehicle moving through the sequence of traffic signals with a disordered configuration. Each traffic signal is controlled by both cycle time and phase shift. The cycle time is the same for all signals, while the phase shift varies from signal to signal by synchronizing with intervals between a signal and the next signal. The nonlinear dynamic model of the vehicular motion is presented by the stochastic nonlinear map. The vehicle exhibits the very complex behavior with varying both cycle time and strength of irregular intervals. The irregular motion induced by the disordered configuration is regularized by adjusting the phase shift within the regularization regions.

  4. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    Science.gov (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  5. Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.

    Science.gov (United States)

    Reinl, Maren; Bartels, Andreas

    2014-11-15

    Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.

    Science.gov (United States)

    Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok

    2018-06-01

    Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.

  7. Region 5 Toxic Substances Control Act Producers

    Science.gov (United States)

    This dataset represents the query results from the Envirofacts database for facilities known as Chemical Manufacturers, Processors and Formulators (MPFs) with TSCA identification numbers located in Region 5.

  8. The 2012 Ferrara seismic sequence: Regional crustal structure, earthquake sources, and seismic hazard

    Science.gov (United States)

    Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.

    2012-10-01

    Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.

  9. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  10. Quick regional centroid moment tensor solutions for the Emilia 2012 (northern Italy seismic sequence

    Directory of Open Access Journals (Sweden)

    Silvia Pondrelli

    2012-10-01

    Full Text Available In May 2012, a seismic sequence struck the Emilia region (northern Italy. The mainshock, of Ml 5.9, occurred on May 20, 2012, at 02:03 UTC. This was preceded by a smaller Ml 4.1 foreshock some hours before (23:13 UTC on May 19, 2012 and followed by more than 2,500 earthquakes in the magnitude range from Ml 0.7 to 5.2. In addition, on May 29, 2012, three further strong earthquakes occurred, all with magnitude Ml ≥5.2: a Ml 5.8 earthquake in the morning (07:00 UTC, followed by two events within just 5 min of each other, one at 10:55 UTC (Ml 5.3 and the second at 11:00 UTC (Ml 5.2. For all of the Ml ≥4.0 earthquakes in Italy and for all of the Ml ≥4.5 in the Mediterranean area, an automatic procedure for the computation of a regional centroid moment tensor (RCMT is triggered by an email alert. Within 1 h of the event, a manually revised quick RCMT (QRCMT can be published on the website if the solution is considered stable. In particular, for the Emilia seismic sequence, 13 QRCMTs were determined and for three of them, those with M >5.5, the automatically computed QRCMTs fitted the criteria for publication without manual revision. Using this seismic sequence as a test, we can then identify the magnitude threshold for automatic publication of our QRCMTs.

  11. Draft genome sequences of three virulent Streptococcus thermophilus bacteriophages isolated from the dairy environment in the Veneto region of Italy

    DEFF Research Database (Denmark)

    Duarte, Viní­cius da Silva; Giaretta, Sabrina; Treu, Laura

    2018-01-01

    Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...

  12. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes

    NARCIS (Netherlands)

    Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.

    2003-01-01

    The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes

  13. Quality Control Test for Sequence-Phenotype Assignments

    Science.gov (United States)

    Ortiz, Maria Teresa Lara; Rosario, Pablo Benjamín Leon; Luna-Nevarez, Pablo; Gamez, Alba Savin; Martínez-del Campo, Ana; Del Rio, Gabriel

    2015-01-01

    Relating a gene mutation to a phenotype is a common task in different disciplines such as protein biochemistry. In this endeavour, it is common to find false relationships arising from mutations introduced by cells that may be depurated using a phenotypic assay; yet, such phenotypic assays may introduce additional false relationships arising from experimental errors. Here we introduce the use of high-throughput DNA sequencers and statistical analysis aimed to identify incorrect DNA sequence-phenotype assignments and observed that 10–20% of these false assignments are expected in large screenings aimed to identify critical residues for protein function. We further show that this level of incorrect DNA sequence-phenotype assignments may significantly alter our understanding about the structure-function relationship of proteins. We have made available an implementation of our method at http://bis.ifc.unam.mx/en/software/chispas. PMID:25700273

  14. Sequencing and association analysis of the type 1 diabetes – linked region on chromosome 10p12-q11

    Directory of Open Access Journals (Sweden)

    Barratt Bryan J

    2007-05-01

    Full Text Available Abstract Background In an effort to locate susceptibility genes for type 1 diabetes (T1D several genome-wide linkage scans have been undertaken. A chromosomal region designated IDDM10 retained genome-wide significance in a combined analysis of the main linkage scans. Here, we studied sequence polymorphisms in 23 Mb on chromosome 10p12-q11, including the putative IDDM10 region, to identify genes associated with T1D. Results Initially, we resequenced the functional candidate genes, CREM and SDF1, located in this region, genotyped 13 tag single nucleotide polymorphisms (SNPs and found no association with T1D. We then undertook analysis of the whole 23 Mb region. We constructed and sequenced a contig tile path from two bacterial artificial clone libraries. By comparison with a clone library from an unrelated person used in the Human Genome Project, we identified 12,058 SNPs. We genotyped 303 SNPs and 25 polymorphic microsatellite markers in 765 multiplex T1D families and followed up 22 associated polymorphisms in up to 2,857 families. We found nominal evidence of association in six loci (P = 0.05 – 0.0026, located near the PAPD1 gene. Therefore, we resequenced 38.8 kb in this region, found 147 SNPs and genotyped 84 of them in the T1D families. We also tested 13 polymorphisms in the PAPD1 gene and in five other loci in 1,612 T1D patients and 1,828 controls from the UK. Overall, only the D10S193 microsatellite marker located 28 kb downstream of PAPD1 showed nominal evidence of association in both T1D families and in the case-control sample (P = 0.037 and 0.03, respectively. Conclusion We conclude that polymorphisms in the CREM and SDF1 genes have no major effect on T1D. The weak T1D association that we detected in the association scan near the PAPD1 gene may be either false or due to a small genuine effect, and cannot explain linkage at the IDDM10 region.

  15. [Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

    Science.gov (United States)

    Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

    2014-06-01

    To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

  16. Forming controlled inset regions by ion implantation and laser bombardment

    International Nuclear Information System (INIS)

    Gibbons, J.F.

    1981-01-01

    A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

  17. Regional Controller | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Identifies, assesses and manages financial and administrative risks together with officers responsible for projects situated in the region by conducting recipient institutional assessments at key points in the project life-cycle, by giving advice to recipients and, where warranted, by organizing training for recipients in the area of ...

  18. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  19. Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

    Science.gov (United States)

    Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

    2018-04-01

    This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

  20. Cognitive Control Structures in the Imitation Learning of Spatial Sequences and Rhythms-An fMRI Study.

    Science.gov (United States)

    Sakreida, Katrin; Higuchi, Satomi; Di Dio, Cinzia; Ziessler, Michael; Turgeon, Martine; Roberts, Neil; Vogt, Stefan

    2018-03-01

    Imitation learning involves the acquisition of novel motor patterns based on action observation (AO). We used event-related functional magnetic resonance imaging to study the imitation learning of spatial sequences and rhythms during AO, motor imagery (MI), and imitative execution in nonmusicians and musicians. While both tasks engaged the fronto-parietal mirror circuit, the spatial sequence task recruited posterior parietal and dorsal premotor regions more strongly. The rhythm task involved an additional network for auditory working memory. This partial dissociation supports the concept of task-specific mirror mechanisms. Two regions of cognitive control were identified: 1) dorsolateral prefrontal cortex (DLPFC) was found to be more strongly activated during MI of novel spatial sequences, which allowed us to extend the 2-level model of imitation learning by Buccino et al. (2004) to spatial sequences. 2) During imitative execution of both tasks, the posterior medial frontal cortex was robustly activated, along with the DLPFC, which suggests that both regions are involved in the cognitive control of imitation learning. The musicians' selective behavioral advantage for rhythm imitation was reflected cortically in enhanced sensory-motor processing during AO and by the absence of practice-related activation differences in DLPFC during rhythm execution. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Association of genetic variations in the mitochondrial DNA control region with presbycusis.

    Science.gov (United States)

    Falah, Masoumeh; Farhadi, Mohammad; Kamrava, Seyed Kamran; Mahmoudian, Saeid; Daneshi, Ahmad; Balali, Maryam; Asghari, Alimohamad; Houshmand, Massoud

    2017-01-01

    The prominent role of mitochondria in the generation of reactive oxygen species, cell death, and energy production contributes to the importance of this organelle in the intracellular mechanism underlying the progression of the common sensory disorder of the elderly, presbycusis. Reduced mitochondrial DNA (mtDNA) gene expression and coding region variation have frequently been reported as being associated with the development of presbycusis. The mtDNA control region regulates gene expression and replication of the genome of this organelle. To comprehensively understand of the role of mitochondria in the progression of presbycusis, we compared variations in the mtDNA control region between subjects with presbycusis and controls. A total of 58 presbycusis patients and 220 control subjects were enrolled in the study after examination by the otolaryngologist and audiology tests. Variations in the mtDNA control region were investigated by polymerase chain reaction and Sanger sequencing. A total of 113 sequence variants were observed in mtDNA, and variants were detected in 100% of patients, with 84% located in hypervariable regions. The frequencies of the variants, 16,223 C>T, 16,311 T>C, 16,249 T>C, and 15,954 A>C, were significantly different between presbycusis and control subjects. The statistically significant difference in the frequencies of four nucleotide variants in the mtDNA control region of presbycusis patients and controls is in agreement with previous experimental evidence and supports the role of mitochondria in the intracellular mechanism underlying presbycusis development. Moreover, these variants have potential as diagnostic markers for individuals at a high risk of developing presbycusis. The data also suggest the possible presence of changes in the mtDNA control region in presbycusis, which could alter regulatory factor binding sites and influence mtDNA gene expression and copy number.

  2. Automatic sequencing and control of Space Station airlock operations

    Science.gov (United States)

    Himel, Victor; Abeles, Fred J.; Auman, James; Tqi, Terry O.

    1989-01-01

    Procedures that have been developed as part of the NASA JSC-sponsored pre-prototype Checkout, Servicing and Maintenance (COSM) program for pre- and post-EVA airlock operations are described. This paper addresses the accompanying pressure changes in the airlock and in the Advanced Extravehicular Mobility Unit (EMU). Additionally, the paper focuses on the components that are checked out, and includes the step-by-step sequences to be followed by the crew, the required screen displays and prompts that accompany each step, and a description of the automated processes that occur.

  3. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    KAUST Repository

    Domina, Maria; Lanza Cariccio, Veronica; Benfatto, Salvatore; D'Aliberti, Deborah; Venza, Mario; Borgogni, Erica; Castellino, Flora; Biondo, Carmelo; D'Andrea, Daniel; Grassi, Luigi; Tramontano, Anna; Teti, Giuseppe; Felici, Franco; Beninati, Concetta

    2014-01-01

    There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER) provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  4. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    Directory of Open Access Journals (Sweden)

    Maria Domina

    Full Text Available There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  5. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    KAUST Repository

    Domina, Maria

    2014-12-04

    There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER) provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  6. Genomic region operation kit for flexible processing of deep sequencing data.

    Science.gov (United States)

    Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

    2013-01-01

    Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

  7. Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

    Science.gov (United States)

    Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

    2018-06-01

    Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

  8. The influence of articulatory suppression on the control of implicit sequence knowledge

    Directory of Open Access Journals (Sweden)

    Vinciane eGaillard

    2012-07-01

    Full Text Available The present study investigated the consciousness-control relationship by suppressing the possibility to exert executive control on incidentally acquired knowledge. Participants performed a serial reaction time (SRT task, followed by a sequence generation task under inclusion and exclusion instructions and a sequence recognition task. The generation task requires control on the sequential knowledge that has been incidentally acquired. We manipulated the possibility for participants to recruit control processes in the generation task in three different conditions. In addition to a control condition, participants generated sequences under inclusion and exclusion concurrently with either articulatory suppression or foot tapping. Results suggest that articulatory suppression specifically impairs exclusion performance by interfering with inner speech. Because participants were nevertheless able to successfully recognize fragments of the training sequence in a final recognition task, this is suggestive of a dissociation between control and recognition memory.

  9. Sequence evolution of the hypervariable region in the putative envelope region E2/NS1 of hepatitis C virus is correlated with specific humoral immune responses.

    OpenAIRE

    van Doorn, L J; Capriles, I; Maertens, G; DeLeys, R; Murray, K; Kos, T; Schellekens, H; Quint, W

    1995-01-01

    Sequence evolution of the hypervariable region 1 (HVR1) in the N terminus of E2/NS1 of hepatitis C virus (HCV) was studied retrospectively in six chimpanzees inoculated with the same genotype 1b strain, containing a unique predominant HVR1 sequence. Immediately after inoculation, all animals contained the same HVR predominant sequence. Two animals developed an acute self-limiting infection. Anti-HVR1 immunoglobulin G (IgG) was produced 40 to 60 days after inoculation and rapidly disappeared a...

  10. Characterization of the HLA-DRβ1 third hypervariable region amino acid sequence according to charge and parental inheritance in systemic sclerosis.

    Science.gov (United States)

    Gentil, Coline A; Gammill, Hilary S; Luu, Christine T; Mayes, Maureen D; Furst, Dan E; Nelson, J Lee

    2017-03-07

    Specific HLA class II alleles are associated with systemic sclerosis (SSc) risk, clinical characteristics, and autoantibodies. HLA nomenclature initially developed with antibodies as typing reagents defining DRB1 allele groups. However, alleles from different DRB1 allele groups encode the same third hypervariable region (3rd HVR) sequence, the primary T-cell recognition site, and 3rd HVR charge differences can affect interactions with T cells. We considered 3rd HVR sequences (amino acids 67-74) irrespective of the allele group and analyzed parental inheritance considered according to the 3rd HVR charge, comparing SSc patients with controls. In total, 306 families (121 SSc and 185 controls) were HLA genotyped and parental HLA-haplotype origin was determined. Analysis was conducted according to DRβ1 3rd HVR sequence, charge, and parental inheritance. The distribution of 3rd HVR sequences differed in SSc patients versus controls (p = 0.007), primarily due to an increase of specific DRB1*11 alleles, in accord with previous observations. The 3rd HVR sequences were next analyzed according to charge and parental inheritance. Paternal transmission of DRB1 alleles encoding a +2 charge 3rd HVR was significantly reduced in SSc patients compared with maternal transmission (p = 0.0003, corrected for analysis of four charge categories p = 0.001). To a lesser extent, paternal transmission was increased when charge was 0 (p = 0.021, corrected for multiple comparisons p = 0.084). In contrast, paternal versus maternal inheritance was similar in controls. SSc patients differed from controls when DRB1 alleles were categorized according to 3rd HVR sequences. Skewed parental inheritance was observed in SSc patients but not in controls when the DRβ1 3rd HVR was considered according to charge. These observations suggest that epigenetic modulation of HLA merits investigation in SSc.

  11. A new method for detecting signal regions in ordered sequences of real numbers, and application to viral genomic data.

    Science.gov (United States)

    Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P

    2018-01-01

    We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.

  12. Controlling the Orbital Sequence in Individual Cu-Phthalocyanine Molecules

    NARCIS (Netherlands)

    Uhlmann, C.; Swart, I.; Repp, J.

    2013-01-01

    We report on the controlled change of the energetic ordering of molecular orbitals. Negatively charged copper(II)phthalocyanine on NaCl/Cu(100) undergoes a Jahn–Teller distortion that lifts the degeneracy of two frontier orbitals. The energetic order of the levels can be controlled by Au and Ag

  13. Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

    Science.gov (United States)

    Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

    2017-10-01

    Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    Directory of Open Access Journals (Sweden)

    Sasaki Yukako

    2008-10-01

    Full Text Available Abstract Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit. Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas. The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98 ; L: 98–100%. The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed.

  15. Evidence for widespread degradation of gene control regions in hominid genomes.

    Directory of Open Access Journals (Sweden)

    Peter D Keightley

    2005-02-01

    Full Text Available Although sequences containing regulatory elements located close to protein-coding genes are often only weakly conserved during evolution, comparisons of rodent genomes have implied that these sequences are subject to some selective constraints. Evolutionary conservation is particularly apparent upstream of coding sequences and in first introns, regions that are enriched for regulatory elements. By comparing the human and chimpanzee genomes, we show here that there is almost no evidence for conservation in these regions in hominids. Furthermore, we show that gene expression is diverging more rapidly in hominids than in murids per unit of neutral sequence divergence. By combining data on polymorphism levels in human noncoding DNA and the corresponding human-chimpanzee divergence, we show that the proportion of adaptive substitutions in these regions in hominids is very low. It therefore seems likely that the lack of conservation and increased rate of gene expression divergence are caused by a reduction in the effectiveness of natural selection against deleterious mutations because of the low effective population sizes of hominids. This has resulted in the accumulation of a large number of deleterious mutations in sequences containing gene control elements and hence a widespread degradation of the genome during the evolution of humans and chimpanzees.

  16. Genome sequences of three strains of Aspergillus flavus for the biological control of Aflatoxin

    Science.gov (United States)

    The genomes of three strains of Aspergillus flavus with demonstrated utility for the biological control of aflatoxin were sequenced. These sequences were assembled with MIRA and annotated with Augustus using A. flavus strain 3357 (NCBI EQ963472) as a reference. Each strain had a genome of 36.3 to ...

  17. Optimal control design of turbo spin-echo sequences with applications to parallel-transmit systems

    NARCIS (Netherlands)

    Sbrizzi, Alessandro; Hoogduin, Hans; Hajnal, Joseph V; van den Berg, CAT; Luijten, Peter R; Malik, Shaihan J

    PURPOSE: The design of turbo spin-echo sequences is modeled as a dynamic optimization problem which includes the case of inhomogeneous transmit radiofrequency fields. This problem is efficiently solved by optimal control techniques making it possible to design patient-specific sequences online.

  18. Sequence analysis of LACI mutations obtained from lung cells of control and radon-exposed Big Blue trademark transgenic mice

    International Nuclear Information System (INIS)

    Jostes, R.F.; Cross, F.T.; Stillwell, L.

    1995-01-01

    We have exposed Stratagene Big Blue trademark transgenic mice by inhalation to 310, 640 and 960 Working Level Months (WLM) of radon progency. Twelve LacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM group and the LacI gene sequenced. Mutations are scored only if they occur unambiguously in both strands of the mutant gene; the entire gene is evaluated. In addition, sixteen LacI mutations were isolated from the lung tissue of a mouse from the 640-WLM group; seven have been completely sequenced. Nine LacI mutations from the lung tissue of unirradiated control mice have been sequenced. Sequence data from the unirradiated mice are similar to that found in lung tissue at Stratagene; predominately G:C to A:T transitions in the protein associated region. The mutation spectrum from radon-irradiated mice is markedly different from that obtained with the control, unirradiated mice. Small deletions and insertions compromise 53% of the mutations in the irradiated mice. No multiple events have been noted in the spontaneous mutations; six of the mutations obtained from radon-irradiated mice (26%) have multiple events within the gene. In some, deletions, insertions are base changes occur together. The mutational events in the irradiated mice are approximately equally distributed throughout the gene. The breakpoint rejoining regions of large deletions obtained from the radon-irradiated mice are being studied at the University of California, San Francisco

  19. An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Hongzhi Cao

    Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

  20. [Sequence polymorphisms of the mitochondrial DNA HVR I and HVR II regions in the Deng populations from Tibet in China].

    Science.gov (United States)

    Kang, Longli; Zhang, Xiaofeng; Liu, Kai; Zhao, Jianmin

    2009-12-01

    To analyze the sequence polymorphisms of the mitochondrial DNA hypervariable regions I (HVR I) and HVR II in the Deng population in Linzhi area of Tibet. mtDNAs obtained from 119 unrelated individuals were amplified and directly sequenced. One hundred and ten variable sites were identified, including nucleotide transitions, transversions, and insertions. In the HVR I region (nt16024-nt16365), 68 polymorphic sites and 119 haplotypes were observed, the genetic diversity was 0.9916. In the HVR II (nt73-nt340) region, 42 polymorphic sites and 113 haplotypes were observed, and the genetic diversity was 0.9907. The random match probability of the HVR I and HVR II regions were 0.0084 and 0.0093, respectively. When combining the HVR I and HVR II regions, 119 different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0084. There are some unique polymorphic loci in the Deng population. There are different genetic structures between Chinese and other Asian populations in the mitochondrial DNA D-loop region. Sequence polymorphism of mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.

  1. Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

    2009-05-01

    DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

  2. Evolution and strengthening of the Calabrian Regional Seismic Network during the Pollino sequence

    Science.gov (United States)

    D'Alessandro, Antonino; Gervasi, Anna; Guerra, Ignazio

    2013-04-01

    In the last three years the Calabria-Lucania border area is affected by an intense seismic activity generated by the activation of geological structures which be seat of clusters of microearthquakes, with energy release sufficient to be felt and to generate alarm and bother. Besides to the historical memory of the inhabitants of Mormanno (the town most affected of macroseismic effects) there are some historical documents that indicate the occurrence of a similar seismic crisis in 1888. A more recent seismic sequence, the first monitored by seismic instruments, occurred in 1973-1974. In the last case, the activity started in early 2010 and is still ongoing. The two shocks of ML = 4.3 and 5.0 and the the very long time duration differs this crisis from the previous ones. Given this background, in 1981 was installed at Mormanno a seismic station (MMN) belonging to Regional Seismic Network of the University of Calabria (RSRC), now also a station of the Italian National Seismic Network of the Istituto Nazionale di Geofisica Vulcanolgia (INSN-INGV). This seismic station made it possible to follow the evolution of seismicity in this area and in particular the progressive increase in seismic activity started in 2010. Since 2010, some 3D stand-alone, was installed by the University of Calabria. Further stations of INGV were installed in November 2011 after a sharp increase of the energy release and subsequently by the INGV and the GeoForschungsZentrum (Potsdam) after the main shock of the whole sequence. Seismic networks are powerful tools for understanding active tectonic processes in a monitored seismically active region. However, the optimal monitoring of a seismic region requires the assessment of the seismic network capabilities to identify seismogenic areas that are not adequately covered and to quantify measures that will allow the network improvement. In this paper we examine in detail the evolution and the strengthening of the RSRC in the last years analyzing the

  3. Sequence Control System of 1-MW CW Klystron for the PEFP

    CERN Document Server

    Park, Byoung R; Chun Myung Hwan; Han Yeung Jin; Hyo Jeong Maeng; Kim Sung Chul; Yang Jae Seok; Yu In Ha

    2005-01-01

    Sequence control system of 1-MW CW klystron for the PEFP (Proton Engineering Frontier Project) has been developed in order to drive the 1-MW klystron amplifier. The system is able to control several power supplies and many environment conditions. The hardware of sequence control and the interlock system are based on the Allen-Bradley's SLC500 Program Logic Controller (PLC). Also the system can be controlled by a touch screen at local mode or Ethernet network with high level HMI at remote mode.

  4. Sequence-aware intrusion detection in industrial control systems

    NARCIS (Netherlands)

    Caselli, M.; Zambon, Emmanuele; Kargl, Frank; Zhou, Jianying; Jones, D.

    Nowadays, several threats endanger cyber-physical systems. Among these systems, industrial control systems (ICS) operating on critical infrastructures have been proven to be an attractive target for attackers. The case of Stuxnet has not only showed that ICSs are vulnerable to cyber-attacks, but

  5. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  6. Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum.

    Science.gov (United States)

    Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred

    2017-06-29

    The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

  7. Multifractal Detrended Fluctuation Analysis of Regional Precipitation Sequences Based on the CEEMDAN-WPT

    Science.gov (United States)

    Liu, Dong; Cheng, Chen; Fu, Qiang; Liu, Chunlei; Li, Mo; Faiz, Muhammad Abrar; Li, Tianxiao; Khan, Muhammad Imran; Cui, Song

    2018-03-01

    In this paper, the complete ensemble empirical mode decomposition with the adaptive noise (CEEMDAN) algorithm is introduced into the complexity research of precipitation systems to improve the traditional complexity measure method specific to the mode mixing of the Empirical Mode Decomposition (EMD) and incomplete decomposition of the ensemble empirical mode decomposition (EEMD). We combined the CEEMDAN with the wavelet packet transform (WPT) and multifractal detrended fluctuation analysis (MF-DFA) to create the CEEMDAN-WPT-MFDFA, and used it to measure the complexity of the monthly precipitation sequence of 12 sub-regions in Harbin, Heilongjiang Province, China. The results show that there are significant differences in the monthly precipitation complexity of each sub-region in Harbin. The complexity of the northwest area of Harbin is the lowest and its predictability is the best. The complexity and predictability of the middle and Midwest areas of Harbin are about average. The complexity of the southeast area of Harbin is higher than that of the northwest, middle, and Midwest areas of Harbin and its predictability is worse. The complexity of Shuangcheng is the highest and its predictability is the worst of all the studied sub-regions. We used terrain and human activity as factors to analyze the causes of the complexity of the local precipitation. The results showed that the correlations between the precipitation complexity and terrain are obvious, and the correlations between the precipitation complexity and human influence factors vary. The distribution of the precipitation complexity in this area may be generated by the superposition effect of human activities and natural factors such as terrain, general atmospheric circulation, land and sea location, and ocean currents. To evaluate the stability of the algorithm, the CEEMDAN-WPT-MFDFA was compared with the equal probability coarse graining LZC algorithm, fuzzy entropy, and wavelet entropy. The results show

  8. Performance of Globally Linearized Controller and Two Region Fuzzy Logic Controller on a Nonlinear Process

    Directory of Open Access Journals (Sweden)

    N. Jaya

    2008-10-01

    Full Text Available In this work, a design and implementation of a Conventional PI controller, single region fuzzy logic controller, two region fuzzy logic controller and Globally Linearized Controller (GLC for a two capacity interacting nonlinear process is carried out. The performance of this process using single region FLC, two region FLC and GLC are compared with the performance of conventional PI controller about an operating point of 50 %. It has been observed that GLC and two region FLC provides better performance. Further, this procedure is also validated by real time experimentation using dSPACE.

  9. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

    Science.gov (United States)

    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

    1993-01-01

    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with the RNA and DNA sequences of the virus populations of their mothers.

    Science.gov (United States)

    Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M

    1993-01-01

    We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584

  11. Plasmid P1 replication: negative control by repeated DNA sequences.

    OpenAIRE

    Chattoraj, D; Cordes, K; Abeles, A

    1984-01-01

    The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pi...

  12. B4C control rod behavior during severe accident sequences

    International Nuclear Information System (INIS)

    Steinbrueck, M.

    2003-01-01

    The oxidation kinetics of various types of boron carbides (pellets, powder) as well as the degradation of B 4 C control rod segments were investigated in the temperature range between 800 and 1600 deg C. Mass spectrometric gas analysis was used to determine oxidation rates in transient and isothermal tests. The oxidation kinetics of boron carbide are determined by the formation of a liquid boron oxide layer and its loss due to the reaction with surplus steam to form volatile boric acids and at temperatures above 1500 deg C by direct evaporation. Under these test conditions linear oxidation kinetics are established soon after oxidation has initiated. The oxidation kinetics are strongly influenced by the thermal-hydraulic boundary conditions, in particular by the steam flow rate. Only very low amounts of methane were ever produced in these tests. Enhanced degradation of B 4 C control rods starts with the rapid formation of eutectic melts in the systems B 4 C-stainless steel (SS) and SS-Zircaloy at temperatures above 1250 deg C. Initially, this melt is kept within a ZrO 2 scale externally formed at the Zircaloy guide tube. The absorber melt is rapidly oxidized after failure of the oxide shell and aggressively attacks adjacent fuel claddings. (author)

  13. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  14. 40 CFR 81.112 - Charleston Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.112 Charleston Intrastate Air Quality Control Region. The Charleston Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... Quality Control Region: Region 1. 81.107Greenwood Intrastate Air Quality Control Region: Region 2. 81...

  15. Control Mechanism and Security Region for Intentional Islanding Transition

    DEFF Research Database (Denmark)

    Chen, Yu; Xu, Zhao; Østergaard, Jacob

    2009-01-01

    in the grid. The concept of Islanding Security Region (ISR) has been proposed as an organic composition of the developed control mechanism. The purpose of this control mechanism is to maintain the frequency stability and eventually the security of power supply to the customers, by utilizing resources from...... generation and demand sides. The control mechanism can be extended to consider the distributed generations like wind power and other innovative technologies such as the Demand as Frequency controlled Reserve (DFR) technique in the future....

  16. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    Science.gov (United States)

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

    Science.gov (United States)

    Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

    2017-11-01

    Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

  18. Genetic Diversity of Toxoplasma gondii Strains from Different Hosts and Geographical Regions by Sequence Analysis of GRA20 Gene.

    Science.gov (United States)

    Ning, Hong-Rui; Huang, Si-Yang; Wang, Jin-Lei; Xu, Qian-Ming; Zhu, Xing-Quan

    2015-06-01

    Toxoplasma gondii is a eukaryotic parasite of the phylum Apicomplexa, which infects all warm-blood animals, including humans. In the present study, we examined sequence variation in dense granule 20 (GRA20) genes among T. gondii isolates collected from different hosts and geographical regions worldwide. The complete GRA20 genes were amplified from 16 T. gondii isolates using PCR, sequence were analyzed, and phylogenetic reconstruction was analyzed by maximum parsimony (MP) and maximum likelihood (ML) methods. The results showed that the complete GRA20 gene sequence was 1,586 bp in length among all the isolates used in this study, and the sequence variations in nucleotides were 0-7.9% among all strains. However, removing the type III strains (CTG, VEG), the sequence variations became very low, only 0-0.7%. These results indicated that the GRA20 sequence in type III was more divergence. Phylogenetic analysis of GRA20 sequences using MP and ML methods can differentiate 2 major clonal lineage types (type I and type III) into their respective clusters, indicating the GRA20 gene may represent a novel genetic marker for intraspecific phylogenetic analyses of T. gondii.

  19. Bilingualism alters brain functional connectivity between "control" regions and "language" regions: Evidence from bimodal bilinguals.

    Science.gov (United States)

    Li, Le; Abutalebi, Jubin; Zou, Lijuan; Yan, Xin; Liu, Lanfang; Feng, Xiaoxia; Wang, Ruiming; Guo, Taomei; Ding, Guosheng

    2015-05-01

    Previous neuroimaging studies have revealed that bilingualism induces both structural and functional neuroplasticity in the dorsal anterior cingulate cortex (dACC) and the left caudate nucleus (LCN), both of which are associated with cognitive control. Since these "control" regions should work together with other language regions during language processing, we hypothesized that bilingualism may also alter the functional interaction between the dACC/LCN and language regions. Here we tested this hypothesis by exploring the functional connectivity (FC) in bimodal bilinguals and monolinguals using functional MRI when they either performed a picture naming task with spoken language or were in resting state. We found that for bimodal bilinguals who use spoken and sign languages, the FC of the dACC with regions involved in spoken language (e.g. the left superior temporal gyrus) was stronger in performing the task, but weaker in the resting state as compared to monolinguals. For the LCN, its intrinsic FC with sign language regions including the left inferior temporo-occipital part and right inferior and superior parietal lobules was increased in the bilinguals. These results demonstrate that bilingual experience may alter the brain functional interaction between "control" regions and "language" regions. For different control regions, the FC alters in different ways. The findings also deepen our understanding of the functional roles of the dACC and LCN in language processing. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  1. UBV(RI)sub(c) photometry of some standard sequences in the Harvard F regions and in the Magellanic Clouds

    International Nuclear Information System (INIS)

    Menzies, J.W.; Laing, J.D.

    1988-01-01

    This paper presents the results of a photometric programme aimed at improving the UBV(RI)sub(c) standard sequences in the Harvard F regions and in the Small and Large Magellanic Clouds. Magnitudes and colours are given for 99 stars, and they are compared with the current values which were obtained or compiled by a previous author. (author)

  2. Sequence-controlled polymerization guided by aryl-fluoroaryl π-stacking

    KAUST Repository

    Mugemana, Clement; Almahdali, Sarah; Rodionov, Valentin

    2014-01-01

    The ability to control monomer sequences is essential in macromolecular chemistry. Better sequence control leads to better control over macromolecular folding and self-assembly, which, in turn, would enable control over bulk properties (such as thermal behavior, conductivity and rigidity), as well as mimicking the properties of globular proteins. Here, we present a three-part synopsis of recent advances in research on sequence-controlled polymerization guided by aryl-perfluoroaryl π-π stacking of monomer pairs. We also show that for monomers that are capable of strong associative interactions, the classical reactivity ratio analysis based on Fineman-Ross/terminal reactivity models may lead to an imprecise determination of the monomer alternation mode. © 2014 American Chemical Society.

  3. SEQATOMS: a web tool for identifying missing regions in PDB in sequence context

    NARCIS (Netherlands)

    Brandt, B.W.; Heringa, J.; Leunissen, J.A.M.

    2008-01-01

    With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their

  4. Orifice design for the control of coupled region flow

    International Nuclear Information System (INIS)

    Atherton, R.; Spadaro, P.R.; Brummerhop, F.G.

    1975-01-01

    A fluid system arrangement for nuclear reactors is described comprising a triplate orifice apparatus which simultaneously controls core flow distribution, flow rate ratio between hydraulically coupled regions of the blanket and radial static pressure gradients entering and leaving the blanket fuel region. The design of the apparatus is based on the parameters of the diameter of the orifice holes, the friction factor, and expansion, contraction and turning pressure loss coefficients of the geometry of each orifice region. These above parameters are properly matched to provide the desired pressure drop, flow split and negligible cross flow at the interface of standard and power-flattened open lattice blanket regions. (U.S.)

  5. Asynchronous, Decentralized DS-CDMA Using Feedback-Controlled Spreading Sequences for Time-Dispersive Channels

    Science.gov (United States)

    Miyatake, Teruhiko; Chiba, Kazuki; Hamamura, Masanori; Tachikawa, Shin'ichi

    We propose a novel asynchronous direct-sequence codedivision multiple access (DS-CDMA) using feedback-controlled spreading sequences (FCSSs) (FCSS/DS-CDMA). At the receiver of FCSS/DS-CDMA, the code-orthogonalizing filter (COF) produces a spreading sequence, and the receiver returns the spreading sequence to the transmitter. Then the transmitter uses the spreading sequence as its updated version. The performance of FCSS/DS-CDMA is evaluated over time-dispersive channels. The results indicate that FCSS/DS-CDMA greatly suppresses both the intersymbol interference (ISI) and multiple access interference (MAI) over time-invariant channels. FCSS/DS-CDMA is applicable to the decentralized multiple access.

  6. A multifunction editor for programming control sequences for a robot based radiopharmaceutical synthesis system

    International Nuclear Information System (INIS)

    Appelquist, G.; Bohm, C.

    1990-01-01

    A Multifunction Editor is a development tool for building control sequences for a robotized production system for positron emitting radiopharmaceuticals. This system consists of SCARA robot and a PC-AT personal computer as a controller together with general and synthesis specific chemistry equipment. The general equipment, which is common for many synthesis, is fixed to the wall of the hotcell, while the specific equipment, dedicated to the given synthesis, is located on a removable tray. The program recognizes commands to move the robot, to control valves and to control the computer screen. From within the editor it is possible to run the control sequence forward or backward to test it and to use the single step feature to debug. The editor commands include insert, replace and delete of commands in the sequence. When programming or editing robot movements the robot may be controlled by the mouse, from the keyboard or from a remote control box. The robot control sequence consists of a succession of stored robot positions. The screen control is used to display dynamic flowchart diagrams. This is achieved by displaying a modified picture on the screen whenever the system state has been changed significantly

  7. Association of genetic variations in the mitochondrial DNA control region with presbycusis

    Directory of Open Access Journals (Sweden)

    Falah M

    2017-03-01

    Full Text Available Masoumeh Falah,1 Mohammad Farhadi,1 Seyed Kamran Kamrava,1 Saeid Mahmoudian,1 Ahmad Daneshi,1 Maryam Balali,1 Alimohamad Asghari,2 Massoud Houshmand1,3 1ENT and Head & Neck Research Center and Department, Iran University of Medical Sciences, Tehran, Iran; 2Skull Base Research Center, Iran University of Medical Sciences, Tehran, Iran; 3Department of Medical Genetics, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran Background: The prominent role of mitochondria in the generation of reactive oxygen species, cell death, and energy production contributes to the importance of this organelle in the intracellular mechanism underlying the progression of the common sensory disorder of the elderly, presbycusis. Reduced mitochondrial DNA (mtDNA gene expression and coding region variation have frequently been reported as being associated with the development of presbycusis. The mtDNA control region regulates gene expression and replication of the genome of this organelle. To comprehensively understand of the role of mitochondria in the progression of presbycusis, we compared variations in the mtDNA control region between subjects with presbycusis and controls.Methods: A total of 58 presbycusis patients and 220 control subjects were enrolled in the study after examination by the otolaryngologist and audiology tests. Variations in the mtDNA control region were investigated by polymerase chain reaction and Sanger sequencing.Results: A total of 113 sequence variants were observed in mtDNA, and variants were detected in 100% of patients, with 84% located in hypervariable regions. The frequencies of the variants, 16,223 C>T, 16,311 T>C, 16,249 T>C, and 15,954 A>C, were significantly different between presbycusis and control subjects.Conclusion: The statistically significant difference in the frequencies of four nucleotide variants in the mtDNA control region of presbycusis patients and controls is in agreement with previous experimental

  8. Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity.

    OpenAIRE

    Gough, N M; Bernard, O

    1981-01-01

    To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...

  9. Rapid evaluation and quality control of next generation sequencing data with FaQCs.

    Science.gov (United States)

    Lo, Chien-Chi; Chain, Patrick S G

    2014-11-19

    Next generation sequencing (NGS) technologies that parallelize the sequencing process and produce thousands to millions, or even hundreds of millions of sequences in a single sequencing run, have revolutionized genomic and genetic research. Because of the vagaries of any platform's sequencing chemistry, the experimental processing, machine failure, and so on, the quality of sequencing reads is never perfect, and often declines as the read is extended. These errors invariably affect downstream analysis/application and should therefore be identified early on to mitigate any unforeseen effects. Here we present a novel FastQ Quality Control Software (FaQCs) that can rapidly process large volumes of data, and which improves upon previous solutions to monitor the quality and remove poor quality data from sequencing runs. Both the speed of processing and the memory footprint of storing all required information have been optimized via algorithmic and parallel processing solutions. The trimmed output compared side-by-side with the original data is part of the automated PDF output. We show how this tool can help data analysis by providing a few examples, including an increased percentage of reads recruited to references, improved single nucleotide polymorphism identification as well as de novo sequence assembly metrics. FaQCs combines several features of currently available applications into a single, user-friendly process, and includes additional unique capabilities such as filtering the PhiX control sequences, conversion of FASTQ formats, and multi-threading. The original data and trimmed summaries are reported within a variety of graphics and reports, providing a simple way to do data quality control and assurance.

  10. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    1987-10-16

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  11. PuLSE: Quality control and quantification of peptide sequences explored by phage display libraries.

    Science.gov (United States)

    Shave, Steven; Mann, Stefan; Koszela, Joanna; Kerr, Alastair; Auer, Manfred

    2018-01-01

    The design of highly diverse phage display libraries is based on assumption that DNA bases are incorporated at similar rates within the randomized sequence. As library complexity increases and expected copy numbers of unique sequences decrease, the exploration of library space becomes sparser and the presence of truly random sequences becomes critical. We present the program PuLSE (Phage Library Sequence Evaluation) as a tool for assessing randomness and therefore diversity of phage display libraries. PuLSE runs on a collection of sequence reads in the fastq file format and generates tables profiling the library in terms of unique DNA sequence counts and positions, translated peptide sequences, and normalized 'expected' occurrences from base to residue codon frequencies. The output allows at-a-glance quantitative quality control of a phage library in terms of sequence coverage both at the DNA base and translated protein residue level, which has been missing from toolsets and literature. The open source program PuLSE is available in two formats, a C++ source code package for compilation and integration into existing bioinformatics pipelines and precompiled binaries for ease of use.

  12. Complete Genome Sequence of the Quality Control Strain Staphylococcus aureus subsp. aureus ATCC 25923.

    Science.gov (United States)

    Treangen, Todd J; Maybank, Rosslyn A; Enke, Sana; Friss, Mary Beth; Diviak, Lynn F; Karaolis, David K R; Koren, Sergey; Ondov, Brian; Phillippy, Adam M; Bergman, Nicholas H; Rosovitz, M J

    2014-11-06

    Staphylococcus aureus subsp. aureus ATCC 25923 is commonly used as a control strain for susceptibility testing to antibiotics and as a quality control strain for commercial products. We present the completed genome sequence for the strain, consisting of the chromosome and a 27.5-kb plasmid. Copyright © 2014 Treangen et al.

  13. Sequence analysis of the breakpoint regions of an X;5 translocation in a female with Duchenne muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others

    1995-08-01

    X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.

  14. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  15. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  16. Regional dialogue and multilateral arms control efforts today

    International Nuclear Information System (INIS)

    Graham, T. Jr.

    1994-01-01

    The significance of arms control and non-proliferation tasks is stressed emphasising what has been done, and-more important-what must still be done. Although tangible developments at the regional level may seem at times to be slow in coming, it is important to remember that the United States-Soviet transition from voluntary declarations to detailed arms control agreements with intrusive verification regimes spanned the entire length of cold war. Given the instabilities afflicting these regions, establishing a regional dialogue is itself a confidence-building measure. The experience of the United States and the former Soviet Union amply demonstrates that mere existence of regular dialogue can reduce tension by providing a platform for communication among military and Government participants even when political crisis prevents diplomatic contacts at senior levels. The international community should be encouraged by the progress that has been made to date to address regional instabilities. Such steps are an integral part of the international effort, carried out both at the United Nations and elsewhere, to adopt acceptable levels of conventional military forces and to eliminate weapons of mass destruction. Given the instabilities afflicting these regions, establishing a regional dialogue is itself a confidence-building measure. World changes, while potentially dangerous and certainly challenging, offer the hope of replacing antagonism with cooperation, creating a progressively more democratic global environment, preventing proliferation, and dampening regional conflicts. Continuing to make effective use of the entire mix of arms control and confidence-building tools will help to realize these hopes

  17. The regional costs and benefits of acid rain control

    International Nuclear Information System (INIS)

    Berkman, M.P.

    1991-01-01

    Congress recently enacted acid rain control legislation as part of the 1990 Clean Air Act Amendments following a decade-long debate among disparate regional interests. Although Congress succeeded in drafting a law acceptable to all regions, the regional costs and benefits of the legislation remain uncertain. The research presented here attempts to estimate the regional costs and benefits and the economic impacts of acid rain controls. These estimates are made using a modeling system composed of econometric, linear programming and input-output models. The econometric and linear programming components describe markets for electricity and coal. The outputs of these components including capital investment, electricity demand, and coal production are taken as exogenous inputs by a multiregional input-output model. The input-output model produces estimates of changes in final demand, gross output, and employment. The utility linear programming model also predicts sulfur dioxide emissions (an acid-rain precursor). According to model simulations, the costs of acid rain control exceed the benefits for many regions including several regions customarily thought to be the major beneficiaries of acid rain control such as New England

  18. New tool to assemble repetitive regions using next-generation sequencing data

    Science.gov (United States)

    Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz

    2017-08-01

    The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.

  19. Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.

    Science.gov (United States)

    Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia

    2017-07-24

    Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

  20. Sequence variation of koala retrovirus transmembrane protein p15E among koalas from different geographic regions

    Science.gov (United States)

    Ishida, Yasuko; McCallister, Chelsea; Nikolaidis, Nikolas; Tsangaras, Kyriakos; Helgen, Kristofer M.; Greenwood, Alex D.; Roca, Alfred L.

    2014-01-01

    The koala retrovirus (KoRV), which is transitioning from an exogenous to an endogenous form, has been associated with high mortality in koalas. For other retroviruses, the envelope protein p15E has been considered a candidate for vaccine development. We therefore examined proviral sequence variation of KoRV p15E in a captive Queensland and three wild southern Australian koalas. We generated 163 sequences with intact open reading frames, which grouped into 39 distinct haplotypes. Sixteen distinct haplotypes comprising 139 of the sequences (85%) coded for the same polypeptide. Among the remaining 23 haplotypes, 22 were detected only once among the sequences, and each had 1 or 2 non-synonymous differences from the majority sequence. Several analyses suggested that p15E was under purifying selection. Important epitopes and domains were highly conserved across the p15E sequences and in previously reported exogenous KoRVs. Overall, these results support the potential use of p15E for KoRV vaccine development. PMID:25462343

  1. Seismicity Controlled by a Frictional Afterslip During a Small-Magnitude Seismic Sequence (ML Taiwan

    Science.gov (United States)

    Canitano, Alexandre; Godano, Maxime; Hsu, Ya-Ju; Lee, Hsin-Ming; Linde, Alan T.; Sacks, Selwyn

    2018-02-01

    We report evidence for frictional afterslip at shallow depths (about 5 to 7 km) during a small-magnitude seismic sequence (with MLTaiwan. The afterslip, which was recorded by a nearby borehole dilatometer, lasted about a month with a cumulative geodetic moment magnitude of 4.8 ± 0.2. The afterslip comprised two stages and controlled the aftershock sequence. The first postseismic stage, which followed a ML 4.6 earthquake, lasted about 6 h and mostly controlled the ruptures of neighboring asperities (e.g., multiplets) near the hypocenter. Then, a 4 week duration large afterslip event following a ML 4.9 earthquake controlled the rate of aftershocks during its first 2 days through brittle creep. The study presents a rare case of simultaneous seismological and geodetic observations for afterslip following earthquakes with magnitude lower than 5. Furthermore, the geodetic moment of the postseismic phase is at least equivalent to the coseismic moment of the sequence.

  2. Regularized rare variant enrichment analysis for case-control exome sequencing data.

    Science.gov (United States)

    Larson, Nicholas B; Schaid, Daniel J

    2014-02-01

    Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.

  3. Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison

    Science.gov (United States)

    2010-01-01

    Background The cultivated olive (Olea europaea L.) is the most agriculturally important species of the Oleaceae family. Although many studies have been performed on plastid polymorphisms to evaluate taxonomy, phylogeny and phylogeography of Olea subspecies, only few polymorphic regions discriminating among the agronomically and economically important olive cultivars have been identified. The objective of this study was to sequence the entire plastome of olive and analyze many potential polymorphic regions to develop new inter-cultivar genetic markers. Results The complete plastid genome of the olive cultivar Frantoio was determined by direct sequence analysis using universal and novel PCR primers designed to amplify all overlapping regions. The chloroplast genome of the olive has an organisation and gene order that is conserved among numerous Angiosperm species and do not contain any of the inversions, gene duplications, insertions, inverted repeat expansions and gene/intron losses that have been found in the chloroplast genomes of the genera Jasminum and Menodora, from the same family as Olea. The annotated sequence was used to evaluate the content of coding genes, the extent, and distribution of repeated and long dispersed sequences and the nucleotide composition pattern. These analyses provided essential information for structural, functional and comparative genomic studies in olive plastids. Furthermore, the alignment of the olive plastome sequence to those of other varieties and species identified 30 new organellar polymorphisms within the cultivated olive. Conclusions In addition to identifying mutations that may play a functional role in modifying the metabolism and adaptation of olive cultivars, the new chloroplast markers represent a valuable tool to assess the level of olive intercultivar plastome variation for use in population genetic analysis, phylogenesis, cultivar characterisation and DNA food tracking. PMID:20868482

  4. Region based Brain Computer Interface for a home control application.

    Science.gov (United States)

    Akman Aydin, Eda; Bay, Omer Faruk; Guler, Inan

    2015-08-01

    Environment control is one of the important challenges for disabled people who suffer from neuromuscular diseases. Brain Computer Interface (BCI) provides a communication channel between the human brain and the environment without requiring any muscular activation. The most important expectation for a home control application is high accuracy and reliable control. Region-based paradigm is a stimulus paradigm based on oddball principle and requires selection of a target at two levels. This paper presents an application of region based paradigm for a smart home control application for people with neuromuscular diseases. In this study, a region based stimulus interface containing 49 commands was designed. Five non-disabled subjects were attended to the experiments. Offline analysis results of the experiments yielded 95% accuracy for five flashes. This result showed that region based paradigm can be used to select commands of a smart home control application with high accuracy in the low number of repetitions successfully. Furthermore, a statistically significant difference was not observed between the level accuracies.

  5. Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

    International Nuclear Information System (INIS)

    Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

    1988-01-01

    The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

  6. REGIONAL DRAINWATER MANAGEMENT: SOURCE CONTROL, AGROFORESTRY, AND EVAPORATION PONDS

    OpenAIRE

    Posnikoff, Judith F.; Knapp, Keith C.

    1996-01-01

    Source control is one way to address salinity and drainage problems in irrigated agriculture, and reuse of drainage flows on salt-tolerant crops or trees in agroforestry production is another. A regional model of agricultural production with drainwater reuse and disposal is developed. Deep percolation flows are controlled through choice of crop areas, irrigation systems, and applied-water quantities. Crop drainwater may by reused in agroforestry production, and residual emissions are disposed...

  7. Transcription Factor Zbtb20 Controls Regional Specification of Mammalian Archicortex

    DEFF Research Database (Denmark)

    Rosenthal, Eva Helga

    2010-01-01

    Combinatorial expression of sets of transcription factors (TFs) along the mammalian cortex controls its subdivision into functional areas. Unlike neocortex, only few recent data suggest genetic mechanisms controlling the regionalization of the archicortex. TF Emx2 plays a crucial role in patterning...... later on becoming restricted exclusively to postmitotic neurons of hippocampus (Hi) proper, dentate gyrus (DG), and two transitory zones, subiculum (S) and retrosplenial cortex (Rsp). Analysis of Zbtb20-/- mice revealed altered cortical patterning at the border between neocortex and archicortex...

  8. Uranium mineralization rules controlled by sedimentation in Bayanwula region in Erlian basin

    International Nuclear Information System (INIS)

    Lu Chao

    2012-01-01

    Uranium mineralization is closely related to sedimentation in Bayanwula region in Erlian Basin. Clarifying the relation of sedimentation and Uranium Mineralization Through detailed analysis of vertical sequences, stratigraphic correlation and the heterogeneity of sand body. Study show that the of development characteristics of sequences of Bayanwula region control the vertical positioning of favorable sand, the skeleton sand bodies of LST in upper Saihan formation is the most favorable reservoir space for uranium. Uranium mineralization is closely related with the heterogeneity of the sand bodies of upper Saihan formation. the heterogeneity of Sand body is mainly reflected in plane and vertical. In plane, with the research of the sand distributed system of upper Saihan formation, the change position of sandstone thickness and sand rate, the position of the variation of shape and trend of sand body, and the change position of sand body character and genesis are most favorable for uranium mineralization. In vertical, the number of layers and thickness of isolated barrier bed not only control the thickness of oxide sandstone. but also they are associated with the distribution of uranium mineralization; The evolution of sedimentary basins created Bayanwula uranium deposits. There is a second order sequence boundary between the upper Saihan formation and the Erlian formation of Late Cretaceous, which is a long-term exposure and erosion unconformity, resulting in the partly erosion of the upper Saihan formation, providing the best conditions of the penetration of the uranium-bearing oxygen water and the development of phreatic oxidation and interlayer oxidation zone. (author)

  9. Sequence analysis of the its-2 region: a tool to identify strains of Scenedesmus (Chlorophyceae)

    NARCIS (Netherlands)

    Van Hannen, E.J.; Lürling, M.; Van Donk, E.

    2000-01-01

    The genetic distances between several strains of Senedesmus obliquus (Turp,) Kutz,, S, acutus Hortobagyi, and S, naegelii Chod. calculated from ITS-2 sequences were found to be smaller than the genetic distances within other strains of Scenedesmus-that is, in S, acuminatus (Lagerh,) Chod, and S,

  10. Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder; Kristensen, Claus; Betenbaugh, Michael J.

    2015-01-01

    Background: The DHFR negative CHO DXB11 cell line (also known as DUX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins.  Results: Here we present the genomic sequence...... of the CHO DXB11 genome sequenced to a depth of 33x. Overall a significant genomic drift was seen favoring GC -> AT point mutations in line with the chemical mutagenesis strategy used for generation of the cell line. The sequencing depth for each gene in the genome revealed distinct peaks at sequencing...... in eight additional analyzed CHO genomes (15-20% haploidy) but not in the genome of the Chinese hamster. The dhfr gene is confirmed to be haploid in CHO DXB11; transcriptionally active and the remaining allele contains a G410C point mutation causing a Thr137Arg missense mutation. We find similar to 2...

  11. An atlas of over 90.000 conserved noncoding sequences provides insight into crucifer regulatory regions

    NARCIS (Netherlands)

    Haudry, A.; Platts, A.E.; Vello, E.; Hoen, D.R.; Leclerq, M.; Williamson, R.J.; Forczek, E.; Joly-Lopez, Z.; Steffen, J.G.; Hazzouri, K.M.; Dewar, K.; Stinchcombe, J.R.; Schoen, D.J.; Wang, X.; Schmutz, J.; Town, C.D.; Edger, P.P.; Pires, J.C.; Schumaker, K.S.; Jarvis, D.E.; Mandakova, T.; Lysak, M.; Bergh, van den E.; Schranz, M.E.; Harrison, P.M.

    2013-01-01

    Despite the central importance of noncoding DNA to gene regulation and evolution, understanding of the extent of selection on plant noncoding DNA remains limited compared to that of other organisms. Here we report sequencing of genomes from three Brassicaceae species (Leavenworthia alabamica,

  12. Neural-network-designed pulse sequences for robust control of singlet-triplet qubits

    Science.gov (United States)

    Yang, Xu-Chen; Yung, Man-Hong; Wang, Xin

    2018-04-01

    Composite pulses are essential for universal manipulation of singlet-triplet spin qubits. In the absence of noise, they are required to perform arbitrary single-qubit operations due to the special control constraint of a singlet-triplet qubit, while in a noisy environment, more complicated sequences have been developed to dynamically correct the error. Tailoring these sequences typically requires numerically solving a set of nonlinear equations. Here we demonstrate that these pulse sequences can be generated by a well-trained, double-layer neural network. For sequences designed for the noise-free case, the trained neural network is capable of producing almost exactly the same pulses known in the literature. For more complicated noise-correcting sequences, the neural network produces pulses with slightly different line shapes, but the robustness against noises remains comparable. These results indicate that the neural network can be a judicious and powerful alternative to existing techniques in developing pulse sequences for universal fault-tolerant quantum computation.

  13. Current situation, genetic relationship and control measures of infectious bronchitis virus variants circulating in African regions

    Directory of Open Access Journals (Sweden)

    Khadija Khataby

    2016-08-01

    Three S1 gene hypervariable regions were studied and compared to the reference genotypes/serotypes that found emerging in African regions. This comparison was based on phylogenetic trees, nucleotide and amino-acid sequence analysis. It clearly appears that IBV variants reported in Africa, display a low genetic relationship between them and with the majority of the reference strains emerging in neighboring countries, except the case of variants from Libya and Egypt that show a high relatedness. Also the Massachusetts serotypes were the most prevalent co-circulating with both serotypes, Italy02 type in Morocco and Qx-like genotype in South part of the African continent. In order to control the IBV variants in African regions, an efficient vaccination strategy program should be implemented.

  14. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  15. Whole-exome sequencing reveals genetic variants associated with chronic kidney disease characterized by tubulointerstitial damages in North Central Region, Sri Lanka.

    Science.gov (United States)

    Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio

    2015-09-01

    The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.

  16. Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells

    International Nuclear Information System (INIS)

    Kwon, Y.K.; Hecht, N.B.

    1991-01-01

    The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA

  17. A Systems Approach towards an Intelligent and Self-Controlling Platform for Integrated Continuous Reaction Sequences**

    Science.gov (United States)

    Ingham, Richard J; Battilocchio, Claudio; Fitzpatrick, Daniel E; Sliwinski, Eric; Hawkins, Joel M; Ley, Steven V

    2015-01-01

    Performing reactions in flow can offer major advantages over batch methods. However, laboratory flow chemistry processes are currently often limited to single steps or short sequences due to the complexity involved with operating a multi-step process. Using new modular components for downstream processing, coupled with control technologies, more advanced multi-step flow sequences can be realized. These tools are applied to the synthesis of 2-aminoadamantane-2-carboxylic acid. A system comprising three chemistry steps and three workup steps was developed, having sufficient autonomy and self-regulation to be managed by a single operator. PMID:25377747

  18. Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Irshad M. Sulaiman

    2014-06-01

    Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.

  19. Draft genome sequence of bitter gourd (Momordica charantia), a vegetable and medicinal plant in tropical and subtropical regions.

    Science.gov (United States)

    Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo

    2017-02-01

    Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

    Science.gov (United States)

    Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

    2016-04-01

    The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  1. Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

    Directory of Open Access Journals (Sweden)

    Masoume Vakili Azghandi

    2016-05-01

    Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  2. Sequence Analysis of How Disability Influenced Life Trajectories in a Past Population from the Nineteenth-Century Sundsvall Region, Sweden

    Directory of Open Access Journals (Sweden)

    Lotta Vikström

    2017-05-01

    Full Text Available Historically, little is known about whether and to what extent disabled people found work and formed families. To fill this gap, this study analyses the life course trajectories of both disabled and non-disabled individuals, between the ages of 15 and 33, from the Sundsvall region in Sweden during the nineteenth century. Having access to micro-data that report disabilities in a population of 8,874 individuals from the parish registers digitised by the Demographic Data Base, Umeå University, we employ sequence analysis on a series of events that are expected to occur in life of young adults: getting a job, marrying and becoming a parent, while also taking into account out-migration and death. Through this method we obtain a holistic picture of the life course of disabled people. Main findings show that their trajectories did not include work or family to the same extent as those of non-disabled people. Secondary findings concerning migration and mortality indicate that the disabled rarely out-migrated from the region, and they suffered from premature deaths. To our knowledge this is the first study to employ sequence analysis on a substantially large number of cases to provide demographic evidence of how disability shaped human trajectories in the past during an extended period of life. Accordingly, we detail our motivation for this method, describe our analytical approach, and discuss the advantages and disadvantages associated with sequence analysis for our case study.

  3. Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

    Science.gov (United States)

    Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

    2003-08-01

    A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

  4. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

    Science.gov (United States)

    Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

    2010-03-09

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  5. Genome-Based Identification of Active Prophage Regions by Next Generation Sequencing in Bacillus licheniformis DSM13

    Science.gov (United States)

    Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja

    2015-01-01

    Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873

  6. Identification of similar regions of protein structures using integrated sequence and structure analysis tools

    Directory of Open Access Journals (Sweden)

    Heiland Randy

    2006-03-01

    Full Text Available Abstract Background Understanding protein function from its structure is a challenging problem. Sequence based approaches for finding homology have broad use for annotation of both structure and function. 3D structural information of protein domains and their interactions provide a complementary view to structure function relationships to sequence information. We have developed a web site http://www.sblest.org/ and an API of web services that enables users to submit protein structures and identify statistically significant neighbors and the underlying structural environments that make that match using a suite of sequence and structure analysis tools. To do this, we have integrated S-BLEST, PSI-BLAST and HMMer based superfamily predictions to give a unique integrated view to prediction of SCOP superfamilies, EC number, and GO term, as well as identification of the protein structural environments that are associated with that prediction. Additionally, we have extended UCSF Chimera and PyMOL to support our web services, so that users can characterize their own proteins of interest. Results Users are able to submit their own queries or use a structure already in the PDB. Currently the databases that a user can query include the popular structural datasets ASTRAL 40 v1.69, ASTRAL 95 v1.69, CLUSTER50, CLUSTER70 and CLUSTER90 and PDBSELECT25. The results can be downloaded directly from the site and include function prediction, analysis of the most conserved environments and automated annotation of query proteins. These results reflect both the hits found with PSI-BLAST, HMMer and with S-BLEST. We have evaluated how well annotation transfer can be performed on SCOP ID's, Gene Ontology (GO ID's and EC Numbers. The method is very efficient and totally automated, generally taking around fifteen minutes for a 400 residue protein. Conclusion With structural genomics initiatives determining structures with little, if any, functional characterization

  7. Complete re-sequencing of a 2Mb topological domain encompassing the FTO/IRXB genes identifies a novel obesity-associated region upstream of IRX5

    DEFF Research Database (Denmark)

    Hunt, Lilian E; Noyvert, Boris; Bhaw-Rosun, Leena

    2015-01-01

    BACKGROUND: Association studies have identified a number of loci that contribute to an increased body mass index (BMI), the strongest of which is in the first intron of the FTO gene on human chromosome 16q12.2. However, this region is both non-coding and under strong linkage disequilibrium, making...... it recalcitrant to functional interpretation. Furthermore, the FTO gene is located within a complex cis-regulatory landscape defined by a topologically associated domain that includes the IRXB gene cluster, a trio of developmental regulators. Consequently, at least three genes in this interval have been...... implicated in the aetiology of obesity. METHODS: Here, we sequence a 2 Mb region encompassing the FTO, RPGRIP1L and IRXB cluster genes in 284 individuals from a well-characterised study group of Danish men containing extremely overweight young adults and controls. We further replicate our findings both...

  8. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  9. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  10. Networked Predictive Control for Nonlinear Systems With Arbitrary Region Quantizers.

    Science.gov (United States)

    Yang, Hongjiu; Xu, Yang; Xia, Yuanqing; Zhang, Jinhui

    2017-04-06

    In this paper, networked predictive control is investigated for planar nonlinear systems with quantization by an extended state observer (ESO). The ESO is used not only to deal with nonlinear terms but also to generate predictive states for dealing with network-induced delays. Two arbitrary region quantizers are applied to take effective values of signals in forward channel and feedback channel, respectively. Based on a "zoom" strategy, sufficient conditions are given to guarantee stabilization of the closed-loop networked control system with quantization. A simulation example is proposed to exhibit advantages and availability of the results.

  11. Habits as action sequences: hierarchical action control and changes in outcome value.

    Science.gov (United States)

    Dezfouli, Amir; Lingawi, Nura W; Balleine, Bernard W

    2014-11-05

    Goal-directed action involves making high-level choices that are implemented using previously acquired action sequences to attain desired goals. Such a hierarchical schema is necessary for goal-directed actions to be scalable to real-life situations, but results in decision-making that is less flexible than when action sequences are unfolded and the decision-maker deliberates step-by-step over the outcome of each individual action. In particular, from this perspective, the offline revaluation of any outcomes that fall within action sequence boundaries will be invisible to the high-level planner resulting in decisions that are insensitive to such changes. Here, within the context of a two-stage decision-making task, we demonstrate that this property can explain the emergence of habits. Next, we show how this hierarchical account explains the insensitivity of over-trained actions to changes in outcome value. Finally, we provide new data that show that, under extended extinction conditions, habitual behaviour can revert to goal-directed control, presumably as a consequence of decomposing action sequences into single actions. This hierarchical view suggests that the development of action sequences and the insensitivity of actions to changes in outcome value are essentially two sides of the same coin, explaining why these two aspects of automatic behaviour involve a shared neural structure. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  12. NGS QC Toolkit: a toolkit for quality control of next generation sequencing data.

    Directory of Open Access Journals (Sweden)

    Ravi K Patel

    Full Text Available Next generation sequencing (NGS technologies provide a high-throughput means to generate large amount of sequence data. However, quality control (QC of sequence data generated from these technologies is extremely important for meaningful downstream analysis. Further, highly efficient and fast processing tools are required to handle the large volume of datasets. Here, we have developed an application, NGS QC Toolkit, for quality check and filtering of high-quality data. This toolkit is a standalone and open source application freely available at http://www.nipgr.res.in/ngsqctoolkit.html. All the tools in the application have been implemented in Perl programming language. The toolkit is comprised of user-friendly tools for QC of sequencing data generated using Roche 454 and Illumina platforms, and additional tools to aid QC (sequence format converter and trimming tools and analysis (statistics tools. A variety of options have been provided to facilitate the QC at user-defined parameters. The toolkit is expected to be very useful for the QC of NGS data to facilitate better downstream analysis.

  13. Numerical modeling of block structure dynamics: Application to the Vrancea region and study of earthquakes sequences in the synthetic catalogs

    International Nuclear Information System (INIS)

    Soloviev, A.A.; Vorobieva, I.A.

    1995-08-01

    A seismically active region is represented as a system of absolutely rigid blocks divided by infinitely thin plane faults. The interaction of the blocks along the fault planes and with the underlying medium is viscous-elastic. The system of blocks moves as a consequence of prescribed motion of boundary blocks and the underlying medium. When for some part of a fault plane the stress surpasses a certain strength level a stress-drop (''a failure'') occurs. It can cause a failure for other parts of fault planes. The failures are considered as earthquakes. As a result of the numerical simulation a synthetic earthquake catalogue is produced. This procedure is applied for numerical modeling of dynamics of the block structure approximating the tectonic structure of the Vrancea region. By numerical experiments the values of the model parameters were obtained which supplied the synthetic earthquake catalog with the space distribution of epicenters close to the real distribution of the earthquake epicenters in the Vrancea region. The frequency-magnitude relations (Gutenberg-Richter curves) obtained for the synthetic and real catalogs have some common features. The sequences of earthquakes arising in the model are studied for some artificial structures. It is found that ''foreshocks'', ''main shocks'', and ''aftershocks'' could be detected among earthquakes forming the sequences. The features of aftershocks, foreshocks, and catalogs of main shocks are analysed. (author). 5 refs, 12 figs, 16 tabs

  14. Control of bootstrap current in the pedestal region of tokamaks

    Energy Technology Data Exchange (ETDEWEB)

    Shaing, K. C. [Institute for Space and Plasma Sciences, National Cheng Kung University, Tainan City 70101, Taiwan (China); Department of Engineering Physics, University of Wisconsin, Madison, Wisconsin 53796 (United States); Lai, A. L. [Institute for Space and Plasma Sciences, National Cheng Kung University, Tainan City 70101, Taiwan (China)

    2013-12-15

    The high confinement mode (H-mode) plasmas in the pedestal region of tokamaks are characterized by steep gradient of the radial electric field, and sonic poloidal U{sub p,m} flow that consists of poloidal components of the E×B flow and the plasma flow velocity that is parallel to the magnetic field B. Here, E is the electric field. The bootstrap current that is important for the equilibrium, and stability of the pedestal of H-mode plasmas is shown to have an expression different from that in the conventional theory. In the limit where ‖U{sub p,m}‖≫ 1, the bootstrap current is driven by the electron temperature gradient and inductive electric field fundamentally different from that in the conventional theory. The bootstrap current in the pedestal region can be controlled through manipulating U{sub p,m} and the gradient of the radial electric. This, in turn, can control plasma stability such as edge-localized modes. Quantitative evaluations of various coefficients are shown to illustrate that the bootstrap current remains finite when ‖U{sub p,m}‖ approaches infinite and to provide indications how to control the bootstrap current. Approximate analytic expressions for viscous coefficients that join results in the banana and plateau-Pfirsch-Schluter regimes are presented to facilitate bootstrap and neoclassical transport simulations in the pedestal region.

  15. 40 CFR 81.88 - Billings Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.88 Billings Intrastate Air Quality Control Region. The Metropolitan Billings Intrastate Air Quality Control Region (Montana) has been renamed the Billings Intrastate Air Quality Control... to by Montana authorities as follows: Sec. 481.168Great Falls Intrastate Air Quality Control Region...

  16. Mitochondrial DNA control region variability in wild boars from west Balkans

    Directory of Open Access Journals (Sweden)

    Đan Mihajla

    2013-01-01

    Full Text Available The wild boar (Sus scrofa is one of most abundant game species in hunting areas of Balkan region. The large fraction of pre-glacial genetic diversity in wild boar populations from the Balkans was addressed due to high proportion of unique mtDNA haplotypes found in Greece, indicating Balkan as main refugial area for wild boars. The aim of the present study is to characterize mitochondrial DNA control region variability in wild boars from different areas in the West Balkan region, in order to evaluate level of genetic variability, to detect unique haplotypes and to infer possible structuring. The total number of 163 individuals from different sampling localities were included in the study. A fragment of the mtDNA control region was amplified and sequenced by standard procedures. Population genetic analyses were performed using several computer packages: BioEdit, ARLEQUIN 3.5.1.2., Network 4.6.0.0 and MEGA5. Eleven different haplotypes were identified and haplotype diversity was 0.676, nucleotide diversity 0.0026, and the average number of nucleotide differences (k 1.169. The mismatch distribution and neutrality tests indicated the expansion of the all populations. It is shown that high level of genetic diversity is present in the wild boars from the West Balkan region and we have managed to detect regional unique haplotypes in high frequency. Genetic diversity differences have been found in regional wild boar groups, clustering them in two main clusters, but further speculations on the reasons for the observed clustering are prevented due to restricted informativness of the single locus marker. Obtained knowledge of genetic variation in the wild boar may be relevant for improving knowledge of the phylogeny and phylogeography of the wild boars, but as well as for hunting societies and responsible authorities for the effective control of wild boar populations.

  17. Identification of genomic regions associated with female fertility in Danish Jersey using whole genome sequence data

    DEFF Research Database (Denmark)

    Höglund, Johanna; Guldbrandtsen, Bernt; Lund, Mogens Sandø

    2015-01-01

    6 QTL were detected for FTI: one QTL on each of BTA7, BTA20, BTA23, BTA25, and two QTL on BTA9 (QTL9–1 and QTL9–2). In the second step, ICF showed association with the QTL regions on BTA7, QTL9–2 QTL2 on BTA9, and BTA25, AIS for cows on BTA20 and BTA23, AIS for heifers on QTL9–2 on BTA9, IFL...... for cows on BTA20, BTA23 and BTA25, IFL for heifers on BTA7 and QTL9-2 on BTA9, NRR for heifers on BTA7 and BTA23, and NRR for cows on BTA23. Conclusion: The genome wide association study presented here revealed 6 genomic regions associated with FTI. Screening these 6 QTL regions for the underlying female...... quantitative trait locus regions were re-analyzed using a linear mixed model (animal model) for both FTI and its component traits AIS, NRR, IFL and ICF. The underlying traits were analyzed separately for heifers (first parity cows) and cows (later parity cows) for AIS, NRR, and IFL. Results: In the first step...

  18. A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

    Directory of Open Access Journals (Sweden)

    Dolores González

    2012-12-01

    Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

  19. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  20. Negative sequence current control in wind power plants with VSC-HVDC connection

    DEFF Research Database (Denmark)

    Chaudhary, Sanjay; Teodorescu, Remus; Rodriguez, Pedro

    2012-01-01

    Large offshore wind power plants may have multi-MW wind turbine generators (WTG) equipped with full-scale converters (FSC) and voltage source converter (VSC) based high voltaage direct-current (HVDC) transmission for grid connection. The power electronic converters in theWTG-FSC and the VSC......-HVDC allow fast current control in the offshore grid. This paper presents a method of controlling the negative sequence current injection into the offshore grid from the VSC-HVDC as well as WTG-FSCs. This would minimize the power oscillations and hence reduce the dc voltage overshoots in the VSC-HVDC system...... as well as in the WTG-FSCs; especially when the offshore grid is unbalanced due to asymmetric faults. The formulation for negative sequence current injection is mathematically derived and then implemented in electromagnetic transients (EMT) simulation model. The simulated results show that the negative...

  1. Neuropeptide processing in regional brain slices: Effect of conformation and sequence

    Energy Technology Data Exchange (ETDEWEB)

    Li, Z.W.; Bijl, W.A.; van Nispen, J.W.; Brendel, K.; Davis, T.P. (Univ. of Arizona, Tucson (USA))

    1990-05-01

    The central enzymatic stability of des-enkephalin-gamma-endorphin and its synthetic analogs (cycloN alpha 6, C delta 11)beta-endorphin-(6-17) and (Pro7, Lys(Ac)9)-beta-endorphin(6-17) was studied in vitro using a newly developed, regionally dissected rat brain slice, time course incubation procedure. Tissue slice viability was estimated as the ability of the brain slice to take up or release gamma-(3H)aminobutyric acid after high K+ stimulation. Results demonstrated stability of uptake/release up to 5 hr of incubation, suggesting tissue viability over this period. The estimated half-life of peptides based on the results obtained in our incubation protocol suggest that the peptides studied are metabolized at different rates in the individual brain regions tested. A good correlation exists between the high enzyme activity of neutral endopeptidase and the rapid degradation of des-enkephalin-gamma-endorphin and (cycloN alpha 6, C delata 11)beta-endorphin-(6-17) in caudate putamen. Proline substitution combined with lysine acetylation appears to improve resistance to enzymatic metabolism in caudate putamen and hypothalamus. However, cyclization of des-enkephalin-gamma-endorphin forming an amide bond between the alpha-NH2 of the N-terminal threonine and the gamma-COOH of glutamic acid did not improve peptide stability in any brain region tested. The present study has shown that the brain slice technique is a valid and unique approach to study neuropeptide metabolism in small, discrete regions of rat brain where peptides, peptidases and receptors are colocalized and that specific structural modifications can improve peptide stability.

  2. Draft Genome Sequence of Bacillus velezensis B6, a Rhizobacterium That Can Control Plant Diseases.

    Science.gov (United States)

    Gao, Yu-Han; Guo, Rong-Jun; Li, Shi-Dong

    2018-03-22

    The draft genome of Bacillus velezensis strain B6, a rhizobacterium with good biocontrol performance isolated from soil in China, was sequenced. The assembly comprises 32 scaffolds with a total size of 3.88 Mb. Gene clusters coding either ribosomally encoded bacteriocins or nonribosomally encoded antimicrobial polyketides and lipopeptides in the genome may contribute to plant disease control. Copyright © 2018 Gao et al.

  3. Intensity stabilisation of optical pulse sequences for coherent control of laser-driven qubits

    Science.gov (United States)

    Thom, Joseph; Yuen, Ben; Wilpers, Guido; Riis, Erling; Sinclair, Alastair G.

    2018-05-01

    We demonstrate a system for intensity stabilisation of optical pulse sequences used in laser-driven quantum control of trapped ions. Intensity instability is minimised by active stabilisation of the power (over a dynamic range of > 104) and position of the focused beam at the ion. The fractional Allan deviations in power were found to be logic gates to be below 10^{-6} per gate.

  4. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia

    Science.gov (United States)

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W.; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-01-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

  5. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  6. 40 CFR 81.104 - Central Pennsylvania Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.104 Section 81.104 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.104 Central Pennsylvania Intrastate Air Quality Control Region. The Central Pennsylvania Intrastate Air Quality Control Region consists of the territorial area encompassed by...

  7. 40 CFR 81.43 - Metropolitan Toledo Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.43 Section 81.43 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.43 Metropolitan Toledo Interstate Air Quality Control Region. The Metropolitan Toledo Interstate Air Quality Control Region (Ohio-Michigan) consists of the territorial area...

  8. 40 CFR 81.31 - Metropolitan Providence Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.31 Section 81.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.31 Metropolitan Providence Interstate Air Quality Control Region. The Metropolitan Providence Interstate Air Quality Control Region (Rhode Island-Massachusetts) consists of the...

  9. 40 CFR 81.117 - Southeast Missouri Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.117 Section 81.117 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.117 Southeast Missouri Intrastate Air Quality Control Region. The Southeast Missouri Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  10. 40 CFR 81.90 - Androscoggin Valley Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.90 Section 81.90 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.90 Androscoggin Valley Interstate Air Quality Control Region. The Androscoggin Valley Interstate Air Quality Control Region (Maine-New Hampshire) consists of the territorial...

  11. 40 CFR 81.78 - Metropolitan Portland Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.78 Section 81.78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.78 Metropolitan Portland Intrastate Air Quality Control Region. The Metropolitan Portland Intrastate Air Quality Control Region (Maine) consists of the territorial area...

  12. 40 CFR 81.45 - Metropolitan Atlanta Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.45 Section 81.45 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.45 Metropolitan Atlanta Intrastate Air Quality Control Region. The Metropolitan Atlanta Intrastate Air Quality Control Region (Georgia) has been revised to consist of the...

  13. 40 CFR 81.30 - Southeastern Wisconsin Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.30 Section 81.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.30 Southeastern Wisconsin Intrastate Air Quality Control Region. The Metropolitan Milwaukee Intrastate Air Quality Control Region (Wisconsin) has been renamed the Southeastern...

  14. 40 CFR 81.123 - Southeastern Oklahoma Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.123 Section 81.123 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.123 Southeastern Oklahoma Intrastate Air Quality Control Region. The Southeastern Oklahoma Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  15. 40 CFR 81.98 - Burlington-Keokuk Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.98 Section 81.98 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.98 Burlington-Keokuk Interstate Air Quality Control Region. The Burlington-Keokuk Interstate Air Quality Control Region (Illinois-Iowa) is revised to consist of the...

  16. 40 CFR 81.16 - Metropolitan Denver Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.16 Section 81.16 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.16 Metropolitan Denver Intrastate Air Quality Control Region. The Metropolitan Denver Intrastate Air Quality Control Region (Colorado) consists of the territorial area...

  17. 40 CFR 81.36 - Maricopa Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.36 Maricopa Intrastate Air Quality Control Region. The Phoenix-Tucson Intrastate Air Quality Control Region has been renamed the Maricopa Intrastate Air Quality Control Region... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Maricopa Intrastate Air Quality...

  18. 40 CFR 81.49 - Southeast Florida Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.49 Section 81.49 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.49 Southeast Florida Intrastate Air Quality Control Region. The Southeast Florida Intrastate Air Quality Control Region is redesignated to consist of the territorial area...

  19. 40 CFR 81.47 - Central Oklahoma Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.47 Section 81.47 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.47 Central Oklahoma Intrastate Air Quality Control Region. The Metropolitan Oklahoma Intrastate Air Quality Control Region has been renamed the Central Oklahoma Intrastate...

  20. 40 CFR 81.59 - Cumberland-Keyser Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.59 Section 81.59 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.59 Cumberland-Keyser Interstate Air Quality Control Region. The Cumberland-Keyser Interstate Air Quality Control Region (Maryland-West Virginia) has been revised to consist...

  1. 40 CFR 81.29 - Metropolitan Indianapolis Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Air Quality Control Region. 81.29 Section 81.29 Protection of Environment ENVIRONMENTAL PROTECTION... Designation of Air Quality Control Regions § 81.29 Metropolitan Indianapolis Intrastate Air Quality Control Region. The Metropolitan Indianapolis Intrastate Air Quality Control Region consists of the territorial...

  2. 40 CFR 81.20 - Metropolitan Cincinnati Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.20 Section 81.20 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.20 Metropolitan Cincinnati Interstate Air Quality Control Region. The Metropolitan Cincinnati Interstate Air Quality Control Region (Ohio-Kentucky-Indiana) is revised to consist of...

  3. 40 CFR 81.97 - Southwest Florida Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.97 Section 81.97 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.97 Southwest Florida Intrastate Air Quality Control Region. The Southwest Florida Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  4. 40 CFR 81.77 - Puerto Rico Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Puerto Rico Air Quality Control Region... PROGRAMS (CONTINUED) DESIGNATION OF AREAS FOR AIR QUALITY PLANNING PURPOSES Designation of Air Quality Control Regions § 81.77 Puerto Rico Air Quality Control Region. The Puerto Rico Air Quality Control Region...

  5. 40 CFR 81.101 - Metropolitan Dubuque Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.101 Section 81.101 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.101 Metropolitan Dubuque Interstate Air Quality Control Region. The Metropolitan Dubuque Interstate Air Quality Control Region (Illinois-Iowa-Wisconsin) consists of the...

  6. 40 CFR 81.79 - Northeastern Oklahoma Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.79 Section 81.79 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.79 Northeastern Oklahoma Intrastate Air Quality Control Region. The Metropolitan Tulsa Intrastate Air Quality Control Region has been renamed the Northeastern Oklahoma Intrastate...

  7. 40 CFR 81.48 - Champlain Valley Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.48 Section 81.48 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.48 Champlain Valley Interstate Air Quality Control Region. The Champlain Valley Interstate Air Quality Control Region (Vermont-New York) has been revised to consist of the...

  8. 40 CFR 81.116 - Northern Missouri Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.116 Section 81.116 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.116 Northern Missouri Intrastate Air Quality Control Region. The Northern Missouri Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  9. 40 CFR 81.24 - Niagara Frontier Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.24 Section 81.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.24 Niagara Frontier Intrastate Air Quality Control Region. The Niagara Frontier Intrastate Air Quality Control Region (New York) consists of the territorial area...

  10. 40 CFR 81.106 - Greenville-Spartanburg Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.106 Section 81.106 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.106 Greenville-Spartanburg Intrastate Air Quality Control Region. The Greenville-Spartanburg Intrastate Air Quality Control Region (South Carolina) consists of the territorial...

  11. 40 CFR 81.44 - Metropolitan Memphis Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.44 Section 81.44 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.44 Metropolitan Memphis Interstate Air Quality Control Region. The Metropolitan Memphis Interstate Air Quality Control Region (Arkansas-Mississippi-Tennessee) consists of the...

  12. 40 CFR 81.67 - Lake Michigan Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.67 Lake Michigan Intrastate Air Quality Control Region. The Menominee-Escanaba (Michigan)-Marinette (Wisconsin) Interstate Air Quality Control Region has been renamed the Lake Michigan Intrastate Air Quality Control Region (Wisconsin) and revised to consist of the territorial area...

  13. 40 CFR 81.51 - Portland Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.51 Portland Interstate Air Quality Control Region. The Portland Interstate Air Quality Control Region (Oregon-Washington) has been revised to consist of the territorial area... Portland Interstate Air Quality Control Region (Oregon-Washington) will be referred to by Washington...

  14. 40 CFR 81.34 - Metropolitan Dayton Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.34 Section 81.34 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.34 Metropolitan Dayton Intrastate Air Quality Control Region. The Metropolitan Dayton Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  15. 40 CFR 81.19 - Metropolitan Boston Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.19 Section 81.19 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.19 Metropolitan Boston Intrastate Air Quality Control Region. The Metropolitan Boston Intrastate Air Quality Control Region (Massachusetts) consists of the territorial area...

  16. 40 CFR 81.28 - Metropolitan Baltimore Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.28 Section 81.28 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.28 Metropolitan Baltimore Intrastate Air Quality Control Region. The Metropolitan Baltimore Intrastate Air Quality Control Region (Maryland) consists of the territorial area...

  17. 40 CFR 81.119 - Western Tennessee Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.119 Section 81.119 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.119 Western Tennessee Intrastate Air Quality Control Region. The Western Tennessee Intrastate Air Quality Control Region consists of the territorial area encompassed by...

  18. 40 CFR 81.115 - Northwest Nevada Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.115 Section 81.115 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.115 Northwest Nevada Intrastate Air Quality Control Region. The Northwest Nevada Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  19. 40 CFR 81.41 - Metropolitan Birmingham Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.41 Section 81.41 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.41 Metropolitan Birmingham Intrastate Air Quality Control Region. The Metropolitan Birmingham Intrastate Air Quality Control Region (Alabama) has been revised to consist of the...

  20. 40 CFR 81.14 - Metropolitan Chicago Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.14 Section 81.14 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.14 Metropolitan Chicago Interstate Air Quality Control Region. The Metropolitan Chicago Interstate Air Quality Control Region (Illinois-Indiana) is revised to consist of the...

  1. 40 CFR 81.118 - Southwest Missouri Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.118 Section 81.118 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.118 Southwest Missouri Intrastate Air Quality Control Region. The Southwest Missouri Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  2. 40 CFR 81.89 - Metropolitan Cheyenne Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.89 Section 81.89 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.89 Metropolitan Cheyenne Intrastate Air Quality Control Region. The Metropolitan Cheyenne Intrastate Air Quality Control Region (Wyoming) consists of the territorial area...

  3. 40 CFR 81.87 - Metropolitan Boise Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.87 Section 81.87 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.87 Metropolitan Boise Intrastate Air Quality Control Region. The Metropolitan Boise Intrastate Air Quality Control Region (Idaho) consists of the territorial area encompassed...

  4. 40 CFR 81.23 - Southwest Pennsylvania Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.23 Section 81.23 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.23 Southwest Pennsylvania Intrastate Air Quality Control Region. The Southwest Pennsylvania Intrastate Air Quality Control Region is redesignated to consist of the territorial...

  5. 40 CFR 81.75 - Metropolitan Charlotte Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.75 Section 81.75 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.75 Metropolitan Charlotte Interstate Air Quality Control Region. The Metropolitan Charlotte Interstate Air Quality Control Region (North Carolina-South Carolina) has been revised...

  6. 40 CFR 81.122 - Mississippi Delta Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.122 Section 81.122 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.122 Mississippi Delta Intrastate Air Quality Control Region. The Mississippi Delta Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  7. 40 CFR 81.120 - Middle Tennessee Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Region. 81.120 Section 81.120 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Air Quality Control Regions § 81.120 Middle Tennessee Intrastate Air Quality Control Region. The Middle Tennessee Intrastate Air Quality Control Region consists of the territorial area encompassed by...

  8. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  9. Complete mitochondrial genome of endangered Yellow-shouldered Amazon (Amazona barbadensis): two control region copies in parrot species of the Amazona genus.

    Science.gov (United States)

    Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara

    2013-08-01

    Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.

  10. Negative Sequence Droop Method based Hierarchical Control for Low Voltage Ride-Through in Grid-Interactive Microgrids

    DEFF Research Database (Denmark)

    Zhao, Xin; Firoozabadi, Mehdi Savaghebi; Quintero, Juan Carlos Vasquez

    2015-01-01

    . In this paper, a voltage support strategy based on negative sequence droop control, which regulate the positive/negative sequence active and reactive power flow by means of sending proper voltage reference to the inner control loop, is proposed for the grid connected MGs to ride through voltage sags under...... complex line impedance conditions. In this case, the MGs should inject a certain amount of positive and negative sequence power to the grid so that the voltage quality at load side can be maintained at a satisfied level. A two layer hierarchical control strategy is proposed in this paper. The primary...... control loop consists of voltage and current inner loops, conventional droop control and virtual impedance loop while the secondary control loop is based on positive/negative sequence droop control which can achieve power injection under voltage sags. Experimental results with asymmetrical voltage sags...

  11. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

    DEFF Research Database (Denmark)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

    2013-01-01

    as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

  12. Well-control co-ops for regional responses

    International Nuclear Information System (INIS)

    Abel, L.W.; Winchester, J.

    1996-01-01

    Oilfield exploration and production companies worldwide can benefit economically and in many other ways by participating in well-control cooperatives rather than operating alone and reacting to well control (WC) events by creating one-off equipment to respond to the event. The authors have presented details of a proposed co-op in this paper. The cost to maintain a full complement of WC equipment and retain trained personnel in a given region is prohibitive for a single company; however, cost becomes reasonable when resources are shared among an operator base of co-operating companies. Each individual operator receives the full benefit of having strong WC event response capability while paying only a portion of the cost

  13. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Noushin Niknafs

    2015-10-01

    Full Text Available Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8 can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can

  14. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Science.gov (United States)

    Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q; Karchin, Rachel

    2015-10-01

    Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single

  15. Genetic distance of Malaysian mousedeer based on mitochondrial DNA cytochrome oxidase I (COI) and D-loop region sequences

    Science.gov (United States)

    Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir

    2018-04-01

    Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.

  16. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  17. Design and control of an alternative distillation sequence for bioethanol purification

    DEFF Research Database (Denmark)

    Errico, Massimiliano; Ramírez-Márquez, César; Torres Ortega, Carlo Edgar

    2015-01-01

    BACKGROUND: Bioethanol is a green fuel considered to be a sustainable alternative to petro-derived gasoline. The transport sector contributes significantly to carbon dioxide emission and consequently has a negative impact on the air quality and is responsible for the increase of the greenhouse...... separation is presented. The steady state performance and the dynamic beavior are analyzed compared with the classical configuration reported in the literature. RESULTS: Ethanol-water azeotropic separation represents a challenge for bioethanol purification. Usually a three column sequence is used to obtain...... fuel grade bioethanol by extractive distillation. In order to reduce bioethanol purification cost a two column separation sequence is proposed. This configuration shows a 10% saving in capital costs together with higher ethanol recovery and better control properties compared with the classical three...

  18. Optimal pseudorandom sequence selection for online c-VEP based BCI control applications

    DEFF Research Database (Denmark)

    Isaksen, Jonas L.; Mohebbi, Ali; Puthusserypady, Sadasivan

    2017-01-01

    to predict the chance of completion and accuracy score. Results: No specific pseudorandom sequence showed superior accuracy on the group basis. When isolating the individual performances with the highest accuracy, time consumption per identification was not significantly increased. The Accuracy Score aids...... is a laborious process. Aims: This study aimed to suggest an efficient method for choosing the optimal stimulus sequence based on a fast test and simple measures to increase the performance and minimize the time consumption for research trials. Methods: A total of 21 healthy subjects were included in an online...... wheelchair control task and completed the same task using stimuli based on the m-code, the gold-code, and the Barker-code. Correct/incorrect identification and time consumption were obtained for each identification. Subject-specific templates were characterized and used in a forward-step first-order model...

  19. Colloidal polymers with controlled sequence and branching constructed from magnetic field assembled nanoparticles.

    Science.gov (United States)

    Bannwarth, Markus B; Utech, Stefanie; Ebert, Sandro; Weitz, David A; Crespy, Daniel; Landfester, Katharina

    2015-03-24

    The assembly of nanoparticles into polymer-like architectures is challenging and usually requires highly defined colloidal building blocks. Here, we show that the broad size-distribution of a simple dispersion of magnetic nanocolloids can be exploited to obtain various polymer-like architectures. The particles are assembled under an external magnetic field and permanently linked by thermal sintering. The remarkable variety of polymer-analogue architectures that arises from this simple process ranges from statistical and block copolymer-like sequencing to branched chains and networks. This library of architectures can be realized by controlling the sequencing of the particles and the junction points via a size-dependent self-assembly of the single building blocks.

  20. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    Directory of Open Access Journals (Sweden)

    Blackmon Barbara P

    2011-07-01

    Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.

  1. Mapping and validation of the major sex-determining region in Nile tilapia (Oreochromis niloticus L. Using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Christos Palaiokostas

    Full Text Available Sex in Oreochromis niloticus (Nile tilapia is principally determined by an XX/XY locus but other genetic and environmental factors also influence sex ratio. Restriction Associated DNA (RAD sequencing was used in two families derived from crossing XY males with females from an isogenic clonal line, in order to identify Single Nucleotide Polymorphisms (SNPs and map the sex-determining region(s. We constructed a linkage map with 3,802 SNPs, which corresponded to 3,280 informative markers, and identified a major sex-determining region on linkage group 1, explaining nearly 96% of the phenotypic variance. This sex-determining region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus draft genome. In order to validate this, a diverse family (4 families; 96 individuals in total and population (40 broodstock individuals test panel were genotyped for five of the SNPs showing the highest association with phenotypic sex. From the expanded data set, SNPs Oni23063 and Oni28137 showed the highest association, which persisted both in the case of family and population data. Across the entire dataset all females were found to be homozygous for these two SNPs. Males were heterozygous, with the exception of five individuals in the population and two in the family dataset. These fish possessed the homozygous genotype expected of females. Progeny sex ratios (over 95% females from two of the males with the "female" genotype indicated that they were neomales (XX males. Sex reversal induced by elevated temperature during sexual differentiation also resulted in phenotypic males with the "female" genotype. This study narrows down the region containing the main sex-determining locus, and provides genetic markers tightly linked to this locus, with an association that persisted across the population. These markers will be of use in refining the production of genetically male O. niloticus for aquaculture.

  2. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    Directory of Open Access Journals (Sweden)

    Shultz Jeffry

    2008-07-01

    Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

  3. Development and detection efficiency of sequence characterized amplified region markers for authentication of medicinal plant Ruta graveolens and its adulterant Euphorbia dracunculoides

    Directory of Open Access Journals (Sweden)

    Irum Gul

    2016-01-01

    Full Text Available Background: With the increase in demand of herbal medicines, adulteration in these drugs is also gaining momentum and remains an indispensable problem in domestic and export markets. Correct identification is the first step toward assuring quality, safety, and efficacy of indigenous herbal medicines. Materials and Methods: In this study, sequence characterized amplified region (SCAR markers were developed to discriminate Ruta graveolens from its adulterant Euphorbia dracunculoides. Random amplified polymorphic DNA (RAPD was performed and subsequently converted into SCAR markers. Results: After performing RAPD, SCAR primers were designed from the selected unique RAPD amplicons of the genuine drug as well as its adulterant. These primers produced 670 bp and 750 bp SCAR markers with genomic DNA sample of R. graveolens and E. dracunculoides, respectively. Conclusion: Development of these markers will help in the quality control of herbal drugs and monitoring widespread adulteration of these drugs by pharmaceutical industries and government agencies.

  4. Phylogeographic study of brown trout from Serbia, based on mitochondrial DNA control region analysis

    Directory of Open Access Journals (Sweden)

    Snoj Aleš

    2006-06-01

    Full Text Available Abstract In order to illuminate the phylogeography of brown trout (Salmo trutta populations in the Balkan state of Serbia, the 561 bp 5'-end of mtDNA control region of 101 individuals originating from upland tributaries of the Danubian, Aegean and Adriatic drainages were sequenced and compared to corresponding brown trout sequences obtained in previous studies. Among 15 haplotypes found, 14 were considered native, representing the Danubian and Adriatic lineages of the brown trout, while one haplotype (ATcs1, found only in two individuals originating from two stocked rivers, corresponded to the Atlantic lineage and was considered introduced. Native haplotypes exhibited a strong geographic pattern of distribution: the Danubian haplotypes were strictly confined to the Danubian drainage, while the Adriatic haplotypes dominated in the Aegean and Adriatic drainages; most of the total molecular variance (69% was attributed to differences among the drainages. Phylogenetic reconstruction, supplemented with seven haplotypes newly described in this study, suggested a sister position of the Atlantic-Danubian and Adriatic-Mediterranean-marmoratus ("southern" phylogenetic group, and pointed to the existence of a distinct clade, detected within the "southern" group. The data obtained confirmed our expectation of the existence of high genetic diversity in Balkan trout populations, and we recommend more widespread surveys covering trout stocks from the region.

  5. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  6. The High Degree of Sequence Plasticity of the Arenavirus Noncoding Intergenic Region (IGR) Enables the Use of a Nonviral Universal Synthetic IGR To Attenuate Arenaviruses.

    Science.gov (United States)

    Iwasaki, Masaharu; Cubitt, Beatrice; Sullivan, Brian M; de la Torre, Juan C

    2016-01-06

    Hemorrhagic fever arenaviruses (HFAs) pose important public health problems in regions where they are endemic. Concerns about human-pathogenic arenaviruses are exacerbated because of the lack of FDA-licensed arenavirus vaccines and because current antiarenaviral therapy is limited to an off-label use of ribavirin that is only partially effective. We have recently shown that the noncoding intergenic region (IGR) present in each arenavirus genome segment, the S and L segments (S-IGR and L-IGR, respectively), plays important roles in the control of virus protein expression and that this knowledge could be harnessed for the development of live-attenuated vaccine strains to combat HFAs. In this study, we further investigated the sequence plasticity of the arenavirus IGR. We demonstrate that recombinants of the prototypic arenavirus lymphocytic choriomeningitis virus (rLCMVs), whose S-IGRs were replaced by the S-IGR of Lassa virus (LASV) or an entirely nonviral S-IGR-like sequence (Ssyn), are viable, indicating that the function of S-IGR tolerates a high degree of sequence plasticity. In addition, rLCMVs whose L-IGRs were replaced by Ssyn or S-IGRs of the very distantly related reptarenavirus Golden Gate virus (GGV) were viable and severely attenuated in vivo but able to elicit protective immunity against a lethal challenge with wild-type LCMV. Our findings indicate that replacement of L-IGR by a nonviral Ssyn could serve as a universal molecular determinant of arenavirus attenuation. Hemorrhagic fever arenaviruses (HFAs) cause high rates of morbidity and mortality and pose important public health problems in regions where they are endemic. Implementation of live-attenuated vaccines (LAVs) will represent a major step to combat HFAs. Here we document that the arenavirus noncoding intergenic region (IGR) has a high degree of plasticity compatible with virus viability. This observation led us to generate recombinant LCMVs containing nonviral synthetic IGRs. These r

  7. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  8. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  9. Targeted Sequencing of Lung Function Loci in Chronic Obstructive Pulmonary Disease Cases and Controls.

    Directory of Open Access Journals (Sweden)

    María Soler Artigas

    Full Text Available Chronic obstructive pulmonary disease (COPD is the third leading cause of death worldwide; smoking is the main risk factor for COPD, but genetic factors are also relevant contributors. Genome-wide association studies (GWAS of the lung function measures used in the diagnosis of COPD have identified a number of loci, however association signals are often broad and collectively these loci only explain a small proportion of the heritability. In order to examine the association with COPD risk of genetic variants down to low allele frequencies, to aid fine-mapping of association signals and to explain more of the missing heritability, we undertook a targeted sequencing study in 300 COPD cases and 300 smoking controls for 26 loci previously reported to be associated with lung function. We used a pooled sequencing approach, with 12 pools of 25 individuals each, enabling high depth (30x coverage per sample to be achieved. This pooled design maximised sample size and therefore power, but led to challenges during variant-calling since sequencing error rates and minor allele frequencies for rare variants can be very similar. For this reason we employed a rigorous quality control pipeline for variant detection which included the use of 3 independent calling algorithms. In order to avoid false positive associations we also developed tests to detect variants with potential batch effects and removed them before undertaking association testing. We tested for the effects of single variants and the combined effect of rare variants within a locus. We followed up the top signals with data available (only 67% of collapsing methods signals in 4,249 COPD cases and 11,916 smoking controls from UK Biobank. We provide suggestive evidence for the combined effect of rare variants on COPD risk in TNXB and in sliding windows within MECOM and upstream of HHIP. These findings can lead to an improved understanding of the molecular pathways involved in the development of COPD.

  10. Quality control of next-generation sequencing library through an integrative digital microfluidic platform.

    Science.gov (United States)

    Thaitrong, Numrin; Kim, Hanyoup; Renzi, Ronald F; Bartsch, Michael S; Meagher, Robert J; Patel, Kamlesh D

    2012-12-01

    We have developed an automated quality control (QC) platform for next-generation sequencing (NGS) library characterization by integrating a droplet-based digital microfluidic (DMF) system with a capillary-based reagent delivery unit and a quantitative CE module. Using an in-plane capillary-DMF interface, a prepared sample droplet was actuated into position between the ground electrode and the inlet of the separation capillary to complete the circuit for an electrokinetic injection. Using a DNA ladder as an internal standard, the CE module with a compact LIF detector was capable of detecting dsDNA in the range of 5-100 pg/μL, suitable for the amount of DNA required by the Illumina Genome Analyzer sequencing platform. This DMF-CE platform consumes tenfold less sample volume than the current Agilent BioAnalyzer QC technique, preserving precious sample while providing necessary sensitivity and accuracy for optimal sequencing performance. The ability of this microfluidic system to validate NGS library preparation was demonstrated by examining the effects of limited-cycle PCR amplification on the size distribution and the yield of Illumina-compatible libraries, demonstrating that as few as ten cycles of PCR bias the size distribution of the library toward undesirable larger fragments. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Region-wide and ecotype-specific differences in demographic histories of threespine stickleback populations, estimated from whole genome sequences.

    Science.gov (United States)

    Liu, Shenglin; Hansen, Michael M; Jacobsen, Magnus W

    2016-10-01

    We analysed 81 whole genome sequences of threespine sticklebacks from Pacific North America, Greenland and Northern Europe, representing 16 populations. Principal component analysis of nuclear SNPs grouped populations according to geographical location, with Pacific populations being more divergent from each other relative to European and Greenlandic populations. Analysis of mitogenome sequences showed Northern European populations to represent a single phylogeographical lineage, whereas Greenlandic and particularly Pacific populations showed admixture between lineages. We estimated demographic history using a genomewide coalescence with recombination approach. The Pacific populations showed gradual population expansion starting >100 Kya, possibly reflecting persistence in cryptic refuges near the present distributional range, although we do not rule out possible influence of ancient admixture. Sharp population declines ca. 14-15 Kya were suggested to reflect founding of freshwater populations by marine ancestors. In Greenland and Northern Europe, demographic expansion started ca. 20-25 Kya coinciding with the end of the Last Glacial Maximum. In both regions, marine and freshwater populations started to show different demographic trajectories ca. 8-9 Kya, suggesting that this was the time of recolonization. In Northern Europe, this estimate was surprisingly late, but found support in subfossil evidence for presence of several freshwater fish species but not sticklebacks 12 Kya. The results demonstrate distinctly different demographic histories across geographical regions with potential consequences for adaptive processes. They also provide empirical support for previous assumptions about freshwater populations being founded independently from large, coherent marine populations, a key element in the Transporter Hypothesis invoked to explain the widespread occurrence of parallel evolution across freshwater stickleback populations. © 2016 John Wiley & Sons Ltd.

  12. Configuring the Orion Guidance, Navigation, and Control Flight Software for Automated Sequencing

    Science.gov (United States)

    Odegard, Ryan G.; Siliwinski, Tomasz K.; King, Ellis T.; Hart, Jeremy J.

    2010-01-01

    The Orion Crew Exploration Vehicle is being designed with greater automation capabilities than any other crewed spacecraft in NASA s history. The Guidance, Navigation, and Control (GN&C) flight software architecture is designed to provide a flexible and evolvable framework that accommodates increasing levels of automation over time. Within the GN&C flight software, a data-driven approach is used to configure software. This approach allows data reconfiguration and updates to automated sequences without requiring recompilation of the software. Because of the great dependency of the automation and the flight software on the configuration data, the data management is a vital component of the processes for software certification, mission design, and flight operations. To enable the automated sequencing and data configuration of the GN&C subsystem on Orion, a desktop database configuration tool has been developed. The database tool allows the specification of the GN&C activity sequences, the automated transitions in the software, and the corresponding parameter reconfigurations. These aspects of the GN&C automation on Orion are all coordinated via data management, and the database tool provides the ability to test the automation capabilities during the development of the GN&C software. In addition to providing the infrastructure to manage the GN&C automation, the database tool has been designed with capabilities to import and export artifacts for simulation analysis and documentation purposes. Furthermore, the database configuration tool, currently used to manage simulation data, is envisioned to evolve into a mission planning tool for generating and testing GN&C software sequences and configurations. A key enabler of the GN&C automation design, the database tool allows both the creation and maintenance of the data artifacts, as well as serving the critical role of helping to manage, visualize, and understand the data-driven parameters both during software development

  13. Processes Controlling Water Vapor in the Winter Arctic Tropopause Region

    Science.gov (United States)

    Pfister, Leonhard; Selkirk, Henry B.; Jensen, Eric J.; Padolske, James; Sachse, Glen; Avery, Melody; Schoeberl, Mark R.; Mahoney, Michael J.; Richard, Erik

    2002-01-01

    This work describes transport and thermodynamic processes that control water vapor near the tropopause during the SAGE III-Ozone Loss and Validation Experiment (SOLVE), held during the Arctic 1999/2000 winter season. Aircraft-based water vapor, carbon monoxide, and ozone measurements were analyzed so as to establish how deeply tropospheric air mixes into the Arctic lowermost stratosphere and what the implications are for cloud formation and water vapor removal in this region of the atmosphere. There are three major findings. First, troposphere-to-stratosphere exchange extends into the Arctic stratosphere to about 13 km. Penetration is to similar levels throughout the winter, however, because ozone increases with altitude most rapidly in the early spring, tropospheric air mixes with the highest values of ozone in that season. The effect of this upward mixing is to elevate water vapor mixing ratios significantly above their prevailing stratospheric values of above 5ppmv. Second, the potential for cloud formation in the stratosphere is highest during early spring, with about 20% of the parcels which have ozone values of 300-350 ppbv experiencing ice saturation in a given 10 day period. Third, during early spring, temperatures at the troposphere are cold enough so that 5-10% of parcels experience relative humidities above 100%, even if the water content is as low as 5 ppmv. The implication is that during this period, dynamical processes near the Arctic tropopause can dehydrate air and keep the Arctic tropopause region very dry during early spring.

  14. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

    Science.gov (United States)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

    2013-11-01

    In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

  15. Factors controlling the regional distribution of vanadium in ground water

    Science.gov (United States)

    Wright, Michael T.; Belitz, Kenneth

    2010-01-01

    Although the ingestion of vanadium (V) in drinking water may have possible adverse health effects, there have been relatively few studies of V in groundwater. Given the importance of groundwater as a source of drinking water in many areas of the world, this study examines the potential sources and geochemical processes that control the distribution of V in groundwater on a regional scale. Potential sources of V to groundwater include dissolution of V rich rocks, and waste streams from industrial processes. Geochemical processes such as adsorption/desorption, precipitation/dissolution, and chemical transformations control V concentrations in groundwater. Based on thermodynamic data and laboratory studies, V concentrations are expected to be highest in samples collected from oxic and alkaline groundwater. However, the extent to which thermodynamic data and laboratory results apply to the actual distribution of V in groundwater is not well understood. More than 8400 groundwater samples collected in California were used in this study. Of these samples, high (> or = 50 μg/L) and moderate (25 to 49 μg/L) V concentrations were most frequently detected in regions where both source rock and favorable geochemical conditions occurred. The distribution of V concentrations in groundwater samples suggests that significant sources of V are mafic and andesitic rock. Anthropogenic activities do not appear to be a significant contributor of V to groundwater in this study. High V concentrations in groundwater samples analyzed in this study were almost always associated with oxic and alkaline groundwater conditions, which is consistent with predictions based on thermodynamic data.

  16. Hypertension Control and Cardiometabolic Risk: A Regional Perspective

    Directory of Open Access Journals (Sweden)

    Martin Thoenes

    2012-01-01

    Full Text Available Background. We investigated the association between blood pressure control and common cardiometabolic risk factors from a global and regional perspective. Methods. In the present analysis of a large cross-sectional i-SEARCH study, 17.092 outpatients receiving antihypertensive treatment were included in 26 countries. According to clinical guidelines for the management of arterial hypertension, patients were classified based on the level of seated systolic/diastolic blood pressure (SBP/DBP. Uncontrolled hypertension was defined as SBP/DBP ≥140/90 mmHg for non-diabetics, and ≥130/80 mmHg for diabetics. Results. Overall, mean age was 63.1 years, 52.8% were male, and mean BMI was 28.9 kg/m2. Mean SBP/DBP was 148.9/87.0 mmHg, and 76.3% of patients had uncontrolled hypertension. Diabetes was present in 29.1% with mean HbA1c of 6.8%. Mean LDL-cholesterol was 3.2 mmol/L, HDL-cholesterol 1.3 mmol/L, and triglycerides 1.8 mmol/L; 49.0% had hyperlipidemia. Patients with uncontrolled hypertension had a higher BMI (29.4 versus 28.6 kg/m2, LDL-cholesterol (3.4 versus 3.0 mmol/L, triglycerides (1.9 versus 1.7 mmol/L, and HbA1c (6.8 versus 6.7% than those with controlled blood pressure (P<0.0001 for all parameters. Conclusions. Among outpatients treated for arterial hypertension, three quarters had uncontrolled blood pressure. Elevated SBP/DBP and uncontrolled hypertension were associated with increasing BMI, LDL-cholesterol, triglycerides, and HbA1c, both globally and regionally.

  17. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  18. Adaptive Optics Facility: control strategy and first on-sky results of the acquisition sequence

    Science.gov (United States)

    Madec, P.-Y.; Kolb, J.; Oberti, S.; Paufique, J.; La Penna, P.; Hackenberg, W.; Kuntschner, H.; Argomedo, J.; Kiekebusch, M.; Donaldson, R.; Suarez, M.; Arsenault, R.

    2016-07-01

    The Adaptive Optics Facility is an ESO project aiming at converting Yepun, one of the four 8m telescopes in Paranal, into an adaptive telescope. This is done by replacing the current conventional secondary mirror of Yepun by a Deformable Secondary Mirror (DSM) and attaching four Laser Guide Star (LGS) Units to its centerpiece. In the meantime, two Adaptive Optics (AO) modules have been developed incorporating each four LGS WaveFront Sensors (WFS) and one tip-tilt sensor used to control the DSM at 1 kHz frame rate. The four LGS Units and one AO module (GRAAL) have already been assembled on Yepun. Besides the technological challenge itself, one critical area of AOF is the AO control strategy and its link with the telescope control, including Active Optics used to shape M1. Another challenge is the request to minimize the overhead due to AOF during the acquisition phase of the observation. This paper presents the control strategy of the AOF. The current control of the telescope is first recalled, and then the way the AO control makes the link with the Active Optics is detailed. Lab results are used to illustrate the expected performance. Finally, the overall AOF acquisition sequence is presented as well as first results obtained on sky with GRAAL.

  19. Psychometric evaluation of a motor control test battery of the craniofacial region.

    Science.gov (United States)

    von Piekartz, H; Stotz, E; Both, A; Bahn, G; Armijo-Olivo, S; Ballenberger, N

    2017-12-01

    The primary objective of this study was to determine the structural and known-group validity as well as the inter-rater reliability of a test battery to evaluate the motor control of the craniofacial region. Seventy volunteers without TMD and 25 subjects with TMD (Axes I) per the DC/TMD were asked to execute a test battery consisting of eight tests. The tests were video-taped in the same sequence in a standardised manner. Two experienced physical therapists participated in this study as blinded assessors. We used exploratory factor analysis to identify the underlying component structure of the eight tests. Internal consistency (Cronbach's α), inter-rater reliability (intra-class correlation coefficient) and construct validity (ie, hypothesis testing-known-group validity) (receiver operating curves) were also explored for the test battery. The structural validity showed the presence of one factor underlying the construct of the test battery. The internal consistency was excellent (0.90) as well as the inter-rater reliability. All values of reliability were close to 0.9 or above indicating very high inter-rater reliability. The area under the curve (AUC) was 0.93 for rater 1 and 0.94 for rater two, respectively, indicating excellent discrimination between subjects with TMD and healthy controls. The results of the present study support the psychometric properties of test battery to measure motor control of the craniofacial region when evaluated through videotaping. This test battery could be used to differentiate between healthy subjects and subjects with musculoskeletal impairments in the cervical and oro-facial regions. In addition, this test battery could be used to assess the effectiveness of management strategies in the craniofacial region. © 2017 John Wiley & Sons Ltd.

  20. Introduction of the Python script STRinNGS for analysis of STR regions in FASTQ or BAM files and expansion of the Danish STR sequence database to 11 STRs

    DEFF Research Database (Denmark)

    Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter

    2016-01-01

    This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...

  1. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

    Science.gov (United States)

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

    2008-05-01

    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  2. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  3. VWF mutations and new sequence variations identified in healthy controls are more frequent in the African-American population.

    Science.gov (United States)

    Bellissimo, Daniel B; Christopherson, Pamela A; Flood, Veronica H; Gill, Joan Cox; Friedman, Kenneth D; Haberichter, Sandra L; Shapiro, Amy D; Abshire, Thomas C; Leissinger, Cindy; Hoots, W Keith; Lusher, Jeanne M; Ragni, Margaret V; Montgomery, Robert R

    2012-03-01

    Diagnosis and classification of VWD is aided by molecular analysis of the VWF gene. Because VWF polymorphisms have not been fully characterized, we performed VWF laboratory testing and gene sequencing of 184 healthy controls with a negative bleeding history. The controls included 66 (35.9%) African Americans (AAs). We identified 21 new sequence variations, 13 (62%) of which occurred exclusively in AAs and 2 (G967D, T2666M) that were found in 10%-15% of the AA samples, suggesting they are polymorphisms. We identified 14 sequence variations reported previously as VWF mutations, the majority of which were type 1 mutations. These controls had VWF Ag levels within the normal range, suggesting that these sequence variations might not always reduce plasma VWF levels. Eleven mutations were found in AAs, and the frequency of M740I, H817Q, and R2185Q was 15%-18%. Ten AA controls had the 2N mutation H817Q; 1 was homozygous. The average factor VIII level in this group was 99 IU/dL, suggesting that this variation may confer little or no clinical symptoms. This study emphasizes the importance of sequencing healthy controls to understand ethnic-specific sequence variations so that asymptomatic sequence variations are not misidentified as mutations in other ethnic or racial groups.

  4. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  5. Sequence requirements of the HIV-1 protease flap region determined by saturation mutagenesis and kinetic analysis of flap mutants

    Science.gov (United States)

    Shao, Wei; Everitt, Lorraine; Manchester, Marianne; Loeb, Daniel D.; Hutchison, Clyde A.; Swanstrom, Ronald

    1997-01-01

    The retroviral proteases (PRs) have a structural feature called the flap, which consists of a short antiparallel β-sheet with a turn. The flap extends over the substrate binding cleft and must be flexible to allow entry and exit of the polypeptide substrates and products. We analyzed the sequence requirements of the amino acids within the flap region (positions 46–56) of the HIV-1 PR. The phenotypes of 131 substitution mutants were determined using a bacterial expression system. Four of the mutant PRs with mutations in different regions of the flap were selected for kinetic analysis. Our phenotypic analysis, considered in the context of published structures of the HIV-1 PR with a bound substrate analogs, shows that: (i) Met-46 and Phe-53 participate in hydrophobic interactions on the solvent-exposed face of the flap; (ii) Ile-47, Ile-54, and Val-56 participate in hydrophobic interactions on the inner face of the flap; (iii) Ile-50 has hydrophobic interactions at the distance of both the δ and γ carbons; (iv) the three glycine residues in the β-turn of the flap are virtually intolerant of substitutions. Among these mutant PRs, we have identified changes in both kcat and Km. These results establish the nature of the side chain requirements at each position in the flap and document a role for the flap in both substrate binding and catalysis. PMID:9122179

  6. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  7. Fed-Batch Control and Visualization of Monomer Sequences of Individual ICAR ATRP Gradient Copolymer Chains

    Directory of Open Access Journals (Sweden)

    Dagmar R. D'hooge

    2014-04-01

    Full Text Available Based on kinetic Monte Carlo simulations of the monomer sequences of a representative number of copolymer chains (≈ 150,000, optimal synthesis procedures for linear gradient copolymers are proposed, using bulk Initiators for Continuous Activator Regeneration Atom Transfer Radical Polymerization (ICAR ATRP. Methyl methacrylate and n-butyl acrylate are considered as comonomers with CuBr2/PMDETA (N,N,N′,N′′,N′′-pentamethyldiethylenetriamine as deactivator at 80 °C. The linear gradient quality is determined in silico using the recently introduced gradient deviation ( polymer property. Careful selection or fed-batch addition of the conventional radical initiator I2 allows a reduction of the polymerization time with ca. a factor 2 compared to the corresponding batch case, while preserving control over polymer properties ( ≈ 0.30; dispersity ≈ 1.1. Fed-batch addition of not only I2, but also comonomer and deactivator (50 ppm under starved conditions yields a below 0.25 and, hence, an excellent linear gradient quality for the dormant polymer molecules, albeit at the expense of an increase of the overall polymerization time. The excellent control is confirmed by the visualization of the monomer sequences of ca. 1000 copolymer chains.

  8. Cycle-time determination and process control of sequencing batch membrane bioreactors.

    Science.gov (United States)

    Krampe, J

    2013-01-01

    In this paper a method to determine the cycle time for sequencing batch membrane bioreactors (SBMBRs) is introduced. One of the advantages of SBMBRs is the simplicity of adapting them to varying wastewater composition. The benefit of this flexibility can only be fully utilised if the cycle times are optimised for the specific inlet load conditions. This requires either proactive and ongoing operator adjustment or active predictive instrument-based control. Determination of the cycle times for conventional sequencing batch reactor (SBR) plants is usually based on experience. Due to the higher mixed liquor suspended solids concentrations in SBMBRs and the limited experience with their application, a new approach to calculate the cycle time had to be developed. Based on results from a semi-technical pilot plant, the paper presents an approach for calculating the cycle time in relation to the influent concentration according to the Activated Sludge Model No. 1 and the German HSG (Hochschulgruppe) Approach. The approach presented in this paper considers the increased solid contents in the reactor and the resultant shortened reaction times. This allows for an exact calculation of the nitrification and denitrification cycles with a tolerance of only a few minutes. Ultimately the same approach can be used for a predictive control strategy and for conventional SBR plants.

  9. Automatic start-up system of nuclear reactor based on sequence control technology

    International Nuclear Information System (INIS)

    Zhang Yao; Zhang Dafa; Peng Huaqing

    2009-01-01

    A conceptive design of an automatic start-up system based on the sequence control for the nuclear reactors is given in this paper, so as to solve the problems during the start-up process, such as the long operation time, low automatic control level and high accident rate. The start-up process and its requirements are analyzed in detail at first. Then,the principle, the architecture, the key technologies of the automatic start-up system of nuclear reactors are designed and discussed. With the designed system, the automatic start-up of the nuclear reactor can be realized,the work load of the operator can be reduced,and the safety and efficiency of the nuclear power plant during its start-up can be improved. (authors)

  10. Development of dominant sequence characterized amplified region (SCAR marker linked with plume moth (Exelastis atomosa Walsingham 1886 resistance in pigeon-pea

    Directory of Open Access Journals (Sweden)

    Ramya R Mishra

    2015-12-01

    Full Text Available The mode of gene action governing resistance to plume moth (Exelastis atomosa Walsingham 1886 derived from pigeon-pea (Cajanus scarabaeoides (L. Thouars accession ICPW-94 has been determined and the resistance alleles have been designated as PPM1. The progenies of F2 population and F3 families derived from an interspecific cross C. cajan (L. Huth ('ICP-26' x C. scarabaeoides (accession ICPW-94 revealed monogenic gene action for resistance to plume moth, and the dominant control by single locus or cluster of tightly linked alleles. Bulked segregant analysis (BSA of 116 F2 progenies by using 143 parental polymorphic RAPD primers could identify a fragment OPA09(910 associated with plume moth resistance in coupling phase of linkage. Further single plant analysis of the 116 F2 mapping population revealed OPA09(910 was linked to PPMi locus conferring host resistance to plume moth with recombination fraction (rf value of 0.125 (12.7 cM of Kosambi function. The resistance specific fragment OPA09(910 was cloned, sequenced and converted into a sequence characterized amplified region (SCAR marker, SCOPA09(942, which was also closely associated (10.3 cM with the locus PPMl with rf value 0.102. BLAST analysis with pigeon-pea genome sequence also confirmed its occurrence in CcLG02 (Scafseq.LG_V5.0fa and contig 01597 (AFSP01.fsa1. This SCAR marker showed reasonable screening efficiency in the F2, F3, and BC1F1 lines, thus it can be used as genetic handle in marker-assisted introgression of the genomic fragment conferring plume moth resistance and screening of breeding lines in pigeon-pea.

  11. Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

    1996-12-01

    Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

  12. Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers

    OpenAIRE

    Davis, Ronald L.; Davidson, Norman

    1984-01-01

    Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...

  13. Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

    International Nuclear Information System (INIS)

    Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

    1991-01-01

    The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

  14. [Population genetic differentiation of Phrynocephalus axillaris in east of Xinjiang Uygur Autonomous Region based on sequence variation of mitochondrial ND4-tRNALeu gene].

    Science.gov (United States)

    Li, Jun; Guo, Xian-Guang; Wang, Yue-Zhao

    2010-08-01

    A 838 bp fragment of mtDNA ND4-tRNALeu gene was sequenced for 66 individuals from five populations (DB: Dabancheng, TU: Turpan, SS: Shanshan, HL: Liushuquan, HD: East district of Hami) of Phrynocephalus axillaris distributed in east of Xinjiang Uygur Autonomous Region. Seventeen haplotypes were identified from 29 nucleotide polymorphic sites in the aligned 838 bp sequence. Excluding DB, there were relatively high haplotype diversity [(0.600+/-0.113)oscillation since Pleistocene and genetic drift.

  15. Comparison of Control of Clostridium difficile Infection in Six English Hospitals Using Whole-Genome Sequencing.

    Science.gov (United States)

    Eyre, David W; Fawley, Warren N; Rajgopal, Anu; Settle, Christopher; Mortimer, Kalani; Goldenberg, Simon D; Dawson, Susan; Crook, Derrick W; Peto, Tim E A; Walker, A Sarah; Wilcox, Mark H

    2017-08-01

    Variation in Clostridium difficile infection (CDI) rates between healthcare institutions suggests overall incidence could be reduced if the lowest rates could be achieved more widely. We used whole-genome sequencing (WGS) of consecutive C. difficile isolates from 6 English hospitals over 1 year (2013-14) to compare infection control performance. Fecal samples with a positive initial screen for C. difficile were sequenced. Within each hospital, we estimated the proportion of cases plausibly acquired from previous cases. Overall, 851/971 (87.6%) sequenced samples contained toxin genes, and 451 (46.4%) were fecal-toxin-positive. Of 652 potentially toxigenic isolates >90-days after the study started, 128 (20%, 95% confidence interval [CI] 17-23%) were genetically linked (within ≤2 single nucleotide polymorphisms) to a prior patient's isolate from the previous 90 days. Hospital 2 had the fewest linked isolates, 7/105 (7%, 3-13%), hospital 1, 9/70 (13%, 6-23%), and hospitals 3-6 had similar proportions of linked isolates (22-26%) (P ≤ .002 comparing hospital-2 vs 3-6). Results were similar adjusting for locally circulating ribotypes. Adjusting for hospital, ribotype-027 had the highest proportion of linked isolates (57%, 95% CI 29-81%). Fecal-toxin-positive and toxin-negative patients were similarly likely to be a potential transmission donor, OR = 1.01 (0.68-1.49). There was no association between the estimated proportion of linked cases and testing rates. WGS can be used as a novel surveillance tool to identify varying rates of C. difficile transmission between institutions and therefore to allow targeted efforts to reduce CDI incidence. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  16. Designing sequence to control protein function in an EF-hand protein.

    Science.gov (United States)

    Bunick, Christopher G; Nelson, Melanie R; Mangahas, Sheryll; Hunter, Michael J; Sheehan, Jonathan H; Mizoue, Laura S; Bunick, Gerard J; Chazin, Walter J

    2004-05-19

    The extent of conformational change that calcium binding induces in EF-hand proteins is a key biochemical property specifying Ca(2+) sensor versus signal modulator function. To understand how differences in amino acid sequence lead to differences in the response to Ca(2+) binding, comparative analyses of sequence and structures, combined with model building, were used to develop hypotheses about which amino acid residues control Ca(2+)-induced conformational changes. These results were used to generate a first design of calbindomodulin (CBM-1), a calbindin D(9k) re-engineered with 15 mutations to respond to Ca(2+) binding with a conformational change similar to that of calmodulin. The gene for CBM-1 was synthesized, and the protein was expressed and purified. Remarkably, this protein did not exhibit any non-native-like molten globule properties despite the large number of mutations and the nonconservative nature of some of them. Ca(2+)-induced changes in CD intensity and in the binding of the hydrophobic probe, ANS, implied that CBM-1 does undergo Ca(2+) sensorlike conformational changes. The X-ray crystal structure of Ca(2+)-CBM-1 determined at 1.44 A resolution reveals the anticipated increase in hydrophobic surface area relative to the wild-type protein. A nascent calmodulin-like hydrophobic docking surface was also found, though it is occluded by the inter-EF-hand loop. The results from this first calbindomodulin design are discussed in terms of progress toward understanding the relationships between amino acid sequence, protein structure, and protein function for EF-hand CaBPs, as well as the additional mutations for the next CBM design.

  17. Recombination in the 5' leader of murine leukemia virus is accurate and influenced by sequence identity with a strong bias toward the kissing-loop dimerization region

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    1998-01-01

    during minus-strand DNA synthesis occurred within defined areas of the genome and did not lead to misincorporations at the crossover site. The nonrandom distribution of recombination sites did not reflect a bias for specific sites due to selection at the level of marker gene expression. We address...... whether template switching is affected by the length of sequence identity, by palindromic sequences, and/or by putative stem-loop structures. Sixteen of 24 sites of recombination colocalized with the kissing-loop dimerization region, and we propose that RNA-RNA interactions between palindromic sequences...

  18. Applying Ancestry and Sex Computation as a Quality Control Tool in Targeted Next-Generation Sequencing.

    Science.gov (United States)

    Mathias, Patrick C; Turner, Emily H; Scroggins, Sheena M; Salipante, Stephen J; Hoffman, Noah G; Pritchard, Colin C; Shirts, Brian H

    2016-03-01

    To apply techniques for ancestry and sex computation from next-generation sequencing (NGS) data as an approach to confirm sample identity and detect sample processing errors. We combined a principal component analysis method with k-nearest neighbors classification to compute the ancestry of patients undergoing NGS testing. By combining this calculation with X chromosome copy number data, we determined the sex and ancestry of patients for comparison with self-report. We also modeled the sensitivity of this technique in detecting sample processing errors. We applied this technique to 859 patient samples with reliable self-report data. Our k-nearest neighbors ancestry screen had an accuracy of 98.7% for patients reporting a single ancestry. Visual inspection of principal component plots was consistent with self-report in 99.6% of single-ancestry and mixed-ancestry patients. Our model demonstrates that approximately two-thirds of potential sample swaps could be detected in our patient population using this technique. Patient ancestry can be estimated from NGS data incidentally sequenced in targeted panels, enabling an inexpensive quality control method when coupled with patient self-report. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. 40 CFR 81.111 - Georgetown Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.111 Georgetown Intrastate Air Quality Control Region. The Georgetown Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Georgetown Intrastate Air Quality...

  20. 40 CFR 81.42 - Chattanooga Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.42 Chattanooga Interstate Air Quality Control Region. The Chattanooga Interstate Air Quality Control Region (Georgia-Tennessee) has been revised to consist of the territorial area... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Chattanooga Interstate Air Quality...

  1. 40 CFR 81.107 - Greenwood Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.107 Greenwood Intrastate Air Quality Control Region. The Greenwood Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Greenwood Intrastate Air Quality...

  2. 40 CFR 81.110 - Camden-Sumter Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.110 Camden-Sumter Intrastate Air Quality Control Region. The Camden-Sumter Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Camden-Sumter Intrastate Air Quality...

  3. 40 CFR 81.80 - Las Vegas Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.80 Las Vegas Intrastate Air Quality Control Region. The Las Vegas Intrastate Air Quality Control Region (Nevada) has been revised to consist of the territorial area encompassed by... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Las Vegas Intrastate Air Quality...

  4. 40 CFR 81.108 - Columbia Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.108 Columbia Intrastate Air Quality Control Region. The Columbia Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Columbia Intrastate Air Quality...

  5. 40 CFR 81.17 - Metropolitan Los Angeles Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.17 Metropolitan Los Angeles Air Quality Control Region. The Metropolitan Los Angeles Air Quality Control Region consists of the following territorial area (including the territorial... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Metropolitan Los Angeles Air Quality...

  6. 40 CFR 81.109 - Florence Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.109 Florence Intrastate Air Quality Control Region. The Florence Intrastate Air Quality Control Region (South Carolina) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Florence Intrastate Air Quality...

  7. 40 CFR 81.52 - Wasatch Front Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.52 Wasatch Front Intrastate Air Quality Control Region. The Wasatch Front Intrastate Air Quality Control Region (Utah) consists of the territorial area encompassed by the boundaries... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Wasatch Front Intrastate Air Quality...

  8. 40 CFR 81.54 - Cook Inlet Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.54 Cook Inlet Intrastate Air Quality Control Region. The Cook Inlet Intrastate Air Quality Control Region (Alaska) consists of the territorial area encompassed by the boundaries... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Cook Inlet Intrastate Air Quality...

  9. 40 CFR 81.95 - Central Florida Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.95 Central Florida Intrastate Air Quality Control Region. The Central Florida Intrastate Air Quality Control Region consists of the territorial area encompassed by the boundaries of the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Central Florida Intrastate Air Quality...

  10. 40 CFR 81.35 - Louisville Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.35 Louisville Interstate Air Quality Control Region. The Louisville Interstate Air Quality Control Region (Kentucky-Indiana) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Louisville Interstate Air Quality...

  11. 40 CFR 81.32 - Puget Sound Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Quality Control Regions § 81.32 Puget Sound Intrastate Air Quality Control Region. The Puget Sound Intrastate Air Quality Control Region (Washington) consists of the territorial area encompassed by the... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Puget Sound Intrastate Air Quality...

  12. 40 CFR 81.134 - Austin-Waco Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Austin-Waco Intrastate Air Quality Control Region. 81.134 Section 81.134 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.134 Austin-Waco Intrastate Air Quality Control Region. The Austin-Waco...

  13. 40 CFR 81.38 - Metropolitan Houston-Galveston Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Metropolitan Houston-Galveston... Designation of Air Quality Control Regions § 81.38 Metropolitan Houston-Galveston Intrastate Air Quality Control Region. The Metropolitan Houston-Galveston Intrastate Air Quality Control Region (Texas) has been...

  14. 40 CFR 81.63 - Metropolitan Fort Smith Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Metropolitan Fort Smith Interstate Air... Air Quality Control Regions § 81.63 Metropolitan Fort Smith Interstate Air Quality Control Region. The Metropolitan Fort Smith Interstate Air Quality Control Region (Arkansas-Oklahoma) has been revised to consist...

  15. 40 CFR 81.256 - Northeast Iowa Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Iowa Intrastate Air Quality Control Region. 81.256 Section 81.256 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.256 Northeast Iowa Intrastate Air Quality Control Region. The Northeast Iowa...

  16. 40 CFR 81.62 - Northeast Mississippi Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Mississippi Intrastate Air... Air Quality Control Regions § 81.62 Northeast Mississippi Intrastate Air Quality Control Region. The Alabama-Mississippi-Tennessee Interstate Air Quality Control Region has been renamed the Northeast...

  17. 40 CFR 81.216 - Northeast Indiana Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Indiana Intrastate Air... Air Quality Control Regions § 81.216 Northeast Indiana Intrastate Air Quality Control Region. The Northeast Indiana Intrastate Air Quality Control Region (Indiana) consists of the territorial area...

  18. 40 CFR 81.237 - Northeast Georgia Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Georgia Intrastate Air... Air Quality Control Regions § 81.237 Northeast Georgia Intrastate Air Quality Control Region. The Northeast Georgia Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  19. 40 CFR 81.139 - Northeast Arkansas Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Arkansas Intrastate Air... Air Quality Control Regions § 81.139 Northeast Arkansas Intrastate Air Quality Control Region. The Northeast Arkansas Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  20. 40 CFR 81.251 - Northeast Kansas Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Kansas Intrastate Air... Air Quality Control Regions § 81.251 Northeast Kansas Intrastate Air Quality Control Region. The Northeast Kansas Intrastate Air Quality Control Region consists of the territorial area encompassed by the...

  1. 40 CFR 81.162 - Northeast Plateau Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Plateau Intrastate Air... Air Quality Control Regions § 81.162 Northeast Plateau Intrastate Air Quality Control Region. The Northeast Plateau Intrastate Air Quality Control Region (California) consists of the territorial area...

  2. 40 CFR 81.121 - Four Corners Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Four Corners Interstate Air Quality Control Region. 81.121 Section 81.121 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.121 Four Corners Interstate Air Quality Control Region. The Four Corners...

  3. 40 CFR 81.176 - San Luis Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false San Luis Intrastate Air Quality Control Region. 81.176 Section 81.176 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.176 San Luis Intrastate Air Quality Control Region. The San Luis Intrastate...

  4. 40 CFR 81.93 - Hampton Roads Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Hampton Roads Intrastate Air Quality Control Region. 81.93 Section 81.93 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Quality Control Regions § 81.93 Hampton Roads Intrastate Air Quality Control Region. The Metropolitan...

  5. Sequence analysis of the 3’-untranslated region of HSP70 (type I genes in the genus Leishmania: its usefulness as a molecular marker for species identification

    Directory of Open Access Journals (Sweden)

    Requena Jose M

    2012-04-01

    Full Text Available Abstract Background The Leishmaniases are a group of clinically diverse diseases caused by parasites of the genus Leishmania. To distinguish between species is crucial for correct diagnosis and prognosis as well as for treatment decisions. Recently, sequencing of the HSP70 coding region has been applied in phylogenetic studies and for identifying of Leishmania species with excellent results. Methods In the present study, we analyzed the 3’-untranslated region (UTR of Leishmania HSP70-type I gene from 24 strains representing eleven Leishmania species in the belief that this non-coding region would have a better discriminatory capacity for species typing than coding regions. Results It was observed that there was a remarkable degree of sequence conservation in this region, even between species of the subgenus Leishmania and Viannia. In addition, the presence of many microsatellites was a common feature of the 3´-UTR of HSP70-I genes in the Leishmania genus. Finally, we constructed dendrograms based on global sequence alignments of the analyzed Leishmania species and strains, the results indicated that this particular region of HSP70 genes might be useful for species (or species complex typing, improving for particular species the discrimination capacity of phylogenetic trees based on HSP70 coding sequences. Given the large size variation of the analyzed region between the Leishmania and Viannia subgenera, direct visualization of the PCR amplification product would allow discrimination between subgenera, and a HaeIII-PCR-RFLP analysis might be used for differentiating some species within each subgenera. Conclusions Sequence and phylogenetic analyses indicated that this region, which is readily amplified using a single pair of primers from both Old and New World Leishmania species, might be useful as a molecular marker for species discrimination.

  6. Optimal supplementary frequency controller design using the wind farm frequency model and controller parameters stability region.

    Science.gov (United States)

    Toulabi, Mohammadreza; Bahrami, Shahab; Ranjbar, Ali Mohammad

    2018-03-01

    In most of the existing studies, the frequency response in the variable speed wind turbines (VSWTs) is simply realized by changing the torque set-point via appropriate inputs such as frequency deviations signal. However, effective dynamics and systematic process design have not been comprehensively discussed yet. Accordingly, this paper proposes a proportional-derivative frequency controller and investigates its performance in a wind farm consisting of several VSWTs. A band-pass filter is deployed before the proposed controller to avoid responding to either steady state frequency deviations or high rate of change of frequency. To design the controller, the frequency model of the wind farm is first characterized. The proposed controller is then designed based on the obtained open loop system. The stability region associated with the controller parameters is analytically determined by decomposing the closed-loop system's characteristic polynomial into the odd and even parts. The performance of the proposed controller is evaluated through extensive simulations in MATLAB/Simulink environment in a power system comprising a high penetration of VSWTs equipped with the proposed controller. Finally, based on the obtained feasible area and appropriate objective function, the optimal values associated with the controller parameters are determined using the genetic algorithm (GA). Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  7. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  8. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  9. Analysis of Canis mitochondrial DNA demonstrates high concordance between the control region and ATPase genes

    Directory of Open Access Journals (Sweden)

    White Bradley N

    2010-07-01

    Full Text Available Abstract Background Phylogenetic studies of wild Canis species have relied heavily on the mitochondrial DNA control region (mtDNA CR to infer species relationships and evolutionary lineages. Previous analyses of the CR provided evidence for a North American evolved eastern wolf (C. lycaon, that is more closely related to red wolves (C. rufus and coyotes (C. latrans than grey wolves (C. lupus. Eastern wolf origins, however, continue to be questioned. Therefore, we analyzed mtDNA from 89 wolves and coyotes across North America and Eurasia at 347 base pairs (bp of the CR and 1067 bp that included the ATPase6 and ATPase8 genes. Phylogenies and divergence estimates were used to clarify the evolutionary history of eastern wolves, and regional comparisons of nonsynonomous to synonomous substitutions (dN/dS at the ATPase6 and ATPase8 genes were used to elucidate the potential role of selection in shaping mtDNA geographic distribution. Results We found high concordance across analyses between the mtDNA regions studied. Both had a high percentage of variable sites (CR = 14.6%; ATP = 9.7% and both phylogenies clustered eastern wolf haplotypes monophyletically within a North American evolved lineage apart from coyotes. Divergence estimates suggest the putative red wolf sequence is more closely related to coyotes (DxyCR = 0.01982 ± 0.00494 SD; DxyATP = 0.00332 ± 0.00097 SD than the eastern wolf sequences (DxyCR = 0.03047 ± 0.00664 SD; DxyATP = 0.00931 ± 0.00205 SD. Neutrality tests on both genes were indicative of the population expansion of coyotes across eastern North America, and dN/dS ratios suggest a possible role for purifying selection in the evolution of North American lineages. dN/dS ratios were higher in European evolved lineages from northern climates compared to North American evolved lineages from temperate regions, but these differences were not statistically significant. Conclusions These results demonstrate high concordance between coding

  10. Late Proterozoic glacially controlled shelf sequences in western Mali (west Africa)

    Science.gov (United States)

    Deynoux, M.; Prousti, J. N.; Simon, B.

    , in tems of sequential stratigraphy, the deposits of the galcial Bakoya Groupe are organized in shallowing upward sequences limited by maximum flooding surfaces of regional extent. One of these sequences (the Ba4 Formation) is subdivided into parasequences generated in relation with local ice sheet fluctuation including glacioisostacy.

  11. ITS all right mama: investigating the formation of chimeric sequences in the ITS2 region by DNA metabarcoding analyses of fungal mock communities of different complexities.

    Science.gov (United States)

    Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard

    2017-07-01

    The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.

  12. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions.

    Science.gov (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J

    2018-03-01

    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  13. Measures for regional security and arms control in the South-East Asian area

    International Nuclear Information System (INIS)

    Uren, R.T.

    1992-01-01

    The subject of regional security and arms control in the South-East Asia raises some new and difficult issues. No approach to ensuring regional security could be complete without military dimension including the following categories: regional arms control; global arms control measure; confidence building measures that are designed to enhance the transparency of defense policies; confidence building measures that encourage cooperation among the military forces in the region

  14. Evaluation of an Extremum Seeking Control Based Optimization and Sequencing Strategy for a Chilled-water Plant

    OpenAIRE

    Zhao, Zhongfan; Li, Yaoyu; Mu, Baojie; Salsbury, Timothy I.; House, John M.

    2016-01-01

    Chilled-water plants with multiple chillers account for a significant fraction of energy use in large commercial buildings. Real-time optimization and sequencing of such plants is thus critical for building energy efficiency. Due to the cost and complexity associated with calibrating a chiller plant model to field operation, model-free control has become an attractive solution. Recently, Mu et al. (2015) proposed a model-free real-time optimization and sequencing strategy based on extremum se...

  15. Controllable quantum private queries using an entangled Fibonacci-sequence spiral source

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Hong, E-mail: honglaimm@163.com [School of Computer and Information Science, Southwest University, Chongqing 400715 (China); Department of Computing, Macquarie University, Sydney, NSW 2109 (Australia); School of Science, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Orgun, Mehmet A. [Department of Computing, Macquarie University, Sydney, NSW 2109 (Australia); Pieprzyk, Josef [School of Electrical Engineering and Computer Science, Queensland University of Technology, Brisbane, QLD 4000 (Australia); Xiao, Jinghua [School of Science, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Xue, Liyin [Corporate Analytics, The Australian Taxation Office, Sydney NSW 2000 (Australia); Jia, Zhongtian, E-mail: ise_jiazt@ujn.edu.cn [Provincial Key Laboratory for Network Based Intelligent Computing, University of Jinan, Jinan 250022 (China)

    2015-10-23

    Highlights: • Alice can easily control the size of a block by adjusting the parameter m rather than a high-dimension oracle. • The case of Alice knowing an exact multi-bit message can be realized deterministically. • Our protocol provides broad measures of protection against errors caused by the effect of noise. • Our protocol can greatly save both quantum and classical communication and exhibit some advantages in security. • Our protocol is scalable and flexible, and secure against quantum memory attacks by Alice. - Abstract: By changing the initial values in entangled Fibonacci-sequence spiral sources in Simon et al.'s (2013) experimental setup [13], we propose a controllable quantum private query protocol. Moreover, our protocol achieves flexible key expansion and even exhibits secure advantages during communications because of the following observations. We observe the close relationships between Lucas numbers and the first kind of Chebyshev maps, and the Chebyshev maps and k-Chebyshev maps; by adjusting the parameter m in k-Chebyshev maps, Alice and Bob can obtain their expected values of the key blocks and database respectively.

  16. Controllable quantum private queries using an entangled Fibonacci-sequence spiral source

    International Nuclear Information System (INIS)

    Lai, Hong; Orgun, Mehmet A.; Pieprzyk, Josef; Xiao, Jinghua; Xue, Liyin; Jia, Zhongtian

    2015-01-01

    Highlights: • Alice can easily control the size of a block by adjusting the parameter m rather than a high-dimension oracle. • The case of Alice knowing an exact multi-bit message can be realized deterministically. • Our protocol provides broad measures of protection against errors caused by the effect of noise. • Our protocol can greatly save both quantum and classical communication and exhibit some advantages in security. • Our protocol is scalable and flexible, and secure against quantum memory attacks by Alice. - Abstract: By changing the initial values in entangled Fibonacci-sequence spiral sources in Simon et al.'s (2013) experimental setup [13], we propose a controllable quantum private query protocol. Moreover, our protocol achieves flexible key expansion and even exhibits secure advantages during communications because of the following observations. We observe the close relationships between Lucas numbers and the first kind of Chebyshev maps, and the Chebyshev maps and k-Chebyshev maps; by adjusting the parameter m in k-Chebyshev maps, Alice and Bob can obtain their expected values of the key blocks and database respectively

  17. Succinylcholine versus rocuronium for rapid sequence intubation in intensive care: a prospective, randomized controlled trial

    Science.gov (United States)

    2011-01-01

    Introduction Succinylcholine and rocuronium are widely used to facilitate rapid sequence induction (RSI) intubation in intensive care. Concerns relate to the side effects of succinylcholine and to slower onset and inferior intubation conditions associated with rocuronium. So far, succinylcholine and rocuronium have not been compared in an adequately powered randomized trial in intensive care. Accordingly, the aim of the present study was to compare the incidence of hypoxemia after rocuronium or succinylcholine in critically ill patients requiring an emergent RSI. Methods This was a prospective randomized controlled single-blind trial conducted from 2006 to 2010 at the University Hospital of Basel. Participants were 401 critically ill patients requiring emergent RSI. Patients were randomized to receive 1 mg/kg succinylcholine or 0.6 mg/kg rocuronium for neuromuscular blockade. The primary outcome was the incidence of oxygen desaturations defined as a decrease in oxygen saturation ≥ 5%, assessed by continuous pulse oxymetry, at any time between the start of the induction sequence and two minutes after the completion of the intubation. A severe oxygen desaturation was defined as a decrease in oxygen saturation ≥ 5% leading to a saturation value of ≤ 80%. Results There was no difference between succinylcholine and rocuronium regarding oxygen desaturations (succinylcholine 73/196; rocuronium 66/195; P = 0.67); severe oxygen desaturations (succinylcholine 20/196; rocuronium 20/195; P = 1.0); and extent of oxygen desaturations (succinylcholine -14 ± 12%; rocuronium -16 ± 13%; P = 0.77). The duration of the intubation sequence was shorter after succinycholine than after rocuronium (81 ± 38 sec versus 95 ± 48 sec; P = 0.002). Intubation conditions (succinylcholine 8.3 ± 0.8; rocuronium 8.2 ± 0.9; P = 0.7) and failed first intubation attempts (succinylcholine 32/200; rocuronium 36/201; P = 1.0) did not differ between the groups. Conclusions In critically ill

  18. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    Science.gov (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  19. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

    Science.gov (United States)

    Ducote, M J; Prakash, S; Pettis, G S

    2000-12-01

    Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

  20. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  1. Study on regional stratagem for coal mine disasters control and prevention in China

    Energy Technology Data Exchange (ETDEWEB)

    Shen, B.; Lei, Y. [China Coal Research Institute, Beijing (China)

    2009-09-15

    A regional strategy study was aimed at coal mine disaster control and prevention, which deepens and enriches the macro-strategy of coal mine disaster control and prevention, and provides an important support for the rapid and healthy development of China's regional coal industry. The country was divided into 4 regions: Northeast, North, South and Xinqing. In view of the regional status of coal mine disasters, the regulation and development trend of regional coal mine disasters was analysed, the outstanding problems and key factors were identified, and general thoughts on regional coal mine disaster control and prevention are put forward. 4 refs., 4 figs., 1 tab.

  2. Sequence variations in C9orf72 downstream of the hexanucleotide repeat region and its effect on repeat-primed PCR interpretation

    DEFF Research Database (Denmark)

    Nordin, Angelica; Akimoto, Chizuru; Wuolikainen, Anna

    2017-01-01

    A large GGGGCC-repeat expansion mutation (HREM) in C9orf72 is the most common known cause of ALS and FTD in European populations. Sequence variations immediately downstream of the HREM region have previously been observed and have been suggested to be one reason for difficulties in interpreting R...

  3. The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

    Directory of Open Access Journals (Sweden)

    Eva Hřibová

    2011-03-01

    Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

  4. Mitochondrial control region and GSTP1 polymorphism associated ...

    African Journals Online (AJOL)

    Souvik Ghatak

    2016-02-20

    Feb 20, 2016 ... were identified in urinary bladder cancer samples in GSTP1 gene. These two heteroplasmic ... also develop into a genetic marker of hereditary urinary blad- der cancer. ..... loop region in human colorectal cancer. Dis Colon ...

  5. Coral bleaching pathways under the control of regional temperature variability

    Science.gov (United States)

    Langlais, C. E.; Lenton, A.; Heron, S. F.; Evenhuis, C.; Sen Gupta, A.; Brown, J. N.; Kuchinke, M.

    2017-11-01

    Increasing sea surface temperatures (SSTs) are predicted to adversely impact coral populations worldwide through increasing thermal bleaching events. Future bleaching is unlikely to be spatially uniform. Therefore, understanding what determines regional differences will be critical for adaptation management. Here, using a cumulative heat stress metric, we show that characteristics of regional SST determine the future bleaching risk patterns. Incorporating observed information on SST variability, in assessing future bleaching risk, provides novel options for management strategies. As a consequence, the known biases in climate model variability and the uncertainties in regional warming rate across climate models are less detrimental than previously thought. We also show that the thresholds used to indicate reef viability can strongly influence a decision on what constitutes a potential refugia. Observing and understanding the drivers of regional variability, and the viability limits of coral reefs, is therefore critical for making meaningful projections of coral bleaching risk.

  6. Infection control in anaesthesia in regional, tertiary and central ...

    African Journals Online (AJOL)

    2012-09-10

    Sep 10, 2012 ... King Edward VIII Hospital; Nelson R Mandela School of Medicine, University of KwaZulu-Natal ... Samuel R, MBChB, DipHIVMan, FCPath(Viro)(SA), Specialist Virologist, Inkosi Albert Luthuli ... 12 regional level hospitals.

  7. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants.

    Science.gov (United States)

    Rodovalho, Cynara M; Ferro, Milene; Fonseca, Fernando Pp; Antonio, Erik A; Guilherme, Ivan R; Henrique-Silva, Flávio; Bacci, Maurício

    2011-06-17

    Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  8. Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

    International Nuclear Information System (INIS)

    Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

    2003-01-01

    Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

  9. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

    Science.gov (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

    2009-05-01

    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  10. Hemiptera Mitochondrial Control Region: New Sights into the Structural Organization, Phylogenetic Utility, and Roles of Tandem Repetitions of the Noncoding Segment

    Directory of Open Access Journals (Sweden)

    Kui Li

    2018-04-01

    Full Text Available As a major noncoding fragment, the control region (CR of mtDNA is responsible for the initiation of mitogenome transcription and replication. Several structural features of CR sequences have been reported in many insects. However, comprehensive analyses on the structural organization and phylogenetic utility, as well as the role of tandem replications (TRs on length variation, high A+T content, and shift of base skew of CR sequences are poorly investigated in hemipteran insects. In this study, we conducted a series of comparative analyses, using 116 samples covering all 11 infraorders of the five currently recognized monophyletic groups in the Hemiptera. Several structural elements (mononucleotide stretches containing conserved sequence blocks (CSBs, TRs, and GA-rich region were identified in the mitochondrial control region in hemipteran insects, without showing a consistent location. The presence and absence of certain specific structural elements in CR sequences show the various structural organizations of that segment among the five monophyletic groups, which indicates the diversification of the control region’s structural organization in Hemiptera. Among the many groups within Hemiptera, eight monophyletic groups and three consistent phylogenetic trees were recovered, using CSBs datasets by maximum likelihood and Bayesian methods, which suggests the possible utility of CR sequences for phylogenetic reconstruction in certain groups of Hemiptera. Statistical analyses showed that TRs may contribute to the length variation, high AT content, and the shift of base skewing of CR sequences toward high AT content in the Hemiptera. Our findings enrich the knowledge of structural organization, phylogenetic utility, and roles of tandem replication of hemipteran CR, and provide a possible framework for mitochondrial control region analyses in hemimetabolous insects.

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    Science.gov (United States)

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. 40 CFR 81.76 - State of Hawaii Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false State of Hawaii Air Quality Control... PROGRAMS (CONTINUED) DESIGNATION OF AREAS FOR AIR QUALITY PLANNING PURPOSES Designation of Air Quality Control Regions § 81.76 State of Hawaii Air Quality Control Region. The State of Hawaii Air Quality...

  14. 40 CFR 81.55 - Northeast Pennsylvania-Upper Delaware Valley Interstate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Northeast Pennsylvania-Upper Delaware... Designation of Air Quality Control Regions § 81.55 Northeast Pennsylvania-Upper Delaware Valley Interstate Air Quality Control Region. The Northeast Pennsylvania-Upper Delaware Valley Interstate Air Quality Control...

  15. Phenylketonuria and Gut Microbiota: A Controlled Study Based on Next-Generation Sequencing

    Science.gov (United States)

    Pinheiro de Oliveira, Felipe; Mendes, Roberta Hack; Dobbler, Priscila Thiago; Mai, Volker; Pylro, Victor Salter; Waugh, Sheldon G; Vairo, Filippo; Refosco, Lilia Farret; Schwartz, Ida Vanessa Doederlein

    2016-01-01

    Phenylketonuria (PKU) is an inborn error of metabolism associated with high blood levels of phenylalanine (Phe). A Phe-restricted diet supplemented with L-amino acids is the main treatment strategy for this disease; if started early, most neurological abnormalities can be prevented. The healthy human gut contains trillions of commensal bacteria, often referred to as the gut microbiota. The composition of the gut microbiota is known to be modulated by environmental factors, including diet. In this study, we compared the gut microbiota of 8 PKU patients on Phe-restricted dietary treatment with that of 10 healthy individuals. The microbiota were characterized by 16S rRNA sequencing using the Ion Torrent™ platform. The most dominant phyla detected in both groups were Bacteroidetes and Firmicutes. PKU patients showed reduced abundance of the Clostridiaceae, Erysipelotrichaceae, and Lachnospiraceae families, Clostridiales class, Coprococcus, Dorea, Lachnospira, Odoribacter, Ruminococcus and Veillonella genera, and enrichment of Prevotella, Akkermansia, and Peptostreptococcaceae. Microbial function prediction suggested significant differences in starch/glucose and amino acid metabolism between PKU patients and controls. Together, our results suggest the presence of distinct taxonomic groups within the gut microbiome of PKU patients, which may be modulated by their plasma Phe concentration. Whether our findings represent an effect of the disease itself, or a consequence of the modified diet is unclear. PMID:27336782

  16. ChronQC: a quality control monitoring system for clinical next generation sequencing.

    Science.gov (United States)

    Tawari, Nilesh R; Seow, Justine Jia Wen; Perumal, Dharuman; Ow, Jack L; Ang, Shimin; Devasia, Arun George; Ng, Pauline C

    2018-05-15

    ChronQC is a quality control (QC) tracking system for clinical implementation of next-generation sequencing (NGS). ChronQC generates time series plots for various QC metrics to allow comparison of current runs to historical runs. ChronQC has multiple features for tracking QC data including Westgard rules for clinical validity, laboratory-defined thresholds and historical observations within a specified time period. Users can record their notes and corrective actions directly onto the plots for long-term recordkeeping. ChronQC facilitates regular monitoring of clinical NGS to enable adherence to high quality clinical standards. ChronQC is freely available on GitHub (https://github.com/nilesh-tawari/ChronQC), Docker (https://hub.docker.com/r/nileshtawari/chronqc/) and the Python Package Index. ChronQC is implemented in Python and runs on all common operating systems (Windows, Linux and Mac OS X). tawari.nilesh@gmail.com or pauline.c.ng@gmail.com. Supplementary data are available at Bioinformatics online.

  17. Controls on facies and sequence stratigraphy of an upper Miocene carbonate ramp and platform, Melilla basin, NE Morocco

    Science.gov (United States)

    Cunningham, K.J.; Collins, Luke S.

    2002-01-01

    Upwelling of cool seawater, paleoceanographic circulation, paleoclimate, local tectonics and relative sea-level change controlled the lithofacies and sequence stratigraphy of a carbonate ramp and overlying platform that are part of a temporally well constrained carbonate complex in the Melilla basin, northeastern Morocco. At Melilla, from oldest to youngest, a third-order depositional sequence within the carbonate complex contains (1) a retrogradational, transgressive, warm temperate-type rhodalgal ramp; (2) an early highstand, progradational, bioclastic platform composed mainly of a temperate-type, bivalve-rich molechfor facies; and (3) late highstand, progradational to downstepping, subtropical/tropical-type chlorozoan fringing Porites reefs. The change from rhodalgal ramp to molechfor platform occurred at 7.0??0.14 Ma near the Tortonian/Messinian boundary. During a late stage in the development of the bioclastic platform a transition from temperate-type molechfor facies to subtropical/tropical-type chlorozoan facies occurred and is bracketed by chron 3An.2n (??? 6.3-6.6 Ma). Comparison to a well-dated carbonate complex in southeastern Spain at Cabo de Gata suggests that upwelling of cool seawater influenced production of temperate-type limestone within the ramp and platform at Melilla during postulated late Tortonian-early Messinian subtropical/tropical paleoclimatic conditions in the western Paleo-Mediterranean region. The upwelling of cool seawater across the bioclastic platform at Melilla could be related to the beginning of 'siphoning' of deep, cold Atlantic waters into the Paleo-Mediterranean Sea at 7.17 Ma. The facies change within the bioclastic platform from molechfor to chlorozoan facies may be coincident with a reduction of the siphoning of Atlantic waters and the end of upwelling at Melilla during chron 3An.2n. The ramp contains one retrogradational parasequence and the bioclastic platform three progradational parasequences. Minor erosional surfaces

  18. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study.

  19. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    International Nuclear Information System (INIS)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study

  20. Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

    International Nuclear Information System (INIS)

    Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

    1989-01-01

    The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

  1. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  2. Association analysis using next-generation sequence data from publicly available control groups: the robust variance score statistic.

    Science.gov (United States)

    Derkach, Andriy; Chiang, Theodore; Gong, Jiafen; Addis, Laura; Dobbins, Sara; Tomlinson, Ian; Houlston, Richard; Pal, Deb K; Strug, Lisa J

    2014-08-01

    Sufficiently powered case-control studies with next-generation sequence (NGS) data remain prohibitively expensive for many investigators. If feasible, a more efficient strategy would be to include publicly available sequenced controls. However, these studies can be confounded by differences in sequencing platform; alignment, single nucleotide polymorphism and variant calling algorithms; read depth; and selection thresholds. Assuming one can match cases and controls on the basis of ethnicity and other potential confounding factors, and one has access to the aligned reads in both groups, we investigate the effect of systematic differences in read depth and selection threshold when comparing allele frequencies between cases and controls. We propose a novel likelihood-based method, the robust variance score (RVS), that substitutes genotype calls by their expected values given observed sequence data. We show theoretically that the RVS eliminates read depth bias in the estimation of minor allele frequency. We also demonstrate that, using simulated and real NGS data, the RVS method controls Type I error and has comparable power to the 'gold standard' analysis with the true underlying genotypes for both common and rare variants. An RVS R script and instructions can be found at strug.research.sickkids.ca, and at https://github.com/strug-lab/RVS. lisa.strug@utoronto.ca Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Simultaneous identification of DNA and RNA viruses present in pig faeces using process-controlled deep sequencing.

    Directory of Open Access Journals (Sweden)

    Jana Sachsenröder

    Full Text Available BACKGROUND: Animal faeces comprise a community of many different microorganisms including bacteria and viruses. Only scarce information is available about the diversity of viruses present in the faeces of pigs. Here we describe a protocol, which was optimized for the purification of the total fraction of viral particles from pig faeces. The genomes of the purified DNA and RNA viruses were simultaneously amplified by PCR and subjected to deep sequencing followed by bioinformatic analyses. The efficiency of the method was monitored using a process control consisting of three bacteriophages (T4, M13 and MS2 with different morphology and genome types. Defined amounts of the bacteriophages were added to the sample and their abundance was assessed by quantitative PCR during the preparation procedure. RESULTS: The procedure was applied to a pooled faecal sample of five pigs. From this sample, 69,613 sequence reads were generated. All of the added bacteriophages were identified by sequence analysis of the reads. In total, 7.7% of the reads showed significant sequence identities with published viral sequences. They mainly originated from bacteriophages (73.9% and mammalian viruses (23.9%; 0.8% of the sequences showed identities to plant viruses. The most abundant detected porcine viruses were kobuvirus, rotavirus C, astrovirus, enterovirus B, sapovirus and picobirnavirus. In addition, sequences with identities to the chimpanzee stool-associated circular ssDNA virus were identified. Whole genome analysis indicates that this virus, tentatively designated as pig stool-associated circular ssDNA virus (PigSCV, represents a novel pig virus. CONCLUSION: The established protocol enables the simultaneous detection of DNA and RNA viruses in pig faeces including the identification of so far unknown viruses. It may be applied in studies investigating aetiology, epidemiology and ecology of diseases. The implemented process control serves as quality control, ensures

  4. Exact Boundary Controllability of Electromagnetic Fields in a General Region

    International Nuclear Information System (INIS)

    Eller, M. M.; Masters, J. E.

    2002-01-01

    We prove exact controllability for Maxwell's system with variable coefficients in a bounded domain by a current flux in the boundary. The proof relies on a duality argument which reduces the proof of exact controllability to the proof of continuous observability for the homogeneous adjoint system. There is no geometric restriction imposed on the domain

  5. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

    DEFF Research Database (Denmark)

    Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha

    2017-01-01

    To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural ...

  6. Genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia

    Directory of Open Access Journals (Sweden)

    Anastasiia Kovaliova

    2017-03-01

    Full Text Available Here we report the draft genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia. The draft genome has a size of 4.9 Mb and encodes multiple K+-transporters and proton-consuming decarboxylases. The phylogenetic analysis based on concatenated ribosomal proteins revealed that strain DV clusters together with the acid-tolerant Desulfovibrio sp. TomC and Desulfovibrio magneticus. The draft genome sequence and annotation have been deposited at GenBank under the accession number MLBG00000000.

  7. Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

    Science.gov (United States)

    Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

    2015-10-01

    Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

  8. State and Regional Control of Geological Carbon Sequestration

    Energy Technology Data Exchange (ETDEWEB)

    Reitze, Arnold [Univ. of Utah, Salt Lake City, UT (United States); Durrant, Marie [Univ. of Utah, Salt Lake City, UT (United States)

    2011-03-01

    The United States has economically recoverable coal reserves of about 261 billion tons, which is in excess of a 250-­year supply based on 2009 consumption rates. However, in the near future the use of coal may be legally restricted because of concerns over the effects of its combustion on atmospheric carbon dioxide concentrations. Carbon capture and geologic sequestration offer one method to reduce carbon emissions from coal and other hydrocarbon energy production. While the federal government is providing increased funding for carbon capture and sequestration, recent congressional legislative efforts to create a framework for regulating carbon emissions have failed. However, regional and state bodies have taken significant actions both to regulate carbon and facilitate its capture and sequestration. This article explores how regional bodies and state government are addressing the technical and legal problems that must be resolved in order to have a viable carbon sequestration program. Several regional bodies have formed regulations and model laws that affect carbon capture and storage, and three bodies comprising twenty-three states—the Regional Greenhouse Gas Initiative, the Midwest Regional Greenhouse Gas Reduction Accord, and the Western Climate initiative—have cap-­and-trade programs in various stages of development. State property, land use and environmental laws affect the development and implementation of carbon capture and sequestration projects, and unless federal standards are imposed, state laws on torts and renewable portfolio requirements will directly affect the liability and viability of these projects. This paper examines current state laws and legislative efforts addressing carbon capture and sequestration.

  9. Comparison of PCR-RFLP pattern with sequencing analysis of the ITS region of Hyrcanain\\'s Tilia

    Directory of Open Access Journals (Sweden)

    Hamed Yousefzadeh

    2014-01-01

    T. hyrcana and T. rubra from Hyrcanian's origin, but it could not separate T. begonifloia from the other hyrcanian species. In this respect, derived results were similar to sequencing one. In conclusion, with regard to less expensive and less time consuming PCR-RFLP technique and high similarity between its result with sequencing, we recommend this method as a simple and economical method with relatively high efficiency studding plant phylogeny.

  10. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  11. Genetic control of environmental variation of two quantitative traits of Drosophila melanogaster revealed by whole-genome sequencing

    DEFF Research Database (Denmark)

    Sørensen, Peter; de los Campos, Gustavo; Morgante, Fabio

    2015-01-01

    and others more volatile performance. Understanding the mechanisms responsible for environmental variability not only informs medical questions but is relevant in evolution and in agricultural science. In this work fully sequenced inbred lines of Drosophila melanogaster were analyzed to study the nature...... of genetic control of environmental variance for two quantitative traits: starvation resistance (SR) and startle response (SL). The evidence for genetic control of environmental variance is compelling for both traits. Sequence information is incorporated in random regression models to study the underlying...... genetic signals, which are shown to be different in the two traits. Genomic variance in sexual dimorphism was found for SR but not for SL. Indeed, the proportion of variance captured by sequence information and the contribution to this variance from four chromosome segments differ between sexes in SR...

  12. Risk factors control in patients with cardiovascular diseases in Ivanovo region: possibilities of a regional registry

    Directory of Open Access Journals (Sweden)

    Belova O.A.

    2016-03-01

    Conclusion ― In primary care units of Ivanovo region in 2015 patients were insufficiently asked about their lifestyle (smoking, physical activity, eating habits, as well as their body weight was measured. If a patient had a risk factor he usually receive a proper advice. For BP, weight and blood lipids the goals were achieved rare.

  13. Environment control in selected industrial regions of Austria

    International Nuclear Information System (INIS)

    Schindler, I.; Wiesenberger, H.; Kutschera, U.

    2004-01-01

    The environmental situation (air, water and soil) of fourteen Austrian regions (Arnoldstein-Gailitz, Brixlegg, Brueckl, Lend, Linz, Lenzing, Donawitz, Schwechat, Tanklager Lobau, Treibach-Althofen, Hallein, Poels, Ranshofen and St. Poelten) with industrial activities based on available data (1994-2002) is described. The connection and the temporal development of the emissions from industrial plants, the immissions and the environmental exposure as far as possible are shown, as well as actual information deficits and possible needs for action are worked out. For each region the following information is provided: location, description of present industrial plants, emissions (air, waste water and waste water treatment), wastes and residues, deposits of toxic waste, water immissions, air immissions and soil-vegetation-bioindication. (nevyjel)

  14. A comparative study of pseudorandom sequences used in a c-VEP based BCI for online wheelchair control

    DEFF Research Database (Denmark)

    Isaksen, Jonas L.; Mohebbi, Ali; Puthusserypady, Sadasivan

    2016-01-01

    In this study, a c-VEP based BCI system was developed to run on three distinctive pseudorandom sequences, namely the m-code, the Gold-code, and the Barker-code. The Visual Evoked Potentials (VEPs) were provoked using these codes. In the online session, subjects controlled a LEGO® Mindstorms® robot...

  15. Whole-Genome Sequence of Pseudomonas graminis Strain UASWS1507, a Potential Biological Control Agent and Biofertilizer Isolated in Switzerland.

    Science.gov (United States)

    Crovadore, Julien; Calmin, Gautier; Chablais, Romain; Cochard, Bastien; Schulz, Torsten; Lefort, François

    2016-10-06

    We report here the whole-genome shotgun sequence of the strain UASWS1507 of the species Pseudomonas graminis, isolated in Switzerland from an apple tree. This is the first genome registered for this species, which is considered as a potential and valuable resource of biological control agents and biofertilizers for agriculture. Copyright © 2016 Crovadore et al.

  16. Impact of emission control on regional air quality in the Pearl Delta River region, southern China

    Science.gov (United States)

    Wang, N.; Xuejiao, D.

    2017-12-01

    The Pearl River Delta (PRD) in China has been suffering from air quality issues and the government has implemented a series of strategies in controlling emissions. In an attempt to provide scientific support for improving air quality, the paper investigates the concerning past-to-present air quality data and assesses air quality resulting from emission control. Statistical data revealed that energy consumption doubled from 2004 to 20014 and vehicle usage increased significantly from 2006 to 2014. Due to the effect of control efforts, primary emission of SO2, NOx and PM2.5 decreased resulting in ambient concentrations of SO2, NO2 and PM10 decreased by 66%, 20% and 24%, respectively. However, O3 increased 19% because of the increase of VOC emission. A chemical transport model, the Community Multi-scale Air Quality, was employed to evaluate the responses of nitrate, ammonium, SOA, PM2.5 and O3 to changes in NOx, VOC and NH3 emissions. Three scenarios, a baseline scenario, a CAP scenario (control strength followed as past tendency), and a REF scenario (strict control referred to latest policy and plans), were conducted to investigate the responses and mechanisms. NOx controlling scenarios showed that NOx, nitrate and PM2.5 reduced by 1.8%, 0.7% and 0.2% under CAP and reduced by 7.2%, 1.8% and 0.3% under REF, respectively. The results indicated that reducing NOx emission caused the increase of atmospheric oxidizability, which might result in a compensation of PM2.5 due to the increase of nitrate or sulfate. NH3 controlling scenarios showed that nitrate was sensitive to NH3 emission in PRD, with nitrate decreased by 0 - 10.6% and 0 - 48% under CAP and REF, respectively. Since controlling NH3 emissions not only reduced ammonium but also significantly reduced nitrate, the implement of NH3 controlling strategy was highly suggested. The VOC scenarios revealed that though SOA was not the major component of PM2.5, controlling VOC emission might take effect in southwestern PRD

  17. Two‐phase designs for joint quantitative‐trait‐dependent and genotype‐dependent sampling in post‐GWAS regional sequencing

    Science.gov (United States)

    Espin‐Garcia, Osvaldo; Craiu, Radu V.

    2017-01-01

    ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496

  18. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  19. Research on frequency control strategy of interconnected region based on fuzzy PID

    Science.gov (United States)

    Zhang, Yan; Li, Chunlan

    2018-05-01

    In order to improve the frequency control performance of the interconnected power grid, overcome the problems of poor robustness and slow adjustment of traditional regulation, the paper puts forward a frequency control method based on fuzzy PID. The method takes the frequency deviation and tie-line deviation of each area as the control objective, takes the regional frequency deviation and its deviation as input, and uses fuzzy mathematics theory, adjusts PID control parameters online. By establishing the regional frequency control model of water-fire complementary power generation in MATLAB, the regional frequency control strategy is given, and three control modes (TBC-FTC, FTC-FTC, FFC-FTC) are simulated and analyzed. The simulation and experimental results show that, this method has better control performance compared with the traditional regional frequency regulation.

  20. Preliminary Analysis of Aircraft Loss of Control Accidents: Worst Case Precursor Combinations and Temporal Sequencing

    Science.gov (United States)

    Belcastro, Christine M.; Groff, Loren; Newman, Richard L.; Foster, John V.; Crider, Dennis H.; Klyde, David H.; Huston, A. McCall

    2014-01-01

    Aircraft loss of control (LOC) is a leading cause of fatal accidents across all transport airplane and operational classes, and can result from a wide spectrum of hazards, often occurring in combination. Technologies developed for LOC prevention and recovery must therefore be effective under a wide variety of conditions and uncertainties, including multiple hazards, and their validation must provide a means of assessing system effectiveness and coverage of these hazards. This requires the definition of a comprehensive set of LOC test scenarios based on accident and incident data as well as future risks. This paper defines a comprehensive set of accidents and incidents over a recent 15 year period, and presents preliminary analysis results to identify worst-case combinations of causal and contributing factors (i.e., accident precursors) and how they sequence in time. Such analyses can provide insight in developing effective solutions for LOC, and form the basis for developing test scenarios that can be used in evaluating them. Preliminary findings based on the results of this paper indicate that system failures or malfunctions, crew actions or inactions, vehicle impairment conditions, and vehicle upsets contributed the most to accidents and fatalities, followed by inclement weather or atmospheric disturbances and poor visibility. Follow-on research will include finalizing the analysis through a team consensus process, defining future risks, and developing a comprehensive set of test scenarios with correlation to the accidents, incidents, and future risks. Since enhanced engineering simulations are required for batch and piloted evaluations under realistic LOC precursor conditions, these test scenarios can also serve as a high-level requirement for defining the engineering simulation enhancements needed for generating them.

  1. Efficient and controllable thermal ablation induced by short-pulsed HIFU sequence assisted with perfluorohexane nanodroplets.

    Science.gov (United States)

    Chang, Nan; Lu, Shukuan; Qin, Dui; Xu, Tianqi; Han, Meng; Wang, Supin; Wan, Mingxi

    2018-07-01

    A HIFU sequence with extremely short pulse duration and high pulse repetition frequency can achieve thermal ablation at a low acoustic power using inertial cavitation. Because of its cavitation-dependent property, the therapeutic outcome is unreliable when the treatment zone lacks cavitation nuclei. To overcome this intrinsic limitation, we introduced perfluorocarbon nanodroplets as extra cavitation nuclei into short-pulsed HIFU-mediated thermal ablation. Two types of nanodroplets were used with perfluorohexane (PFH) as the core material coated with bovine serum albumin (BSA) or an anionic fluorosurfactant (FS) to demonstrate the feasibility of this study. The thermal ablation process was recorded by high-speed photography. The inertial cavitation activity during the ablation was revealed by sonoluminescence (SL). The high-speed photography results show that the thermal ablation volume increased by ∼643% and 596% with BSA-PFH and FS-PFH, respectively, than the short-pulsed HIFU alone at an acoustic power of 19.5 W. Using nanodroplets, much larger ablation volumes were created even at a much lower acoustic power. Meanwhile, the treatment time for ablating a desired volume significantly reduced in the presence of nanodroplets. Moreover, by adjusting the treatment time, lesion migration towards the HIFU transducer could also be avoided. The SL results show that the thermal lesion shape was significantly dependent on the inertial cavitation in this short-pulsed HIFU-mediated thermal ablation. The inertial cavitation activity became more predictable by using nanodroplets. Therefore, the introduction of PFH nanodroplets as extra cavitation nuclei made the short-pulsed HIFU thermal ablation more efficient by increasing the ablation volume and speed, and more controllable by reducing the acoustic power and preventing lesion migration. Copyright © 2018. Published by Elsevier B.V.

  2. The regional control of the canadian energy production

    International Nuclear Information System (INIS)

    Petitlaurent, S.; Sarrazin, J.

    2004-12-01

    This document provides information and presents data on the energy situation in many regions of Canada. The first part deals with the petroleum and the bitumen shales of Alberta (reserves, exploitation and production, environmental impacts), the second part discusses with the hydroelectricity choice of Quebec and the 2004 crisis. The nuclear situation of Ontario is presented in the third part (nuclear park, programs, uranium reserves, research and development on Candu reactors), while the fourth part deals with the renewable energies (wind power and biomass). The canadian situation facing the Kyoto protocol is discussed in the last part. (A.L.B.)

  3. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  4. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  5. Multi-region fuzzy logic controller with local PID controllers for U-tube steam generator in nuclear power plant

    Directory of Open Access Journals (Sweden)

    Puchalski Bartosz

    2015-12-01

    Full Text Available In the paper, analysis of multi-region fuzzy logic controller with local PID controllers for steam generator of pressurized water reactor (PWR working in wide range of thermal power changes is presented. The U-tube steam generator has a nonlinear dynamics depending on thermal power transferred from coolant of the primary loop of the PWR plant. Control of water level in the steam generator conducted by a traditional PID controller which is designed for nominal power level of the nuclear reactor operates insufficiently well in wide range of operational conditions, especially at the low thermal power level. Thus the steam generator is often controlled manually by operators. Incorrect water level in the steam generator may lead to accidental shutdown of the nuclear reactor and consequently financial losses. In the paper a comparison of proposed multi region fuzzy logic controller and traditional PID controllers designed only for nominal condition is presented. The gains of the local PID controllers have been derived by solving appropriate optimization tasks with the cost function in a form of integrated squared error (ISE criterion. In both cases, a model of steam generator which is readily available in literature was used for control algorithms synthesis purposes. The proposed multi-region fuzzy logic controller and traditional PID controller were subjected to broad-based simulation tests in rapid prototyping software - Matlab/Simulink. These tests proved the advantage of multi-region fuzzy logic controller with local PID controllers over its traditional counterpart.

  6. Sequencing analysis of ghrelin gene 5' flanking region: relations between the sequence variants, fasting plasma total ghrelin concentrations, and body mass index.

    Science.gov (United States)

    Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi

    2006-10-01

    Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest

  7. Infection control in anaesthesia in regional, tertiary and central ...

    African Journals Online (AJOL)

    2012-09-10

    Sep 10, 2012 ... Describe how self-inflating resuscitation bags (Ambu®) are decontamined? Question 8. Do you feel that you have enough time between each case to adequately clean anaesthetic equipment and still perform your other duties? Table II: Definitions and classifications used in infection control practices.

  8. The conundrum of chemical boll weevil control in subtropical regions

    Science.gov (United States)

    The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a tropical Mesoamerican insect that invaded the United States in 1893, spreading across the Cotton Belt as the key pest of cotton and causing billions of dollars in yield losses and insecticide-based control efforts;...

  9. Environmental Control for Regional Library Facilities. RR-80-3.

    Science.gov (United States)

    King, Richard G., Jr.

    This report presents an overview of the damage to library materials caused by uncontrollable environmental variables. The control of atmospheric pollutants, temperature, and humidity are discussed with regard to damage, standards, and the costs of deterioration due to these factors. Twelve references are listed. (FM)

  10. AUTOMATIC CONTROL SYSTEM ОF REGIONAL BOILER HOUSE

    Directory of Open Access Journals (Sweden)

    V. A. Sednin

    2005-01-01

    Full Text Available Implementation of an automatic control system is one of directions that promotes to increase an operational efficiency of a heat supply system. A heating boiler house in Surgut (Russia is taken as an example to demonstrate an actual realization of such system.

  11. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  12. Sequence analysis of the L protein of the Ebola 2014 outbreak: Insight into conserved regions and mutations.

    Science.gov (United States)

    Ayub, Gohar; Waheed, Yasir

    2016-06-01

    The 2014 Ebola outbreak was one of the largest that have occurred; it started in Guinea and spread to Nigeria, Liberia and Sierra Leone. Phylogenetic analysis of the current virus species indicated that this outbreak is the result of a divergent lineage of the Zaire ebolavirus. The L protein of Ebola virus (EBOV) is the catalytic subunit of the RNA‑dependent RNA polymerase complex, which, with VP35, is key for the replication and transcription of viral RNA. Earlier sequence analysis demonstrated that the L protein of all non‑segmented negative‑sense (NNS) RNA viruses consists of six domains containing conserved functional motifs. The aim of the present study was to analyze the presence of these motifs in 2014 EBOV isolates, highlight their function and how they may contribute to the overall pathogenicity of the isolates. For this purpose, 81 2014 EBOV L protein sequences were aligned with 475 other NNS RNA viruses, including Paramyxoviridae and Rhabdoviridae viruses. Phylogenetic analysis of all EBOV outbreak L protein sequences was also performed. Analysis of the amino acid substitutions in the 2014 EBOV outbreak was conducted using sequence analysis. The alignment demonstrated the presence of previously conserved motifs in the 2014 EBOV isolates and novel residues. Notably, all the mutations identified in the 2014 EBOV isolates were tolerant, they were pathogenic with certain examples occurring within previously determined functional conserved motifs, possibly altering viral pathogenicity, replication and virulence. The phylogenetic analysis demonstrated that all sequences with the exception of the 2014 EBOV sequences were clustered together. The 2014 EBOV outbreak has acquired a great number of mutations, which may explain the reasons behind this unprecedented outbreak. Certain residues critical to the function of the polymerase remain conserved and may be targets for the development of antiviral therapeutic agents.

  13. Meteorological Controls on Local and Regional Volcanic Ash Dispersal.

    Science.gov (United States)

    Poulidis, Alexandros P; Phillips, Jeremy C; Renfrew, Ian A; Barclay, Jenni; Hogg, Andrew; Jenkins, Susanna F; Robertson, Richard; Pyle, David M

    2018-05-02

    Volcanic ash has the capacity to impact human health, livestock, crops and infrastructure, including international air traffic. For recent major eruptions, information on the volcanic ash plume has been combined with relatively coarse-resolution meteorological model output to provide simulations of regional ash dispersal, with reasonable success on the scale of hundreds of kilometres. However, to predict and mitigate these impacts locally, significant improvements in modelling capability are required. Here, we present results from a dynamic meteorological-ash-dispersion model configured with sufficient resolution to represent local topographic and convectively-forced flows. We focus on an archetypal volcanic setting, Soufrière, St Vincent, and use the exceptional historical records of the 1902 and 1979 eruptions to challenge our simulations. We find that the evolution and characteristics of ash deposition on St Vincent and nearby islands can be accurately simulated when the wind shear associated with the trade wind inversion and topographically-forced flows are represented. The wind shear plays a primary role and topographic flows a secondary role on ash distribution on local to regional scales. We propose a new explanation for the downwind ash deposition maxima, commonly observed in volcanic eruptions, as resulting from the detailed forcing of mesoscale meteorology on the ash plume.

  14. Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

    Directory of Open Access Journals (Sweden)

    Subhasis Banerjee

    2001-01-01

    Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

  15. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls.

    Science.gov (United States)

    Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M; Agarwala, Vineeta; Gaulton, Kyle J; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J; Rivas, Manuel A; Perry, John R B; Sim, Xueling; Blackwell, Thomas W; Robertson, Neil R; Rayner, N William; Cingolani, Pablo; Locke, Adam E; Tajes, Juan Fernandez; Highland, Heather M; Dupuis, Josee; Chines, Peter S; Lindgren, Cecilia M; Hartl, Christopher; Jackson, Anne U; Chen, Han; Huyghe, Jeroen R; van de Bunt, Martijn; Pearson, Richard D; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M; Gamazon, Eric R; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A; Below, Jennifer E; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L; Pasko, Dorota; Parker, Stephen C J; Varga, Tibor V; Green, Todd; Beer, Nicola L; Day-Williams, Aaron G; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F; Han, Bok-Ghee; Jenkinson, Christopher P; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C Y; Palmer, Nicholette D; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D; Neale, Benjamin M; Purcell, Shaun; Butterworth, Adam S; Howson, Joanna M M; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K L; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H T; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E; Rybin, Dennis; Farook, Vidya S; Fowler, Sharon P; Freedman, Barry I; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K; Puppala, Sobha; Scott, William R; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C; Mangino, Massimo; Bonnycastle, Lori L; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L; Herder, Christian; Groves, Christopher J; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A; Doney, Alex S F; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H; Stirrups, Kathleen; Wood, Andrew R; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N A; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M; Syvänen, Ann-Christine; Bergman, Richard N; Bharadwaj, Dwaipayan; Bottinger, Erwin P; Cho, Yoon Shin; Chandak, Giriraj R; Chan, Juliana Cn; Chia, Kee Seng; Daly, Mark J; Ebrahim, Shah B; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A; Lehman, Donna M; Jia, Weiping; Ma, Ronald C W; Pollin, Toni I; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J F; Small, Kerrin S; Ried, Janina S; DeFronzo, Ralph A; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R; Gloyn, Anna L; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D; Hattersley, Andrew T; Bowden, Donald W; Collins, Francis S; Atzmon, Gil; Chambers, John C; Spector, Timothy D; Laakso, Markku; Strom, Tim M; Bell, Graeme I; Blangero, John; Duggirala, Ravindranath; Tai, E Shyong; McVean, Gilean; Hanis, Craig L; Wilson, James G; Seielstad, Mark; Frayling, Timothy M; Meigs, James B; Cox, Nancy J; Sladek, Rob; Lander, Eric S; Gabriel, Stacey; Mohlke, Karen L; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J; Morris, Andrew P; Kang, Hyun Min; Altshuler, David; Burtt, Noël P; Florez, Jose C; Boehnke, Michael; McCarthy, Mark I

    2017-12-19

    To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D.

  16. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  17. First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications.

    Science.gov (United States)

    Chen, Zhi-Teng; Du, Yu-Zhou

    2017-05-05

    The complete mitochondrial genome (mitogenome) of Nemoura nankinensis (Plecoptera: Nemouridae) was sequenced as the first reported mitogenome from the family Nemouridae. The N. nankinensis mitogenome was the longest (16,602 bp) among reported plecopteran mitogenomes, and it contains 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes. Most PCGs used standard ATN as start codons, and TAN as termination codons. All tRNA genes of N. nankinensis could fold into the cloverleaf secondary structures except for trnSer ( AGN ), whose dihydrouridine (DHU) arm was reduced to a small loop. There was also a large non-coding region (control region, CR) in the N. nankinensis mitogenome. The 1751 bp CR was the longest and had the highest A+T content (81.8%) among stoneflies. A large tandem repeat region, five potential stem-loop (SL) structures, four tRNA-like structures and four conserved sequence blocks (CSBs) were detected in the elongated CR. The presence of these tRNA-like structures in the CR has never been reported in other plecopteran mitogenomes. These novel features of the elongated CR in N. nankinensis may have functions associated with the process of replication and transcription. Finally, phylogenetic reconstruction suggested that Nemouridae was the sister-group of Capniidae.

  18. Comparison of sequences of hypervariable region (HVR subunit S-1 gene of field isolate I-37 infectious bronchitis virus with Connecticut serotype

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2003-06-01

    Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.

  19. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  20. Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    Menezes, M.R.; Kumar, G.; Kunal, S.P.

    Biology (2012) 80, 2198–2212 doi:10.1111/j.1095-8649.2012.03270.x, available online at wileyonlinelibrary.com Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D...-loop region M. R. Menezes*, G. Kumar and S. P. Kunal Biological Oceanography Division, National Institute of Oceanography (CSIR), Dona Paula, Goa 403 004, India (Received 26 May 2011, Accepted 14 February 2012) Genetic structure of skipjack tuna Katsuwonus...

  1. Three genetic stocks of frigate tuna Auxis thazard thazard (Lacepede, 1800) along the Indian coast revealed from sequence analyses of mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    GirishKumar; Kunal, S.P.; Menezes, M.R.; Meena, R.M.

    revealed from sequence analyses of mitochondrial DNA D-loop region Name of authors: 1. Girish Kumar* Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: girishkumar....nio@gmail.com Tel: +919766548060 2. Swaraj Priyaranjan Kunal Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: swar.mbt@gmail.com 3. Maria Rosalia Menezes Biological Oceanography...

  2. Regional Persistent Organic Pollutants' Environmental Impact Assessment and Control Model

    Directory of Open Access Journals (Sweden)

    Jurgis Staniskis

    2008-10-01

    Full Text Available The sources of formation, environmental distribution and fate of persistent organic pollutants (POPs are increasingly seen as topics to be addressed and solved at the global scale. Therefore, there are already two international agreements concerning persistent organic pollutants: the Protocol of 1998 to the 1979 Convention on the Long-Range Transboundary Air Pollution on Persistent Organic Pollutants (Aarhus Protocol; and the Stockholm Convention on Persistent Organic Pollutants. For the assessment of environmental pollution of POPs, for the risk assessment, for the evaluation of new pollutants as potential candidates to be included in the POPs list of the Stokholmo or/and Aarhus Protocol, a set of different models are developed or under development. Multimedia models help describe and understand environmental processes leading to global contamination through POPs and actual risk to the environment and human health. However, there is a lack of the tools based on a systematic and integrated approach to POPs management difficulties in the region.

  3. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Henrique-Silva Flávio

    2011-06-01

    Full Text Available Abstract Background Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. Results The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. Conclusion The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  4. [Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].

    Science.gov (United States)

    Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming

    2013-03-01

    Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

  5. Sequencing of 15622 gene-bearing BACs clarifies the gene-dense regions of the barley genome

    Czech Academy of Sciences Publication Activity Database

    Munoz-Amatriain, M.; Lonardi, S.; Luo, M.C.; Madishetty, K.; Svensson, J.T.; Moscou, M. J.; Wanamaker, S.; Kudrna, D.; Zheng, J.; Šimková, Hana; Doležel, Jaroslav; Grimwood, J.; Mammadov, J.; Close, T.J.

    2015-01-01

    Roč. 84, č. 1 (2015), s. 216-227 ISSN 0960-7412 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Barley * Hordeum vulgare L * BAC sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.468, year: 2015

  6. Identification of genome-wide non-canonical spliced regions and analysis of biological functions for spliced sequences using Read-Split-Fly.

    Science.gov (United States)

    Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman

    2017-10-03

    It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions

  7. Masking as an effective quality control method for next-generation sequencing data analysis.

    Science.gov (United States)

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  8. Regional quality control survey of blood-gas analysis.

    Science.gov (United States)

    Minty, B D; Nunn, J F

    1977-09-01

    We undertook an external quality control survey of blood-gas analysis in 16 laboratories at 13 hospitals. All samples were prepared in the laboratories under investigation by equilibration of blood or serum with gas mixtures of known composition. pH of serum was measured with no significant bias but with an SD of random error 0.026 pH units, which was almost twice the SD of the reference range (0.015). An acceptable random error (half SD of reference range) was not obtained in a longitudinal internal quality control suvey although there were acceptable results for buffer pH in both field and internal surveys. Blood PO2 was measured with no significant bias but with SD of random error 1.38 kPa which reduced to 0.72 kPa by excluding one egregious result. The latter value was just over half of the SD of the reference range (1.2 kPa). PCO2 of blood was also measured without significant bias but with a much smaller SD of random error of 0.28 kPa (by excluding one egregious result), which was again just over half the SD of the reference range (0.51 kPa). Measurements of blood PO2 and PCO2 seem generally acceptable in relation to their respective reference ranges but measurements of pH were unsatisfactory in both internal and external trials.

  9. NicoLase-An open-source diode laser combiner, fiber launch, and sequencing controller for fluorescence microscopy.

    Directory of Open Access Journals (Sweden)

    Philip R Nicovich

    Full Text Available Modern fluorescence microscopy requires software-controlled illumination sources with high power across a wide range of wavelengths. Diode lasers meet the power requirements and combining multiple units into a single fiber launch expands their capability across the required spectral range. We present the NicoLase, an open-source diode laser combiner, fiber launch, and software sequence controller for fluorescence microscopy and super-resolution microscopy applications. Two configurations are described, giving four or six output wavelengths and one or two single-mode fiber outputs, with all CAD files, machinist drawings, and controller source code openly available.

  10. Automated control procedures and first results from the temporary seismic monitoring of the 2012 Emilia sequence

    Directory of Open Access Journals (Sweden)

    Simone Marzorati

    2012-10-01

    Full Text Available After moderate to strong earthquakes in Italy or in the surrounding areas, the Istituto Nazionale di Geofisica e Vulcanologia (INGV; National Institute for Geophysics and Volcanology activates a temporary seismic network infrastructure. This is devoted to integration with the Italian National Seismic Network (RSN [Delladio 2011] in the epicentral area, thus improving the localization of the aftershocks distribution after a mainshock. This infrastructure is composed of a stand-alone, locally recording part (Re.Mo. [Moretti et al. 2010] and a real-time telemetered part (Re.Mo.Tel. [Abruzzese et al. 2011a, 2011b] that can stream data to the acquisition centers in Rome and Grottaminarda. After the May 20, 2012, Ml 5.9 earthquake in the Emilia region (northern Italy, the temporary network was deployed in the epicentral area; in particular, 10 telemetered and 12 stand-alone stations were installed [Moretti et al. 2012, this volume]. Using the dedicated connection between the acquisition center in Rome and the Ancona acquisition sub-center [Cattaneo et al. 2011], the signals of the real-time telemetered stations were acquired also in this sub-center. These were used for preliminary quality control, by adopting the standard procedures in use here (see next paragraph, and Monachesi et al. [2011]. The main purpose of the present study is a first report on this quality check, which should be taken into account for the correct use of these data. […

  11. Improved local and regional control with radiotherapy for Merkel cell carcinoma of the head and neck.

    Science.gov (United States)

    Strom, Tobin; Naghavi, Arash O; Messina, Jane L; Kim, Sungjune; Torres-Roca, Javier F; Russell, Jeffery; Sondak, Vernon K; Padhya, Tapan A; Trotti, Andy M; Caudell, Jimmy J; Harrison, Louis B

    2017-01-01

    We hypothesized that radiotherapy (RT) would improve both local and regional control with Merkel cell carcinoma of the head and neck. A single-institution institutional review board-approved study was performed including 113 patients with nonmetastatic Merkel cell carcinoma of the head and neck. Postoperative RT was delivered to the primary tumor bed (71.7% cases) ± draining lymphatics (33.3% RT cases). Postoperative local RT was associated with improved local control (3-year actuarial local control 89.4% vs 68.1%; p = .005; Cox hazard ratio [HR] 0.18; 95% confidence interval [CI] = 0.06-0.55; p = .002). Similarly, regional RT was associated with improved regional control (3-year actuarial regional control 95.0% vs 66.7%; p = .008; Cox HR = 0.09; 95% CI = 0.01-0.69; p = .02). Regional RT played an important role for both clinical node-negative patients (3-year regional control 100% vs 44.7%; p = .03) and clinical/pathological node-positive patients (3-year regional control 90.9% vs 55.6%; p = .047). Local RT was beneficial for all patients with Merkel cell carcinoma of the head and neck, whereas regional RT was beneficial for clinical node-negative and clinical/pathological node-positive patients. © 2016 Wiley Periodicals, Inc. Head Neck 39: 48-55, 2017. © 2016 Wiley Periodicals, Inc.

  12. Nonlinear H∞ Optimal Control Scheme for an Underwater Vehicle with Regional Function Formulation

    Directory of Open Access Journals (Sweden)

    Zool H. Ismail

    2013-01-01

    Full Text Available A conventional region control technique cannot meet the demands for an accurate tracking performance in view of its inability to accommodate highly nonlinear system dynamics, imprecise hydrodynamic coefficients, and external disturbances. In this paper, a robust technique is presented for an Autonomous Underwater Vehicle (AUV with region tracking function. Within this control scheme, nonlinear H∞ and region based control schemes are used. A Lyapunov-like function is presented for stability analysis of the proposed control law. Numerical simulations are presented to demonstrate the performance of the proposed tracking control of the AUV. It is shown that the proposed control law is robust against parameter uncertainties, external disturbances, and nonlinearities and it leads to uniform ultimate boundedness of the region tracking error.

  13. The use of management controls in different cultural regions

    DEFF Research Database (Denmark)

    Malmi, Teemu; Ax, Christian; Bedford, David

    2016-01-01

    perceive compensation as important purpose, whereas Germanic and Nordic SBUs emphasize attention direction and learning. Budgets and performance measurement systems are used interactively to a larger extent by Anglo-Saxon and Germanic compared to Nordic SBUs. Rewards are based on achievement of financial...... targets more in Anglo than in Germanic SBUs. Reward and compensation in Anglo SBUs is more subjective, individual based and relies also on non-financial rewards to a larger extent than in Germanic and Nordic SBUs. Regarding cultural controls, Anglo SBUs value recruitment within organization more highly...... than Nordic SBUs and Anglo SBUs use various socialization practices to a larger extent than Germanic and Nordic SBUs do. Implications of these and other findings for both theory development and practice are discussed....

  14. NOESY-WaterControl: a new NOESY sequence for the observation of under-water protein resonances

    Energy Technology Data Exchange (ETDEWEB)

    Torres, Allan M.; Zheng, Gang, E-mail: g.zheng@westernsydney.edu.au; Price, William S. [Western Sydney University, Nanoscale Organisation and Dynamics Group, School of Science and Health (Australia)

    2017-03-15

    Highly selective and efficient water signal suppression is indispensable in biomolecular 2D nuclear Overhauser effect spectroscopy (NOESY) experiments. However, the application of conventional water suppression schemes can cause a significant or complete loss of the biomolecular resonances at and around the water chemical shift (ω{sub 2}). In this study, a new sequence, NOESY-WaterControl, was developed to address this issue. The new sequence was tested on lysozyme and bovine pancreatic trypsin inhibitor (BPTI), demonstrating its efficiency in both water suppression and, more excitingly, preserving water-proximate biomolecular resonances in ω{sub 2}. The 2D NOESY maps obtained using the new sequence thus provide more information than the maps obtained with conventional water suppression, thereby lessening the number of experiments needed to complete resonance assignments of biomolecules. The 2D NOESY-WaterControl map of BPTI showed strong bound water and exchangeable proton signals in ω{sub 1} but these signals were absent in ω{sub 2}, indicating the possibility of using the new sequence to discriminate bound water and exchangeable proton resonances from non-labile proton resonances with similar chemical shifts to water.

  15. NOESY-WaterControl: a new NOESY sequence for the observation of under-water protein resonances

    International Nuclear Information System (INIS)

    Torres, Allan M.; Zheng, Gang; Price, William S.

    2017-01-01

    Highly selective and efficient water signal suppression is indispensable in biomolecular 2D nuclear Overhauser effect spectroscopy (NOESY) experiments. However, the application of conventional water suppression schemes can cause a significant or complete loss of the biomolecular resonances at and around the water chemical shift (ω 2 ). In this study, a new sequence, NOESY-WaterControl, was developed to address this issue. The new sequence was tested on lysozyme and bovine pancreatic trypsin inhibitor (BPTI), demonstrating its efficiency in both water suppression and, more excitingly, preserving water-proximate biomolecular resonances in ω 2 . The 2D NOESY maps obtained using the new sequence thus provide more information than the maps obtained with conventional water suppression, thereby lessening the number of experiments needed to complete resonance assignments of biomolecules. The 2D NOESY-WaterControl map of BPTI showed strong bound water and exchangeable proton signals in ω 1 but these signals were absent in ω 2 , indicating the possibility of using the new sequence to discriminate bound water and exchangeable proton resonances from non-labile proton resonances with similar chemical shifts to water.

  16. SURVEILLANCE AND CONTROL OF ANTIBIOTIC RESISTANCE IN THE MEDITERRANEAN REGION

    Directory of Open Access Journals (Sweden)

    Walter Ricciardi

    2016-07-01

    Full Text Available Antibiotic resistance is one of the most relevant problems in the healthcare: the growth of resistant micro-organisms in healthcare settings is a worrisome threat, raising length to stay (LOS, morbidity and mortality in those patients. The importance of the antibiotic resistance and its spread around the world, gave rise to the activation of several surveillance systems, based especially on the collection of laboratory data to local or national level. The objective of this work is to carry out a review of the scientific literature existing on the topic and scientific activities related to surveillance on antibiotic resistance in countries bordering the Mediterranean Sea. Recent Data from European Centre for Disease Prevention and Control (November 2015 show, for different combinations bacterium-drug, an increase of resistance from North to South and from West to East of Europe; it is particularly worrying the phenomenon of resistance carried out by some gram negative, specifically Klebsiella pneumoniae and Escherichia coli to third-generation cephalosporin, often combined in opposition to fluoroquinolones and amino glycosides. Is particularly relevant the incidence of resistance to carbapenems by strains of Enterobacteriaceae (Klebsiella included. The resistance exerted by MRSA (Methicillin-resistant Staphylococcus aureus continues to be relevant, albeit showing some decline in recent years. The incidence of resistance carried on by Streptococcus pneumoniae is stable and is mainly relevant to macrolides. Finally, a significant increase in recording relatively exercised by Enterococcus faecium to Vancomycin. Detecting, preventing, and controlling antibiotic resistance requires strategic, coordinated, and sustained efforts. It also depends on the engagement of governments, academia, industry, healthcare providers, the general public, and the agricultural community, as well as international partners. Committing to combating antibiotic

  17. Controls of Tufa Development in Bonito Region - Brazil.

    Science.gov (United States)

    Bahniuk Rumbelsperger, A. M.; Oste, J.; França, A.; Cury, L. F.

    2017-12-01

    environment during the annual hydrologic cycle integrated with isotopic analysis, showed very early diagenetic processes responsible for the formation of carbonate tufa in this region.

  18. Whole-genome sequencing of Bacillus subtilis XF-1 reveals mechanisms for biological control and multiple beneficial properties in plants.

    Science.gov (United States)

    Guo, Shengye; Li, Xingyu; He, Pengfei; Ho, Honhing; Wu, Yixin; He, Yueqiu

    2015-06-01

    Bacillus subtilis XF-1 is a gram-positive, plant-associated bacterium that stimulates plant growth and produces secondary metabolites that suppress soil-borne plant pathogens. In particular, it is especially highly efficient at controlling the clubroot disease of cruciferous crops. Its 4,061,186-bp genome contains an estimated 3853 protein-coding sequences and the 1155 genes of XF-1 are present in most genome-sequenced Bacillus strains: 3757 genes in B. subtilis 168, and 1164 in B. amyloliquefaciens FZB42. Analysis using the Cluster of Orthologous Groups database of proteins shows that 60 genes control bacterial mobility, 221 genes are related to cell wall and membrane biosynthesis, and more than 112 are genes associated with secondary metabolites. In addition, the genes contributed to the strain's plant colonization, bio-control and stimulation of plant growth. Sequencing of the genome is a fundamental step for developing a desired strain to serve as an efficient biological control agent and plant growth stimulator. Similar to other members of the taxon, XF-1 has a genome that contains giant gene clusters for the non-ribosomal synthesis of antifungal lipopeptides (surfactin and fengycin), the polyketides (macrolactin and bacillaene), the siderophore bacillibactin, and the dipeptide bacilysin. There are two synthesis pathways for volatile growth-promoting compounds. The expression of biosynthesized antibiotic peptides in XF-1 was revealed by matrix-assisted laser desorption/ionization-time of flight mass spectrometry.

  19. Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

    Science.gov (United States)

    Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

    2016-09-21

    With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our

  20. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

    Science.gov (United States)

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  1. Oligo-Miocene reservoir sequence characterization and structuring in the Sisseb El Alem-Kalaa Kebira regions (Northeastern Tunisia)

    Science.gov (United States)

    Houatmia, Faten; Khomsi, Sami; Bédir, Mourad

    2015-11-01

    The Sisseb El Alem-Enfidha basin is located in the northeastern Tunisia, It is borded by Nadhour - Saouaf syncline to the north, Kairouan plain to the south, the Mediterranean Sea to the east and Tunisian Atlassic "dorsale" to the west. Oligocene and Miocene deltaic deposits present the main potential deep aquifers in this basin with high porosity (25%-30%). The interpretation of twenty seismic reflection profiles, calibrated by wire line logging data of twelve oil wells, hydraulic wells and geologic field sections highlighted the impact of tectonics on the structuring geometry of Oligo-Miocene sandstones reservoirs and their distribution in raised structures and subsurface depressions. Miocene seismostratigraphy analysis from Ain Ghrab Formation (Langhian) to the Segui Formation (Quaternary) showed five third-order seismic sequence deposits and nine extended lenticular sandy bodies reservoirs limited by toplap and downlap surfaces unconformities, Oligocene deposits presented also five third- order seismic sequences with five extended lenticular sandy bodies reservoirs. The Depth and the thickness maps of these sequence reservoir packages exhibited the structuring of this basin in sub-basins characterized by important lateral and vertical geometric and thichness variations. Petroleum wells wire line logging correlation with clay volume calculation showed an heterogeneous multilayer reservoirs of Oligocene and Miocene formed by the arrangement of fourteen sandstone bodies being able to be good reservoirs, separated by impermeable clay packages and affected by faults. Reservoirs levels correspond mainly to the lower system tract (LST) of sequences. Intensive fracturing by deep seated faults bounding the different sub-basins play a great role for water surface recharge and inter-layer circulations between affected reservoirs. The total pore volume of the Oligo-Miocene reservoir sandy bodies in the study area, is estimated to about 4 × 1012 m3 and equivalent to 4

  2. Sequencing and assembly of low copy and genic regions of isolated Triticum aestivum chromosome arm 7DS

    Czech Academy of Sciences Publication Activity Database

    Berkman, O. J.; Skarshewski, A.; Lorenc, M. T.; Kubaláková, Marie; Šimková, Hana; Batley, J.; Doležel, Jaroslav; Edwards, D.

    2011-01-01

    Roč. 9, č. 7 (2011), s. 768-775 ISSN 1467-7644 R&D Projects: GA ČR GA521/07/1573; GA MŠk ED0007/01/01 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat genome sequence * chromosome 7 * genome assembly Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.442, year: 2011

  3. Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

    Directory of Open Access Journals (Sweden)

    Jonathan Brassac

    Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

  4. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

    DEFF Research Database (Denmark)

    Jason, Flannick; Fuchsberger, Christian; Mahajan, Anubha

    2017-01-01

    variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced...... individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics...... from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D....

  5. Regionally differentiated air pollution control regulations in the installation-related emission control law of the Federal Republic of Germany

    International Nuclear Information System (INIS)

    Buettner, T.W.

    1992-01-01

    The volume treats an issue from the boundary zone between environmental law and environmental economics, namely the regionalization of air pollution control standards in installation-related emission control law. In order to examine the question of whether this proposal, which originates in the field of environmental economics, can be adopted and is purposeful, the author initially performs a complete inventorization of applicable norms, this covering emission control law, the law of regional planning, and the provisions of international law. This status quo is then reviewed using conformity and optimization criteria developed by the political sciences. The assessment comes to the conclusion that the introduction of regionally differentiated air pollution control standards is not desirable. The author further submits proposals for the streamlining of the law of installation-related air pollution control in the Federal Republic of Germany. (orig.) [de

  6. Evaluating geothermal and hydrogeologic controls on regional groundwater temperature distribution

    Science.gov (United States)

    Burns, Erick R.; Ingebritsen, Steven E.; Manga, Michael; Williams, Colin F.

    2016-01-01

    A one-dimensional (1-D) analytic solution is developed for heat transport through an aquifer system where the vertical temperature profile in the aquifer is nearly uniform. The general anisotropic form of the viscous heat generation term is developed for use in groundwater flow simulations. The 1-D solution is extended to more complex geometries by solving the equation for piece-wise linear or uniform properties and boundary conditions. A moderately complex example, the Eastern Snake River Plain (ESRP), is analyzed to demonstrate the use of the analytic solution for identifying important physical processes. For example, it is shown that viscous heating is variably important and that heat conduction to the land surface is a primary control on the distribution of aquifer and spring temperatures. Use of published values for all aquifer and thermal properties results in a reasonable match between simulated and measured groundwater temperatures over most of the 300 km length of the ESRP, except for geothermal heat flow into the base of the aquifer within 20 km of the Yellowstone hotspot. Previous basal heat flow measurements (∼110 mW/m2) made beneath the ESRP aquifer were collected at distances of >50 km from the Yellowstone Plateau, but a higher basal heat flow of 150 mW/m2 is required to match groundwater temperatures near the Plateau. The ESRP example demonstrates how the new tool can be used during preliminary analysis of a groundwater system, allowing efficient identification of the important physical processes that must be represented during more-complex 2-D and 3-D simulations of combined groundwater and heat flow.

  7. Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes.

    Science.gov (United States)

    Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S

    2010-10-01

    Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (Pc) 2010 Elsevier B.V. All rights reserved.

  8. Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region

    Science.gov (United States)

    Wu, Shuang; Kanda, Tatsuo; Nakamoto, Shingo; Jiang, Xia; Miyamura, Tatsuo; Nakatani, Sueli M.; Ono, Suzane Kioko; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2013-01-01

    Background Hepatitis C virus (HCV) subgenotypes 1a and 1b have different impacts on the treatment response to peginterferon plus ribavirin with direct-acting antivirals (DAAs) against patients infected with HCV genotype 1, as the emergence rates of resistance mutations are different between these two subgenotypes. In Japan, almost all of HCV genotype 1 belongs to subgenotype 1b. Methods and Findings To determine HCV subgenotype 1a or 1b in Japanese patients infected with HCV genotype 1, real-time PCR-based method and Sanger method were used for the HCV NS5B region. HCV subgenotypes were determined in 90% by real-time PCR-based method. We also analyzed the specific probe regions for HCV subgenotypes 1a and 1b using ultra-deep sequencing, and uncovered mutations that could not be revealed using direct-sequencing by Sanger method. We estimated the prevalence of HCV subgenotype 1a as 1.2-2.5% of HCV genotype 1 patients in Japan. Conclusions Although real-time PCR-based HCV subgenotyping method seems fair for differentiating HCV subgenotypes 1a and 1b, it may not be sufficient for clinical practice. Ultra-deep sequencing is useful for revealing the resistant strain(s) of HCV before DAA treatment as well as mixed infection with different genotypes or subgenotypes of HCV. PMID:24069214

  9. Sequences within both the 5' untranslated region and the Gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA

    International Nuclear Information System (INIS)

    Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.

    2003-01-01

    It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant

  10. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    Science.gov (United States)

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  11. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    Science.gov (United States)

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

  12. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    Science.gov (United States)

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

  13. Sliding mode control of dissolved oxygen in an integrated nitrogen removal process in a sequencing batch reactor (SBR).

    Science.gov (United States)

    Muñoz, C; Young, H; Antileo, C; Bornhardt, C

    2009-01-01

    This paper presents a sliding mode controller (SMC) for dissolved oxygen (DO) in an integrated nitrogen removal process carried out in a suspended biomass sequencing batch reactor (SBR). The SMC performance was compared against an auto-tuning PI controller with parameters adjusted at the beginning of the batch cycle. A method for cancelling the slow DO sensor dynamics was implemented by using a first order model of the sensor. Tests in a lab-scale reactor showed that the SMC offers a better disturbance rejection capability than the auto-tuning PI controller, furthermore providing reasonable performance in a wide range of operation. Thus, SMC becomes an effective robust nonlinear tool to the DO control in this process, being also simple from a computational point of view, allowing its implementation in devices such as industrial programmable logic controllers (PLCs).

  14. Genomic relationships of Actinobacillus pleuropneumoniae serotype 2 strains evaluated by ribotyping, sequence analysis of ribosomal intergenic regions, and pulsed-field gel electrophoresis

    DEFF Research Database (Denmark)

    Fussing, V.

    1998-01-01

    The aim of the present study was to examine the genomic relationship among 112 Actinobacillus pleuropneumoniae serotype 2 strains obtained throughout Europe and North America. HindIII ribotyping of the strains resulted in five ribotypes of high similarity (87-98%). Sequence analysis of the riboso......The aim of the present study was to examine the genomic relationship among 112 Actinobacillus pleuropneumoniae serotype 2 strains obtained throughout Europe and North America. HindIII ribotyping of the strains resulted in five ribotypes of high similarity (87-98%). Sequence analysis...... of the ribosomal intergenic region of strains representing each ribotype and each country showed no differences. A common ribotype was further characterized by PFGE of 12 strains representing all countries. The resultant five PFGE patterns of European strains showed a similarity of more than 91%, to which the two...

  15. Controlling the structure of sequence-defined poly(phosphodiester)s for optimal MS/MS reading of digital information.

    Science.gov (United States)

    Amalian, J-A; Al Ouahabi, A; Cavallo, G; König, N F; Poyer, S; Lutz, J-F; Charles, L

    2017-11-01

    Digital polymers are monodisperse chains with a controlled sequence of co-monomers, defined as letters of an alphabet, and are used to store information at the molecular level. Reading such messages is hence a sequencing task that can be efficiently achieved by tandem mass spectrometry. To improve their readability, structure of sequence-controlled synthetic polymers can be optimized, based on considerations regarding their fragmentation behavior. This strategy is described here for poly(phosphodiester)s, which were synthesized as monodisperse chains with more than 100 units but exhibited extremely complex dissociation spectra. In these polymers, two repeating units that differ by a simple H/CH 3 variation were defined as the 0 and 1 bit of the ASCII code and spaced by a phosphate moiety. They were readily ionized in negative ion mode electrospray but dissociated via cleavage at all phosphate bonds upon collisional activation. Although allowing a complete sequence coverage of digital poly(phosphodiester)s, this fragmentation behavior was not efficient for macromolecules with more than 50 co-monomers, and data interpretation was very tedious. The structure of these polymers was then modified by introducing alkoxyamine linkages at appropriate location throughout the chain. A first design consisted of placing these low dissociation energy bonds between each monomeric bit: while cleavage of this sole bond greatly simplified MS/MS spectra, efficient sequencing was limited to chains with up to about 50 units. In contrast, introduction of alkoxyamine bonds between each byte (i.e. a set of eight co-monomers) was a more successful strategy. Long messages (so far, up to 8 bytes) could be read in MS 3 experiments, where single-byte containing fragments released during the first activation stage were further dissociated for sequencing. The whole sequence of such byte-truncated poly(phosphodiester)s could be easily re-constructed based on a mass tagging system which permits

  16. Sequence-Stratigraphic Analysis of the Regional Observation Monitoring Program (ROMP) 29A Test Corehole and Its Relation to Carbonate Porosity and Regional Transmissivity in the Floridan Aquifer System, Highlands County, Florida

    Science.gov (United States)

    Ward, W. C.; Cunningham, K.J.; Renken, R.A.; Wacker, M.A.; Carlson, J.I.

    2003-01-01

    An analysis was made to describe and interpret the lithology of a part of the Upper Floridan aquifer penetrated by the Regional Observation Monitoring Program (ROMP) 29A test corehole in Highlands County, Florida. This information was integrated into a one-dimensional hydrostratigraphic model that delineates candidate flow zones and confining units in the context of sequence stratigraphy. Results from this test corehole will serve as a starting point to build a robust three-dimensional sequence-stratigraphic framework of the Floridan aquifer system. The ROMP 29A test corehole penetrated the Avon Park Formation, Ocala Limestone, Suwannee Limestone, and Hawthorn Group of middle Eocene to Pliocene age. The part of the Avon Park Formation penetrated in the ROMP 29A test corehole contains two composite depositional sequences. A transgressive systems tract and a highstand systems tract were interpreted for the upper composite sequence; however, only a highstand systems tract was interpreted for the lower composite sequence of the deeper Avon Park stratigraphic section. The composite depositional sequences are composed of at least five high-frequency depositional sequences. These sequences contain high-frequency cycle sets that are an amalgamation of vertically stacked high-frequency cycles. Three types of high-frequency cycles have been identified in the Avon Park Formation: peritidal, shallow subtidal, and deeper subtidal high-frequency cycles. The vertical distribution of carbonate-rock diffuse flow zones within the Avon Park Formation is heterogeneous. Porous vuggy intervals are less than 10 feet, and most are much thinner. The volumetric arrangement of the diffuse flow zones shows that most occur in the highstand systems tract of the lower composite sequence of the Avon Park Formation as compared to the upper composite sequence, which contains both a backstepping transgressive systems tract and a prograding highstand systems tract. Although the porous and permeable

  17. A strand specific high resolution normalization method for chip-sequencing data employing multiple experimental control measurements

    DEFF Research Database (Denmark)

    Enroth, Stefan; Andersson, Claes; Andersson, Robin

    2012-01-01

    High-throughput sequencing is becoming the standard tool for investigating protein-DNA interactions or epigenetic modifications. However, the data generated will always contain noise due to e.g. repetitive regions or non-specific antibody interactions. The noise will appear in the form of a backg......, the background is only used to adjust peak calling and not as a pre-processing step that aims at discerning the signal from the background noise. A normalization procedure that extracts the signal of interest would be of universal use when investigating genomic patterns....

  18. Pinning-controlled synchronization of complex networks with bounded or unbounded synchronized regions

    International Nuclear Information System (INIS)

    Yan-Li, Zou; Guan-Rong, Chen

    2009-01-01

    This paper studies pinning-controlled synchronization of complex networks with bounded or unbounded synchronized regions. To study a state-feedback pinning-controlled network with N nodes, it first converts the controlled network to an extended network of N+1 nodes without controls. It is shown that the controlled synchronizability of the given network is determined by the real part of the smallest nonzero eigenvalue of the coupling matrix of its extended network when the synchronized region is unbounded; but it is determined by the ratio of the real parts of the largest and the smallest nonzero eigenvalues of the coupling matrix when the synchronized region is bounded. Both theoretical analysis and numerical simulation show that the portion of controlled nodes has no critical values when the synchronized region is unbounded, but it has a critical value when the synchronized region is bounded. In the former case, therefore, it is possible to control the network to achieve synchronization by pinning only one node. In the latter case, the network can achieve controlled synchronization only when the portion of controlled nodes is larger than the critical value. (general)

  19. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  20. Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

    2007-05-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

  1. Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

    2008-01-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

  2. ProteinSplit: splitting of multi-domain proteins using prediction of ordered and disordered regions in protein sequences for virtual structural genomics

    International Nuclear Information System (INIS)

    Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz

    2007-01-01

    The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors

  3. Segmented seismicity of the Mw 6.2 Baladeh earthquake sequence (Alborz mountains, Iran) revealed from regional moment tensors

    DEFF Research Database (Denmark)

    Donner, Stefanie; Rössler, Dirk; Krüger, Frank

    2013-01-01

    The M w 6.2 Baladeh earthquake occurred on 28 May 2004 in the Alborz Mountains, northern Iran. This earthquake was the first strong shock in this intracontinental orogen for which digital regional broadband data are available. The Baladeh event provides a rare opportunity to study fault geometry...... model, regional waveform data of the mainshock and larger aftershocks (M w  ≥3.3) were inverted for moment tensors. For the Baladeh mainshock, this included inversion for kinematic parameters. All analysed earthquakes show dominant thrust mechanisms at depths between 14 and 26 km, with NW–SE striking...

  4. 76 FR 50326 - Regional Rail, LLC-Continuance in Control Exemption-Tyburn Railroad, LLC

    Science.gov (United States)

    2011-08-12

    .... Regional is a Delaware limited liability company that currently controls 2 Class III railroads, East Penn... Company and operate approximately 0.9 miles of rail lines in Morrisville, Pa. The parties intend to...

  5. The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

    Directory of Open Access Journals (Sweden)

    Manqiong Yuan

    Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

  6. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  7. Atomic Layer Control of Thin Film Growth Using Binary Reaction Sequence Chemistry

    National Research Council Canada - National Science Library

    George, Steven

    1997-01-01

    Our research is focusing on the atomic layer control of thin film growth. Our goal is to deposit films with precise control of thickness and conformality on both flat and high aspect ratio structures...

  8. GWAS of DNA Methylation Variation Within Imprinting Control Regions Suggests Parent-of-Origin Association

    NARCIS (Netherlands)

    Renteria, M.E.; Coolen, M.W.; Statham, A.L.; Choi, R.S.; Qu, W.; Campbell, M.J.; Smith, S.; Henders, A.K.; Montgomery, G.W.; Clark, S. J.; Martin, N.G.; Medland, S.E.

    2013-01-01

    Imprinting control regions (ICRs) play a fundamental role in establishing and maintaining the non-random monoallelic expression of certain genes, via common regulatory elements such as non-coding RNAs and differentially methylated regions (DMRs) of DNA. We recently surveyed DNA methylation levels

  9. New information technologies in operative control of modes in regional electrical power systems

    OpenAIRE

    ANDREY D. TEVJASHEV; TATJANA B. TIMOFEEVA

    2003-01-01

    The problem of development of software for management of modes in electrical power systems in connection with casual character of a load in network is considered. The stochastic mathematical model of a system for operating control of modes in regional electrical power systems is offered. The methods for problem solving of operating control and operating planning of operational modes in regional electrical power systems are developed. The application of the developed models and methods will al...

  10. Determination of equivalent cross sections for representation of control rod regions in diffusion calculations

    International Nuclear Information System (INIS)

    Scherer, W.; Neef, H.J.

    1976-07-01

    The representation of control rod regions in reactor calculations requires a combination of transport and diffusion theory calculations. A method is described which produces equivalent cross sections for a rodded region. These cross sections used in a diffusion theory calcualtion yield the same rod efficiency and reaction rate distribution as the transport theory calculation for the explicit heterogeneous control rod. The description of the method is complemented by sample problems. (orig.) [de

  11. X-ray sources in regions of star formation. II. The pre-main-sequence G star HDE 283572

    International Nuclear Information System (INIS)

    Walter, F.M.; Brown, A.; Linsky, J.L.; Rydgren, A.E.; Vrba, F.; Joint Institute for Laboratory Astrophysics, Boulder, CO; Computer Sciences Corp., El Segundo, CA; Naval Observatory, Flagstaff, AZ)

    1987-01-01

    This paper reports the detection of HDE 283572, a ninth-magnitude G star 8 arcmin south of RY Tau, as a bright X-ray source. The observations reveal this object to be a fairly massive (about 2 solar masses) pre-main-sequence star associated with the Taurus-Auriga star formation complex. It exhibits few of the characteristics of the classical T Tauri stars and is a good example of a naked T Tauri star. The star is a mid-G subgiant, of about three solar radii and rotates with a period of 1.5 d. The coronal and chromospheric surface fluxes are similar to those of the most active late type stars (excluding T Tauri stars). The X-ray and UV lines most likely arise in different atmospheric structures. Radiative losses are some 1000 times the quiet solar value and compare favorably with those of T Tauri stars. 49 references

  12. Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

    Science.gov (United States)

    Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

    1993-11-01

    A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

  13. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  14. The mitochondrial DNA makeup of Romanians: A forensic mtDNA control region database and phylogenetic characterization.

    Science.gov (United States)

    Turchi, Chiara; Stanciu, Florin; Paselli, Giorgia; Buscemi, Loredana; Parson, Walther; Tagliabracci, Adriano

    2016-09-01

    To evaluate the pattern of Romanian population from a mitochondrial perspective and to establish an appropriate mtDNA forensic database, we generated a high-quality mtDNA control region dataset from 407 Romanian subjects belonging to four major historical regions: Moldavia, Transylvania, Wallachia and Dobruja. The entire control region (CR) was analyzed by Sanger-type sequencing assays and the resulting 306 different haplotypes were classified into haplogroups according to the most updated mtDNA phylogeny. The Romanian gene pool is mainly composed of West Eurasian lineages H (31.7%), U (12.8%), J (10.8%), R (10.1%), T (9.1%), N (8.1%), HV (5.4%),K (3.7%), HV0 (4.2%), with exceptions of East Asian haplogroup M (3.4%) and African haplogroup L (0.7%). The pattern of mtDNA variation observed in this study indicates that the mitochondrial DNA pool is geographically homogeneous across Romania and that the haplogroup composition reveals signals of admixture of populations of different origin. The PCA scatterplot supported this scenario, with Romania located in southeastern Europe area, close to Bulgaria and Hungary, and as a borderland with respect to east Mediterranean and other eastern European countries. High haplotype diversity (0.993) and nucleotide diversity indices (0.00838±0.00426), together with low random match probability (0.0087) suggest the usefulness of this control region dataset as a forensic database in routine forensic mtDNA analysis and in the investigation of maternal genetic lineages in the Romanian population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.

    Science.gov (United States)

    Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W

    2007-05-01

    Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

  16. Manipulating femtosecond spin-orbit torques with laser pulse sequences to control magnetic memory states and ringing

    Science.gov (United States)

    Lingos, P. C.; Wang, J.; Perakis, I. E.

    2015-05-01

    Femtosecond (fs) coherent control of collective order parameters is important for nonequilibrium phase dynamics in correlated materials. Here, we propose such control of ferromagnetic order based on using nonadiabatic optical manipulation of electron-hole (e -h ) photoexcitations to create fs carrier-spin pulses with controllable direction and time profile. These spin pulses are generated due to the time-reversal symmetry breaking arising from nonperturbative spin-orbit and magnetic exchange couplings of coherent photocarriers. By tuning the nonthermal populations of exchange-split, spin-orbit-coupled semiconductor band states, we can excite fs spin-orbit torques that control complex magnetization pathways between multiple magnetic memory states. We calculate the laser-induced fs magnetic anisotropy in the time domain by using density matrix equations of motion rather than the quasiequilibrium free energy. By comparing to pump-probe experiments, we identify a "sudden" out-of-plane magnetization canting displaying fs magnetic hysteresis, which agrees with switchings measured by the static Hall magnetoresistivity. This fs transverse spin-canting switches direction with magnetic state and laser frequency, which distinguishes it from the longitudinal nonlinear optical and demagnetization effects. We propose that sequences of clockwise or counterclockwise fs spin-orbit torques, photoexcited by shaping two-color laser-pulse sequences analogous to multidimensional nuclear magnetic resonance (NMR) spectroscopy, can be used to timely suppress or enhance magnetic ringing and switching rotation in magnetic memories.

  17. Fault-Tolerant Region-Based Control of an Underwater Vehicle with Kinematically Redundant Thrusters

    Directory of Open Access Journals (Sweden)

    Zool H. Ismail

    2014-01-01

    Full Text Available This paper presents a new control approach for an underwater vehicle with a kinematically redundant thruster system. This control scheme is derived based on a fault-tolerant decomposition for thruster force allocation and a region control scheme for the tracking objective. Given a redundant thruster system, that is, six or more pairs of thrusters are used, the proposed redundancy resolution and region control scheme determine the number of thruster faults, as well as providing the reference thruster forces in order to keep the underwater vehicle within the desired region. The stability of the presented control law is proven in the sense of a Lyapunov function. Numerical simulations are performed with an omnidirectional underwater vehicle and the results of the proposed scheme illustrate the effectiveness in terms of optimizing the thruster forces.

  18. Prehospital rapid sequence intubation improves functional outcome for patients with severe traumatic brain injury: a randomized controlled trial.

    Science.gov (United States)

    Bernard, Stephen A; Nguyen, Vina; Cameron, Peter; Masci, Kevin; Fitzgerald, Mark; Cooper, David J; Walker, Tony; Std, B Paramed; Myles, Paul; Murray, Lynne; David; Taylor; Smith, Karen; Patrick, Ian; Edington, John; Bacon, Andrew; Rosenfeld, Jeffrey V; Judson, Rodney

    2010-12-01

    To determine whether paramedic rapid sequence intubation in patients with severe traumatic brain injury (TBI) improves neurologic outcomes at 6 months compared with intubation in the hospital. Severe TBI is associated with a high rate of mortality and long-term morbidity. Comatose patients with TBI routinely undergo endo-tracheal intubation to protect the airway, prevent hypoxia, and control ventilation. In many places, paramedics perform intubation prior to hospital arrival. However, it is unknown whether this approach improves outcomes. In a prospective, randomized, controlled trial, we assigned adults with severe TBI in an urban setting to either prehospital rapid sequence intubation by paramedics or transport to a hospital emergency department for intubation by physicians. The primary outcome measure was the median extended Glasgow Outcome Scale (GOSe) score at 6 months. Secondary end-points were favorable versus unfavorable outcome at 6 months, length of intensive care and hospital stay, and survival to hospital discharge. A total of 312 patients with severe TBI were randomly assigned to paramedic rapid sequence intubation or hospital intubation. The success rate for paramedic intubation was 97%. At 6 months, the median GOSe score was 5 (interquartile range, 1-6) in patients intubated by paramedics compared with 3 (interquartile range, 1-6) in the patients intubated at hospital (P = 0.28).The proportion of patients with favorable outcome (GOSe, 5-8) was 80 of 157 patients (51%) in the paramedic intubation group compared with 56 of 142 patients (39%) in the hospital intubation group (risk ratio, 1.28; 95% confidence interval, 1.00-1.64; P = 0.046). There were no differences in intensive care or hospital length of stay, or in survival to hospital discharge. In adults with severe TBI, prehospital rapid sequence intubation by paramedics increases the rate of favorable neurologic outcome at 6 months compared with intubation in the hospital.

  19. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  20. Phylogenetic Analysis of a ?Jewel Orchid? Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    OpenAIRE

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal th...

  1. Sequence diversity of the C-terminal region of Plasmodium falciparum merozoite surface protein 1 in southern Iran.

    Science.gov (United States)

    Zamani, Zahra; Razavi, Mohammad Reza; Sadeghi, Sedigheh; Naddaf, Saeed; Pourfallah, Fatemeh; Mirkhani, Fatemeh; Arjmand, Mohammad; Feizhaddad, Hossein; Rad, Mina Ebrahimi; Ebrahimi Rad, Mina; Tameemi, Marzieh; Assmar, Mehdi

    2009-01-01

    The C-terminal region of the merozoite surface protein 1 (MSP-1) of Plasmodium falciparum is a strong vaccine candidate as it is associated with immunity to the parasite. This corresponds approximately to the conserved 17th block of the gene and is composed of two EGF- like domains. These domains exhibit only four single amino acid substitutions which show several potential variants in this region of the gene. As the variations might be important for a regional vaccine design, a study was carried out to determine the variations present in P. falciparum isolates from southern Iran. Besides the usual E-T-S-R-L and the Q-K-N-G-F types, we found Q-T-S-R-L, E-K-N-G-F, E-T-S-G-L, Z-T-S-G-L and Z-T-S-R-L types, where Z was E or Q signifying the presence of mixed clones in single isolates.

  2. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S.J.; Smith, T.J.; England, S.; Collins, F.; Davies, K.E.

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  3. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S J; Smith, T J; England, S; Collins, F; Davies, K E

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  4. Seismic sequence stratigraphy and platform to basin reservoir structuring of Lower Cretaceous deposits in the Sidi Aïch-Majoura region (Central Tunisia)

    Science.gov (United States)

    Azaïez, Hajer; Bédir, Mourad; Tanfous, Dorra; Soussi, Mohamed

    2007-05-01

    In central Tunisia, Lower Cretaceous deposits represent carbonate and sandstone reservoir series that correspond to proven oil fields. The main problems for hydrocarbon exploration of these levels are their basin tectonic configuration and their sequence distribution in addition to the source rock availability. The Central Atlas of Tunisia is characterized by deep seated faults directed northeast-southwest, northwest-southeast and north-south. These faults limit inherited tectonic blocks and show intruded Triassic salt domes. Lower Cretaceous series outcropping in the region along the anticline flanks present platform deposits. The seismic interpretation has followed the Exxon methodologies in the 26th A.A.P.G. Memoir. The defined Lower Cretaceous seismic units were calibrated with petroleum well data and tied to stratigraphic sequences established by outcrop studies. This allows the subsurface identification of subsiding zones and thus sequence deposit distribution. Seismic mapping of these units boundary shows a structuring from a platform to basin blocks zones and helps to understand the hydrocarbon reservoir systems-tract and horizon distribution around these domains.

  5. Chloroplast DNA analysis of Tunisian cork oak populations (Quercus suber L.): sequence variations and molecular evolution of the trnL (UAA)-trnF (GAA) region.

    Science.gov (United States)

    Abdessamad, A; Baraket, G; Sakka, H; Ammari, Y; Ksontini, M; Hannachi, A Salhi

    2016-10-24

    Sequences of the trnL-trnF spacer and combined trnL-trnF region in chloroplast DNA of cork oak (Quercus suber L.) were analyzed to detect polymorphisms and to elucidate molecular evolution and demographic history. The aligned sequences varied in length and nucleotide composition. The overall ratio of transition/transversion (ti/tv) of 0.724 for the intergenic spacer and 0.258 for the pooled sequences were estimated, and indicated that transversions are more frequent than transitions. The molecular evolution and demographic history of Q. suber were investigated. Neutrality tests (Tajima's D and Fu and Li) ruled out the null hypothesis of a strictly neutral model, and Fu's Fs and Ramos-Onsins and Rozas' R2 confirmed the recent expansion of cork oak trees, validating its persistency in North Africa since the last glaciation during the Quaternary. The observed uni-modal mismatch distribution and the Harpending's raggedness index confirmed the demographic history model for cork oak. A phylogenetic dendrogram showed that the distribution of Q. suber trees occurs independently of geographical origin, the relief of the population site, and the bioclimatic stages. The molecular history and cytoplasmic diversity suggest that in situ and ex situ conservation strategies can be recommended for preserving landscape value and facing predictable future climatic changes.

  6. Method and System for Controlling a Dexterous Robot Execution Sequence Using State Classification

    Science.gov (United States)

    Sanders, Adam M. (Inventor); Platt, Robert J., Jr. (Inventor); Quillin, Nathaniel (Inventor); Permenter, Frank Noble (Inventor); Pfeiffer, Joseph (Inventor)

    2014-01-01

    A robotic system includes a dexterous robot and a controller. The robot includes a plurality of robotic joints, actuators for moving the joints, and sensors for measuring a characteristic of the joints, and for transmitting the characteristics as sensor signals. The controller receives the sensor signals, and is configured for executing instructions from memory, classifying the sensor signals into distinct classes via the state classification module, monitoring a system state of the robot using the classes, and controlling the robot in the execution of alternative work tasks based on the system state. A method for controlling the robot in the above system includes receiving the signals via the controller, classifying the signals using the state classification module, monitoring the present system state of the robot using the classes, and controlling the robot in the execution of alternative work tasks based on the present system state.

  7. In situ optical sequencing and structure analysis of a trinucleotide repeat genome region by localization microscopy after specific COMBO-FISH nano-probing

    Science.gov (United States)

    Stuhlmüller, M.; Schwarz-Finsterle, J.; Fey, E.; Lux, J.; Bach, M.; Cremer, C.; Hinderhofer, K.; Hausmann, M.; Hildenbrand, G.

    2015-10-01

    Trinucleotide repeat expansions (like (CGG)n) of chromatin in the genome of cell nuclei can cause neurological disorders such as for example the Fragile-X syndrome. Until now the mechanisms are not clearly understood as to how these expansions develop during cell proliferation. Therefore in situ investigations of chromatin structures on the nanoscale are required to better understand supra-molecular mechanisms on the single cell level. By super-resolution localization microscopy (Spectral Position Determination Microscopy; SPDM) in combination with nano-probing using COMBO-FISH (COMBinatorial Oligonucleotide FISH), novel insights into the nano-architecture of the genome will become possible. The native spatial structure of trinucleotide repeat expansion genome regions was analysed and optical sequencing of repetitive units was performed within 3D-conserved nuclei using SPDM after COMBO-FISH. We analysed a (CGG)n-expansion region inside the 5' untranslated region of the FMR1 gene. The number of CGG repeats for a full mutation causing the Fragile-X syndrome was found and also verified by Southern blot. The FMR1 promotor region was similarly condensed like a centromeric region whereas the arrangement of the probes labelling the expansion region seemed to indicate a loop-like nano-structure. These results for the first time demonstrate that in situ chromatin structure measurements on the nanoscale are feasible. Due to further methodological progress it will become possible to estimate the state of trinucleotide repeat mutations in detail and to determine the associated chromatin strand structural changes on the single cell level. In general, the application of the described approach to any genome region will lead to new insights into genome nano-architecture and open new avenues for understanding mechanisms and their relevance in the development of heredity diseases.

  8. Possible conservation units of the sun bear (Helarctos malayanus) in Sarawak based on variation of mtDNA control region.

    Science.gov (United States)

    Onuma, Manabu; Suzuki, Masatsugu; Ohtaishi, Noriyuki

    2006-11-01

    The mitochondrial DNA control region of the sun bear (Helarctos malayanus) was sequenced using 21 DNA samples collected from confiscated sun bears to identify conservation units, such as evolutionarily significant units and management units, in Sarawak, Borneo Island. A total of 10 haplotypes were observed, indicating the presence of at least two lineages in the sun bear population in Sarawak. Presumably, these two lineages could represent evolutionarily significant units. However, the geographical distributions of the two lineages remained unknown due to the lack of information regarding the exact capture locations of the confiscated sun bears. It is essential to elucidate the geographical distributions of these lineages in order to create a proper conservation plan for the sun bears in Sarawak. Therefore, further studies examining the haplotype distributions using DNA samples from known localities are essential.

  9. Velo-Cardio-Facial syndrome and DiGeorge sequence with meningomyelocele and deletions of the 22q11 region

    Energy Technology Data Exchange (ETDEWEB)

    Nickel, R.E.; Pillers, D.M.; Merkens, M.; Magenis, R.E.; Zonana, J. [Oregon Health Sciences Univ., Portland, OR (United States); Driscoll, D.A.; Emanuel, B.S. [Univ. of Pennsylvania Medical Center, Philadelphia, PA (United States)

    1994-10-01

    Approximately 5% of children with neural tube defects (NTDs) have a congenital heart defect and/or cleft lip and palate. The cause of isolated meningomyelocele, congenital heart defects, or cleft lip and palate has been largely thought to be multifactorial. However, chromosomal, teratogenic, and single gene causes of combinations of NTDs with congenital heart defects and/or cleft lip and palate have been reported. We report on 3 patients with meningomyelocele, congenital heart defects, and 22q11 deletions. Two of the children had the clinical diagnosis of velo-cardio-facial syndrome (VCFS); both have bifid uvula. The third child had DiGeorge sequence (DGS). The association of NTDs with 22q11 deletion has not been reported previously. An accurate diagnosis of the 22q11 deletion is critical as this micro-deletion and its associated clinical problems is transmitted as an autosomal dominant trait due to the inheritance of the deletion-bearing chromosome. We recommend that all children with NTDs and congenital heart defects, with or without cleft palate, have cytogenetic and molecular studies performed to detect 22q11 deletions. 31 refs., 3 figs.

  10. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. The parental non-equivalence of imprinting control regions during mammalian development and evolution.

    Directory of Open Access Journals (Sweden)

    Reiner Schulz

    2010-11-01

    Full Text Available In mammals, imprinted gene expression results from the sex-specific methylation of imprinted control regions (ICRs in the parental germlines. Imprinting is linked to therian reproduction, that is, the placenta and imprinting emerged at roughly the same time and potentially co-evolved. We assessed the transcriptome-wide and ontology effect of maternally versus paternally methylated ICRs at the developmental stage of setting of the chorioallantoic placenta in the mouse (8.5dpc, using two models of imprinting deficiency including completely imprint-free embryos. Paternal and maternal imprints have a similar quantitative impact on the embryonic transcriptome. However, transcriptional effects of maternal ICRs are qualitatively focused on the fetal-maternal interface, while paternal ICRs weakly affect non-convergent biological processes, with little consequence for viability at 8.5dpc. Moreover, genes regulated by maternal ICRs indirectly influence genes regulated by paternal ICRs, while the reverse is not observed. The functional dominance of maternal imprints over early embryonic development is potentially linked to selection pressures favoring methylation-dependent control of maternal over paternal ICRs. We previously hypothesized that the different methylation histories of ICRs in the maternal versus the paternal germlines may have put paternal ICRs under higher mutational pressure to lose CpGs by deamination. Using comparative genomics of 17 extant mammalian species, we show here that, while ICRs in general have been constrained to maintain more CpGs than non-imprinted sequences, the rate of CpG loss at paternal ICRs has indeed been higher than at maternal ICRs during evolution. In fact, maternal ICRs, which have the characteristics of CpG-rich promoters, have gained CpGs compared to non-imprinted CpG-rich promoters. Thus, the numerical and, during early embryonic development, functional dominance of maternal ICRs can be explained as the

  12. The parental non-equivalence of imprinting control regions during mammalian development and evolution.

    Science.gov (United States)

    Schulz, Reiner; Proudhon, Charlotte; Bestor, Timothy H; Woodfine, Kathryn; Lin, Chyuan-Sheng; Lin, Shau-Ping; Prissette, Marine; Oakey, Rebecca J; Bourc'his, Déborah

    2010-11-18

    In mammals, imprinted gene expression results from the sex-specific methylation of imprinted control regions (ICRs) in the parental germlines. Imprinting is linked to therian reproduction, that is, the placenta and imprinting emerged at roughly the same time and potentially co-evolved. We assessed the transcriptome-wide and ontology effect of maternally versus paternally methylated ICRs at the developmental stage of setting of the chorioallantoic placenta in the mouse (8.5dpc), using two models of imprinting deficiency including completely imprint-free embryos. Paternal and maternal imprints have a similar quantitative impact on the embryonic transcriptome. However, transcriptional effects of maternal ICRs are qualitatively focused on the fetal-maternal interface, while paternal ICRs weakly affect non-convergent biological processes, with little consequence for viability at 8.5dpc. Moreover, genes regulated by maternal ICRs indirectly influence genes regulated by paternal ICRs, while the reverse is not observed. The functional dominance of maternal imprints over early embryonic development is potentially linked to selection pressures favoring methylation-dependent control of maternal over paternal ICRs. We previously hypothesized that the different methylation histories of ICRs in the maternal versus the paternal germlines may have put paternal ICRs under higher mutational pressure to lose CpGs by deamination. Using comparative genomics of 17 extant mammalian species, we show here that, while ICRs in general have been constrained to maintain more CpGs than non-imprinted sequences, the rate of CpG loss at paternal ICRs has indeed been higher than at maternal ICRs during evolution. In fact, maternal ICRs, which have the characteristics of CpG-rich promoters, have gained CpGs compared to non-imprinted CpG-rich promoters. Thus, the numerical and, during early embryonic development, functional dominance of maternal ICRs can be explained as the consequence of two

  13. Pollution control in pulp and paper industrial effluents using integrated chemical-biological treatment sequences.

    Science.gov (United States)

    El-Bestawy, Ebtesam; El-Sokkary, Ibrahim; Hussein, Hany; Keela, Alaa Farouk Abu

    2008-11-01

    The main objective of the present study was to improve the quality of pulp and paper industrial wastewater of two local mills RAKTA and El-Ahlia, Alexandria, Egypt, and to bring their pollutant contents to safe discharge levels. Quality improvement was carried out using integrated chemical and biological treatment approaches after their optimization. Chemical treatment (alum, lime, and ferric chloride) was followed by oxidation using hydrogen peroxide and finally biological treatment using activated sludge (90 min for RAKTA and 60 min for El-Ahlia effluents). Chemical coagulation produced low-quality effluents, while pH adjustment during coagulation treatment did not enhance the quality of the effluents. Maximum removal of the tested pollutants was achieved using the integrated treatment and the pollutants recorded residual concentrations (RCs) of 34.67, 17.33, 0.13, and 0.43 mg/l and 15.0, 11.0, 0.0, and 0.13 mg/l for chemical oxygen demand (COD), biochemical oxygen demand (BOD5), tannin and lignin, and silica in RAKTA and El-Ahlia effluents, respectively, all of which were below their maximum permissible limits (MPLs) for the safe discharge into water courses. Specific oxygen uptake rate (SOUR) and sludge volume index (SVI) values reflect good conditions and healthy activated sludge. Based on the previous results, optimized conditions were applied as bench scale on the raw effluents of RAKTA and El-Ahlia via the batch chemical and the biological treatment sequences proposed. For RAKTA effluents, the sequence was as follows: (1) coagulation with 375 mg/l FeCl3, (2) oxidation with 50 mg/l hydrogen peroxide, and (3) biological treatment using activated sludge with 2,000 mg/l initial concentration and 90 min hydraulic retention time (HRT), while for El-Ahlia raw effluents, the sequence was (1) coagulation with 250 mg/l FeCl3, (2) oxidation with 45 mg/l hydrogen peroxide, and (3) biological treatment using activated sludge with 2,000 mg/l initial concentration and 60

  14. Using the SIMGRO regional hydrological model to evaluate salinity control measures in an irrigation area

    NARCIS (Netherlands)

    Kupper, E.; Querner, E.P.; Morábito, J.A.; Menenti, M.

    2002-01-01

    In irrigated areas with drainage and an important interaction with the groundwater system, it is often difficult to predict effects of measures to control salinity. Therefore, in order to evaluate measures to control salinity the SIMGRO integrated regional hydrological model was extended with a

  15. Unmanned Water Craft Identification and Adaptive Control in Low-Speed and Reversing Regions

    DEFF Research Database (Denmark)

    Theisen, Lukas Roy Svane; Galeazzi, Roberto; Blanke, Mogens

    2013-01-01

    This paper treats L1 adaptive hovering control of an unmanned surface vehicle in a station-keeping mode where a region of zero control authority and under-actuation are main challenges. Low-speed and reversing dynamics are identied from full scale sea trials, and parameter uncertainty is estimate...

  16. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  17. Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin.

    Science.gov (United States)

    Roy, M; Lee, R W; Kaarsholm, N C; Thøgersen, H; Brange, J; Dunn, M F

    1990-06-12

    The aromatic region of the 1H-FT-NMR spectrum of the biologically fully-potent, monomeric human insulin mutant, B9 Ser----Asp, B27 Thr----Glu has been investigated in D2O. At 1 to 5 mM concentrations, this mutant insulin is monomeric above pH 7.5. Coupling and amino acid classification of all aromatic signals is established via a combination of homonuclear one- and two-dimensional methods, including COSY, multiple quantum filters, selective spin decoupling and pH titrations. By comparisons with other insulin mutants and with chemically modified native insulins, all resonances in the aromatic region are given sequence-specific assignments without any reliance on the various crystal structures reported for insulin. These comparisons also give the sequence-specific assignments of most of the aromatic resonances of the mutant insulins B16 Tyr----Glu, B27 Thr----Glu and B25 Phe----Asp and the chemically modified species des-(B23-B30) insulin and monoiodo-Tyr A14 insulin. Chemical dispersion of the assigned resonances, ring current perturbations and comparisons at high pH have made possible the assignment of the aromatic resonances of human insulin, and these studies indicate that the major structural features of the human insulin monomer (including those critical to biological function) are also present in the monomeric mutant.

  18. Independent Control of Positive- and Negative-Sequence Current Components in a Doubly Fed Machine

    Czech Academy of Sciences Publication Activity Database

    Bendl, Jiří; Chomát, Miroslav; Schreier, Luděk

    2005-01-01

    Roč. 15, č. 3 (2005), s. 191-202 ISSN 1430-144X R&D Projects: GA ČR(CZ) GA102/03/0046 Institutional research plan: CEZ:AV0Z20570509 Keywords : vector control * adjustable speed generation systems * converter control Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.056, year: 2005

  19. Phylogenetic and Genetic Analysis of D-loop and Cyt-b Region of mtDNA Sequence in Iranian Sistani, Sarabi and Brown Swiss Cows

    Directory of Open Access Journals (Sweden)

    reza valizadeh

    2016-06-01

    Full Text Available Cattle have an important role in primary human civilization, so molecular studies for more accurate recognition of their origin are effective to identify unknown historical aspects. Cattle can be divided in to 2 main groups including Bos Tuarus and Bos Indicus. Both types of cattle can be found in Iran; therefore study of their origin has particular importance. The aim of this study was to investigate the nucleotide sequences of Cytochrome-b (Cyt-b and HVR1&2 loci of D-loop gene region in mitochondrial DNA of Sistani, Sarabi and Brown Swiss breeds of cattle. Twenty blood samples of each breed, from non-relative individuals were obtained from blood bank of animal science department of Faculty of Agriculture, Ferdowsi University of Mashhad. The DNA content of sample was extracted based on the guanidinium thiocianate-silicagel method. Polymerase Chain Reaction with specific designed primers was performed to amplify Cyt-b and HVR 1&2 loci with 751 and 701 bp lengths, respectively. Sequencing of amplified Cyt-b and HVR 1&2 loci were done based on Sanger method by automatic sequencer machine (ABI 3130. Nucleotide diversity in Brown Swiss, Sarabi and Sistani breeds were estimated 0.0037, 0.0024 and 0.0029, respectively. Sequences of Cyt-b and HVR 1&2 were register in National Center for Biotechnology Institute due to nucleotide differences. Results of phylogenetic test using UPGMA for both loci showed that Sarabi and Sistani breeds are belonging to first group and Brown Swiss breed to other group.

  20. Color differences among feral pigeons (Columba livia) are not attributable to sequence variation in the coding region of the melanocortin-1 receptor gene (MC1R)

    Science.gov (United States)

    2013-01-01

    Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680

  1. Using regional moment tensors to constrain the kinematics and stress evolution of the 2010–2013 Canterbury earthquake sequence, South Island, New Zealand

    Science.gov (United States)

    Herman, Matthew W.; Herrmann, Robert B.; Benz, Harley M.; Furlong, Kevin P.

    2014-01-01

    On September 3, 2010, a MW 7.0 (U.S. Geological Survey moment magnitude) earthquake ruptured across the Canterbury Plains in South Island, New Zealand. Since then, New Zealand GNS Science has recorded over 10,000 aftershocks ML 2.0 and larger, including three destructive ~ MW 6.0 earthquakes near Christchurch. We treat the Canterbury earthquake sequence as an intraplate earthquake sequence, and compare its kinematics to an Andersonian model for fault slip in a uniform stress field. We determined moment magnitudes and double couple solutions for 150 earthquakes having MW 3.7 and larger through the use of a waveform inversion technique using data from broadband seismic stations on South Island, New Zealand. The majority (126) of these double couple solutions have strike-slip focal mechanisms, with right-lateral slip on ENE fault planes or equivalently left-lateral slip on SSE fault planes. The remaining focal mechanisms indicate reverse faulting, except for two normal faulting events. The strike-slip segments have compatible orientations for slip in a stress field with a horizontal σ1 oriented ~ N115°E, and horizontal σ3. The preference for right lateral strike-slip earthquakes suggests that these structures are inherited from previous stages of deformation. Reverse slip is interpreted to have occurred on previously existing structures in regions with an absence of existing structures optimally oriented for strike-slip deformation. Despite the variations in slip direction and faulting style, most aftershocks had nearly the same P-axis orientation, consistent with the regional σ1. There is no evidence for significant changes in these stress orientations throughout the Canterbury earthquake sequence.

  2. Method for improving accident sequence recognition in nuclear power plant control rooms

    International Nuclear Information System (INIS)

    Heising, C.D.; Dinsmore, S.C.

    1983-01-01

    This work adapts fault trees from plant-specific probabilistic risk analyses (PRAs) to construct and quantitatively evaluate an alarm analysis system for the engineered safety features (ESFs). The purpose is to help improve reactor operator recognition and identification of potential accident sequences. The PRA system fault trees provide system failure mode information which can be used to construct alarm trees. These alarm trees provide a framework for assessing the plant indicators so that the plant conditions are made more readily apparent to plant personnel. In the alarm tree, possible states of each instrumented alarem are identified as true or false. In addition, a warning status is defined and integrated into an alarm analysis routine. The impact of this additional status conditioned on the Boolean laws used to evaluate the alarm trees is examined. An application is described for BWR high pressure coolant injection system (HPCI) that would be utilized during many severe reactor accidents

  3. Video Enhancement and Dynamic Range Control of HDR Sequences for Automotive Applications

    Directory of Open Access Journals (Sweden)

    Giovanni Ramponi

    2007-01-01

    Full Text Available CMOS video cameras with high dynamic range (HDR output are particularly suitable for driving assistance applications, where lighting conditions can strongly vary, going from direct sunlight to dark areas in tunnels. However, common visualization devices can only handle a low dynamic range, and thus a dynamic range reduction is needed. Many algorithms have been proposed in the literature to reduce the dynamic range of still pictures. Anyway, extending the available methods to video is not straightforward, due to the peculiar nature of video data. We propose an algorithm for both reducing the dynamic range of video sequences and enhancing its appearance, thus improving visual quality and reducing temporal artifacts. We also provide an optimized version of our algorithm for a viable hardware implementation on an FPGA. The feasibility of this implementation is demonstrated by means of a case study.

  4. Adaptive Control of a Utility-Scale Wind Turbine Operating in Region 3

    Science.gov (United States)

    Frost, Susan A.; Balas, Mark J.; Wright, Alan D.

    2009-01-01

    Adaptive control techniques are well suited to nonlinear applications, such as wind turbines, which are difficult to accurately model and which have effects from poorly known operating environments. The turbulent and unpredictable conditions in which wind turbines operate create many challenges for their operation. In this paper, we design an adaptive collective pitch controller for a high-fidelity simulation of a utility scale, variable-speed horizontal axis wind turbine. The objective of the adaptive pitch controller in Region 3 is to regulate generator speed and reject step disturbances. The control objective is accomplished by collectively pitching the turbine blades. We use an extension of the Direct Model Reference Adaptive Control (DMRAC) approach to track a reference point and to reject persistent disturbances. The turbine simulation models the Controls Advanced Research Turbine (CART) of the National Renewable Energy Laboratory in Golden, Colorado. The CART is a utility-scale wind turbine which has a well-developed and extensively verified simulator. The adaptive collective pitch controller for Region 3 was compared in simulations with a bas celliansesical Proportional Integrator (PI) collective pitch controller. In the simulations, the adaptive pitch controller showed improved speed regulation in Region 3 when compared with the baseline PI pitch controller and it demonstrated robustness to modeling errors.

  5. Regulatory sequence of cupin family gene

    Science.gov (United States)

    Hood, Elizabeth; Teoh, Thomas

    2017-07-25

    This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

  6. Optimal control and optimal trajectories of regional macroeconomic dynamics based on the Pontryagin maximum principle

    Science.gov (United States)

    Bulgakov, V. K.; Strigunov, V. V.

    2009-05-01

    The Pontryagin maximum principle is used to prove a theorem concerning optimal control in regional macroeconomics. A boundary value problem for optimal trajectories of the state and adjoint variables is formulated, and optimal curves are analyzed. An algorithm is proposed for solving the boundary value problem of optimal control. The performance of the algorithm is demonstrated by computing an optimal control and the corresponding optimal trajectories.

  7. Persistence of Mycoplasma hyopneumoniae sequence types in spite of a control program for enzootic pneumonia in pigs.

    Science.gov (United States)

    Overesch, Gudrun; Kuhnert, Peter

    2017-09-15

    Enzootic pneumonia (EP) in pigs caused by Mycoplasma (M.) hyopneumoniae has successfully been combatted in Switzerland. A control program was fully implemented in 2004 which is based on total depopulation strategies of affected fattening farms as well as partial depopulation on breeding farms. Thereby, the number of cases has dropped drastically from more than 200 in 2003 to two cases in 2013. Currently monitoring is done based on clinical observation and subsequent diagnostic of coughing pigs. Moreover, in case of more than 10% gross pathological lesions per slaughter batch laboratory confirmation for EP is compulsory. Despite these strict measures it was not possible to eliminate M. hyopneumoniae from Swiss pig production. In fact, during the last few years the number of EP cases has slightly increased. Therefore, genotyping of the involved M. hyopneumoniae strains was conducted in order to elucidate possible sources and routes of infection. All available and typeable samples from totally 22 cases during the period 2014-2016 were investigated by extended multilocus sequence typing (MLST). A total of 16 cases, including eight from 2014, five from 2015 and three from 2016 could thereby be included in the study. MLST revealed that the majority of cases in 2014/2015 were due to two major spread scenarios, i.e. two M. hyopneumoniae sequence types, each scenario involving six individual production farms in five to six different Cantons (states), respectively. Moreover, by comparison of archived sequences some sequence types were observed over ten years demonstrating their persistence over a long time and the possible partial failure of elimination measures in Switzerland. Insufficient sanitation on affected farms and subsequent animal transport of symptomless infected pigs could lead to recurrent cases. Wild boar harbor identical strains found with EP but solid data are missing to assign a role as reservoir to this wild animal. Implementing a monitoring scheme for M

  8. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  9. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Directory of Open Access Journals (Sweden)

    Chao Hu

    Full Text Available A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae based on the nuclear ribosomal internal transcribed spacer (ITS region and two chloroplast loci (matK and trnL-F was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1 Goodyera is not monophyletic; 2 Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3 sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  10. Second Order Sliding Mode Control Scheme for an Autonomous Underwater Vehicle with Dynamic Region Concept

    Directory of Open Access Journals (Sweden)

    Zool H. Ismail

    2015-01-01

    Full Text Available The main goal in developing closed loop control system for an Autonomous Underwater Vehicle (AUV is to make a robust vehicle from natural and exogenous perturbations such as wind, wave, and ocean currents. However a well-known robust control, for instance, Sliding Mode Controller (SMC, gives a chattering effect and it influences the stability of an AUV. Furthermore, some researchers combined other controls to get better result but it tends to present long computational time and causes large energy consumption. Thus, this paper proposed a Super Twisting Sliding Mode Controller (STSMC with dynamic region concept for an AUV. STSMC or a second order SMC is adopted as a robust controller which is free from chattering effect. Meanwhile, the implementation of dynamic region is useful to reduce the energy usage. As a result, the proposed controller obtains global asymptotic stability which is validated by using Lyapunov-like function. Moreover, some simulations present the efficiency of proposed controller. In conclusion, STSMC with region based control is effective to be applied for the robust tracking of an AUV. It contributes to give a fast response when handling the perturbations, short computational time, and low energy demand.

  11. Time Sequence Spectroscopy of AW UMa. The 518 nm Mg i Triplet Region Analyzed With Broadening Functions

    Science.gov (United States)

    Rucinski, Slavek M.

    2015-02-01

    High-resolution spectroscopic observations of AW UMa, obtained on three consecutive nights with a median time resolution of 2.1 minutes, have been analyzed using the broadening function method in the spectral window of 22.75 nm around the 518 nm Mg i triplet region. Doppler images of the system reveal the presence of vigorous mass motions within the binary system; their presence puts into question the solid-body rotation assumption of the contact binary model. AW UMa appears to be a very tight, semi-detached binary; the mass transfer takes place from the more massive to the less massive component. The primary, a fast-rotating star with Vsin i=181.4+/- 2.5 km s-1, is covered with inhomogeneities: very slowly drifting spots and a dense network of ripples more closely participating in its rotation. The spectral lines of the primary show an additional broadening component (called the “pedestal”) that originates either in the equatorial regions, which rotate faster than the rest of the star by about 50 km s-1, or in an external disk-like structure. The secondary component appears to be smaller than predicted by the contact model. The radial velocity field around the secondary is dominated by accretion of matter transferred from (and possibly partly returned to) the primary component. The parameters of the binary are Asin i=2.73+/- 0.11 {{R}⊙ } and {{M}1}{{sin }3}i=1.29+/- 0.15 {{M}⊙ }, {{M}2}{{sin }3}i=0.128+/- 0.016 {{M}⊙ }. The mass ratio, {{q}sp}={{M}2}/{{M}1}=0.099+/- 0.003, while still the most uncertain among the spectroscopic elements, is substantially different from the previous numerous and mutually consistent photometric investigations which were based on the contact model. It should be studied why photometry and spectroscopy give such discrepant results and whether AW UMa is an unusual object or if only very high-quality spectroscopy can reveal the true nature of W UMa-type binaries. Based on observations obtained at the Canada

  12. Time sequence spectroscopy of AW UMa. The 518 nm Mg I triplet region analyzed with broadening functions

    International Nuclear Information System (INIS)

    Rucinski, Slavek M.

    2015-01-01

    High-resolution spectroscopic observations of AW UMa, obtained on three consecutive nights with a median time resolution of 2.1 minutes, have been analyzed using the broadening function method in the spectral window of 22.75 nm around the 518 nm Mg i triplet region. Doppler images of the system reveal the presence of vigorous mass motions within the binary system; their presence puts into question the solid-body rotation assumption of the contact binary model. AW UMa appears to be a very tight, semi-detached binary; the mass transfer takes place from the more massive to the less massive component. The primary, a fast-rotating star with Vsini=181.4±2.5 km s −1 , is covered with inhomogeneities: very slowly drifting spots and a dense network of ripples more closely participating in its rotation. The spectral lines of the primary show an additional broadening component (called the “pedestal”) that originates either in the equatorial regions, which rotate faster than the rest of the star by about 50 km s −1 , or in an external disk-like structure. The secondary component appears to be smaller than predicted by the contact model. The radial velocity field around the secondary is dominated by accretion of matter transferred from (and possibly partly returned to) the primary component. The parameters of the binary are Asini=2.73±0.11 R ⊙ and M 1 sin 3 i=1.29±0.15 M ⊙ , M 2 sin 3 i=0.128±0.016 M ⊙ . The mass ratio, q sp =M 2 /M 1 =0.099±0.003, while still the most uncertain among the spectroscopic elements, is substantially different from the previous numerous and mutually consistent photometric investigations which were based on the contact model. It should be studied why photometry and spectroscopy give such discrepant results and whether AW UMa is an unusual object or if only very high-quality spectroscopy can reveal the true nature of W UMa-type binaries.

  13. European external quality control study on the competence of laboratories to recognize rare sequence variants resulting in unusual genotyping results.

    Science.gov (United States)

    Márki-Zay, János; Klein, Christoph L; Gancberg, David; Schimmel, Heinz G; Dux, László

    2009-04-01

    Depending on the method used, rare sequence variants adjacent to the single nucleotide polymorphism (SNP) of interest may cause unusual or erroneous genotyping results. Because such rare variants are known for many genes commonly tested in diagnostic laboratories, we organized a proficiency study to assess their influence on the accuracy of reported laboratory results. Four external quality control materials were processed and sent to 283 laboratories through 3 EQA organizers for analysis of the prothrombin 20210G>A mutation. Two of these quality control materials contained sequence variants introduced by site-directed mutagenesis. One hundred eighty-nine laboratories participated in the study. When samples gave a usual result with the method applied, the error rate was 5.1%. Detailed analysis showed that more than 70% of the failures were reported from only 9 laboratories. Allele-specific amplification-based PCR had a much higher error rate than other methods (18.3% vs 2.9%). The variants 20209C>T and [20175T>G; 20179_20180delAC] resulted in unusual genotyping results in 67 and 85 laboratories, respectively. Eighty-three (54.6%) of these unusual results were not recognized, 32 (21.1%) were attributed to technical issues, and only 37 (24.3%) were recognized as another sequence variant. Our findings revealed that some of the participating laboratories were not able to recognize and correctly interpret unusual genotyping results caused by rare SNPs. Our study indicates that the majority of the failures could be avoided by improved training and careful selection and validation of the methods applied.

  14. LPV Control for the Full Region Operation of a Wind Turbine Integrated with Synchronous Generator

    Science.gov (United States)

    Grigoriadis, Karolos M.; Nyanteh, Yaw D.

    2015-01-01

    Wind turbine conversion systems require feedback control to achieve reliable wind turbine operation and stable current supply. A robust linear parameter varying (LPV) controller is proposed to reduce the structural loads and improve the power extraction of a horizontal axis wind turbine operating in both the partial load and the full load regions. The LPV model is derived from the wind turbine state space models extracted by FAST (fatigue, aerodynamics, structural, and turbulence) code linearization at different operating points. In order to assure a smooth transition between the two regions, appropriate frequency-dependent varying scaling parametric weighting functions are designed in the LPV control structure. The solution of a set of linear matrix inequalities (LMIs) leads to the LPV controller. A synchronous generator model is connected with the closed LPV control loop for examining the electrical subsystem performance obtained by an inner speed control loop. Simulation results of a 1.5 MW horizontal axis wind turbine model on the FAST platform illustrates the benefit of the LPV control and demonstrates the advantages of this proposed LPV controller, when compared with a traditional gain scheduling PI control and prior LPV control configurations. Enhanced structural load mitigation, improved power extraction, and good current performance were obtained from the proposed LPV control. PMID:25884036

  15. LPV Control for the Full Region Operation of a Wind Turbine Integrated with Synchronous Generator

    Directory of Open Access Journals (Sweden)

    Guoyan Cao

    2015-01-01

    Full Text Available Wind turbine conversion systems require feedback control to achieve reliable wind turbine operation and stable current supply. A robust linear parameter varying (LPV controller is proposed to reduce the structural loads and improve the power extraction of a horizontal axis wind turbine operating in both the partial load and the full load regions. The LPV model is derived from the wind turbine state space models extracted by FAST (fatigue, aerodynamics, structural, and turbulence code linearization at different operating points. In order to assure a smooth transition between the two regions, appropriate frequency-dependent varying scaling parametric weighting functions are designed in the LPV control structure. The solution of a set of linear matrix inequalities (LMIs leads to the LPV controller. A synchronous generator model is connected with the closed LPV control loop for examining the electrical subsystem performance obtained by an inner speed control loop. Simulation results of a 1.5 MW horizontal axis wind turbine model on the FAST platform illustrates the benefit of the LPV control and demonstrates the advantages of this proposed LPV controller, when compared with a traditional gain scheduling PI control and prior LPV control configurations. Enhanced structural load mitigation, improved power extraction, and good current performance were obtained from the proposed LPV control.

  16. Development and Evaluation of a Control System for Regional Traffic Management

    Directory of Open Access Journals (Sweden)

    John L. McLin

    2011-01-01

    Full Text Available Traffic congestion is a worsening problem in metropolitan areas which will require integrated regional traffic control systems to improve traffic conditions. This paper presents a regional traffic control system which can detect incident conditions and provide integrated traffic management during nonrecurrent congestion events. The system combines advanced artificial intelligence techniques with a traffic performance model based on HCM equations. Preliminary evaluation of the control system using traffic microsimulation demonstrates that it has the potential to improve system conditions during traffic incidents. In addition, several enhancements were identified which will make the system more robust in a real traffic control setting. An assessment of the control system elements indicates that there are no substantial technical barriers in implementing this system in a large traffic network.

  17. Reflections on the Anopheles gambiae genome sequence, transgenic mosquitoes and the prospect for controlling malaria and other vector borne diseases.

    Science.gov (United States)

    Tabachnick, Walter J

    2003-09-01

    The completion of the Anopheles gambiae Giles genome sequencing project is a milestone toward developing more effective strategies in reducing the impact of malaria and other vector borne diseases. The successes in developing transgenic approaches using mosquitoes have provided another essential new tool for further progress in basic vector genetics and the goal of disease control. The use of transgenic approaches to develop refractory mosquitoes is also possible. The ability to use genome sequence to identify genes, and transgenic approaches to construct refractory mosquitoes, has provided the opportunity that with the future development of an appropriate genetic drive system, refractory transgenes can be released into vector populations leading to nontransmitting mosquitoes. An. gambiae populations incapable of transmitting malaria. This compelling strategy will be very difficult to achieve and will require a broad substantial research program for success. The fundamental information that is required on genome structure, gene function and environmental effects on genetic expression are largely unknown. The ability to predict gene effects on phenotype is rudimentary, particularly in natural populations. As a result, the release of a refractory transgene into natural mosquito populations is imprecise and there is little ability to predict unintended consequences. The new genetic tools at hand provide opportunities to address an array of important issues, many of which can have immediate impact on the effectiveness of a host of strategies to control vector borne disease. Transgenic release approaches represent only one strategy that should be pursued. A balanced research program is required.

  18. Synchronization and sequencing of data acquisition and control electronics at the European X-ray free electron laser

    International Nuclear Information System (INIS)

    Gessler, Patrick

    2015-11-01

    The 3.5 km long European X-Ray Free Electron Laser, currently under construction in northern Germany, will deliver bursts of up to 2700 short X-ray pulses every 100 ms, providing wavelengths between 0.05 and 6 nm, and a repetition rate of 4.5 MHz to several experiment stations. It allows in-depth research in various scientific fields. In order to set-up the beam, position samples and capture the measured variables, information from the accelerator, diagnostic devices and detectors have to be digitized, converted, processed, transferred, concentrated, distributed, reorganized, controlled and saved. All these steps have to be accurately synchronized and sequenced relative to the actual electron bunch or photon pulse in order to guarantee correct data acquisition timings and unique identification of each bunch passing the beamlines. This document provides a complete description of the planning, design, realization and evaluation of the European XFEL Timing System, which implements the synchronization and sequencing of the data acquisition and control electronics for the European X-Ray Free-Electron Laser Facility.

  19. Genome sequence of foot-and-mouth disease virus outside the 3A region is also responsible for virus replication in bovine cells.

    Science.gov (United States)

    Ma, Xueqing; Li, Pinghua; Sun, Pu; Lu, Zengjun; Bao, Huifang; Bai, Xingwen; Fu, Yuanfang; Cao, Yimei; Li, Dong; Chen, Yingli; Qiao, Zilin; Liu, Zaixin

    2016-07-15

    The deletion of residues 93-102 in non-structure protein 3A of foot-and-mouth disease virus (FMDV) is associated with the inability of FMDV to grow in bovine cells and attenuated virulence in cattle.Whereas, a previously reported FMDV strain O/HKN/21/70 harboring 93-102 deletion in 3A protein grew equally well in bovine and swine cells. This suggests that changes inFMDV genome sequence, in addition to 93-102 deletion in 3A, may also affectthe viral growth phenotype in bovine cellsduring infection and replication.However, it is nuclear that changes in which region (inside or outside of 3A region) influences FMDV growth phenotype in bovine cells.In this study, to determine the region in FMDV genomeaffecting viral growth phenotype in bovine cells, we constructed chimeric FMDVs, rvGZSB-HKN3A and rvHN-HKN3A, by introducing the 3A coding region of O/HKN/21/70 into the context of O/SEA/Mya-98 strain O/GZSB/2011 and O Cathay topotype strain O/HN/CHA/93, respectively, since O/GZSB/2011 containing full-length 3A protein replicated well in bovine and swine cells, and O/HN/CHA/93 harboring 93-102 deletion in 3A protein grew poorly in bovine cells.The chimeric virusesrvGZSB-HKN3A and rvHN-HKN3A displayed growth properties and plaque phenotypes similar to those of the parental virus rvGZSB and rv-HN in BHK-21 and primary fetal porcine kidney (FPK) cells. However, rvHN-HKN3A and rv-HN replicated poorly in primary fetal bovine kidney (FBK) cells with no visible plaques, and rvGZSB-HKN3A exhibited lower growth rate and smaller plaque size phenotypes than those of the parental virus in FBK cells, but similar growth properties and plaque phenotypes to those of the recombinant viruses harboring 93-102 deletion in 3A. These results demonstrate that the difference present in FMDV genome sequence outside the 3A coding region also have influence on FMDV replication ability in bovine cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first