WorldWideScience

Sample records for continuous-wave 285-nm radiation

  1. Generation of 99-mW continuous-wave 285-nm radiation for magneto-optical trapping of Mg atoms

    DEFF Research Database (Denmark)

    Madsen, Dorte Nørgaard; Yu, Ping; Balslev, Søren

    2002-01-01

    We have developed a tunable intense narrow-band 285 nm light source based on frequency doubling of 570 nm light in BBO. At input powers of 840 mW (including 130 mW used for locking purposes) we generate 99 mW UV radiation with an intensity profile suitable for laser-cooling experiments. The light...... is used for laser cooling of neutral magnesium atoms in a magneto-optical trap (MOT). We capture about 5 x 10(6) atoms directly from a thermal beam and find that the major loss mechanism of the magnesium MOT is a near-resonant two-photon ionization process....

  2. Generation of continuous-wave 194 nm laser for mercury ion optical frequency standard

    Science.gov (United States)

    Zou, Hongxin; Wu, Yue; Chen, Guozhu; Shen, Yong; Liu, Qu; Precision measurement; atomic clock Team

    2015-05-01

    194 nm continuous-wave (CW) laser is an essential part in mercury ion optical frequency standard. The continuous-wave tunable radiation sources in the deep ultraviolet (DUV) region of the spectrum is also serviceable in high-resolution spectroscopy with many atomic and molecular lines. We introduce a scheme to generate continuous-wave 194 nm radiation with SFM in a Beta Barium Borate (BBO) crystal here. The two source beams are at 718 nm and 266 nm, respectively. Due to the property of BBO, critical phase matching (CPM) is implemented. One bow-tie cavity is used to resonantly enhance the 718 nm beam while the 266 nm makes a single pass, which makes the configuration easy to implement. Considering the walk-off effect in CPM, the cavity mode is designed to be elliptical so that the conversion efficiency can be promoted. Since the 266 nm radiation is generated by a 532 nm laser through SHG in a BBO crystal with a large walk-off angle, the output mode is quite non-Gaussian. To improve mode matching, we shaped the 266 nm beam into Gaussian modes with a cylindrical lens and iris diaphragm. As a result, 2.05 mW 194 nm radiation can be generated. As we know, this is the highest power for 194 nm CW laser using SFM in BBO with just single resonance. The work is supported by the National Natural Science Foundation of China (Grant No. 91436103 and No. 11204374).

  3. Generation of continuous-wave single-frequency 1.5 W 378 nm radiation by frequency doubling of a Ti:sapphire laser.

    Science.gov (United States)

    Cha, Yong-Ho; Ko, Kwang-Hoon; Lim, Gwon; Han, Jae-Min; Park, Hyun-Min; Kim, Taek-Soo; Jeong, Do-Young

    2010-03-20

    We have generated continuous-wave single-frequency 1.5 W 378 nm radiation by frequency doubling a high-power Ti:sapphire laser in an external enhancement cavity. An LBO crystal that is Brewster-cut and antireflection coated on both ends is used for a long-term stable frequency doubling. By optimizing the input coupler's reflectivity, we could generate 1.5 W 378 nm radiation from a 5 W 756 nm Ti:sapphire laser. According to our knowledge, this is the highest CW frequency-doubled power of a Ti:sapphire laser.

  4. 303 nm continuous wave ultraviolet laser generated by intracavity frequency-doubling of diode-pumped Pr3+:LiYF4 laser

    Science.gov (United States)

    Zhu, Pengfei; Zhang, Chaomin; Zhu, Kun; Ping, Yunxia; Song, Pei; Sun, Xiaohui; Wang, Fuxin; Yao, Yi

    2018-03-01

    We demonstrate an efficient and compact ultraviolet laser at 303 nm generated by intracavity frequency doubling of a continuous wave (CW) laser diode-pumped Pr3+:YLiF4 laser at 607 nm. A cesium lithium borate (CLBO) crystal, cut for critical type I phase matching at room temperature, is used for second-harmonic generation (SHG) of the fundamental laser. By using an InGaN laser diode array emitting at 444.3 nm with a maximum incident power of 10 W, as high as 68 mW of CW output power at 303 nm is achieved. The output power stability in 4 h is better than 2.85%. To the best of our knowledge, this is high efficient UV laser generated by frequency doubling of an InGaN laser diode array pumped Pr3+:YLiF4 laser.

  5. Continuous-wave ceramic Nd:YAG laser at 1123 nm

    International Nuclear Information System (INIS)

    Zhang, S S; Wang, Q P; Zhang, X Y; Cong, Z H; Fan, S Z; Liu, Z J; Sun, W J

    2009-01-01

    Ceramic Nd:YAG (cNd:YAG) materials are employed to generate 1123-nm laser. A fiber-coupled continuous-wave (CW) 808-nm diode laser is used as the pumping source. With an incident diode power of 26.1 W, a CW output power of up to 10.8 W is obtained with a 10-mm-long ceramic Nd:YAG rod (1.0 at.%-Nd-doped). The conversion efficiency from diode power to 1123-nm laser power is 41.4%. The laser performance of another 10-mm-long cNd:YAG rod with a Nd-doping concentration of 0.6 at.% is studied as a comparison

  6. A diode-end-pumped Nd:GYSGG continuous wave laser at 1104 nm

    International Nuclear Information System (INIS)

    Shen, B J; Kang, H X; Zhang, C G; Chen, P; Gao, R L; Liang, J; Gao, H J; Zhang, Q L; Sun, D L; Yin, S T; Luo, J Q

    2013-01-01

    The continuous wave (CW) laser performance of Nd:GYSGG at 1104 nm is investigated for the first time, to our knowledge. A CW laser output power of 4.7 W is obtained when the pump power of the 808 nm fiber coupled laser diode is 19.1 W, corresponding to a conversion efficiency of 24.6% and slope efficiency of 37%. (paper)

  7. Efficient continuous-wave 1112 nm Nd:YAG laser operation under direct diode pumping at 885 nm

    International Nuclear Information System (INIS)

    Gao, J; Dai, X J; Zhang, L; Wu, X D

    2013-01-01

    We report compact diode-end-pumped continuous-wave laser operation at 1112 nm under 885 nm diode-direct pumping for the first time. On the basis of the R 2 →Y 6 transition in a conventional Nd:YAG (yttrium aluminum garnet) single crystal, the maximum output power of 12.5 W is achieved, with an optical to optical efficiency of 46.6% and a slope efficiency of 52.9%. To the best of our knowledge, this represents the highest output at 1112 nm generated by a diode-end-pumped Nd:YAG laser. Furthermore, it is the highest optical to optical efficiency ever reported for 1112 nm Nd:YAG lasers. The short term power stability is ∼0.32% at 12.0 W output. (letter)

  8. Continuous wave ultraviolet radiation induced frustration of etching in lithium niobate single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Mailis, S.; Riziotis, C.; Smith, P.G.R.; Scott, J.G.; Eason, R.W

    2003-02-15

    Illumination of the -z face of congruent lithium niobate single crystals with continuous wave (c.w.) ultraviolet (UV) laser radiation modifies the response of the surface to subsequent acid etching. A frequency doubled Ar{sup +} laser ({lambda}=244 nm) was used to illuminate the -z crystal face making it resistive to HF etching and thus transforming the illuminated tracks into ridge structures. This process enables the fabrication of relief patterns in a photolithographic manner. Spatially resolved Raman spectroscopy indicates preservation of the good crystal quality after irradiation.

  9. An efficient continuous-wave 591 nm light source based on sum-frequency mixing of a diode pumped Nd:GdVO4–Nd:CNGG laser

    International Nuclear Information System (INIS)

    Zhao, Y D; Liu, J H

    2013-01-01

    We report a laser architecture to obtain continuous-wave (CW) yellow-orange light sources at the 591 nm wavelength. An 808 nm diode pumped a Nd:GdVO 4 crystal emitting at 1063 nm. A part of the pump power was then absorbed by the Nd:CNGG crystal. The remaining pump power was used to pump a Nd:CNGG crystal emitting at 1329 nm. Intracavity sum-frequency mixing at 1063 and 1329 nm was then realized in a LiB 3 O 5 (LBO) crystal to reach the yellow-orange radiation. We obtained a CW output power of 494 mW at 591 nm with a pump laser diode emitting 17.8 W at 808 nm. (paper)

  10. Continuous-wave single-frequency laser with dual wavelength at 1064 and 532 nm.

    Science.gov (United States)

    Zhang, Chenwei; Lu, Huadong; Yin, Qiwei; Su, Jing

    2014-10-01

    A continuous-wave high-power single-frequency laser with dual-wavelength output at 1064 and 532 nm is presented. The dependencies of the output power on the transmission of the output coupler and the phase-matching temperature of the LiB(3)O(5) (LBO) crystal are studied. An output coupler with transmission of 19% is used, and the temperature of LBO is controlled to the optimal phase-matching temperature of 422 K; measured maximal output powers of 33.7 W at 1064 nm and of 1.13 W at 532 nm are obtained with optical-optical conversion efficiency of 45.6%. The laser can be single-frequency operated stably and mode-hop-free, and the measured frequency drift is less than 15 MHz in 1 min. The measured Mx2 and My2 for the 1064 nm laser are 1.06 and 1.09, respectively. The measured Mx2 and My2 for the 532 nm laser are 1.12 and 1.11, respectively.

  11. Resonantly diode-pumped continuous-wave and Q-switched Er:YAG laser at 1645 nm.

    Science.gov (United States)

    Chang, N W H; Simakov, N; Hosken, D J; Munch, J; Ottaway, D J; Veitch, P J

    2010-06-21

    We describe an efficient Er:YAG laser that is resonantly pumped using continuous-wave (CW) laser diodes at 1470 nm. For CW lasing, it emits 6.1 W at 1645 nm with a slope efficiency of 36%, the highest efficiency reported for an Er:YAG laser that is pumped in this manner. In Q-switched operation, the laser produces diffraction-limited pulses with an average power of 2.5 W at 2 kHz PRF. To our knowledge this is the first Q-switched Er:YAG laser resonantly pumped by CW laser diodes.

  12. Continuous-wave and passively Q-switched Nd:YVO4 laser at 1085 nm

    Science.gov (United States)

    Lin, Hongyi; Liu, Hong; Huang, Xiaohua; Zhang, Jiyan

    2017-11-01

    An admirable and efficient Nd:YVO4 laser at 1085 nm is demonstrated with a compact 35 mm plano-plano cavity. A chosen narrow bandpass filter with high-transmittance (HT) coating at 1064 nm (T=96%) and optimized part-reflection (PR) coating at 1085 nm (T=15%) is used as the output coupler. In the continuous-wave (CW) regime, the maximum output power reaches 3110 mW at the pump power of 11.41 W. Based on a Cr:YAG crystal with initial-transmittance of 91%, the first passively Q-switched Nd:YVO4 laser at 1085 nm is achieved. When the pump power is changed from the threshold of 4.50 to 6.08 W, the dual-wavelength lines at 1064 and 1085 nm are generated simultaneously. However, at the pump power of above 6.08 W, the single-wavelength line at 1085 nm is achieved. The largest output power, the highest peak power, and the narrowest pulse width are 1615 mW, 878 W and 26.2 ns, respectively.

  13. 270 nm Pseudomorphic Ultraviolet Light-Emitting Diodes with Over 60 mW Continuous Wave Output Power

    Science.gov (United States)

    Grandusky, James R.; Chen, Jianfeng; Gibb, Shawn R.; Mendrick, Mark C.; Moe, Craig G.; Rodak, Lee; Garrett, Gregory A.; Wraback, Michael; Schowalter, Leo J.

    2013-03-01

    In this letter, the achievement of over 60 mW output power from pseudomorphic ultraviolet light-emitting diodes in continuous wave operation is reported. Die thinning and encapsulation improved the photon extraction efficiency to over 15%. Improved thermal management and a high characteristic temperature resulted in a low thermal rolloff up to 300 mA injection current with an output power of 67 mW, an external quantum efficiency (EQE) of 4.9%, and a wall plug efficiency (WPE) of 2.5% for a single-chip device emitting at 271 nm in continuous wave operation.

  14. All-solid-state continuous-wave doubly resonant all-intracavity sum-frequency mixer.

    Science.gov (United States)

    Kretschmann, H M; Heine, F; Huber, G; Halldórsson, T

    1997-10-01

    A new resonator design for doubly resonant continuous-wave intracavity sum-frequency mixing is presented. We generated 212 mW of coherent radiation at 618 nm by mixing the radiation of a 1080-nm Nd(3+):YAlO(3) laser and a 1444-nm Nd(3+):YAG laser. Two different mixing resonator setups and several nonlinear-optical crystals were investigated. So far output is limited by unequal performance of the two fundamental lasers and coating problems of the nonlinear crystals.

  15. 532 nm continuous wave mode-locked Nd:GdVO4 laser with SESAM

    International Nuclear Information System (INIS)

    Li, L; Liu, J; Liu, M; Liu, S; Chen, F; Wang, W; Wang, Y

    2009-01-01

    We obtain continuous wave mode-locked Nd:GdVO 4 -KTP laser with a SESAM. This is the first report of CW mode-locked Nd:GdVO 4 -KTP laser with a SESAM to our knowledge. 396 mw CW mode-locked pulse is achieved at the incident power of 7.653 W, with the repetition about 95 MHz. The pulse duration is assumed to be 5.5 ps, this is the shortest green pulse of 532 nm with SESAM

  16. Efficient Disinfection of Tap and Surface Water with Single High Power 285 nm LED and Square Quartz Tube

    Directory of Open Access Journals (Sweden)

    Martin Hessling

    2016-01-01

    Full Text Available A small water disinfection system based on the combination of a strong single 25 mW LED with a wavelength of 285 nm and a short quartz tube with an outer rectangular cross section is presented. For the disinfection tests clear tap water and slightly turbid and yellow pond water are contaminated with high concentrations of Escherichia coli bacteria. These water samples are exposed to the germicidal 285 nm LED radiation while they flow through the quartz tube. The portion of surviving germs is determined by membrane filtration for different water qualities and flow rates. For clear tap water the bacteria concentration can be reduced by at least three orders of magnitude up to flow rates of about 20 L/h. In pond water the maximum flow rate for such a reduction is less than 3 L/h. These high disinfection capabilities and the small size of this system, allow its integration in medical systems for point of use disinfection or even its application in the Third World for decentralized water disinfection powered by small solar cells, because this disinfection capacity should be sufficient for small groups or families.

  17. Continuous-wave, single-frequency 229  nm laser source for laser cooling of cadmium atoms.

    Science.gov (United States)

    Kaneda, Yushi; Yarborough, J M; Merzlyak, Yevgeny; Yamaguchi, Atsushi; Hayashida, Keitaro; Ohmae, Noriaki; Katori, Hidetoshi

    2016-02-15

    Continuous-wave output at 229 nm for the application of laser cooling of Cd atoms was generated by the fourth harmonic using two successive second-harmonic generation stages. Employing a single-frequency optically pumped semiconductor laser as a fundamental source, 0.56 W of output at 229 nm was observed with a 10-mm long, Brewster-cut BBO crystal in an external cavity with 1.62 W of 458 nm input. Conversion efficiency from 458 nm to 229 nm was more than 34%. By applying a tapered amplifier (TA) as a fundamental source, we demonstrated magneto-optical trapping of all stable Cd isotopes including isotopes Cd111 and Cd113, which are applicable to optical lattice clocks.

  18. End-pumped continuous-wave intracavity yellow Raman laser at 590 nm with SrWO4 Raman crystal

    Science.gov (United States)

    Yang, F. G.; You, Z. Y.; Zhu, Z. J.; Wang, Y.; Li, J. F.; Tu, C. Y.

    2010-01-01

    We present an end-pumped continuous-wave intra-cavity yellow Raman laser at 590 nm with a 60 mm long pure crystal SrWO4 and an intra-cavity LiB3O5 frequency doubling crystal. The highest output power of yellow laser at 590 nm was 230 mW and the output power and threshold were found to be correlative with the polarized directions of pure single crystal SrWO4 deeply. Along different directions, the minimum and maximum thresholds of yellow Raman laser at 590 nm were measured to be 2.8 W and 14.3 W with respect to 808 nm LD pump power, respectively.

  19. End-pumped continuous-wave intracavity yellow Raman laser at 590 nm with SrWO4 Raman crystal

    International Nuclear Information System (INIS)

    Yang, F G; You, Z Y; Zhu, Z J; Wang, Y; Li, J F; Tu, C Y

    2010-01-01

    We present an end-pumped continuous-wave intra-cavity yellow Raman laser at 590 nm with a 60 mm long pure crystal SrWO 4 and an intra-cavity LiB 3 O 5 frequency doubling crystal. The highest output power of yellow laser at 590 nm was 230 mW and the output power and threshold were found to be correlative with the polarized directions of pure single crystal SrWO 4 deeply. Along different directions, the minimum and maximum thresholds of yellow Raman laser at 590 nm were measured to be 2.8 W and 14.3 W with respect to 808 nm LD pump power, respectively

  20. The generation of a continuous-wave Nd:YVO4/LBO laser at 543 nm by direct in-band diode pumping at 888 nm

    International Nuclear Information System (INIS)

    Fu, S C; Wang, X; Chu, H

    2013-01-01

    We report the generation of a green laser at 543 nm by intracavity frequency doubling of the continuous-wave (cw) laser operation of a 1086 nm Nd:YVO 4 laser under 888 nm diode pumping into the emitting level 4 F 3/2 . An LiB 3 O 5 (LBO) crystal, cut for critical type I phase matching at room temperature, is used for the laser second-harmonic generation. At an incident pump power of 17.8 W, as high as 4.53 W cw output power at 543 nm is achieved. The optical-to-optical conversion efficiency is up to 25.4%, and the fluctuation of the green output power is better than 2.3% in a 30 min period. (paper)

  1. Infrared skin damage thresholds from 1319-nm continuous-wave laser exposures

    Science.gov (United States)

    Oliver, Jeffrey W.; Vincelette, Rebecca; Noojin, Gary D.; Clark, Clifton D.; Harbert, Corey A.; Schuster, Kurt J.; Shingledecker, Aurora D.; Kumru, Semih S.; Maughan, Justin; Kitzis, Naomi; Buffington, Gavin D.; Stolarski, David J.; Thomas, Robert J.

    2013-12-01

    A series of experiments were conducted in vivo using Yucatan miniature pigs (Sus scrofa domestica) to determine thermal damage thresholds to the skin from 1319-nm continuous-wave Nd:YAG laser irradiation. Experiments employed exposure durations of 0.25, 1.0, 2.5, and 10 s and beam diameters of ˜0.6 and 1 cm. Thermal imagery data provided a time-dependent surface temperature response from the laser. A damage endpoint of fifty percent probability of a minimally visible effect was used to determine threshold for damage at 1 and 24 h postexposure. Predicted thermal response and damage thresholds are compared with a numerical model of optical-thermal interaction. Resultant trends with respect to exposure duration and beam diameter are compared with current standardized exposure limits for laser safety. Mathematical modeling agreed well with experimental data, predicting that though laser safety standards are sufficient for exposures <10 s, they may become less safe for very long exposures.

  2. Diode-laser-pumped high efficiency continuous-wave operation at 912 nm laser in Nd:GdVO4 crystal

    International Nuclear Information System (INIS)

    Yu, X; Chen, F; Gao, J; Li, X D; Yan, R P; Zhang, K; Yu, J H; Zhang, Z H

    2009-01-01

    High efficiency operation on continuous-wave (cw) 912 nm laser at room temperature in Nd:GdVO 4 crystal pumped by 808 nm diode-laser is reported in this letter. The maximum output power of 8.0 W was obtained at the incident un-polarized pump power of 47.0 W, giving the corresponding optical-to-optical conversion efficiency of 17.0% and the average slope efficiency of 22.9%. Further tests show that the lasing threshold is reduced and the efficiency is increased evidently when using the π-polarized 808 nm pump source. 4.8 W 912 nm laser was achieved at the polarized pump power of 21.8 W, optical-to-optical conversion efficiency is increased to 22.0% and average slope efficiency is up to 33.6%

  3. Compact, efficient diode-end-pumped Nd:GdVO4 slab continuous-wave 912-nm laser

    International Nuclear Information System (INIS)

    Liu Huan; Gong Ma-Li

    2012-01-01

    A fiber-coupled laser-diode (LD) end-pumped Nd:GdVO 4 slab continuous-wave (CW) 912-nm laser and an LD bar end-pumped Nd:GdVO 4 slab CW 912-nm laser are both demonstrated in this paper. Using the fiber-coupled LD of end-pumped type, a highest CW 912-nm laser output power of 10.17 W is obtained with a high optical-to-optical conversion efficiency of 24.6% and a slope efficiency of 34.5%. The measured M 2 factors of beam quality in x and y directions are 5.3 and 5.1, respectively. Besides, an LD bar of end-pumped type is used to realize CW 912-nm laser output, which has the advantages of compactness and low cost. When the pump power is 38.8 W, the output power is 8.87 W and the measured M 2 factors of beam quality in x and y directions are 16 and 1.31, respectively. In order to improve the beam quality of the 912-nm laser at x direction, a new quasi-concentric laser resonator will be designed, and an LD bar end-pumped Nd:GdVO 4 slab high-power CW 912-nm TEM 00 laser will be realized in the future. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  4. Nonlinear radiation of waves at combination frequencies due to radiation-surface wave interaction in plasmas

    International Nuclear Information System (INIS)

    El Naggar, I.A.; Hussein, A.M.; Khalil, Sh.M.

    1992-09-01

    Electromagnetic waves radiated with combination frequencies from a semi-bounded plasma due to nonlinear interaction of radiation with surface wave (both of P-polarization) has been investigated. Waves are radiated both into vacuum and plasma are found to be P-polarized. We take into consideration the continuity at the plasma boundary of the tangential components of the electric field of the waves. The case of normal incidence of radiation and rarefield plasma layer is also studied. (author). 7 refs

  5. Continuous-wave green thin-disk laser at 524 nm based on frequency-doubled diode-pumped Yb:GSO crystal

    International Nuclear Information System (INIS)

    Shao, Y; Zhang, D; Liu, H P; Jin, H J; Li, Y L; Tao, Z H; Ruan, Q R; Zhang, T Y

    2011-01-01

    We report what is believed to be the first demonstration of diode-pumped continuous-wave (CW) thin-disk Yb 3+ -doped Gd 2 SiO 5 (Yb:GSO) laser at 1048 nm. With a 3.8% output coupler, the maximum output power is 1.38 W under a pump power of 17.8 W. Moreover, intracavity second-harmonic generation (SHG) has also been achieved with a power of 337 mW at 524 nm by using a LiB 3 O 5 (LBO) nonlinear crystal. At the output power level of 337 mW, the green power stability is better than 5% and the ellipticity of spot is 0.97

  6. Generation of continuous coherent radiation at Lyman-alpha and 1S-2P Spectroscopy of atomic hydrogen

    NARCIS (Netherlands)

    Pahl, A.; Fendel, P.; Henrich, B.R.; Walz, J.; Hansch, T.W.; Eikema, K.S.E.

    2005-01-01

    Continuous coherent radiation from wavelengths from 121 to 123 nm in the vacuum ultraviolet (VUV) was generated by four-wave sum-frequency mixing in mercury vapor. A yield of 20 nW at Lyman-alpha (121.57 nm) was achieved. We describe the experimental setup in detail and present a calculation of the

  7. Continuous-wave generation and tunability of eye-safe resonantly diode-pumped Er:YAG laser

    Science.gov (United States)

    Němec, Michal; Indra, Lukás.; Šulc, Jan; Jelínková, Helena

    2016-03-01

    Laser sources generating radiation in the spectral range from 1.5 to 1.7 μm are very attractive for many applications such as satellite communication, range finding, spectroscopy, and atmospheric sensing. The goal of our research was an investigation of continuous-wave generation and wavelength tuning possibility of diode pumped eye-safe Er:YAG laser emitting radiation around 1645 nm. We used two 0.5 at. % doped Er:YAG active media with lengths of 10 mm and 25 mm (diameter 5 mm). As a pumping source, a fibre-coupled 1452 nm laser-diode was utilized, which giving possibility of the in-band pumping with a small quantum defect and low thermal stress of the active bulk laser material. The 150 mm long resonator was formed by a pump mirror (HT @ 1450 nm, HR @ 1610 - 1660 nm) and output coupler with 96 % reflectivity at 1610 - 1660 nm. For continuous-wave generation, the maximal output powers were 0.7 W and 1 W for 10 mm and 25 mm long laser crystals, respectively. The corresponding slope efficiencies with respect to absorbed pump power for these Er:YAG lasers were 26.5 % and 37.8 %, respectively. The beam spatial structure was close to the fundamental Gaussian mode. A wavelength tunability was realized by a birefringent plate and four local spectral maxima at 1616, 1633, 1645, and 1657 nm were reached. The output characteristics of the designed and realized resonantly diode-pumped eye-safe Er:YAG laser show that this compact system has a potential for usage mainly in spectroscopic fields.

  8. Efficient laser-diode end-pumped Nd:GGG lasers at 1054 and 1067 nm.

    Science.gov (United States)

    Xu, Bin; Xu, Huiying; Cai, Zhiping; Camy, P; Doualan, J L; Moncorgé, R

    2014-10-10

    Efficient and compact laser-diode end-pumped Nd:GGG simultaneous multiwavelength continuous-wave lasers at ∼1059, ∼1060 and ∼1062  nm were first demonstrated in a free-running 30 mm plano-concave laser cavity. The maximum output power was up to 3.92 W with a slope efficiency of about 53.6% with respect to the absorbed pump power. By inserting a 0.1 mm optical glass plate acting as a Fabry-Pérot etalon, a single-wavelength laser at ∼1067  nm with a maximum output power of 1.95 W and a slope efficiency of 28.5% can be obtained. Multiwavelength lasers, including those at ∼1054 or ∼1067  nm, were also achievable by suitably tilting the glass etalon. These simultaneous multiwavelength lasers provide a potential source for terahertz wave generation.

  9. Diode-pumped continuous-wave and passively Q-switched Nd:GdLuAG laser at 1443.9 nm

    Science.gov (United States)

    Wu, Qianwen; Liu, Zhaojun; Zhang, Sasa; Cong, Zhenghua; Guan, Chen; Xue, Feng; Chen, Hui; Huang, Qingjie; Xu, Xiaodong; Xu, Jun; Qin, Zengguang

    2017-12-01

    We investigated the 1443.9 nm laser characteristics of Nd:GdLuAG crystal. Diode-end-pumping configuration was employed under both continuous-wave (CW) and passively Q-switched operations. For CW operation, the maximum average output power was 1.36 W with a slope efficiency of 15%. By using a V3+:YAG crystal as the saturable absorber, we obtained the maximum average output power of 164 mW under Q-switched operation. The corresponding pulse energy was 29.3 μJ and pulse duration was 59 ns.

  10. Blood-brain barrier disruption by continuous-wave radio frequency radiation.

    Science.gov (United States)

    Sirav, Bahriye; Seyhan, Nesrin

    2009-01-01

    The increasing use of cellular phones and the increasing number of associated base stations are becoming a widespread source of non ionizing electromagnetic radiation. Some biological effects are likely to occur even at low-level EM fields. This study was designed to investigate the effects of 900 and 1,800 MHz Continuous Wave Radio Frequency Radiation (CW RFR) on the permeability of Blood Brain Barrier (BBB) of rats. Results have shown that 20 min RFR exposure of 900 and 1,800 MHz induces an effect and increases the permeability of BBB of male rats. There was no change in female rats. The scientific evidence on RFR safety or harm remains inconclusive. More studies are needed to demonstrate the effects of RFR on the permeability of BBB and the mechanisms of that breakdown.

  11. Diode-pumped continuous-wave Nd:Gd3Ga5O12 lasers at 1406, 1415 and 1423 nm

    Science.gov (United States)

    Lin, Haifeng; Zhu, Wenzhang; Xiong, Feibing; Ruan, Jianjian

    2018-05-01

    We report a diode-pumped continuous-wave Nd:Gd3Ga5O12 (GGG) laser operating at 1.4 μm spectral region. A dual-wavelength laser at 1423 and 1406 nm is achieved with output power of about 2.59 W at absorbed pump power of 13.4 W. Further increasing the pump power, simultaneous tri-wavelength laser at 1423, 1415 and 1406 nm is also obtained with a maximum output power of 3.96 W at absorbed pump power of 18.9 W. Single-wavelength lasing is also realized at the three emission lines using an intracavity etalon. The laser result is believed to be the highest output power achieved in Nd:GGG crystal, at present, to the best of our knowledge.

  12. Highly efficient single-pass frequency doubling of a continuous-wave distributed feedback laser diode using a PPLN waveguide crystal at 488 nm.

    Science.gov (United States)

    Jechow, Andreas; Schedel, Marco; Stry, Sandra; Sacher, Joachim; Menzel, Ralf

    2007-10-15

    A continuous-wave distributed feedback diode laser emitting at 976 nm was frequency doubled by the use of a periodically poled lithium niobate waveguide crystal with a channel size of 3 microm x 5 microm and an interaction length of 10 mm. A laser to waveguide coupling efficiency of 75% could be achieved resulting in 304 mW of incident infrared light inside the waveguide. Blue laser light emission of 159 mW at 488 nm has been generated, which equals to a conversion efficiency of 52%. The resulting wall plug efficiency was 7.4%.

  13. Building blocks for future detectors: Silicon test masses and 1550 nm laser light

    International Nuclear Information System (INIS)

    Schnabel, R; Britzger, M; Burmeister, O; Danzmann, K; Duck, J; Eberle, T; Friedrich, D; Luck, H; Mehmet, M; Steinlechner, S; Willke, B; Brueckner, F; Nawrodt, R

    2010-01-01

    Current interferometric gravitational wave detectors use the combination of quasi-monochromatic, continuous-wave laser light at 1064 nm and fused silica test masses at room temperature. Detectors of the third generation, such as the Einstein-Telescope, will involve a considerable sensitivity increase. The combination of 1550 nm laser radiation and crystalline silicon test masses at low temperatures might be important ingredients in order to achieve the sensitivity goal. Here we compare some properties of the fused silica and silicon test mass materials relevant for decreasing the thermal noise in future detectors as well as the recent technology achievements in the preparation of laser radiation at 1064 nm and 1550 nm relevant for decreasing the quantum noise. We conclude that silicon test masses and 1550 nm laser light have the potential to form the future building blocks of gravitational wave detection.

  14. Radiation Failures in Intel 14nm Microprocessors

    Science.gov (United States)

    Bossev, Dobrin P.; Duncan, Adam R.; Gadlage, Matthew J.; Roach, Austin H.; Kay, Matthew J.; Szabo, Carl; Berger, Tammy J.; York, Darin A.; Williams, Aaron; LaBel, K.; hide

    2016-01-01

    In this study the 14 nm Intel Broadwell 5th generation core series 5005U-i3 and 5200U-i5 was mounted on Dell Inspiron laptops, MSI Cubi and Gigabyte Brix barebones and tested with Windows 8 and CentOS7 at idle. Heavy-ion-induced hard- and catastrophic failures do not appear to be related to the Intel 14nm Tri-Gate FinFET process. They originate from a small (9 m 140 m) area on the 32nm planar PCH die (not the CPU) as initially speculated. The hard failures seem to be due to a SEE but the exact physical mechanism has yet to be identified. Some possibilities include latch-ups, charge ion trapping or implantation, ion channels, or a combination of those (in biased conditions). The mechanism of the catastrophic failures seems related to the presence of electric power (1.05V core voltage). The 1064 nm laser mimics ionization radiation and induces soft- and hard failures as a direct result of electron-hole pair production, not heat. The 14nm FinFET processes continue to look promising for space radiation environments.

  15. Comparison of photosensitivity in germanium doped silica fibers using 244 nm and 266 nm continuous wave lasers

    DEFF Research Database (Denmark)

    Jensen, Jesper Bo; Varming, Poul; Liu, B.

    2001-01-01

    Diode pumped continuous-wave UV lasers offer an interesting alternative to frequency doubled argon-ion lasers. We report the first photosensitivity comparison using these lasers on deuterium loaded standard telecommunication fibers and unloaded experimental fibers....

  16. Continuous wave terahertz radiation from an InAs/GaAs quantum-dot photomixer device

    Science.gov (United States)

    Kruczek, T.; Leyman, R.; Carnegie, D.; Bazieva, N.; Erbert, G.; Schulz, S.; Reardon, C.; Reynolds, S.; Rafailov, E. U.

    2012-08-01

    Generation of continuous wave radiation at terahertz (THz) frequencies from a heterodyne source based on quantum-dot (QD) semiconductor materials is reported. The source comprises an active region characterised by multiple alternating photoconductive and QD carrier trapping layers and is pumped by two infrared optical signals with slightly offset wavelengths, allowing photoconductive device switching at the signals' difference frequency ˜1 THz.

  17. High-power, continuous-wave, solid-state, single-frequency, tunable source for the ultraviolet.

    Science.gov (United States)

    Aadhi, A; Apurv Chaitanya, N; Singh, R P; Samanta, G K

    2014-06-15

    We report the development of a compact, high-power, continuous-wave, single-frequency, ultraviolet (UV) source with extended wavelength tunability. The device is based on single-pass, intracavity, second-harmonic-generation (SHG) of the signal radiation of a singly resonant optical parametric oscillator (SRO) working in the visible and near-IR wavelength range. The SRO is pumped in the green with a 25-mm-long, multigrating, MgO doped periodically poled stoichiometric lithium tantalate (MgO:sPPLT) as nonlinear crystal. Using three grating periods, 8.5, 9.0, and 9.5 μm of the MgO:sPPLT crystal and a single set of cavity mirrors, the SRO can be tuned continuously across 710.7-836.3 nm in the signal and corresponding idler across 2115.8-1462.1 nm with maximum idler power of 1.9 W and maximum out-coupled signal power of 254 mW. By frequency-doubling the intracavity signal with a 5-mm-long bismuth borate (BIBO) crystal, we can further tune the SRO continuously over 62.8 nm across 355.4-418.2 nm in the UV with maximum single-frequency UV power, as much as 770 mW at 398.28 nm in a Gaussian beam profile. The UV radiation has an instantaneous line-width of ∼14.5  MHz and peak-peak frequency stability of 151 MHz over 100 s. More than 95% of the tuning range provides UV power >260  mW. Access to lower UV wavelengths can in principle be realized by operating the SRO in the visible using shorter grating periods.

  18. 32 CFR 285.5 - Information requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Information requirements. 285.5 Section 285.5 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) FREEDOM OF INFORMATION ACT PROGRAM DOD FREEDOM OF INFORMATION ACT (FOIA) PROGRAM § 285.5 Information...

  19. Comparison of therapeutic effects between pulsed and continuous wave 810-nm wavelength laser irradiation for traumatic brain injury in mice.

    Directory of Open Access Journals (Sweden)

    Takahiro Ando

    Full Text Available Transcranial low-level laser therapy (LLLT using near-infrared light can efficiently penetrate through the scalp and skull and could allow non-invasive treatment for traumatic brain injury (TBI. In the present study, we compared the therapeutic effect using 810-nm wavelength laser light in continuous and pulsed wave modes in a mouse model of TBI.TBI was induced by a controlled cortical-impact device and 4-hours post-TBI 1-group received a sham treatment and 3-groups received a single exposure to transcranial LLLT, either continuous wave or pulsed at 10-Hz or 100-Hz with a 50% duty cycle. An 810-nm Ga-Al-As diode laser delivered a spot with diameter of 1-cm onto the injured head with a power density of 50-mW/cm(2 for 12-minutes giving a fluence of 36-J/cm(2. Neurological severity score (NSS and body weight were measured up to 4 weeks. Mice were sacrificed at 2, 15 and 28 days post-TBI and the lesion size was histologically analyzed. The quantity of ATP production in the brain tissue was determined immediately after laser irradiation. We examined the role of LLLT on the psychological state of the mice at 1 day and 4 weeks after TBI using tail suspension test and forced swim test.The 810-nm laser pulsed at 10-Hz was the most effective judged by improvement in NSS and body weight although the other laser regimens were also effective. The brain lesion volume of mice treated with 10-Hz pulsed-laser irradiation was significantly lower than control group at 15-days and 4-weeks post-TBI. Moreover, we found an antidepressant effect of LLLT at 4-weeks as shown by forced swim and tail suspension tests.The therapeutic effect of LLLT for TBI with an 810-nm laser was more effective at 10-Hz pulse frequency than at CW and 100-Hz. This finding may provide a new insight into biological mechanisms of LLLT.

  20. Diode-side-pumped continuous wave Nd³⁺ : YVO₄ self-Raman laser at 1176 nm.

    Science.gov (United States)

    Kores, Cristine Calil; Jakutis-Neto, Jonas; Geskus, Dimitri; Pask, Helen M; Wetter, Niklaus U

    2015-08-01

    Here we report, to the best of our knowledge, the first diode-side-pumped continuous wave (cw) Nd3+:YVO4 self-Raman laser operating at 1176 nm. The compact cavity design is based on the total internal reflection of the laser beam at the pumped side of the Nd3+:YVO4 crystal. Configurations with a single bounce and a double bounce of the laser beam at the pumped faced have been characterized, providing a quasi-cw peak output power of more than 8 W (multimode) with an optical conversion efficiency of 11.5% and 3.7 W (TEM00) having an optical conversion efficiency of 5.4%, respectively. Cw output power of 1.8 W has been demonstrated.

  1. Continuous Emission of A Radiation Quantum

    International Nuclear Information System (INIS)

    Zheng-Johansson, J X

    2013-01-01

    It is in accordance with such experiments as single photon self-interference that a photon, conveying one radiation energy quantum h × frequency , is spatially extensive and stretches an electromagnetic wave train. A wave train, hence an energy quantum, can only be emitted (or absorbed) by its source (or absorber) gradually. In both two processes the wave and ''particle'' attributes of the radiation field are simultaneously prominent, where an overall satisfactory theory has been lacking; for the latter process no known theoretical description currently exists. This paper presents a first principles treatment, in a unified framework of the classical and quantum mechanics, of the latter process, the emission (similarly absorption) of a single radiation quantum based on the dynamics of the radiation-emitting source, a charged oscillator, which is itself extensive across the potential well in which it oscillates. During the emission of one single radiation quantum, the extensive charged oscillator undergoes a continuous radiation damping and is non-stationary. This process is in this work treated using a quasi stationary approach, whereby the classical equation of motion, which directly facilitates the correspondence principle for a particle oscillator, and the quantum wave equation are established for each sufficiently brief time interval. As an inevitable consequence of the division of the total time for emitting one single quantum, a fractional Planck constant h is introduced. The solutions to the two simultaneous equations yield for the charged oscillator a continuously exponentially decaying Hamiltonian that is at the same time quantised with respect to the fractional-h at any instant of time; and the radiation wave field emitted over time stretches a wave train of finite length. The total system of the source and radiation field maintains at any time (integer n times) one whole energy quantum, (n×) h× frequency, in complete accordance with

  2. Continuous-wave laser operation at 743 and 753 nm based on a diode-pumped c-cut Pr:YAlO3 crystal

    Science.gov (United States)

    Lin, Xiuji; Huang, Xiaoxu; Liu, Bin; Xu, Bin; Xu, Huiying; Cai, Zhiping; Xu, Xiaodong; Li, Dongzhen; Liu, Jian; Xu, Jun

    2018-02-01

    We report on blue-diode-pumped continuous-wave Pr:YAlO3 (YAP) crystal lasers. Using a b-cut sample, a maximum output power of 181 mW is achieved at ∼747 nm with slope efficiency of 12.7% with respect to the absorbed power. Using a c-cut sample, a dual-wavelength laser at ∼743 and ∼753 nm is obtained with a total maximum output power of 72 mW by using the blue diode pumping, for the first time to our knowledge. These laser emissions are all linearly polarized and M2 factors of these output laser beams are also measured. YAP is experimentally verified to be one of effective oxide hosts for Pr-doped visible laser operation besides its fluoride counterparts.

  3. High-power diode-pumped Nd:Lu2O3 crystal continuous-wave thin-disk laser at 1359 nm

    International Nuclear Information System (INIS)

    Li, J H; Liu, X H; Wu, J B; Zhang, X; Li, Y L

    2012-01-01

    We present for the first time, to the best of our knowledge, a 1359 nm continuous-wave (CW) Nd:Lu 2 O 3 laser based on the 4 F 5/2 – 4 F 13/2 transition. The use of a pump module with 16 passes through the crystal allowed the realization of a Nd:Lu 2 O 3 thin-disk laser with 3.52 W of CW output power. The slope efficiency with respect to the incident pump power was 21.4%, and the fluctuation of the output power was better than 3.55% in the given 2 hour. The beam quality factor M 2 is 1.14 and 1.18 for tangential direction and sagittal direction, respectively

  4. The use of shore wave ultraviolet radiation for disinfection in operating rooms

    International Nuclear Information System (INIS)

    Baanrud, H.; Moan, J.

    1999-01-01

    Over a number of years short wave ultraviolet radiation (UVC;200-280 nm) has been used to disinfect air and surfaces in operating rooms, patient rooms and laboratories, as well as air in ventilation ducts. Despite the well-documented effect of ultraviolet radiation on air quality, this technology has been relatively little used. One advantage of this method is that the UVC sources ensure a continuous reduction in the number of airborne microorganisms that are generated all the time. There are, however, some disadvantages with this method. Human exposure to ultraviolet C may cause keratoconjunctivitis and erythema and requires protection of the skin and the eyes of people exposed to levels above recommended exposure limits. However, by enclosing the UVC sources or by irradiation in the absence of human activity, human exposure is eliminated. These and other aspects concerning the use of short wave ultraviolet radiation as a disinfection agent in operating rooms are discussed in this article

  5. Diode-pumped continuous-wave blue laser operation of Nd:GGG at 467.0, 467.7, and 468.5 nm

    International Nuclear Information System (INIS)

    Xu, B; Camy, P; Doualan, J L; Braud, A; Moncorgé, R; Cai, Z P; Brenier, A

    2012-01-01

    Intra-cavity frequency doubling of continuous-wave (CW) laser emission on the quasi-three level ( 4 F 3/2 → 4 I 9/2 ) laser transition of Nd 3+ in Nd:GGG is reported by using a three-mirror folded resonator. The thermal lens experienced by the optically-pumped Nd:GGG laser crystal is measured as a function of the absorbed pump power and compared to that found, in the same conditions, in the case of Nd:YAG. Results are interpreted by using a simple model accounting for the absorbed pump power and the thermo-mechanical properties of each laser crystal. Diode-pumped blue laser operation is achieved, for the first time, at 467.0 and 468.5 nm with output powers of 230 and 450 mW, respectively. Simultaneous laser operation resulting both from frequency-doubling and frequency summing at the three 467.1, 467.7, and 468.1 nm laser wavelengths is also obtained with a total output power of 60 mW

  6. 205 nm continuous-wave laser: application to the measurement of the Lamb shift in hydrogen

    International Nuclear Information System (INIS)

    Bourzeix, S.

    1995-01-01

    The subject of this thesis is the construction of an experimental set-up, and in particular of a tunable continuous-wave laser at 205 nm, for the measurement of the ground state Lamb shift in atomic hydrogen. Chapter 1 deals with the Lamb shift from a historical point of view, and with the interest of its measurement, for metrology and test of quantum electrodynamics. Chapter 2 is devoted to the theory of the hydrogen atom. The principle of the experiment is based on the comparison of two frequencies which are in a ratio of 4: those of the two-photon transitions of 2S-6S or 2S-6D and 1S-3S. Chapter 3 describes the experimental set-up used to measure the 2S-6D transition which is excited by a titanium-sapphire laser at 820 nm. The 205 nm light required to excite the 1S-3S transition is generated by two frequency-doubling of the titanium-sapphire laser, made in non-linear crystals placed in enhancement cavities. Chapter 4 is entirely devoted to the frequency-doubling. After a recall of non-linear optics, the enhancement cavities are described in detail, as well as the results we achieved. At last chapter 5 describes the research for a signal on the 1S-3S transition: the construction of a ground state atomic beam, and the development of the detection system. This work has led to a preliminary measurement of the ground state Lamb shift in atomic hydrogen: L(1S) = 8172.850 (174) MHz whose result is in very good agreement with both the previous measurements and the most recent theoretical results. (author)

  7. Stable continuous-wave single-frequency Nd:YAG blue laser at 473 nm considering the influence of the energy-transfer upconversion.

    Science.gov (United States)

    Wang, Yaoting; Liu, Jianli; Liu, Qin; Li, Yuanji; Zhang, Kuanshou

    2010-06-07

    We report a continuous-wave (cw) single frequency Nd:YAG blue laser at 473 nm end-pumped by a laser diode. A ring laser resonator was designed, the frequency doubling efficiency and the length of nonlinear crystal were optimized based on the investigation of the influence of the frequency doubling efficiency on the thermal lensing effect induced by energy-transfer upconversion. By intracavity frequency doubling with PPKTP crystal, an output power of 1 W all-solid-state cw blue laser of single-frequency operation was achieved. The stability of the blue output power was better than +/- 1.8% in the given four hours.

  8. Continuous micro-vortex-based nanoparticle manipulation via focused surface acoustic waves.

    Science.gov (United States)

    Collins, David J; Ma, Zhichao; Han, Jongyoon; Ai, Ye

    2016-12-20

    Despite increasing demand in the manipulation of nanoscale objects for next generation biological and industrial processes, there is a lack of methods for reliable separation, concentration and purification of nanoscale objects. Acoustic methods have proven their utility in contactless manipulation of microscale objects mainly relying on the acoustic radiation effect, though the influence of acoustic streaming has typically prevented manipulation at smaller length scales. In this work, however, we explicitly take advantage of the strong acoustic streaming in the vicinity of a highly focused, high frequency surface acoustic wave (SAW) beam emanating from a series of focused 6 μm substrate wavelength interdigital transducers patterned on a piezoelectric lithium niobate substrate and actuated with a 633 MHz sinusoidal signal. This streaming field serves to focus fluid streamlines such that incoming particles interact with the acoustic field similarly regardless of their initial starting positions, and results in particle displacements that would not be possible with a travelling acoustic wave force alone. This streaming-induced manipulation of nanoscale particles is maximized with the formation of micro-vortices that extend the width of the microfluidic channel even with the imposition of a lateral flow, occurring when the streaming-induced flow velocities are an order of magnitude larger than the lateral one. We make use of this acoustic streaming to demonstrate the continuous and differential focusing of 100 nm, 300 nm and 500 nm particles.

  9. Intersubband Rabi oscillations in asymmetric nanoheterostructures: implications for a tunable continuous-wave source of a far-infrared and THz radiation.

    Science.gov (United States)

    Kukushkin, V A

    2012-06-01

    A tunable continuous-wave source of a far-infrared and THz radiation based on a semiconductor nanoheterostructure with asymmetric quantum wells is suggested. It utilizes Rabi oscillations at a transition between quantum well subbands excited by external femtosecond pulses of a mid-infrared electromagnetic field. Due to quantum well broken inversion symmetry the subbands possess different average dipole moments, which enables the creation of polarization at the Rabi frequency as the subband populations change. It is shown that if this polarization is excited so that it is periodic in space, then, though being pulsed, it can produce continuous-wave output radiation. Changing the polarization space period and the time intervals between the exciting pulses, one can tune the frequency of this radiation throughout the far-infrared and THz range. In the present work a concrete multiple quantum well heterostructure design and a scheme of its space-periodic polarization are suggested. It is shown that for existing sources of mid-infrared femtosecond pulses the proposed scheme can provide a continuous-wave output power of order the power of far-infrared and THz quantum cascade lasers. Being added to the possibility of its output frequency tuning, this can make the suggested device attractive for fundamental research and various applications.

  10. Diode-pumped continuous-wave and passively Q-switched 1066 nm Nd:GYNbO4 laser

    Science.gov (United States)

    Ma, Yufei; Peng, Zhenfang; He, Ying; Li, Xudong; Yan, Renpeng; Yu, Xin; Zhang, Qingli; Ding, Shoujun; Sun, Dunlu

    2017-08-01

    A diode-pumped passively Q-switched 1066 nm laser with a novel Nd:Gd0.69Y0.3NbO4 mixed crystal was demonstrated for the first time to the best of our knowledge. In the continuous-wave (CW) operation, optimization selection of output couplers was carried out, and a maximum output power of 2.13 W was obtained when the plane mirror with transmission of 25% was chosen and the absorbed pump power was 10.5 W. The Cr4+:YAG passively Q-switched Nd:Gd0.69Y0.3NbO4 laser performance was investigated. At an absorbed pump power of 10.5 W, using Cr4+:YAG with initial transmission of 80%, the obtained minimum pulse width was 7.2 ns with the pulse repetition rate of 19 kHz. The single pulse energy and peak power were estimated to be 26.7 µJ and 3.7 kW, respectively.

  11. Parametrically tunable soliton-induced resonant radiation by three-wave mixing

    DEFF Research Database (Denmark)

    Zhou, Binbin; Liu, Xing; Guo, Hairun

    2017-01-01

    We show that a temporal soliton can induce resonant radiation by three-wave mixing nonlinearities. This constitutes a new class of resonant radiation whose spectral positions are parametrically tunable. The experimental verification is done in a periodically poled lithium niobate crystal, where...... a femtosecond near-IR soliton is excited and resonant radiation waves are observed exactly at the calculated soliton phasematching wavelengths via the sum- and difference-frequency generation nonlinearities. This extends the supercontinuum bandwidth well into the mid IR to span 550–5000 nm, and the mid-IR edge...

  12. Continuous-wave and acousto-optically Q-switched 1066 nm laser performance of a novel Nd:GdTaO4 crystal

    Science.gov (United States)

    Ma, Yufei; He, Ying; Peng, Zhenfang; Sun, Haiyue; Peng, Fang; Yan, Renpeng; Li, Xudong; Yu, Xin; Zhang, Qingli; Ding, Shoujun

    2018-05-01

    A diode-pumped acousto-optically (AO) Q-switched 1066 nm laser with a novel Nd:GdTaO4 crystal was demonstrated for the first time to the best of our knowledge. The optimization selection of output coupler was carried out in the continuous-wave (CW) operation. After that the pulsed Nd:GdTaO4 laser performances using different modulation repetition rates of 10 kHz and 20 kHz were investigated. At an absorbed pump power of 10 W and repetition rates of 10 kHz, the obtained minimum pulse width was 28 ns and the maximum peak power was 5.4 kW.

  13. Photobiomodulation with Pulsed and Continuous Wave Near-Infrared Laser (810 nm, Al-Ga-As Augments Dermal Wound Healing in Immunosuppressed Rats.

    Directory of Open Access Journals (Sweden)

    Gaurav K Keshri

    Full Text Available Chronic non-healing cutaneous wounds are often vulnerable in one or more repair phases that prevent normal healing and pose challenges to the use of conventional wound care modalities. In immunosuppressed subject, the sequential stages of healing get hampered, which may be the consequences of dysregulated or stagnant wound inflammation. Photobiomodulation (PBM or low-level laser (light therapy (LLLT emerges as a promising drug-free, non-invasive biophysical approach for promoting wound healing, reduction of inflammation, pain and restoration of functions. The present study was therefore undertaken to evaluate the photobiomodulatory effects of 810 nm diode laser (40 mW/cm2; 22.6 J/cm2 with pulsed (10 and 100 Hz, 50% duty cycle and continuous wave on full-thickness excision-type dermal wound healing in hydrocortisone-induced immunosuppressed rats. Results clearly delineated that 810 nm PBM at 10 Hz was more effective over continuous and 100 Hz frequency in accelerating wound healing by attenuating the pro-inflammatory markers (NF-kB, TNF-α, augmenting wound contraction (α-SM actin, enhancing cellular proliferation, ECM deposition, neovascularization (HIF-1α, VEGF, re-epithelialization along with up-regulated protein expression of FGFR-1, Fibronectin, HSP-90 and TGF-β2 as compared to the non-irradiated controls. Additionally, 810 nm laser irradiation significantly increased CCO activity and cellular ATP contents. Overall, the findings from this study might broaden the current biological mechanism that could be responsible for photobiomodulatory effect mediated through pulsed NIR 810 nm laser (10 Hz for promoting dermal wound healing in immunosuppressed subjects.

  14. High-power diode-side-pumped intracavity-frequency-doubled continuous wave 532 nm laser

    International Nuclear Information System (INIS)

    Zhang Yuping; Zhang Huiyun; Zhong Kai; Li Xifu; Wang Peng; Yao Jianquan

    2007-01-01

    An efficient and high-power diode-side-pumped cw 532 nm green laser based on a V-shaped cavity geometry, and capable of generating 22.7 W green radiation with optical conversion efficiency of 8.31%, has been demonstrated. The laser is operated with rms noise amplitude of less than 1% and with M 2 -parameter of about 6.45 at the top of the output power. This laser has the potential for scaling to much higher output power. (authors)

  15. 1.9 W continuous-wave single transverse mode emission from 1060 nm edge-emitting lasers with vertically extended lasing area

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. J., E-mail: jarez.miah@tu-berlin.de; Posilovic, K.; Kalosha, V. P.; Rosales, R.; Bimberg, D. [Institut für Festkörperphysik, Technische Universität Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); Kettler, T. [Institut für Festkörperphysik, Technische Universität Berlin, Hardenbergstr. 36, 10623 Berlin (Germany); PBC Lasers GmbH, Hardenbergstr. 36, 10623 Berlin (Germany); Skoczowsky, D. [PBC Lasers GmbH, Hardenbergstr. 36, 10623 Berlin (Germany); Pohl, J.; Weyers, M. [Ferdinand-Braun-Institut für Höchstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany)

    2014-10-13

    High-brightness edge-emitting semiconductor lasers having a vertically extended waveguide structure emitting in the 1060 nm range are investigated. Ridge waveguide (RW) lasers with 9 μm stripe width and 2.64 mm cavity length yield highest to date single transverse mode output power for RW lasers in the 1060 nm range. The lasers provide 1.9 W single transverse mode optical power under continuous-wave (cw) operation with narrow beam divergences of 9° in lateral and 14° (full width at half maximum) in vertical direction. The beam quality factor M{sup 2} is less than 1.9 up to 1.9 W optical power. A maximum brightness of 72 MWcm{sup −2}sr{sup −1} is obtained. 100 μm wide and 3 mm long unpassivated broad area lasers provide more than 9 W optical power in cw operation.

  16. Generation of 14  W at 589  nm by frequency doubling of high-power CW linearly polarized Raman fiber laser radiation in MgO:sPPLT crystal.

    Science.gov (United States)

    Surin, A A; Borisenko, T E; Larin, S V

    2016-06-01

    We introduce an efficient, single-mode, linearly polarized continuous wave (CW) Raman fiber laser (RFL), operating at 1178 nm, with 65 W maximum output power and a narrow linewidth of 0.1 nm. Single-pass second-harmonic generation was demonstrated using a 20 mm long MgO-doped stoichiometric periodically polled lithium tantalate (MgO:sPPLT) crystal pumped by RFL radiation. Output power of 14 W at 589 nm with 22% conversion efficiency was achieved. The possibility of further power scaling is considered, as no crystal degradation was observed at these power levels.

  17. All-periodically poled, high-power, continuous-wave, single-frequency tunable UV source.

    Science.gov (United States)

    Aadhi, A; Chaitanya N, Apurv; Jabir, M V; Singh, R P; Samanta, G K

    2015-01-01

    We report on experimental demonstration of an all-periodically poled, continuous-wave (CW), high-power, single-frequency, ultra-violet (UV) source. Based on internal second-harmonic-generation (SHG) of a CW singly resonant optical parametric oscillator (OPO) pumped in the green, the UV source provides tunable radiation across 398.94-417.08 nm. The compact source comprising of a 25-mm-long MgO-doped periodically poled stoichiometric lithium tantalate (MgO:sPPLT) crystal of period Λ(SLT)=8.5  μm for OPO and a 5-mm-long, multi-grating (Λ(KTP)=3.3, 3.4, 3.6 and 3.8 μm), periodically poled potassium titanium phosphate (PPKTP) for intra-cavity SHG, provides as much as 336 mW of UV power at 398.94 nm, corresponding to a green-to-UV conversion efficiency of ∼6.7%. In addition, the singly resonant OPO (SRO) provides 840 mW of idler at 1541.61 nm and substantial signal power of 108 mW at 812.33 nm transmitted through the high reflective cavity mirrors. UV source provides single-frequency radiation with instantaneous line-width of ∼18.3  MHz and power >100  mW in Gaussian beam profile (ellipticity >92%) across the entire tuning range. Access to lower UV wavelengths requires smaller grating periods to compensate high phase-mismatch resulting from high material dispersion in the UV wavelength range. Additionally, we have measured the normalized temperature and spectral acceptance bandwidth of PPKTP crystal in the UV wavelength range to be ∼2.25°C·cm and ∼0.15  nm·cm, respectively.

  18. 205 nm continuous-wave laser: application to the measurement of the Lamb shift in hydrogen; Laser continu a 205 nm: application a la mesure du deplacement de lamb dans l'hydrogene

    Energy Technology Data Exchange (ETDEWEB)

    Bourzeix, S

    1995-01-15

    The subject of this thesis is the construction of an experimental set-up, and in particular of a tunable continuous-wave laser at 205 nm, for the measurement of the ground state Lamb shift in atomic hydrogen. Chapter 1 deals with the Lamb shift from a historical point of view, and with the interest of its measurement, for metrology and test of quantum electrodynamics. Chapter 2 is devoted to the theory of the hydrogen atom. The principle of the experiment is based on the comparison of two frequencies which are in a ratio of 4: those of the two-photon transitions of 2S-6S or 2S-6D and 1S-3S. Chapter 3 describes the experimental set-up used to measure the 2S-6D transition which is excited by a titanium-sapphire laser at 820 nm. The 205 nm light required to excite the 1S-3S transition is generated by two frequency-doubling of the titanium-sapphire laser, made in non-linear crystals placed in enhancement cavities. Chapter 4 is entirely devoted to the frequency-doubling. After a recall of non-linear optics, the enhancement cavities are described in detail, as well as the results we achieved. At last chapter 5 describes the research for a signal on the 1S-3S transition: the construction of a ground state atomic beam, and the development of the detection system. This work has led to a preliminary measurement of the ground state Lamb shift in atomic hydrogen: L(1S) = 8172.850 (174) MHz whose result is in very good agreement with both the previous measurements and the most recent theoretical results. (author)

  19. Spherical-wave expansions of piston-radiator fields.

    Science.gov (United States)

    Wittmann, R C; Yaghjian, A D

    1991-09-01

    Simple spherical-wave expansions of the continuous-wave fields of a circular piston radiator in a rigid baffle are derived. These expansions are valid throughout the illuminated half-space and are useful for efficient numerical computation in the near-field region. Multipole coefficients are given by closed-form expressions which can be evaluated recursively.

  20. Cw hyper-Raman laser and four-wave mixing in atomic sodium

    Science.gov (United States)

    Klug, M.; Kablukov, S. I.; Wellegehausen, B.

    2005-01-01

    Continuous wave hyper-Raman (HR) generation in a ring cavity on the 6s → 4p transition at 1640 nm in sodium is realized for the first time by two-photon excitation of atomic sodium on the 3s → 6s transition with a continuous wave (cw) dye laser at 590 nm and a single frequency argon ion laser at 514 nm. It is shown, that the direction and efficiency of HR lasing depends on the propagation direction of the pump waves and their frequencies. More than 30% HR gain is measured at 250 mW of pump laser powers for counter-propagating pump waves and a medium length of 90 mm. For much shorter interaction lengths and corresponding focussing of the pump waves a dramatic increase of the gain is predicted. For co-propagating pump waves, in addition, generation of 330 nm radiation on the 4p → 3s transition by a four-wave mixing (FWM) process is observed. Dependencies of HR and parametric four-wave generation have been investigated and will be discussed.

  1. Modification of genetic effects of gamma radiation by laser radiation

    International Nuclear Information System (INIS)

    Khotyljova, L.V.; Khokhlova, S.A.; Khokhlov, I.V.

    1988-01-01

    Full text: Mutants obtained by means of ionizing radiation and chemical mutagens often show low viability and productivity that makes their use in plant breeding difficult. Methods reducing the destructive mutagen action on important functions of plant organism and increasing quality and practical value of induced mutants would be interesting. We believe that one method for increasing efficiency of experimental mutagenesis in plants is the application of laser radiation as a modificator of genetic effects of ionizing radiation and chemical mutagens. Combined exposure of wheat seedlings to a gamma radiation dose of 2 kR and to laser radiation with the wave length of 632.8 nm (power density - 20 mVt/cm 2 , exposure - 30 min.) resulted in reducing the chromosomal aberration percentage from 30.5% in the gamma version to 16.3% in the combined treatment version. A radiosensibilizing effect was observed at additional exposure of gamma irradiated wheat seeds to laser light with the wave length of 441.6 nm where chromosomal aberration percentage increased from 22% in the gamma-irradiation version to 31% in the combined treatment version. By laser radiation it is also possible to normalize mitotic cell activity suppressed by gamma irradiation. Additional seedling irradiation with the light of helium-neon laser (632.8 nm) resulted in recovery of mitotic cell activity from 21% to 62% and increasing the average content of DNA per nucleus by 10%. The influence of only laser radiation on plant variability was also studied and it was shown that irradiation of wheat seeds and seedlings with pulsed and continuous laser light of visible spectrum resulted in phenotypically altered forms in M 2 . Their frequencies was dependent upon power density, dose and radiation wave length. Number of altered forms increased in going from long-wave to short-wave spectrum region. In comparing efficiency of different laser types of pulsed and continuous exposure (dose - 180 J/cm 2 ) 2% of altered

  2. Efficiency of different methods of extra-cavity second harmonic generation of continuous wave single-frequency radiation.

    Science.gov (United States)

    Khripunov, Sergey; Kobtsev, Sergey; Radnatarov, Daba

    2016-01-20

    This work presents for the first time to the best of our knowledge a comparative efficiency analysis among various techniques of extra-cavity second harmonic generation (SHG) of continuous-wave single-frequency radiation in nonperiodically poled nonlinear crystals within a broad range of power levels. Efficiency of nonlinear radiation transformation at powers from 1 W to 10 kW was studied in three different configurations: with an external power-enhancement cavity and without the cavity in the case of single and double radiation pass through a nonlinear crystal. It is demonstrated that at power levels exceeding 1 kW, the efficiencies of methods with and without external power-enhancement cavities become comparable, whereas at even higher powers, SHG by a single or double pass through a nonlinear crystal becomes preferable because of the relatively high efficiency of nonlinear transformation and fairly simple implementation.

  3. Soliton radiation beat analysis of optical pulses generated from two continuous-wave lasers

    Science.gov (United States)

    Zajnulina, M.; Böhm, M.; Blow, K.; Rieznik, A. A.; Giannone, D.; Haynes, R.; Roth, M. M.

    2015-10-01

    We propose a fibre-based approach for generation of optical frequency combs (OFCs) with the aim of calibration of astronomical spectrographs in the low and medium-resolution range. This approach includes two steps: in the first step, an appropriate state of optical pulses is generated and subsequently moulded in the second step delivering the desired OFC. More precisely, the first step is realised by injection of two continuous-wave (CW) lasers into a conventional single-mode fibre, whereas the second step generates a broad OFC by using the optical solitons generated in step one as initial condition. We investigate the conversion of a bichromatic input wave produced by two initial CW lasers into a train of optical solitons, which happens in the fibre used as step one. Especially, we are interested in the soliton content of the pulses created in this fibre. For that, we study different initial conditions (a single cosine-hump, an Akhmediev breather, and a deeply modulated bichromatic wave) by means of soliton radiation beat analysis and compare the results to draw conclusion about the soliton content of the state generated in the first step. In case of a deeply modulated bichromatic wave, we observed the formation of a collective soliton crystal for low input powers and the appearance of separated solitons for high input powers. An intermediate state showing the features of both, the soliton crystal and the separated solitons, turned out to be most suitable for the generation of OFC for the purpose of calibration of astronomical spectrographs.

  4. Continuous wave and AO Q-switch operation Tm,Ho:YAP laser pumped by a laser diode of 798 nm

    International Nuclear Information System (INIS)

    Li, L J; Yao, B Q; Song, C W; Wang, Y Z; Wang, Z G

    2009-01-01

    Continuous wave (CW) and acousto-optical (AO) Q-switch operation of Tm (5 at.%), Ho (0.3 at.%):YAP laser at 2.13 μm wavelength were reported in this paper. The Tm,Ho:YAP crystal was cooled by liquid nitrogen and double-end-pumped by a 14.2 W fiber-coupled laser diode at 798 nm. Different resonator lengths and output couplers for the pump power were tried. A maximum conversion efficiency of 31.3% and a maximum slope efficiency of 35.2% were acquired with CW output power of 4.45 W. Average power of 4.21 W was obtained at pulse repetition frequency (PRF) of 15 kHz, corresponding to an optical-to-optical conversion efficiency of 29.6% and a slope efficiency of 32.4%. The energy per pulse of 2.3 mJ in 64 ns was achieved at 1.5 kHz with the peak power of 35.8 kW

  5. Diode-pumped continuous-wave eye-safe Nd:YAG laser at 1415 nm.

    Science.gov (United States)

    Lee, Hee Chul; Byeon, Sung Ug; Lukashev, Alexei

    2012-04-01

    We describe the output performance of the 1415 nm emission in Nd:YAG in a plane-concave cavity under traditional pumping into the 4F5/2 level (808 nm) and direct in-band pumping into the 4F3/2 level (885 nm). An end-pumped Nd:YAG laser yielded maximum cw output power of 6.3 W and 4.2 W at 885 nm and 808 nm laser diode (LD) pumping, respectively. To the best of our knowledge, this is the highest output power of a LD-pumped 1415 nm laser.

  6. CHROMOSPHERIC HEATING BY ACOUSTIC WAVES COMPARED TO RADIATIVE COOLING

    Energy Technology Data Exchange (ETDEWEB)

    Sobotka, M.; Heinzel, P.; Švanda, M.; Jurčák, J. [Astronomical Institute, Academy of Sciences of the Czech Republic (v.v.i.), Fričova 298, 25165 Ondřejov (Czech Republic); Del Moro, D.; Berrilli, F. [Department of Physics, University of Roma Tor Vergata, Via della Ricerca Scientifica 1, I-00133 Rome (Italy)

    2016-07-20

    Acoustic and magnetoacoustic waves are among the possible candidate mechanisms that heat the upper layers of the solar atmosphere. A weak chromospheric plage near the large solar pore NOAA 11005 was observed on 2008 October 15, in the Fe i 617.3 nm and Ca ii 853.2 nm lines of the Interferometric Bidimemsional Spectrometer attached to the Dunn Solar Telescope. In analyzing the Ca ii observations (with spatial and temporal resolutions of 0.″4 and 52 s) the energy deposited by acoustic waves is compared to that released by radiative losses. The deposited acoustic flux is estimated from the power spectra of Doppler oscillations measured in the Ca ii line core. The radiative losses are calculated using a grid of seven one-dimensional hydrostatic semi-empirical model atmospheres. The comparison shows that the spatial correlation of the maps of radiative losses and acoustic flux is 72%. In a quiet chromosphere, the contribution of acoustic energy flux to radiative losses is small, only about 15%. In active areas with a photospheric magnetic-field strength between 300 and 1300 G and an inclination of 20°–60°, the contribution increases from 23% (chromospheric network) to 54% (a plage). However, these values have to be considered as lower limits and it might be possible that the acoustic energy flux is the main contributor to the heating of bright chromospheric network and plages.

  7. Diode-pumped quasi-three-level Nd:GdV O4–Nd:YAG sum-frequency laser at 464 nm

    International Nuclear Information System (INIS)

    Lu, Jie

    2014-01-01

    We report a laser architecture to obtain continuous-wave (cw) blue radiation at 464 nm. A 808 nm diode pumped a Nd:GdV O 4 crystal emitting at 912 nm. A part of the pump power was then absorbed by the Nd:GdV O 4 crystal. The remainder was used to pump a Nd:YAG crystal emitting at 946 nm. Intracavity sum-frequency mixing at 912 and 946 nm was then realized in a LiB 3 O 5 (LBO) crystal to produce blue radiation. We obtained a cw output power of 1.52 W at 464 nm with a pump laser diode emitting 18.4 W at 808 nm. (letter)

  8. Broadband multi-wavelength Brillouin lasers with an operating wavelength range of 1500–1600 nm generated by four-wave mixing in a dual wavelength Brillouin fiber laser cavity

    Science.gov (United States)

    Li, Q.; Jia, Z. X.; Weng, H. Z.; Li, Z. R.; Yang, Y. D.; Xiao, J. L.; Chen, S. W.; Huang, Y. Z.; Qin, W. P.; Qin, G. S.

    2018-05-01

    We demonstrate broadband multi-wavelength Brillouin lasers with an operating wavelength range of 1500–1600 nm and a frequency separation of ~9.28 GHz generated by four-wave mixing in a dual wavelength Brillouin fiber laser cavity. By using one continuous-wave laser as the pump source, multi-wavelength Brillouin lasers with an operating wavelength range of 1554–1574 nm were generated via cascaded Brillouin scattering and four-wave mixing. Interestingly, when pumped by two continuous-wave lasers with an appropriate frequency separation, the operating wavelength range of the multi-wavelength Brillouin lasers was increased to 1500–1600 nm due to cavity-enhanced cascaded four-wave mixing among the frequency components generated by two pump lasers in the dual wavelength Brillouin laser cavity.

  9. Tunable, continuous-wave, ultraviolet source based on intracavity sum-frequency-generation in an optical parametric oscillator using BiB₃O₆.

    Science.gov (United States)

    Devi, Kavita; Kumar, S Chaitanya; Ebrahim-Zadeh, M

    2013-10-21

    We report a continuous-wave (cw) source of tunable radiation across 333-345 nm in the ultraviolet (UV) using bismuth triborate, BiB₃O₆ (BIBO) as the nonlinear gain material. The source is based on internal sum-frequency-generation (SFG) in a cw singly-resonant optical parametric oscillator (OPO) pumped at 532 nm. The compact tunable source employs a 30-mm-long MgO:sPPLT crystal as the OPO gain medium and a 5-mm-long BIBO crystal for intracavity SFG of the signal and pump, providing up to 21.6 mW of UV power at 339.7 nm, with >15 mW over 64% of the SFG tuning range. The cw OPO is also tunable across 1158-1312 nm in the idler, delivering as much as 1.7 W at 1247 nm, with >1W over 65% of the tuning range. The UV output at maximum power exhibits passive power stability better than 3.4% rms and frequency stability of 193 GHz over more than one minute.

  10. Production of narrowband tunable extreme-ultraviolet radiation by noncollinear resonance-enhanced four-wave mixing

    NARCIS (Netherlands)

    Hannemann, S.; Hollenstein, U.; van Duijn, E.J.; Ubachs, W.M.G.

    2005-01-01

    Fourier-transform-limited extreme-ultraviolet (XUV) radiation (bandwidth ≲300 MHz) tunable around 91 nm is produced by use of two-photon resonance-enhanced four-wave mixing on the Kr resonance at 94 093 cm

  11. Mechanism and computational model for Lyman-α-radiation generation by high-intensity-laser four-wave mixing in Kr-Ar gas

    Science.gov (United States)

    Louchev, Oleg A.; Bakule, Pavel; Saito, Norihito; Wada, Satoshi; Yokoyama, Koji; Ishida, Katsuhiko; Iwasaki, Masahiko

    2011-09-01

    We present a theoretical model combined with a computational study of a laser four-wave mixing process under optical discharge in which the non-steady-state four-wave amplitude equations are integrated with the kinetic equations of initial optical discharge and electron avalanche ionization in Kr-Ar gas. The model is validated by earlier experimental data showing strong inhibition of the generation of pulsed, tunable Lyman-α (Ly-α) radiation when using sum-difference frequency mixing of 212.6 nm and tunable infrared radiation (820-850 nm). The rigorous computational approach to the problem reveals the possibility and mechanism of strong auto-oscillations in sum-difference resonant Ly-α generation due to the combined effect of (i) 212.6-nm (2+1)-photon ionization producing initial electrons, followed by (ii) the electron avalanche dominated by 843-nm radiation, and (iii) the final breakdown of the phase matching condition. The model shows that the final efficiency of Ly-α radiation generation can achieve a value of ˜5×10-4 which is restricted by the total combined absorption of the fundamental and generated radiation.

  12. Mechanism and computational model for Lyman-{alpha}-radiation generation by high-intensity-laser four-wave mixing in Kr-Ar gas

    Energy Technology Data Exchange (ETDEWEB)

    Louchev, Oleg A.; Saito, Norihito; Wada, Satoshi [Advanced Science Institute, RIKEN, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Bakule, Pavel [STFC, ISIS Facility, Rutherford Appleton Laboratory, Chilton, Oxfordshire OX11 0QX (United Kingdom); Yokoyama, Koji [Advanced Science Institute, RIKEN, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Advanced Meson Science Laboratory, RIKEN Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); Ishida, Katsuhiko; Iwasaki, Masahiko [Advanced Meson Science Laboratory, RIKEN Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan)

    2011-09-15

    We present a theoretical model combined with a computational study of a laser four-wave mixing process under optical discharge in which the non-steady-state four-wave amplitude equations are integrated with the kinetic equations of initial optical discharge and electron avalanche ionization in Kr-Ar gas. The model is validated by earlier experimental data showing strong inhibition of the generation of pulsed, tunable Lyman-{alpha} (Ly-{alpha}) radiation when using sum-difference frequency mixing of 212.6 nm and tunable infrared radiation (820-850 nm). The rigorous computational approach to the problem reveals the possibility and mechanism of strong auto-oscillations in sum-difference resonant Ly-{alpha} generation due to the combined effect of (i) 212.6-nm (2+1)-photon ionization producing initial electrons, followed by (ii) the electron avalanche dominated by 843-nm radiation, and (iii) the final breakdown of the phase matching condition. The model shows that the final efficiency of Ly-{alpha} radiation generation can achieve a value of {approx}5x10{sup -4} which is restricted by the total combined absorption of the fundamental and generated radiation.

  13. Continuous-wave terahertz light from optical parametric oscillators

    Energy Technology Data Exchange (ETDEWEB)

    Sowade, Rosita

    2010-12-15

    Continuous-wave (cw) optical parametric oscillators (OPOs) are working horses for spectroscopy in the near and mid infrared. However, in the terahertz frequency range (0.1 to 10 THz), the pump threshold is more than 100 W due to the high absorption in nonlinear crystals and thus exceeds the power of standard cw single-frequency pump sources. In this thesis the first cw OPO capable of generating terahertz radiation is demonstrated. To overcome the high threshold, the signal wave of a primary infrared process is resonantly enhanced to serve as the pump wave for a cascaded parametric process with one wave being at the terahertz frequency level. A terahertz output power of more than two microwatts is measured and tuning is achieved from 1.3 to 1.7 THz. This terahertz source emits a narrow-band, diffraction-limited beam which remains mode-hop free over more than one hour. Such a device inhibits high potential for applications in areas like astronomy, telecommunications or high-resolution spectroscopy. (orig.)

  14. Continuous-wave terahertz light from optical parametric oscillators

    International Nuclear Information System (INIS)

    Sowade, Rosita

    2010-12-01

    Continuous-wave (cw) optical parametric oscillators (OPOs) are working horses for spectroscopy in the near and mid infrared. However, in the terahertz frequency range (0.1 to 10 THz), the pump threshold is more than 100 W due to the high absorption in nonlinear crystals and thus exceeds the power of standard cw single-frequency pump sources. In this thesis the first cw OPO capable of generating terahertz radiation is demonstrated. To overcome the high threshold, the signal wave of a primary infrared process is resonantly enhanced to serve as the pump wave for a cascaded parametric process with one wave being at the terahertz frequency level. A terahertz output power of more than two microwatts is measured and tuning is achieved from 1.3 to 1.7 THz. This terahertz source emits a narrow-band, diffraction-limited beam which remains mode-hop free over more than one hour. Such a device inhibits high potential for applications in areas like astronomy, telecommunications or high-resolution spectroscopy. (orig.)

  15. Ultralow power continuous-wave frequency conversion in hydrogenated amorphous silicon waveguides.

    Science.gov (United States)

    Wang, Ke-Yao; Foster, Amy C

    2012-04-15

    We demonstrate wavelength conversion through nonlinear parametric processes in hydrogenated amorphous silicon (a-Si:H) with maximum conversion efficiency of -13 dB at telecommunication data rates (10 GHz) using only 15 mW of pump peak power. Conversion bandwidths as large as 150 nm (20 THz) are measured in continuous-wave regime at telecommunication wavelengths. The nonlinear refractive index of the material is determined by four-wave mixing (FWM) to be n(2)=7.43×10(-13) cm(2)/W, approximately an order of magnitude larger than that of single crystal silicon. © 2012 Optical Society of America

  16. Comparison of the ablation ability of nucleus pulposus after 1,064 nm Nd:YAG laser and 980 nm diode laser radiation.

    Science.gov (United States)

    Yin, Jian; Han, Zhengfeng; Guo, Baofeng; Guo, Han; Zhang, Tongtong; Zeng, Yanjun; Ren, Longxi

    2015-07-01

    To compare the ablation ability of nucleus pulposus after 1,064 nm Nd:YAG laser and 980 nm diode laser radiation. Goat spine specimen (GSS) was radiated using Nd:YAG laser and 980 nm diode laser and then divided into five groups based on the final energy--200, 400, 600, 800 and 1,000 J groups. The ablation quality of nucleus pulposus after radiation was recorded. The ablation quality of GSS was greater at higher radiation energies in both lasers. When compared at the same energy level, the ablation quality of GSS was greater in 980 nm diode laser than in 1,064 nm Nd:YAG laser. Statistical significance was observed in 200 and 400 J groups (P diode laser showed better ablation ability than 1,064 nm Nd:YAG laser.

  17. 20 W continuous-wave cladding-pumped Nd-doped fiber laser at 910 nm.

    Science.gov (United States)

    Laroche, M; Cadier, B; Gilles, H; Girard, S; Lablonde, L; Robin, T

    2013-08-15

    We demonstrate a double-clad fiber laser operating at 910 nm with a record power of 20 W. Laser emission on the three-level scheme is enabled by the combination of a small inner cladding-to-core diameter ratio and a high brightness pump source at 808 nm. A laser conversion efficiency as high as 44% was achieved in CW operating regime by using resonant fiber Bragg reflectors at 910 nm that prevent the lasing at the 1060 nm competing wavelength. Furthermore, in a master oscillator power-amplifier scheme, an amplified power of 14.8 W was achieved at 914 nm in the same fiber.

  18. Spectrally resolved, broadband frequency response characterization of photodetectors using continuous-wave supercontinuum sources

    Science.gov (United States)

    Choudhury, Vishal; Prakash, Roopa; Nagarjun, K. P.; Supradeepa, V. R.

    2018-02-01

    A simple and powerful method using continuous wave supercontinuum lasers is demonstrated to perform spectrally resolved, broadband frequency response characterization of photodetectors in the NIR Band. In contrast to existing techniques, this method allows for a simple system to achieve the goal, requiring just a standard continuous wave(CW) high-power fiber laser source and an RF spectrum analyzer. From our recent work, we summarize methods to easily convert any high-power fiber laser into a CW supercontinuum. These sources in the time domain exhibit interesting properties all the way down to the femtosecond time scale. This enables measurement of broadband frequency response of photodetectors while the wide optical spectrum of the supercontinuum can be spectrally filtered to obtain this information in a spectrally resolved fashion. The method involves looking at the RF spectrum of the output of a photodetector under test when incident with the supercontinuum. By using prior knowledge of the RF spectrum of the source, the frequency response can be calculated. We utilize two techniques for calibration of the source spectrum, one using a prior measurement and the other relying on a fitted model. Here, we characterize multiple photodetectors from 150MHz bandwidth to >20GHz bandwidth at multiple bands in the NIR region. We utilize a supercontinuum source spanning over 700nm bandwidth from 1300nm to 2000nm. For spectrally resolved measurement, we utilize multiple wavelength bands such as around 1400nm and 1600nm. Interesting behavior was observed in the frequency response of the photodetectors when comparing broadband spectral excitation versus narrower band excitation.

  19. Radiation phenomena of plasma waves, 1

    International Nuclear Information System (INIS)

    Ohnuma, Toshiro.

    1978-06-01

    The fundamental radiation theories on radiation phenomena of plasma waves are presented. As the fundamental concepts of propagating waves, phase, group and ray velocities are explained, and phase velocity surface, group velocity surface, ray velocity surface and refractive index surface are considered. These concepts are important in anisotropic plasma. Fundamental equations for electron plasma waves in a fluid model and fundamental equations for ion plasma waves can be expressed with the above mentioned concepts. Kuehl derived the formulas for general radiation fields of electromagnetic and electrostatic waves which are radiated from an arbitrary current source. Fundamental equations for kinetic model are the Vlasov equation and Maxwell equations. By investigating electromagnetic radiation in cold anisotropic plasma, Kuehl found the important behavior that the fields radiated from a source become very large in certain directions for some ranges of plasma parameters. The fact is the so-called high frequency resonance cone. A fundamental formula for quasi-static radiation from an oscillating point source in warm anisotropic plasma includes the near field of electromagnetic mode and the field of electrostatic mode, which are radiated from the source. This paper presents the formula in a generalized form. (Kato, T.)

  20. Diode laser in-band pumped, efficient 1645 nm continuous-wave and Q-switched Er:YLuAG lasers with near-diffraction-limited beam quality

    International Nuclear Information System (INIS)

    Li, Jing; Yang, SuHui; He, Tao

    2014-01-01

    Fiber-like Er:YLuAG laser rods were tested for continuous-wave (CW) and Q-switched operation. Two narrow-band laser diodes emitting at 1532 nm were used as pump sources. The pump power was confined in the laser rods via total internal reflection. In CW mode, a maximum output power of 7.2 W was measured from a 30 mm long Er:YLuAG laser rod, corresponding to an optical–optical efficiency of 26% and a slope efficiency of 78%. Er:YLuAG and Er:YAG lasers were compared experimentally and exhibited comparable performance, while the measured central wavelength of the Er:YLuAG laser was 1644.75 nm, slightly longer than the central wavelength of the Er:YAG laser in the same experimental circumstances. In Q-switched mode, an output energy of 3.5 mJ was obtained from a 25 mm Er:YLuAG laser rod with a pulse duration of 100 ns and a pulse repetition frequency of 100 Hz. The pulsed output had near-diffraction-limited beam quality with M 2 values of 1.13 and 1.11 in the x and y directions, respectively. (letter)

  1. Efficient continuous-wave, broadly tunable and passive Q-switching lasers based on a Tm3+:CaF2 crystal

    Science.gov (United States)

    Liu, Jingjing; Zhang, Cheng; Zu, Yuqian; Fan, Xiuwei; Liu, Jie; Guo, Xinsheng; Qian, Xiaobo; Su, Liangbi

    2018-04-01

    Laser operations in the continuous-wave as well as in the pulsed regime of a 4 at.% Tm3+:CaF2 crystal are reported. For the continuous-wave operation, a maximum average output power of 1.15 W was achieved, and the corresponding slope efficiency was more than 64%. A continuous tuning range of about 160 nm from 1877-2036 nm was achieved using a birefringent filter. Using Argentum nanorods as a saturable absorber, the significant pulsed operation of a passively Q-switched Tm3+:CaF2 laser was observed at 1935.4 nm for the first time, to the best of our knowledge. A maximum output power of 385 mW with 41.4 µJ pulse energy was obtained under an absorbed pump power of 2.04 W. The present results indicate that the Tm3+:CaF2 lasers could be promising laser sources to operate in the eye-safe spectral region.

  2. CW light sources at the 589 nm sodium D2 line by sum-frequency mixing of diode pumped neodymium lasers

    International Nuclear Information System (INIS)

    Lü, Y F; Lu, J; Xu, L J; Sun, G C; Zhao, Z M; Gao, X; Lin, J Q

    2010-01-01

    We present a laser architecture to obtain continuous-wave (CW) light sources at the 589 nm sodium D2 line. A 808 nm diode-pumped a Nd:YLiF 4 (Nd:YLF) crystal emitting at 1053 nm. A part of the pump power was then absorbed by the Nd:YLF crystal. The remaining was used to pump a Nd:YAG crystal emitting at 1338 nm. Intracavity sum-frequency mixing at 1053 and 1338 nm was then realized in a LiB 3 O 5 (LBO) crystal to reach the yellow-orange radiation. We obtained a CW output power of 235 mW at 589 nm with a pump laser diode emitting 17.8 W at 808 nm

  3. High-efficiency frequency doubling of continuous-wave laser light.

    Science.gov (United States)

    Ast, Stefan; Nia, Ramon Moghadas; Schönbeck, Axel; Lastzka, Nico; Steinlechner, Jessica; Eberle, Tobias; Mehmet, Moritz; Steinlechner, Sebastian; Schnabel, Roman

    2011-09-01

    We report on the observation of high-efficiency frequency doubling of 1550 nm continuous-wave laser light in a nonlinear cavity containing a periodically poled potassium titanyl phosphate crystal (PPKTP). The fundamental field had a power of 1.10 W and was converted into 1.05 W at 775 nm, yielding a total external conversion efficiency of 95±1%. The latter value is based on the measured depletion of the fundamental field being consistent with the absolute values derived from numerical simulations. According to our model, the conversion efficiency achieved was limited by the nonperfect mode matching into the nonlinear cavity and by the nonperfect impedance matching for the maximum input power available. Our result shows that cavity-assisted frequency conversion based on PPKTP is well suited for low-decoherence frequency conversion of quantum states of light.

  4. Broadband light generation at ~1300 nm through spectrally recoiled solitons and dispersive waves

    DEFF Research Database (Denmark)

    Falk, Peter Andreas; Frosz, Michael Henoch; Bang, Ole

    2008-01-01

    We experimentally study the generation of broadband light at ~1300 nm from an 810 nm Ti:sapphire femtosecond pump laser. We use two photonic crystal fibers with a second infrared zero-dispersion wavelength (λZ2) and compare the efficiency of two schemes: in one fiber λZ2=1400 nm and the light...... at 1300 nm is composed of spectrally recoiled solitons; in the other fiber λZ2=1200 nm and the light at 1300 nm is composed of dispersive waves....

  5. Towards terahertz detection and calibration through spontaneous parametric down-conversion in the terahertz idler-frequency range generated by a 795 nm diode laser system

    Directory of Open Access Journals (Sweden)

    Vladimir V. Kornienko

    2018-05-01

    Full Text Available We study a calibration scheme for terahertz wave nonlinear-optical detectors based on spontaneous parametric down-conversion. Contrary to the usual low wavelength pump in the green, we report here on the observation of spontaneous parametric down-conversion originating from an in-growth poled lithium niobate crystal pumped with a continuous wave 50 mW, 795 nm diode laser system, phase-matched to a terahertz frequency idler wave. Such a system is more compact and allows for longer poling periods as well as lower losses in the crystal. Filtering the pump radiation by a rubidium-87 vapor cell allowed the frequency-angular spectra to be obtained down to ∼0.5 THz or ∼1 nm shift from the pump radiation line. The presence of an amplified spontaneous emission “pedestal” in the diode laser radiation spectrum significantly hampers the observation of spontaneous parametric down-conversion spectra, in contrast to conventional narrowband gas lasers. Benefits of switching to longer pump wavelengths are pointed out, such as collinear optical-terahertz phase-matching in bulk crystals.

  6. Towards terahertz detection and calibration through spontaneous parametric down-conversion in the terahertz idler-frequency range generated by a 795 nm diode laser system

    Science.gov (United States)

    Kornienko, Vladimir V.; Kitaeva, Galiya Kh.; Sedlmeir, Florian; Leuchs, Gerd; Schwefel, Harald G. L.

    2018-05-01

    We study a calibration scheme for terahertz wave nonlinear-optical detectors based on spontaneous parametric down-conversion. Contrary to the usual low wavelength pump in the green, we report here on the observation of spontaneous parametric down-conversion originating from an in-growth poled lithium niobate crystal pumped with a continuous wave 50 mW, 795 nm diode laser system, phase-matched to a terahertz frequency idler wave. Such a system is more compact and allows for longer poling periods as well as lower losses in the crystal. Filtering the pump radiation by a rubidium-87 vapor cell allowed the frequency-angular spectra to be obtained down to ˜0.5 THz or ˜1 nm shift from the pump radiation line. The presence of an amplified spontaneous emission "pedestal" in the diode laser radiation spectrum significantly hampers the observation of spontaneous parametric down-conversion spectra, in contrast to conventional narrowband gas lasers. Benefits of switching to longer pump wavelengths are pointed out, such as collinear optical-terahertz phase-matching in bulk crystals.

  7. Continuous terahertz-wave generation using a monolithically integrated horn antenna

    Science.gov (United States)

    Peytavit, E.; Beck, A.; Akalin, T.; Lampin, J.-F.; Hindle, F.; Yang, C.; Mouret, G.

    2008-09-01

    A transverse electromagnetic horn antenna is monolithically integrated with a standard ultrafast interdigitated electrode photodetector on low-temperature-grown GaAs. Continuous-wave terahertz radiation is generated at frequencies up to 2 THz with a maximum power of approximately 1 μW at 780 GHz. Experimental variations in the terahertz power as function of the frequency are explained by means of electromagnetic simulations of the antenna and the photomixer vicinity.

  8. Photoionization pathways and thresholds in generation of Lyman-α radiation by resonant four-wave mixing in Kr-Ar mixture

    OpenAIRE

    Oleg A. Louchev; Norihito Saito; Yu Oishi; Koji Miyazaki; Kotaro Okamura; Jumpei Nakamura; Masahiko Iwasaki; Satoshi Wada

    2016-01-01

    We develop a set of analytical approximations for the estimation of the combined effect of various photoionization processes involved in the resonant four-wave mixing generation of ns pulsed Lyman-α (L-α) radiation by using 212.556 nm and 820-845 nm laser radiation pulses in Kr-Ar mixture: (i) multi-photon ionization, (ii) step-wise (2+1)-photon ionization via the resonant 2-photon excitation of Kr followed by 1-photon ionization and (iii) laser-induced avalanche ionization produced by genera...

  9. Evaluation of cellular effects of pulsed and continuous wave radiofrequency radiation

    International Nuclear Information System (INIS)

    Pavicic, Ivan; Trosic, Ivancica

    2008-01-01

    Full text: In less than twenty years, the mobile telephone has gone from being rare, expensive equipment of the business elite to a pervasive, low-cost personal item. Since the introduction of mobile phones, concerns have been raised about the potential detrimental impacts on living beings from regular use. The first 'modern' network technology on second generation cellular technology was launched in 1991 in Finland on the Global System for Mobile Communications (GSM) standard. This study evaluates cellular effects of, both, continuous (CW) and pulsed GSM modulated waves (PW). Continuous cell culture of Chinese hamster lung cells, line V79, was used in this study. Cell growth and colony forming ability (CFA) was analyzed after 1, 2 and 3 hours of exposure to the both frequency fields, 935 MHz CW and 915 MHz PW. Selected frequency fields were generated inside gigahertz transversal electromagnetic mode cell (GTEM) equipped with the signal generators. Hewlett Packard HP8657A signal generator was used to generate CW 935 MHz frequency field. Anritzu MS2711B spectrum analyzer with tracking generator and Micro devices RF 3146 power amplifier module generated PW radiofrequency field of 915 MHz. Averaged specific absorption rate (SAR) belonging to the CW 935 MHz frequency field was calculated to be 0.12 W/kg, and for GSM modulated 915 MHz field was 0.23 W/kg. Cell samples were irradiated in triplicate. The sham exposed control cell samples were included in the study. The temperature inside the exposure set-up was recorded in ten-minute intervals through the irradiation treatment. Both, sham-exposed and exposed cell samples were kept in the same condition, except in the time of irradiation for experimental samples when signal generator was switched on. To determine cell growth, V79 samples were plated in concentration of 1x10 4 cells/mL. Cells were maintained in the standard laboratory conditions, which are humidified atmosphere, 37 C degrees, and 5% CO 2 . Cell

  10. Wave energy budget analysis in the Earth's radiation belts uncovers a missing energy.

    Science.gov (United States)

    Artemyev, A V; Agapitov, O V; Mourenas, D; Krasnoselskikh, V V; Mozer, F S

    2015-05-15

    Whistler-mode emissions are important electromagnetic waves pervasive in the Earth's magnetosphere, where they continuously remove or energize electrons trapped by the geomagnetic field, controlling radiation hazards to satellites and astronauts and the upper-atmosphere ionization or chemical composition. Here, we report an analysis of 10-year Cluster data, statistically evaluating the full wave energy budget in the Earth's magnetosphere, revealing that a significant fraction of the energy corresponds to hitherto generally neglected very oblique waves. Such waves, with 10 times smaller magnetic power than parallel waves, typically have similar total energy. Moreover, they carry up to 80% of the wave energy involved in wave-particle resonant interactions. It implies that electron heating and precipitation into the atmosphere may have been significantly under/over-valued in past studies considering only conventional quasi-parallel waves. Very oblique waves may turn out to be a crucial agent of energy redistribution in the Earth's radiation belts, controlled by solar activity.

  11. High-efficiency generation of pulsed Lyman-α radiation by resonant laser wave mixing in low pressure Kr-Ar mixture.

    Science.gov (United States)

    Saito, Norihito; Oishi, Yu; Miyazaki, Koji; Okamura, Kotaro; Nakamura, Jumpei; Louchev, Oleg A; Iwasaki, Masahiko; Wada, Satoshi

    2016-04-04

    We report an experimental generation of ns pulsed 121.568 nm Lyman-α radiation by the resonant nonlinear four-wave mixing of 212.556 nm and 845.015 nm radiation pulses providing a high conversion efficiency 1.7x10-3 with the output pulse energy 3.6 μJ achieved using a low pressure Kr-Ar mixture. Theoretical analysis shows that this efficiency is achieved due to the advantage of using (i) the high input laser intensities in combination with (ii) the low gas pressure allowing us to avoid the onset of full-scale discharge in the laser focus. In particular, under our experimental conditions the main mechanism of photoionization caused by the resonant 2-photon 212.556 nm radiation excitation of Kr atoms followed by the 1-photon ionization leads to ≈17% loss of Kr atoms and efficiency loss only by the end of the pulse. The energy of free electrons, generated by 212.556 nm radiation via (2 + 1)-photon ionization and accelerated mainly by 845.015 nm radiation, remains during the pulse below the level sufficient for the onset of full-scale discharge by the electron avalanche. Our analysis also suggests that ≈30-fold increase of 845.015 nm pulse energy can allow one to scale up the L-α radiation pulse energy towards the level of ≈100 μJ.

  12. Comparative mutagenesis and interaction between near-ultraviolet (313- to 405-nm) and far-ultraviolet (254-nm) radiation in Escherichia coli strains with differing repair capabilities

    International Nuclear Information System (INIS)

    Turner, M.A.; Webb, R.B.

    1981-01-01

    Comparative mutagenesis and possible synergistic interaction between broad-spectrum (313- to 405-nm) near-ultraviolet (black light bulb [BLB]) radiation and 254-nm radiation were studied in Escherichia coli strains WP2 (wild type), WP2s (uvrA), WP10 (recA), WP6 (polA), WP6s (polA uvrA), WP100 (uvrA recA), and WP5 (lexA). With BLB radiation, strains WP2s and WP6s demonstrated a high level of mutagenesis, whereas strains WP2, WP5, WP6, WP10, and WP100 did not demonstrate significant mutagenesis. In contrast, 254-nm radiation was mutagenic in strains WP2, WP2s, WP6, and WP6s, but strains WP5, WP10, and WP100 were not significantly mutated. The absence of mutagenesis by BLB radiation in lexA and recA strains WP10, WP5, and WP100 suggests that lex + rec + repair may play a major role in mutagenesis by both BLB and 254-nm radiation. The hypothesis that BLB radiation selectively inhibits rec + lex + repair was tested by sequential BLB-254 nm radiation. With strain WP2, a fluence of 30 J/m 2 at 254 nm induced trp + revertants at a frequency of 15 x 10 -6 . However, when 10 5 J/m 2 or more BLB radiation preceded the 254-nm exposure, no trp + revertants could be detected. A similar inhibition of 254-nm mutagenesis was observed with strain WP6 (polA). However, strains WP2s (uvrA) and WP6s (polA uvrA) showed enhanced 254-nm mutagenesis when a prior exposure to BLB radiation was given

  13. A high power, continuous-wave, single-frequency fiber amplifier at 1091 nm and frequency doubling to 545.5 nm

    International Nuclear Information System (INIS)

    Stappel, M; Steinborn, R; Kolbe, D; Walz, J

    2013-01-01

    We present a high power single-frequency ytterbium fiber amplifier system with an output power of 30 W at 1091 nm. The amplifier system consists of two stages, a preamplifier stage in which amplified spontaneous emission is efficiently suppressed (>40 dB) and a high power amplifier with an efficiency of 52%. Two different approaches to frequency doubling are compared. We achieve 8.6 W at 545.5 nm by single-pass frequency doubling in a MgO-doped periodically poled stoichiometric LiTaO 3 crystal and up to 19.3 W at 545.5 nm by frequency doubling with a lithium-triborate crystal in an external enhancement cavity. (paper)

  14. A comparative study of the plasmon effect in nanoelectrode THz emitters: Pulse vs. continuous-wave radiation

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Kiwon; Lee, Eui Su; Lee, Il-Min; Han, Sang-Pil; Kim, Hyun-Soo; Park, Kyung Hyun, E-mail: khp@etri.re.kr [Terahertz Basic Research Section, Electronics and Telecommunications Research Institute (ETRI), Daejeon 305-700 (Korea, Republic of); Choi, Jeongyong [Metal-Insulator Transition Research Section, Electronics and Telecommunications Research Institute (ETRI), Daejeon 305-700 (Korea, Republic of); Lee, Donghun [Optical Internet Components Research Section, Electronics and Telecommunications Research Institute (ETRI), Daejeon 305-700 (Korea, Republic of)

    2016-08-15

    Plasmonic field enhancement in terahertz (THz) generation is one of the recently arisen techniques in the THz field that has attracted considerable interest. However, the reported levels of enhancement of THz output power in the literature are significantly different from each other, from less than two times to about two orders of magnitude of enhancement in power, which implies the existence of other major limiting factors yet to be revealed. In this work, the contribution of the plasmonic effect to the power enhancement of THz emitters is revisited. We show that the carrier collection efficiency in a THz emitter with plasmonic nanostructures is more critical to the device performance than the plasmonic field enhancement itself. The strong reverse fields induced by the highly localized plasmonic carriers in the vicinity of the nanoelectrodes screen the carrier collections and seriously limit the power enhancement. This is supported by our experimental observations of the significantly enhanced power in a plasmonic nanoelectrode THz emitter in continuous-wave radiation mode, while the same device has limited enhancement with pulsed radiation. We hope that our study may provide an intuitive but practical guideline in adopting plasmonic nanostructures with an aim of enhancing the efficiency of optoelectronic devices.

  15. Efficient continuous-wave eye-safe region signal output from intra-cavity singly resonant optical parametric oscillator

    International Nuclear Information System (INIS)

    Li Bin; Ding Xin; Sheng Quan; Yin Su-Jia; Shi Chun-Peng; Li Xue; Wen Wu-Qi; Yao Jian-Quan; Yu Xuan-Yi

    2012-01-01

    We report an efficient continuous-wave (CW) tunable intra-cavity singly resonant optical parametric oscillator based on the multi-period periodically poled lithium niobate and using a laser diode (LD) end-pumped CW 1064 nm Nd:YVO 4 laser as the pump source. A highly efficiency CW operation is realized through a careful cavity design for mode matching and thermal stability. The signal tuning range is 1401–1500 nm obtained by varying the domain period. The maximum output power of 2.2 W at 1500 nm is obtained with a 17.1 W 808 nm LD power and the corresponding conversion efficiency is 12.9%. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  16. A continuous wave fan beam tomography system having a best estimating filter

    International Nuclear Information System (INIS)

    Gordon, B.M.

    1982-01-01

    A continuous wave fan beam tomographic system is described which continuously samples X-ray absorption values and a means of providing a best-estimate of the X-ray absorption values at discrete points in time determined by sampling signal s(t). The means to provide the best-estimate include a continuous filter having a frequency range defined by the geometry of the mechanical system. Errors due to the statistical variation in photon emissions of the X-ray source are thereby minimized and the effective signal-to-noise ratio of signals is enhanced, which in turn allows a significant reduction in radiation dosage. (author)

  17. Fabrication and stability of fiber bragg gratings for WDM applications using a 266 nm cw-laser

    DEFF Research Database (Denmark)

    Deyerl, Hans-Jürgen; Sørensen, Henrik Rokkjær; Jensen, Jesper Bo Damm

    2003-01-01

    Diode pumped continuous wave all solid state UV-lasers operating at 266 nm offer an interesting alternative to frequency doubled argon ion lasers. We compare photosensitivity, UV-writing of Bragg gratings and thermal decay at 244, 257 and 266 nm.......Diode pumped continuous wave all solid state UV-lasers operating at 266 nm offer an interesting alternative to frequency doubled argon ion lasers. We compare photosensitivity, UV-writing of Bragg gratings and thermal decay at 244, 257 and 266 nm....

  18. Radiation from nonlinear coupling of plasma waves

    International Nuclear Information System (INIS)

    Fung, S.F.

    1986-01-01

    The author examines the generation of electromagnetic radiation by nonlinear resonant interactions of plasma waves in a cold, uniformly magnetized plasma. In particular, he considers the up-conversion of two electrostatic wave packets colliding to produce high frequency electromagnetic radiation. Efficient conversion of electrostatic to electromagnetic wave energy occurs when the pump amplitudes approach and exceed the pump depletion threshold. Results from the inverse scattering transform analysis of the three-wave interaction equations are applied. When the wave packets are initially separated, the fully nonlinear set of coupling equations, which describe the evolution of the wave packets, can be reduced to three separate eigenvalue problems; each can be considered as a scattering problem, analogous to eh Schroedinger equation. In the scattering space, the wave packet profiles act as the scattering potentials. When the wavepacket areas approach (or exceed) π/2, the wave functions are localized (bound states) and the scattering potentials are said to contain solitons. Exchange of solitons occurs during the interaction. The transfer of solitons from the pump waves to the electromagnetic wave leads to pump depletion and the production of strong radiation. The emission of radio waves is considered by the coupling of two upper-hybrid branch wave packets, and an upper-hybrid and a lower hybrid branch wave packet

  19. Quasi-continuous wave and continuous wave laser operation of Eu:KGd(WO4)2 crystal on a 5D0 → 7F4 transition

    International Nuclear Information System (INIS)

    Dashkevich, V I; Orlovich, V A; Bui, A A; Bagayev, S N; Vatnik, S M; Loiko, P A; Yumashev, K V; Kuleshov, N V; Pavlyuk, A A

    2015-01-01

    We report on the first demonstration of quasi-continuous wave (quasi-CW) and real CW room-temperature lasing on the 5 D 0  →  7 F 4 transition of Eu 3+ -doped material using a 25 at.%Eu 3+  : KGd(WO 4 ) 2 crystal pumped into the 7 F 1  →  5 D 1 transition by a diode-end-pumped Nd 3+  : KGd(WO 4 ) 2 /KTP green laser at 533.6 nm. The maximum CW output power of this laser at 702.3 nm is 5.3 mW with 1.4% green-to-red conversion efficiency. In quasi-CW operation mode with a 10% duty cycle, the peak power of ms long pulses reaches ∼54 mW, which corresponds to the optical conversion efficiency of 3.5%. (letter)

  20. Radiation and propagation of electromagnetic waves

    CERN Document Server

    Tyras, George; Declaris, Nicholas

    1969-01-01

    Radiation and Propagation of Electromagnetic Waves serves as a text in electrical engineering or electrophysics. The book discusses the electromagnetic theory; plane electromagnetic waves in homogenous isotropic and anisotropic media; and plane electromagnetic waves in inhomogenous stratified media. The text also describes the spectral representation of elementary electromagnetic sources; the field of a dipole in a stratified medium; and radiation in anisotropic plasma. The properties and the procedures of Green's function method of solution, axial currents, as well as cylindrical boundaries a

  1. Wave energy budget analysis in the Earth’s radiation belts uncovers a missing energy

    Science.gov (United States)

    Artemyev, A.V.; Agapitov, O.V.; Mourenas, D.; Krasnoselskikh, V.V.; Mozer, F.S.

    2015-01-01

    Whistler-mode emissions are important electromagnetic waves pervasive in the Earth’s magnetosphere, where they continuously remove or energize electrons trapped by the geomagnetic field, controlling radiation hazards to satellites and astronauts and the upper-atmosphere ionization or chemical composition. Here, we report an analysis of 10-year Cluster data, statistically evaluating the full wave energy budget in the Earth’s magnetosphere, revealing that a significant fraction of the energy corresponds to hitherto generally neglected very oblique waves. Such waves, with 10 times smaller magnetic power than parallel waves, typically have similar total energy. Moreover, they carry up to 80% of the wave energy involved in wave–particle resonant interactions. It implies that electron heating and precipitation into the atmosphere may have been significantly under/over-valued in past studies considering only conventional quasi-parallel waves. Very oblique waves may turn out to be a crucial agent of energy redistribution in the Earth’s radiation belts, controlled by solar activity. PMID:25975615

  2. Tunable continuous wave and passively Q-switched Nd:LuLiF4 laser with monolayer graphene as saturable absorber

    International Nuclear Information System (INIS)

    Wang, Feng; Luo, Jianjun; Li, Shixia; Li, Tao; Li, Ming

    2015-01-01

    Tunable continuous wave and passively Q-switched Nd:LuLiF 4 laser performances were demonstrated. Employing a 2 mm thick quartz plate as the birefringence filter, three continuous tuning ranges from 1045.2 to 1049.9 nm, 1051 to 1055.1 nm and 1072.1 to 1074.3 nm could be obtained. Q-switched laser operation was realized by using a monolayer graphene as a saturable absorber. At an incident pump power of 5.94 W, the maximum average output power was 669 mW with the pulse duration of 210 ns and the pulse repetition rate of 145 kHz at T = 10%. (paper)

  3. Ocular effects of ultraviolet radiation from 295 to 365 nm

    International Nuclear Information System (INIS)

    Pitts, D.G.; Cullen, A.P.; Hacker, P.D.

    1977-01-01

    A 5,000 watt Xe--Hg source and a double monochromator were used to produce 6.6 nm full band-pass ultraviolet (UV) radiation. Pigmented rabbit eyes were exposed to the 6.6 nm band-pass UV radiant energy in 5 nm steps from 295 to 320 nm and at random intervals above 320 nm. Corneal and lenticular damage was assessed and classified with a biomicroscope. Corneal threshold radiant exposure (Hc) rose very rapidly from 0.022 Jcm -2 at 300 nm to 10.99 Jcm -2 at 335 nm. Radiant exposures exceeding 2 x Hc resulted in irreversible corneal damage. Lenticular damage was limited to wavebands above 295 nm. The action spectrum for the lens began at 295 nm and extended to about 315 nm. Permanent lenticular damage occurred at radiant exposure levels approximately twice the threshold for lenticular radiant exposure. The importance in establishing both corneal and lenticular damage criteria is emphasized

  4. Production of gravitation waves by electromagnetic radiation

    International Nuclear Information System (INIS)

    Buchner, K.; Rosca, R.

    1980-01-01

    An exact solution of Einstein's equations is presented that corresponds to an axisymmetric bundle of electromagnetic waves with finite cross section. Outside this bundle, there is gravitational radiation parallel to the electromagnetic radiation. If no static electromagnetic fields are present, the frequency of the gravitational waves is twice the frequency of the electromagnetic waves. Einstein's energy complex vanishes identically. The covariant energy complex, however, yields also a radial momentum. (author)

  5. Cherenkov Radiation Control via Self-accelerating Wave-packets.

    Science.gov (United States)

    Hu, Yi; Li, Zhili; Wetzel, Benjamin; Morandotti, Roberto; Chen, Zhigang; Xu, Jingjun

    2017-08-18

    Cherenkov radiation is a ubiquitous phenomenon in nature. It describes electromagnetic radiation from a charged particle moving in a medium with a uniform velocity larger than the phase velocity of light in the same medium. Such a picture is typically adopted in the investigation of traditional Cherenkov radiation as well as its counterparts in different branches of physics, including nonlinear optics, spintronics and plasmonics. In these cases, the radiation emitted spreads along a "cone", making it impractical for most applications. Here, we employ a self-accelerating optical pump wave-packet to demonstrate controlled shaping of one type of generalized Cherenkov radiation - dispersive waves in optical fibers. We show that, by tuning the parameters of the wave-packet, the emitted waves can be judiciously compressed and focused at desired locations, paving the way to such control in any physical system.

  6. Radiative cooling and broadband phenomenon in low-frequency waves

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    In this paper, we analyze the effects of radiative cooling on the pure baroclinic low-frequency waves under the approximation of equatorial -plane and semi-geostrophic condition. The results show that radiative cooling does not, exclusively, provide the damping effects on the development of low-frequency waves. Under the delicate radiative-convective equilibrium, radiative effects will alter the phase speed and wave period, and bring about the broadband of phase velocity and wave period by adjusting the vertical profiles of diabatic heating. when the intensity of diabatic heating is moderate and appropriate, it is conductive to the development and sustaining of the low-frequency waves and their broadband phenomena, not the larger, the better. The radiative cooling cannot be neglected in order to reach the moderate and appropriate intensity of diabatic heating.

  7. Thermal properties and continuous-wave laser performance of Yb:LuVO4 crystal

    Science.gov (United States)

    Cheng, Y.; Zhang, H. J.; Yu, Y. G.; Wang, J. Y.; Tao, X. T.; Liu, J. H.; Petrov, V.; Ling, Z. C.; Xia, H. R.; Jiang, M. H.

    2007-03-01

    A laser crystal of Yb:LuVO4 with high optical quality was grown by the Czochralski technique. Its thermal properties including specific heat, thermal expansion coefficients, and thermal conductivities along the a- and c-axis have been measured for the first time. Continuous-wave laser output up to 3.5 W at 1031 nm was obtained at room temperature through end-pumping by a high-power diode laser. The corresponding optical conversion efficiency was 43% and the slope efficiency was 72%.

  8. Production of spectrally reconstructed uv-radiation by means of a nonlinear conversion of the generation frequency of a dye laser with lamp pumping

    Energy Technology Data Exchange (ETDEWEB)

    Anufrik, S S; Mostovnikov, V A; Rubinov, A N

    1976-03-01

    By doubling the generation frequency of an organic dye laser with lamp pumping, radiation is obtained in the spectral region of 285 to 305 nm. Depending on the mode of operation of a given laser the spectral width of the uv-radiation was 0.5 or approximately 0.003 nm. The maximum energy of second harmonic pulses was equal to approximately 0.01 J. (SJR)

  9. Lethal effect of short-wave (254 nm) UV-radiation on cells of Chlamidomonas reinhardii strains with different carotenoid content

    International Nuclear Information System (INIS)

    Kamchatova, I.E.; Chunaev, A.S.; Bronnikov, V.A.

    1987-01-01

    In experiments on related Chlamidomonas reinhardii strains of similar mating type a study was made of sensitivity of cells with different carotenoid content to UV-radiation of 254 nm. Mutants having a lower, as opposed to the wild type strain, content of carotenoids exhibited an increased radiosensitivity. A carotenoid-free mutant was found to possess a higher sensitivity to UV-radiation which was typical of the strain with the impaired excision repair system. The studied subclone of the UV-radiosensitive strain CC-888 was unable to photoreactivate the UV-induced damages which was typical of the wild-type strain. The content of carotenoids in cells of this subnuclone exceeded that in cells of mutants with the reduced pigmentation

  10. Effect of temperature on electrical conductance of inkjet-printed silver nanoparticle ink during continuous wave laser sintering

    International Nuclear Information System (INIS)

    Lee, Dae-Geon; Kim, Dong Keun; Moon, Yoon-Jae; Moon, Seung-Jae

    2013-01-01

    To determine the effect of temperature on the specific electrical conductance of inkjet-printed ink during continuous wave laser sintering, the temperature of the sintered ink was estimated. The ink, which contained 34 wt.% silver nanoparticles with an average size of approximately 50 nm, was inkjet-printed onto a liquid crystal display glass substrate. The printed ink was irradiated with a 532 nm continuous wave laser for 60 s with various laser intensities. During laser irradiation, the in-situ electrical conductance of the sintered ink was measured to estimate the transient thermal conductivity of the ink. The electrical conductance and thermal conductivity of the ink was coupled to obtain the transient temperature by applying the Wiedemann–Franz law to a two-dimensional transient heat conduction equation. The electrical conductance of laser-sintered ink was highly dependent on the sintering temperature of the ink. - Highlights: • The in-situ electrical conductance was measured during the laser sintering process. • Wiedemann–Franz law coupled the electrical conductance with transient temperature. • The transient temperature of the laser-sintered Ag nanoparticle ink was estimated

  11. Sunlight suppressing rejection of 280- to 320-nm UV-radiation-induced skin tumors in mice

    International Nuclear Information System (INIS)

    Morison, W.L.; Kelley, S.P.

    1985-01-01

    Repeated exposure of female C3H/HeNCR- mice to sunlight prevented the normal immunologic rejection of a UV-induced tumor. This systemic immunologic alteration was transferred to syngeneic lethally X-irradiated animals with lymphoid cells from mice exposed to sunlight. The lymphoid cells also were able to suppress the capacity of lymphoid cells from normal animals to reject a UV-induced tumor. The 295- to 320-nm wave band appeared to be responsible for this immunosuppressive effect of sunlight because suppression was prevented by filtration of the radiation through Mylar and by application of a sunscreen containing para-aminobenzoic acid. These observations may have importance in understanding the pathogenesis of sunlight-induced skin cancer in humans

  12. High-power, continuous-wave, single-frequency, all-periodically-poled, near-infrared source.

    Science.gov (United States)

    Devi, Kavita; Chaitanya Kumar, S; Ebrahim-Zadeh, M

    2012-12-15

    We report a high-power, single-frequency, continuous-wave (cw) source tunable across 775-807 nm in the near-infrared, based on internal second harmonic generation (SHG) of a cw singly-resonant optical parametric oscillator (OPO) pumped by a Yb-fiber laser. The compact, all-periodically-poled source employs a 48-mm-long, multigrating MgO doped periodically poled lithium niobate (MgO:PPLN) crystal for the OPO and a 30-mm-long, fan-out grating MgO-doped stoichiometric periodically poled lithium tantalate (MgO:sPPLT) crystal for intracavity SHG, providing as much as 3.7 W of near-infrared power at 793 nm, together with 4 W of idler power at 3232 nm, at an overall extraction efficiency of 28%. Further, the cw OPO is tunable across 3125-3396 nm in the idler, providing as much as 4.3 W at 3133 nm with >3.8  W over 77% of the tuning range together with >3  W of near-infrared power across 56% of SHG tuning range, in high-spatial beam-quality with M2<1.4. The SHG output has an instantaneous linewidth of 8.5 MHz and exhibits a passive power stability better than 3.5% rms over more than 1 min.

  13. On- and off-resonance radiation-atom-coupling matrix elements involving extended atomic wave functions

    Science.gov (United States)

    Komninos, Yannis; Mercouris, Theodoros; Nicolaides, Cleanthes A.

    2014-01-01

    In continuation of our earlier works, we present results concerning the computation of matrix elements of the multipolar Hamiltonian (MPH) between extended wave functions that are obtained numerically. The choice of the MPH is discussed in connection with the broader issue of the form of radiation-atom (or -molecule) interaction that is appropriate for the systematic solution of various problems of matter-radiation interaction. We derive analytic formulas, in terms of the sine-integral function and spherical Bessel functions of various orders, for the cumulative radial integrals that were obtained and calculated by Komninos, Mercouris, and Nicolaides [Phys. Rev. A 71, 023410 (2005), 10.1103/PhysRevA.71.023410]. This development allows the much faster and more accurate computation of such matrix elements, a fact that enhances the efficiency with which the time-dependent Schrödinger equation is solved nonperturbatively, in the framework of the state-specific expansion approach. The formulas are applicable to the general case where a pair of orbitals with angular parts |ℓ1,m1> and |ℓ2,m2> are coupled radiatively. As a test case, we calculate the matrix elements of the electric field and of the paramagnetic operators for on- and off-resonance transitions, between hydrogenic circular states of high angular momentum, whose quantum numbers are chosen so as to satisfy electric dipole and electric quadrupole selection rules. Because of the nature of their wave function (they are nodeless and the large centrifugal barrier keeps their overwhelming part at large distances from the nucleus), the validity of the electric dipole approximation in various applications where the off-resonance couplings must be considered becomes precarious. For example, for the transition from the circular state with n = 20 to that with n = 21, for which ≈400 a.u., the dipole approximation starts to fail already at XUV wavelengths (λ <125nm).

  14. Toward continuous-wave operation of organic semiconductor lasers

    Science.gov (United States)

    Sandanayaka, Atula S. D.; Matsushima, Toshinori; Bencheikh, Fatima; Yoshida, Kou; Inoue, Munetomo; Fujihara, Takashi; Goushi, Kenichi; Ribierre, Jean-Charles; Adachi, Chihaya

    2017-01-01

    The demonstration of continuous-wave lasing from organic semiconductor films is highly desirable for practical applications in the areas of spectroscopy, data communication, and sensing, but it still remains a challenging objective. We report low-threshold surface-emitting organic distributed feedback lasers operating in the quasi–continuous-wave regime at 80 MHz as well as under long-pulse photoexcitation of 30 ms. This outstanding performance was achieved using an organic semiconductor thin film with high optical gain, high photoluminescence quantum yield, and no triplet absorption losses at the lasing wavelength combined with a mixed-order distributed feedback grating to achieve a low lasing threshold. A simple encapsulation technique greatly reduced the laser-induced thermal degradation and suppressed the ablation of the gain medium otherwise taking place under intense continuous-wave photoexcitation. Overall, this study provides evidence that the development of a continuous-wave organic semiconductor laser technology is possible via the engineering of the gain medium and the device architecture. PMID:28508042

  15. Nonlinear Whistler Wave Physics in the Radiation Belts

    Science.gov (United States)

    Crabtree, Chris

    2016-10-01

    Wave particle interactions between electrons and whistler waves are a dominant mechanism for controlling the dynamics of energetic electrons in the radiation belts. They are responsible for loss, via pitch-angle scattering of electrons into the loss cone, and energization to millions of electron volts. It has previously been theorized that large amplitude waves on the whistler branch may scatter their wave-vector nonlinearly via nonlinear Landau damping leading to important consequences for the global distribution of whistler wave energy density and hence the energetic electrons. It can dramatically reduce the lifetime of energetic electrons in the radiation belts by increasing the pitch angle scattering rate. The fundamental building block of this theory has now been confirmed through laboratory experiments. Here we report on in situ observations of wave electro-magnetic fields from the EMFISIS instrument on board NASA's Van Allen Probes that show the signatures of nonlinear scattering of whistler waves in the inner radiation belts. In the outer radiation belts, whistler mode chorus is believed to be responsible for the energization of electrons from 10s of Kev to MeV energies. Chorus is characterized by bursty large amplitude whistler mode waves with frequencies that change as a function of time on timescales corresponding to their growth. Theories explaining the chirping have been developed for decades based on electron trapping dynamics in a coherent wave. New high time resolution wave data from the Van Allen probes and advanced spectral techniques are revealing that the wave dynamics is highly structured, with sub-elements consisting of multiple chirping waves with discrete frequency hops between sub-elements. Laboratory experiments with energetic electron beams are currently reproducing the complex frequency vs time dynamics of whistler waves and in addition revealing signatures of wave-wave and beat-wave nonlinear wave-particle interactions. These new data

  16. Compact corner-pumped Nd:YAG/YAG composite slab 1319 nm/1338 nm laser

    International Nuclear Information System (INIS)

    Liu, H; Gong, M; Wushouer, X; Gao, S

    2010-01-01

    A corner-pumped type is a new pumping type in the diode-pumped solid-state lasers, which has the advantages of high pump efficiency and favorable pump uniformity. A corner-pumped Nd:YAG/YAG composite slab continuous-wave 1319 nm/1338 nm dual-wavelength laser is first demonstrated in this paper. When the cavity length is 25 mm, the maximal output power is up to 7.62 W with a slope efficiency of 16.6% and an optical-to-optical conversion efficiency of 17%. The corresponding spectral line widths of 1319 nm laser and 1338 nm laser are 0.11 and 0.1 nm, respectively. The short-term instability of the output power is better than 1% when the pumping power is 39.5 W. The experimental results show that a corner-pumped type is a kind of feasible schedules in the design of diode-pumped solid-state 1.3 μm lasers with low or medium output powers

  17. Local Tensor Radiation Conditions For Elastic Waves

    DEFF Research Database (Denmark)

    Krenk, S.; Kirkegaard, Poul Henning

    2001-01-01

    A local boundary condition is formulated, representing radiation of elastic waves from an arbitrary point source. The boundary condition takes the form of a tensor relation between the stress at a point on an arbitrarily oriented section and the velocity and displacement vectors at the point....... The tensor relation generalizes the traditional normal incidence impedance condition by accounting for the angle between wave propagation and the surface normal and by including a generalized stiffness term due to spreading of the waves. The effectiveness of the local tensor radiation condition...

  18. Rapid and sensitive trace gas detection with continuous wave Optical Parametric Oscillator-based Wavelength Modulation Spectroscopy

    NARCIS (Netherlands)

    Arslanov, D.D.; Spunei, M.; Ngai, A.K.Y.; Cristescu, S.M.; Lindsay, I.D.; Lindsay, I.D.; Boller, Klaus J.; Persijn, S.T.; Harren, F.J.M.

    2011-01-01

    A fiber-amplified Distributed Bragg Reflector diode laser is used to pump a continuous wave, singly resonant Optical Parametric Oscillator (OPO). The output radiation covers the 3–4 μm with ability of rapid (100 THz/s) and broad mode-hop-free tuning (5 cm−1). Wavelength Modulation Spectroscopy is

  19. Langmuir-like waves and radiation in planetary foreshocks

    Science.gov (United States)

    Cairns, Iver H.; Robinson, P. A.; Anderson, R. R.; Gurnett, D. A.; Kurth, W. S.

    1995-01-01

    The basic objectives of this NASA Grant are to develop theoretical understandings (tested with spacecraft data) of the generation and characteristics of electron plasma waves, commonly known as Langmuir-like waves, and associated radiation near f(sub p) and 2f(sub p) in planetary foreshocks. (Here f(sub p) is plasma frequency.) Related waves and radiation in the source regions of interplanetary type III solar radio bursts provide a simpler observational and theoretical context for developing and testing such understandings. Accordingly, applications to type III bursts constitute a significant fraction of the research effort. The testing of the new Stochastic Growth Theory (SGT) for type III bursts, and its extension and testing for foreshock waves and radiation, constitutes a major longterm strategic goal of the research effort.

  20. Radiation-induced transient attenuation of optical fibers at 800 and 1300 nm

    International Nuclear Information System (INIS)

    Looney, L.D.; Lyons, P.B.

    1987-01-01

    Radiation-induced absorption in optical fibers has been a subject of considerable interest throughout the world. As availability and applications of fibers have evolved from ''first window'' systems operating near 850 nm to ''second window'' systems near 1300 nm, interest in wavelength dependence of radiation effects in optical fibers has similarly evolved. The present work summarizes second-window, radiation-induced transient absorption measurements in optical fibers for times shorter than 5 μs. Comparisons to first window data for these fibers are also presented. Only high purity silica fibers with low-OH concentrations were used in the present study to avoid the large OH absorption band in this region. This paper also collects first window data on several high-OH optical fibers

  1. Theory for beam-plasma millimeter-wave radiation source experiments

    International Nuclear Information System (INIS)

    Rosenberg, M.; Krall, N.A.

    1989-01-01

    This paper reports on theoretical studies for millimeter-wave plasma source experiments. In the device, millimeter-wave radiation is generated in a plasma-filled waveguide driven by counter-streaming electron beams. The beams excite electron plasma waves which couple to produce radiation at twice the plasma frequency. Physics topics relevant to the high electron beam current regime are discussed

  2. Continuous micro-feeding of fine cohesive powders actuated by pulse inertia force and acoustic radiation force in ultrasonic standing wave field.

    Science.gov (United States)

    Wang, Hongcheng; Wu, Liqun; Zhang, Ting; Chen, Rangrang; Zhang, Linan

    2018-07-10

    Stable continuous micro-feeding of fine cohesive powders has recently gained importance in many fields. However, it remains a great challenge in practice because of the powder aggregate caused by interparticle cohesive forces in small capillaries. This paper describes a novel method of feeding fine cohesive powder actuated by a pulse inertia force and acoustic radiation force simultaneously in an ultrasonic standing wave field using a tapered glass nozzle. Nozzles with different outlet diameters are fabricated using glass via a heating process. A pulse inertia force is excited to drive powder movement to the outlet section of the nozzle in a consolidated columnar rod mode. An acoustic radiation force is generated to suspend the particles and make the rod break into large quantities of small agglomerates which impact each other randomly. So the aggregation phenomenon in the fluidization of cohesive powders can be eliminated. The suspended powder is discharged continuously from the nozzle orifice owing to the self-gravities and collisions between the inner particles. The micro-feeding rates can be controlled accurately and the minimum values for RespitoseSV003 and Granulac230 are 0.4 mg/s and 0.5 mg/s respectively. The relative standard deviations of all data points are below 0.12, which is considerably smaller than those of existing vibration feeders with small capillaries. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Crystal growth, spectroscopic characterization, and continuous wave laser operation of Nd3+-doped LiLuF4 crystal

    Science.gov (United States)

    Zhao, C. C.; Hang, Y.; Zhang, L. H.; He, X. M.; Yin, J. G.; Li, R.; Yu, T.; Chen, W. B.

    2011-04-01

    Nd3+-doped LiLuF4 single crystal with high optical quality was grown by Czochralski technique. The segregation coefficient of Nd3+ in LiLuF4 crystal was determined by the inductively coupled plasma atomic emission spectrometry method. Polarized absorption and fluorescence spectra were investigated. The peak absorption cross section at 792 nm and peak emission cross section at 1053 nm are 6.94×10-20 and 7.60×10-20 cm2, respectively. With a laser-diode as the pump source, a maximum 6.22 W continuous-wave laser output at 1053 nm has been obtained with a slope efficiency of 37.2% with respect to the pump power.

  4. Three-dimensional wave-induced current model equations and radiation stresses

    Science.gov (United States)

    Xia, Hua-yong

    2017-08-01

    After the approach by Mellor (2003, 2008), the present paper reports on a repeated effort to derive the equations for three-dimensional wave-induced current. Via the vertical momentum equation and a proper coordinate transformation, the phase-averaged wave dynamic pressure is well treated, and a continuous and depth-dependent radiation stress tensor, rather than the controversial delta Dirac function at the surface shown in Mellor (2008), is provided. Besides, a phase-averaged vertical momentum flux over a sloping bottom is introduced. All the inconsistencies in Mellor (2003, 2008), pointed out by Ardhuin et al. (2008) and Bennis and Ardhuin (2011), are overcome in the presently revised equations. In a test case with a sloping sea bed, as shown in Ardhuin et al. (2008), the wave-driving forces derived in the present equations are in good balance, and no spurious vertical circulation occurs outside the surf zone, indicating that Airy's wave theory and the approach of Mellor (2003, 2008) are applicable for the derivation of the wave-induced current model.

  5. Study on the specificity of yeast cell damage by high-intensity UV radiation (266nm)

    International Nuclear Information System (INIS)

    Burchuladze, T.G.; Frajkin, G.Ya.; Rubin, L.B.

    1981-01-01

    Peculiarities of photoreactivation and photoprotection of the Candida guilliermondii and Candida utilis yeast cells, irradiated with far and near ultraviolet radiation, are considered. New results on the study of the dependence of the cells inactivation degree on the intensity of ultraviolet radiation are presented. The impulse rate density at 266 nm reached 10 10 Ix m -2 xs -1 at the impulse duration of 10 -8 s. Survival curves of the yeast cells during their irradiation with ultraviolet radiation of 266 nm and 254 nm are given. It is shown that with the increase of the irradiation intensity of 266 nm the rates and final levels of photoreactivation decrease. Under the effect of ultraviolet irradiation of high intensity contribution of pyrimidine dimers to the cell inactivation decreases [ru

  6. Unified formulation of radiation conditions for the wave equation

    DEFF Research Database (Denmark)

    Krenk, Steen

    2002-01-01

    A family of radiation conditions for the wave equation is derived by truncating a rational function approxiamtion of the corresponding plane wave representation, and it is demonstrated how these boundary conditions can be formulated in terms of fictitious surface densities, governed by second......-order wave equations on the radiating surface. Several well-established radiation boundary conditions appear as special cases, corresponding to different choice of the coefficients in the rational approximation. The relation between these choices is established, and an explicit formulation in terms...

  7. Photoionization pathways and thresholds in generation of Lyman-α radiation by resonant four-wave mixing in Kr-Ar mixture

    Directory of Open Access Journals (Sweden)

    Oleg A. Louchev

    2016-09-01

    Full Text Available We develop a set of analytical approximations for the estimation of the combined effect of various photoionization processes involved in the resonant four-wave mixing generation of ns pulsed Lyman-α (L-α radiation by using 212.556 nm and 820-845 nm laser radiation pulses in Kr-Ar mixture: (i multi-photon ionization, (ii step-wise (2+1-photon ionization via the resonant 2-photon excitation of Kr followed by 1-photon ionization and (iii laser-induced avalanche ionization produced by generated free electrons. Developed expressions validated by order of magnitude estimations and available experimental data allow us to identify the area for the operation under high input laser intensities avoiding the onset of full-scale discharge, loss of efficiency and inhibition of generated L-α radiation. Calculations made reveal an opportunity for scaling up the output energy of the experimentally generated pulsed L-α radiation without significant enhancement of photoionization.

  8. Photoionization pathways and thresholds in generation of Lyman-α radiation by resonant four-wave mixing in Kr-Ar mixture

    Science.gov (United States)

    Louchev, Oleg A.; Saito, Norihito; Oishi, Yu; Miyazaki, Koji; Okamura, Kotaro; Nakamura, Jumpei; Iwasaki, Masahiko; Wada, Satoshi

    2016-09-01

    We develop a set of analytical approximations for the estimation of the combined effect of various photoionization processes involved in the resonant four-wave mixing generation of ns pulsed Lyman-α (L-α ) radiation by using 212.556 nm and 820-845 nm laser radiation pulses in Kr-Ar mixture: (i) multi-photon ionization, (ii) step-wise (2+1)-photon ionization via the resonant 2-photon excitation of Kr followed by 1-photon ionization and (iii) laser-induced avalanche ionization produced by generated free electrons. Developed expressions validated by order of magnitude estimations and available experimental data allow us to identify the area for the operation under high input laser intensities avoiding the onset of full-scale discharge, loss of efficiency and inhibition of generated L-α radiation. Calculations made reveal an opportunity for scaling up the output energy of the experimentally generated pulsed L-α radiation without significant enhancement of photoionization.

  9. Dicty_cDB: SLH285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH285 (Link to dictyBase) - - - Contig-U16287-1 SLH285F (Link to Original site) SLH2...85F 326 - - - - - - Show SLH285 Library SL (Link to library) Clone ID SLH285 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH285Q.Seq.d/ Representative seq. ID SLH28...5F (Link to Original site) Representative DNA sequence >SLH285 (SLH285Q) /CSM/SL/SLH2-D/SLH285Q.Seq.d/ AAAAA...ue SSF805 (SSF805Q) /CSM/SS/SSF8-A/SSF805Q.Seq.d/ 617 e-176 SLH288 (SLH288Q) /CSM/SL/SLH2-D/SLH288Q.Seq.d/ 617 e-176 SLH285 (SLH2

  10. Superluminescence of cadmium sulfide crystals under pulse X-ray radiation

    International Nuclear Information System (INIS)

    Pavlovskaya, N.G.; Tarasov, M.D.; Balakin, V.A.; Varava, V.P.; Lobov, S.I.; Surskij, O.K.; Tsukerman, V.A.

    1977-01-01

    Studies were made to elucidate luminescence properties of CdS crystal radiated by short pulses of braking x-ray radiation. Such a radiation causes the appearance of superluminescence. The radiation was carried out at 295 and 170 K, the radiation dose being changed from 3600 to 1600 r/pulse. At the temperature of 295 K light luminescence was registered at the wave length of 528 nm and half-width of 15 nm. While the temperature lowers, the radiation shifts to the range of shorter wave lengths, and a decrease of the spectrum half-width is observed. With the increase of radiation dose the decrease of radiation spectrum half-width is observed. Approximate calculations show that to achieve the spectrum narrowing to 1 nm at room temperature it is necessary to increase radiation dose per pulse 5-6 times

  11. 300 nm bandwidth adiabatic SOI polarization splitter-rotators exploiting continuous symmetry breaking.

    Science.gov (United States)

    Socci, Luciano; Sorianello, Vito; Romagnoli, Marco

    2015-07-27

    Adiabatic polarization splitter-rotators are investigated exploiting continuous symmetry breaking thereby achieving significant device size and losses reduction in a single mask fabrication process for both SOI channel and ridge waveguides. A crosstalk lower than -25 dB is expected over 300nm bandwidth, making the device suitable for full grid CWDM and diplexer/triplexer FTTH applications at 1310, 1490 and 1550nm.

  12. Dynamics of Quasi-Electrostatic Whistler waves in Earth's Radiation belts

    Science.gov (United States)

    Goyal, R.; Sharma, R. P.; Gupta, D. N.

    2017-12-01

    A numerical model is proposed to study the dynamics of high amplitude quasi-electrostatic whistler waves propagating near resonance cone angle and their interaction with finite frequency kinetic Alfvén waves (KAWs) in Earth's radiation belts. The quasi-electrostatic character of whistlers is narrated by dynamics of wave propagating near resonance cone. A high amplitude whistler wave packet is obtained using the present analysis which has also been observed by S/WAVES instrument onboard STEREO. The numerical simulation technique employed to study the dynamics, leads to localization (channelling) of waves as well as turbulent spectrum suggesting the transfer of wave energy over a range of frequencies. The turbulent spectrum also indicates the presence of quasi-electrostatic whistlers and density fluctuations associated with KAW in radiation belts plasma. The ponderomotive force of pump quasi-electrostatic whistlers (high frequency) is used to excite relatively much lower frequency waves (KAWs). The wave localization and steeper spectra could be responsible for particle energization or heating in radiation belts.

  13. Dicty_cDB: VHK285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK285 (Link to dictyBase) - - - - - (Link to Original site) VHK2...85F 531 - - - - - - Show VHK285 Library VH (Link to library) Clone ID VHK285 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK2...85Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...85 (VHK285Q) /CSM/VH/VHK2-D/VHK285Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

  14. Wide-band continuous-wave terahertz source with a vertically integrated photomixer

    Science.gov (United States)

    Peytavit, E.; Lampin, J.-F.; Hindle, F.; Yang, C.; Mouret, G.

    2009-10-01

    A transverse electromagnetic horn antenna is monolithically integrated with a low temperature grown GaAs vertical photodetector on a silicon substrate forming a vertically integrated photomixer. Continuous-wave terahertz radiation is generated at frequencies up to 3.5 THz with a power level reaching 20 nW around 3 THz. Microwave and material concepts allow both qualitative and quantitative explanations of the experimental results. The thin film microstrip line topology has been adapted for active devices by an Au-Au thermocompression layer transfer technique and seems to be a promising generic tool for a new generation of efficient terahertz devices.

  15. Continuous-wave laser at 440 nm based on frequency-doubled diode-pumped Nd:GdVO(4) crystal.

    Science.gov (United States)

    Castaing, Marc; Balembois, François; Georges, Patrick

    2008-09-01

    We present for the first time, to the best of our knowledge, a frequency-doubled Nd:GdVO(4) laser operating in a cw on the pure three-level laser line at 880 nm. We obtained 300 mW at 440 nm for 23 W of incident pump power at 808 nm. Moreover, with a 25% output coupler we obtained a cw power of 1.9 W at the fundamental wavelength at 880 nm.

  16. Radiation and detection of gravitational waves in laboratory conditions

    International Nuclear Information System (INIS)

    Bogolyubov, P.N.; Pisarev, A.F.; Shavokhina, N.S.

    1981-01-01

    Two variants are proposed and analyzed for an experiment on radiation and detection of gravitational waves in laboratory conditions in the optical and superhigh frequency range (band). In the first variant the laser light is parametrically transformed to the gravitational wave in the optical-inhomogeneous medium. The gravitational flux produced is registered by the inverse parametric transformation of the gravitational to light wave. In the second variant the radiation of gravitational waves is realized through hypersonic oscillations in piezocrystals, and the reception of waves is made by the superconducting coaxial resonator in which the gravitational wave resonantly transforms into the electromag= . netic wave. The analysis performed testifies to the possibility of an experiment of this type at the present time [ru

  17. Continuing medical education in radiation oncology

    International Nuclear Information System (INIS)

    Chauvet, B.; Barillot, I.; Denis, F.; Cailleux, P.E.; Ardiet, J.M.; Mornex, F.

    2012-01-01

    In France, continuing medical education (CME) and professional practice evaluation (PPE) became mandatory by law in July 2009 for all health professionals. Recently published decrees led to the creation of national specialty councils to implement this organizational device. For radiation oncology, this council includes the French Society for Radiation Oncology (SFRO), the National Radiation Oncology Syndicate (SNRO) and the Association for Continuing Medical Education in Radiation Oncology (AFCOR). The Radiation Oncology National Council will propose a set of programs including CME and PPE, professional thesaurus, labels for CME actions consistent with national requirements, and will organize expertise for public instances. AFCOR remains the primary for CME, but each practitioner can freely choose an organisation for CME, provided that it is certified by the independent scientific commission. The National Order for physicians is the control authority. Radiation oncology has already a strong tradition of independent CME that will continue through this major reform. (authors)

  18. Electromagnetic radiation accompanying gravitational waves from black hole binaries

    Energy Technology Data Exchange (ETDEWEB)

    Dolgov, A. [Dept. of Physics, Novosibirsk State University, Pirogova 2, 630090 Novosibirsk (Russian Federation); Postnov, K., E-mail: dolgov@fe.infn.it, E-mail: kpostnov@gmail.com [Sternberg Astronomical Institute, Moscow M.V. Lomonosov State University, Universitetskij pr. 13, 119234 Moscow (Russian Federation)

    2017-09-01

    The transition of powerful gravitational waves, created by the coalescence of massive black hole binaries, into electromagnetic radiation in external magnetic fields is considered. In contrast to the previous calculations of the similar effect we study the realistic case of the gravitational radiation frequency below the plasma frequency of the surrounding medium. The gravitational waves propagating in the plasma constantly create electromagnetic radiation dragging it with them, despite the low frequency. The plasma heating by the unattenuated electromagnetic wave may be significant in hot rarefied plasma with strong magnetic field and can lead to a noticeable burst of electromagnetic radiation with higher frequency. The graviton-to-photon conversion effect in plasma is discussed in the context of possible electromagnetic counterparts of GW150914 and GW170104.

  19. Electromagnetic radiation accompanying gravitational waves from black hole binaries

    International Nuclear Information System (INIS)

    Dolgov, A.; Postnov, K.

    2017-01-01

    The transition of powerful gravitational waves, created by the coalescence of massive black hole binaries, into electromagnetic radiation in external magnetic fields is considered. In contrast to the previous calculations of the similar effect we study the realistic case of the gravitational radiation frequency below the plasma frequency of the surrounding medium. The gravitational waves propagating in the plasma constantly create electromagnetic radiation dragging it with them, despite the low frequency. The plasma heating by the unattenuated electromagnetic wave may be significant in hot rarefied plasma with strong magnetic field and can lead to a noticeable burst of electromagnetic radiation with higher frequency. The graviton-to-photon conversion effect in plasma is discussed in the context of possible electromagnetic counterparts of GW150914 and GW170104.

  20. Inactivation of certain insect pathogens by ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV.

  1. Nonlinear Scattering of VLF Waves in the Radiation Belts

    Science.gov (United States)

    Crabtree, Chris; Rudakov, Leonid; Ganguli, Guru; Mithaiwala, Manish

    2014-10-01

    Electromagnetic VLF waves, such as whistler mode waves, control the lifetime of trapped electrons in the radiation belts by pitch-angle scattering. Since the pitch-angle scattering rate is a strong function of the wave properties, a solid understanding of VLF wave sources and propagation in the magnetosphere is critical to accurately calculate electron lifetimes. Nonlinear scattering (Nonlinear Landau Damping) is a mechanism that can strongly alter VLF wave propagation [Ganguli et al. 2010], primarily by altering the direction of propagation, and has not been accounted for in previous models of radiation belt dynamics. Laboratory results have confirmed the dramatic change in propagation direction when the pump wave has sufficient amplitude to exceed the nonlinear threshold [Tejero et al. 2014]. Recent results show that the threshold for nonlinear scattering can often be met by naturally occurring VLF waves in the magnetosphere, with wave magnetic fields of the order of 50-100 pT inside the plasmapause. Nonlinear scattering can then dramatically alter the macroscopic dynamics of waves in the radiation belts leading to the formation of a long-lasting wave-cavity [Crabtree et al. 2012] and, when amplification is present, a multi-pass amplifier [Ganguli et al. 2012]. By considering these effects, the lifetimes of electrons can be dramatically reduced. This work is supported by the Naval Research Laboratory base program.

  2. 808-nm diode-pumped continuous-wave Tm:GdVO4 laser at room temperature

    Science.gov (United States)

    Urata, Yoshiharu; Wada, Satoshi

    2005-05-01

    A high-quality gadolinium vanadate (GdVO4) crystal with 7-at. % thulium as the starting material was grown by the Czochralski technique. The measured absorption spectra exhibited sufficient absorption coefficients for laser diodes (LDs) for neodymium laser pumping: 6.0 cm^-1 for pi polarization and 6.2 cm^-1 for sigma polarization at 808 nm. Laser oscillation was carried out with single-stripe 808-nm LDs in an end-pumping configuration. A slope efficiency of 28% and a threshold of 750 mW were exhibited with respect to the absorbed pump power. An output power of 420 mW was achieved at an absorbed power of 2.4 W. It was demonstrated that Tm:GdVO4 is a useful material for 2-μm lasers, particularly in a compact LD-pumped system.

  3. Precipitated Fluxes of Radiation Belt Electrons via Injection of Whistler-Mode Waves

    Science.gov (United States)

    Kulkarni, P.; Inan, U. S.; Bell, T. F.

    2005-12-01

    Inan et al. (U.S. Inan et al., Controlled precipitation of radiation belt electrons, Journal of Geophysical Research-Space Physics, 108 (A5), 1186, doi: 10.1029/2002JA009580, 2003.) suggested that the lifetime of energetic (a few MeV) electrons in the inner radiation belts may be moderated by in situ injection of whistler mode waves at frequencies of a few kHz. We use the Stanford 2D VLF raytracing program (along with an accurate estimation of the path-integrated Landau damping based on data from the HYDRA instrument on the POLAR spacecraft) to determine the distribution of wave energy throughout the inner radiation belts as a function of injection point, wave frequency and injection wave normal angle. To determine the total wave power injected and its initial distribution in k-space (i.e., wave-normal angle), we apply the formulation of Wang and Bell ( T.N.C. Wang and T.F. Bell, Radiation resistance of a short dipole immersed in a cold magnetoionic medium, Radio Science, 4 (2), 167-177, February 1969) for an electric dipole antenna placed at a variety of locations throughout the inner radiation belts. For many wave frequencies and wave normal angles the results establish that most of the radiated power is concentrated in waves whose wave normals are located near the resonance cone. The combined use of the radiation pattern and ray-tracing including Landau damping allows us to make quantitative estimates of the magnetospheric distribution of wave power density for different source injection points. We use these results to estimate the number of individual space-based transmitters needed to significantly impact the lifetimes of energetic electrons in the inner radiation belts. Using the wave power distribution, we finally determine the energetic electron pitch angle scattering and the precipitated flux signatures that would be detected.

  4. Terahertz waves radiated from two noncollinear femtosecond plasma filaments

    Energy Technology Data Exchange (ETDEWEB)

    Du, Hai-Wei; Hoshina, Hiromichi; Otani, Chiko, E-mail: otani@riken.jp [Terahertz Sensing and Imaging Research Team, RIKEN Center for Advanced Photonics, RIKEN, Sendai, Miyagi 980-0845 (Japan); Midorikawa, Katsumi [Attosecond Science Research Team, RIKEN Center for Advanced Photonics, RIKEN, Wako, Saitama 351-0198 (Japan)

    2015-11-23

    Terahertz (THz) waves radiated from two noncollinear femtosecond plasma filaments with a crossing angle of 25° are investigated. The irradiated THz waves from the crossing filaments show a small THz pulse after the main THz pulse, which was not observed in those from single-filament scheme. Since the position of the small THz pulse changes with the time-delay of two filaments, this phenomenon can be explained by a model in which the small THz pulse is from the second filament. The denser plasma in the overlap region of the filaments changes the movement of space charges in the plasma, thereby changing the angular distribution of THz radiation. As a result, this schematic induces some THz wave from the second filament to propagate along the path of the THz wave from the first filament. Thus, this schematic alters the direction of the THz radiation from the filamentation, which can be used in THz wave remote sensing.

  5. Enhanced escape rate for Hg 254 nm resonance radiation in fluorescent lamps

    International Nuclear Information System (INIS)

    Lawler, James E; Raizen, Mark G

    2013-01-01

    The potential of the low-cost MAGIS isotopic separation method to improve fluorescent lamp efficacy is explored using resonance radiation transport simulations. New Hg isotopic mixes are discovered that yield escape rates for 254 nm Hg I resonance radiation equal to 117% to 122% of the rate for a natural isotopic mix under the same lamp conditions. (paper)

  6. Terahertz transmission properties of silicon wafers using continuous-wave terahertz spectroscopy

    Science.gov (United States)

    Kim, Chihoon; Ahn, Jae Sung; Ji, Taeksoo; Eom, Joo Beom

    2017-04-01

    We present the spectral properties of Si wafers using continuous-wave terahertz (CW-THz) spectroscopy. By using a tunable laser source and a fixed distributed-feedback laser diode (DFB-LD), a stably tunable beat source for CW-THz spectroscopy system can be implemented. THz radiation is generated in the frequency range of 100 GHz-800 GHz by photomixing in a photoconductive antenna. We also measured CW-THz waveforms by changing the beat frequency and confirmed repeatability through repeated measurement. We calculated the peaks of the THz frequency by taking fast Fourier transforms (FFTs) of measured THz waveforms. The feasibility of CW-THz spectroscopy is demonstrated by the THz spectra of Si wafers with different resistivities, mobilities, and carrier concentrations. The results show that Si wafers with a lower resistivity absorb more THz waves. Thus, we expect our CW-THz system to have the advantage of being able to perform fast non-destructive analysis.

  7. Terahertz transmission properties of silicon wafers using continuous-wave terahertz spectroscopy

    International Nuclear Information System (INIS)

    Kim, Chihoon; Ahn, Jae Sung; Eom, Joo Beom; Ji, Taeksoo

    2017-01-01

    We present the spectral properties of Si wafers using continuous-wave terahertz (CW-THz) spectroscopy. By using a tunable laser source and a fixed distributed-feedback laser diode (DFB-LD), a stably tunable beat source for CW-THz spectroscopy system can be implemented. THz radiation is generated in the frequency range of 100 GHz–800 GHz by photomixing in a photoconductive antenna. We also measured CW-THz waveforms by changing the beat frequency and confirmed repeatability through repeated measurement. We calculated the peaks of the THz frequency by taking fast Fourier transforms (FFTs) of measured THz waveforms. The feasibility of CW-THz spectroscopy is demonstrated by the THz spectra of Si wafers with different resistivities, mobilities, and carrier concentrations. The results show that Si wafers with a lower resistivity absorb more THz waves. Thus, we expect our CW-THz system to have the advantage of being able to perform fast non-destructive analysis. (paper)

  8. High-precision terahertz frequency modulated continuous wave imaging method using continuous wavelet transform

    Science.gov (United States)

    Zhou, Yu; Wang, Tianyi; Dai, Bing; Li, Wenjun; Wang, Wei; You, Chengwu; Wang, Kejia; Liu, Jinsong; Wang, Shenglie; Yang, Zhengang

    2018-02-01

    Inspired by the extensive application of terahertz (THz) imaging technologies in the field of aerospace, we exploit a THz frequency modulated continuous-wave imaging method with continuous wavelet transform (CWT) algorithm to detect a multilayer heat shield made of special materials. This method uses the frequency modulation continuous-wave system to catch the reflected THz signal and then process the image data by the CWT with different basis functions. By calculating the sizes of the defects area in the final images and then comparing the results with real samples, a practical high-precision THz imaging method is demonstrated. Our method can be an effective tool for the THz nondestructive testing of composites, drugs, and some cultural heritages.

  9. Diode-pumped CW Nd:SGG laser at 1070 nm

    International Nuclear Information System (INIS)

    Liang, W; Sun, G C; Yu, X; Li, B Z; Jin, G Y

    2011-01-01

    We report for the first time (to our knowledge) a diode-pumped Nd:SGG laser emitting at 1070 nm. A power of 1.23 W at 1070 nm has been achieved in continuous-wave (CW) operation with a fiber-coupled laser diode emitting 18.2 W at 806 nm. Intracavity second-harmonic generation (SHG) in CW mode has also been demonstrated with a power of 328 mW at 535 nm by using a LiB 3 O 5 (LBO) nonlinear crystal. The green beam quality factor M 2 was less than 1.22. The green power stability was less 2.5% in 4 hour

  10. High-power actively Q-switched single-mode 1342 nm Nd:YVO4 ring laser, injection-locked by a cw single-frequency microchip laser.

    Science.gov (United States)

    Koch, Peter; Bartschke, Juergen; L'huillier, Johannes A

    2015-11-30

    In this paper we report on the realization of a single-mode Q-switched Nd:YVO4 ring laser at 1342 nm. Unidirectional and single-mode operation of the ring laser is achieved by injection-locking with a continuous wave Nd:YVO4 microchip laser, emitting a single-frequency power of up to 40 mW. The ring laser provides a single-mode power of 13.9 W at 10 kHz pulse repetition frequency with a pulse duration of 18.2 ns and an excellent beam quality (M2 laser, a power of 8.7 W at 671 nm with a pulse duration of 14.8 ns and a beam propagation factor of M2 < 1.1 is obtained. The 671 nm radiation features a long-term spectral width of 75 MHz.

  11. Radiation stress and mean drift in continental shelf waves

    Science.gov (United States)

    Weber, Jan Erik H.; Drivdal, Magnus

    2012-03-01

    The time- and depth-averaged mean drift induced by barotropic continental shelf waves (CSW's) is studied theoretically for idealized shelf topography by calculating the mean volume fluxes to second order in wave amplitude. The waves suffer weak spatial damping due to bottom friction, which leads to radiation stress forcing of the mean fluxes. In terms of the total wave energy density E̅̅ over the shelf region, the radiation stress tensor component S̅11 for CSW's is found to be different from that of shallow water surface waves in a non-rotating ocean. For CSW's, the ratio S̅11/E̅ depends strongly on the wave number. The mean Lagrangian flow forced by the radiation stress can be subdivided into a Stokes drift and a mean Eulerian drift current. The magnitude of latter depends on ratio between the radiation stress and the bottom stress acting on the mean flow. When the effect of bottom friction acts equally strong on the waves and the mean current, calculations for short CSW's show that the Stokes drift and the friction-dependent wave-induced mean Eulerian current varies approximately in anti-phase over the shelf, and that the latter is numerically the largest. For long CSW's they are approximately in phase. In both cases the mean Lagrangian current, which is responsible for the net particle drift, has its largest numerical value at the coast on the shallow part of the shelf. Enhancing the effect of bottom friction on the Eulerian mean flow, results in a general current speed reduction, as well as a change in spatial structure for long waves. Applying realistic physical parameters for the continental shelf west of Norway, calculations yield along-shelf mean drift velocities for short CSW's that may be important for the transport of biological material, neutral tracers, and underwater plumes of dissolved oil from deepwater drilling accidents.

  12. Investigation of the radiation properties of magnetospheric ELF waves induced by modulated ionospheric heating

    Science.gov (United States)

    Wang, Feng; Ni, Binbin; Zhao, Zhengyu; Zhao, Shufan; Zhao, Guangxin; Wang, Min

    2017-05-01

    Electromagnetic extremely low frequency (ELF) waves play an important role in modulating the Earth's radiation belt electron dynamics. High-frequency (HF) modulated heating of the ionosphere acts as a viable means to generate artificial ELF waves. The artificial ELF waves can reside in two different plasma regions in geo-space by propagating in the ionosphere and penetrating into the magnetosphere. As a consequence, the entire trajectory of ELF wave propagation should be considered to carefully analyze the wave radiation properties resulting from modulated ionospheric heating. We adopt a model of full wave solution to evaluate the Poynting vector of the ELF radiation field in the ionosphere, which can reflect the propagation characteristics of the radiated ELF waves along the background magnetic field and provide the initial condition of waves for ray tracing in the magnetosphere. The results indicate that the induced ELF wave energy forms a collimated beam and the center of the ELF radiation shifts obviously with respect to the ambient magnetic field with the radiation power inversely proportional to the wave frequency. The intensity of ELF wave radiation also shows a weak correlation with the size of the radiation source or its geographical location. Furthermore, the combination of ELF propagation in the ionosphere and magnetosphere is proposed on basis of the characteristics of the ELF radiation field from the upper ionospheric boundary and ray tracing simulations are implemented to reasonably calculate magnetospheric ray paths of ELF waves induced by modulated ionospheric heating.

  13. Three-dimensional continuous particle focusing in a microfluidic channel via standing surface acoustic waves (SSAW).

    Science.gov (United States)

    Shi, Jinjie; Yazdi, Shahrzad; Lin, Sz-Chin Steven; Ding, Xiaoyun; Chiang, I-Kao; Sharp, Kendra; Huang, Tony Jun

    2011-07-21

    Three-dimensional (3D) continuous microparticle focusing has been achieved in a single-layer polydimethylsiloxane (PDMS) microfluidic channel using a standing surface acoustic wave (SSAW). The SSAW was generated by the interference of two identical surface acoustic waves (SAWs) created by two parallel interdigital transducers (IDTs) on a piezoelectric substrate with a microchannel precisely bonded between them. To understand the working principle of the SSAW-based 3D focusing and investigate the position of the focal point, we computed longitudinal waves, generated by the SAWs and radiated into the fluid media from opposite sides of the microchannel, and the resultant pressure and velocity fields due to the interference and reflection of the longitudinal waves. Simulation results predict the existence of a focusing point which is in good agreement with our experimental observations. Compared with other 3D focusing techniques, this method is non-invasive, robust, energy-efficient, easy to implement, and applicable to nearly all types of microparticles.

  14. Continuous-wave sodium D2 resonance radiation generated in single-pass sum-frequency generation with periodically poled lithium niobate.

    Science.gov (United States)

    Yue, J; She, C-Y; Williams, B P; Vance, J D; Acott, P E; Kawahara, T D

    2009-04-01

    With two cw single-mode Nd:YAG lasers at 1064 and 1319 nm and a periodically poled lithium niobate crystal, 11 mW of 2 kHz/100 ms bandwidth single-mode tunable 589 nm cw radiation has been detected using single-pass sum-frequency generation. The demonstrated conversion efficiency is approximately 3.2%[W(-1) cm(-1)]. This compact solid-state light source has been used in a solid-state-dye laser hybrid sodium fluorescence lidar transmitter to measure temperatures and winds in the upper atmosphere (80-105 km); it is being implemented into the transmitter of a mobile all-solid-state sodium temperature and wind lidar under construction.

  15. Multi-directional emission and detection of spin waves propagating in yttrium iron garnet with wavelengths down to about 100 nm

    Science.gov (United States)

    Maendl, Stefan; Grundler, Dirk

    2018-05-01

    We performed broadband spin-wave spectroscopy on 200 nm thick yttrium iron garnet containing arrays of partially embedded magnetic nanodisks. Using integrated coplanar waveguides (CPWs), we studied the excitation and transmission of spin waves depending on the presence of nanomagnet arrays of different lateral extensions. By means of the grating coupler effect, we excited spin waves propagating in multiple lateral directions with wavelengths down to 111 nm. They exhibited group velocities of up to 1 km/s. Detection of such short-wavelength spin waves was possible only in symmetrically designed emitter/detector configurations, not with a bare CPW. We report spin waves propagating between grating couplers under oblique angles exhibiting a wave vector component parallel to the CPW. The effective propagation distance amounted to about 80 μm. Such transmission signals were not addressed before and substantiate the versatility of the grating coupler effect for implementing nanomagnonic circuits.

  16. Inactivation of certain insect pathogens by ultraviolet radiation

    International Nuclear Information System (INIS)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV. (orig.) [de

  17. Photoreactivation of cells and phages inactivated by UV of ecological wave-lengths

    International Nuclear Information System (INIS)

    Samojlova, K.A.; Yanovska, Eh.; Vizdalova, M.; Ceskoslovenska Akademie Ved, Brno. Biofysikalni Ustav)

    1979-01-01

    It has been found that the photoreactivity of infusoria Paramecium caudatum and bacteria Escherichia coli is high and practically similar if they are irradiated with short-wave (254 nm) and mean-wave (300-315 nm) UV radiation. The cells damaged with long-wave (315-400 nm) UV rays are not photoactivated. The latter is caused by the appearance of nonphotoreactivated damages since the phages jrradiated with the same UV rays are reactivated extremely weakly in the intact cells of bacteria (phage T7) or are not reactivated at all (phage lambdasub(c1 857))

  18. Crystal growth, optical properties, and continuous-wave laser operation of Nd3+-doped CaNb2O6 crystal

    International Nuclear Information System (INIS)

    Cheng, Y; Xu, X D; Xiao, X D; Li, D Z; Zhao, C C; Zhou, S M; Xin, Z; Yang, X B; Xu, J

    2009-01-01

    Laser crystal Nd:CaNb 2 O 6 with excellent quality has been grown by Czochralski technique. The effective segregation coefficient of Nd 3+ was studied by X-ray fluorescence method. The polarized absorption spectra and the fluorescence spectra of Nd:CaNb 2 O 6 were measured at room temperature. The peak absorption cross section was calculated to be 6.202×10 -20 cm 2 with a broad FWHM of 7 nm at 808 nm for E ∥ a light polarization. The emission cross section at 1062 nm is 9.87×10 -20 cm 2 . We report what we believe to be the first demonstration of the continuous-wave Nd:CaNb 2 O 6 laser operation under diode pumping. Output power of 1.86 W at 1062 nm was obtained with a slope efficiency of 19% in the CW regime

  19. Crystal growth, optical properties, and continuous-wave laser operation of Nd3+-doped CaNb2O6 crystal

    Science.gov (United States)

    Cheng, Y.; Xu, X. D.; Xin, Z.; Yang, X. B.; Xiao, X. D.; Li, D. Z.; Zhao, C. C.; Xu, J.; Zhou, S. M.

    2009-10-01

    Laser crystal Nd:CaNb2O6 with excellent quality has been grown by Czochralski technique. The effective segregation coefficient of Nd3+ was studied by X-ray fluorescence method. The polarized absorption spectra and the fluorescence spectra of Nd:CaNb2O6 were measured at room temperature. The peak absorption cross section was calculated to be 6.202×10-20 cm2 with a broad FWHM of 7 nm at 808 nm for E ∥ a light polarization. The emission cross section at 1062 nm is 9.87×10-20 cm2. We report what we believe to be the first demonstration of the continuous-wave Nd:CaNb2O6 laser operation under diode pumping. Output power of 1.86 W at 1062 nm was obtained with a slope efficiency of 19% in the CW regime.

  20. Auroral kilometric radiation - An example of relativistic wave-particle interaction in geoplasma

    International Nuclear Information System (INIS)

    Pritchett, P.L.

    1990-01-01

    The earth's auroral kilometric radiation (AKR) is believed to be produced by the electron-cyclotron maser instability. This instability is the result of a wave-particle interaction in which relativistic effects are crucial. An explanation is given as to how these relativistic effects alter the shape of the resonance curve in velocity space and modify the R - X mode wave dispersion near the electron cyclotron frequency compared to the results obtained in the nonrelativistic limit and from cold-plasma theory. The properties of the cyclotron maser instability in a driven system are illustrated using two-dimensional electromagnetic particle simulations which incorporate a continual flow of primary energetic electrons along the magnetic field. 31 refs

  1. Radiation of Electron in the Field of Plane Light Wave

    International Nuclear Information System (INIS)

    Zelinsky, A.; Drebot, I.V.; Grigorev, Yu.N.; Zvonareva, O.D.; Tatchyn, R.

    2006-01-01

    Results of integration of a Lorentz equation for a relativistic electron moving in the field of running, plane, linear polarized electromagnetic wave are presented in the paper. It is shown that electron velocities in the field of the wave are almost periodic functions of time. For calculations of angular spectrum of electron radiation intensity expansion of the electromagnetic field in a wave zone into generalized Fourier series was used. Expressions for the radiation intensity spectrum are presented in the paper. Derived results are illustrated for electron and laser beam parameters of NSC KIPT X-ray generator NESTOR. It is shown that for low intensity of the interacting electromagnetic wave the results of energy and angular spectrum calculations in the frame of classical electrodynamics completely coincide with calculation results produced using quantum electrodynamics. Simultaneously, derived expressions give possibilities to investigate dependence of energy and angular Compton radiation spectrum on phase of interaction and the interacting wave intensity

  2. Laser at 532 nm by intracavity frequency-doubling in BBO

    Science.gov (United States)

    Yuan, Xiandan; Wang, Jinsong; Chen, Yongqi; Wu, Yulong; Qi, Yunfei; Sun, Meijiao; Wang, Qi

    2017-06-01

    A simple and compact linear resonator green laser at 532 nm is generated by intracavity frequency-doubling of a diode-side-pumped acousto-optically (AO) Q-switched Nd:YAG laser at 1064 nm. Two acousto-optic Q-switches were placed orthogonally with each other to improve the hold-off capacity. As high as 214 W of continuous-wave (CW) and 154 W of quasi-continuous-wave (QCW) output power at 1064 nm were obtained when the pumping power was 1598 W. The type I phase-matched BBO crystal was used as the nonlinear medium in the second harmonic generation. A green laser with an average output power of 37 W was obtained at a repetition rate of 20 kHz and a pulse width of 54 ns, which corresponds to pulse energy of 1.85 mJ per pulse and a peak power 34.26 kW, respectively. Project supported by the Beijing Engineering Technology Research Center of All-Solid-State Lasers Advanced Manufacturing, the National High Technology Research and Development Program of China (No. 2014AA032607), and the National Natural Science Foundation of China (Nos. 61404135, 61405186, 61308032, 61308033).

  3. Sub-wavelength patterning of organic monolayers via nonlinear processing with continuous-wave lasers

    Energy Technology Data Exchange (ETDEWEB)

    Mathieu, Mareike; Hartmann, Nils, E-mail: nils.hartmann@uni-due.de [Fakultaet fuer Chemie, Universitaet Duisburg-Essen, 45117 Essen (Germany); CeNIDE-Center for Nanointegration Duisburg-Essen, 47048 Duisburg (Germany); NETZ-NanoEnergieTechnikZentrum, 47048 Duisburg (Germany)

    2010-12-15

    In recent years, nonlinear processing with continuous-wave lasers has been demonstrated to be a facile means of rapid nanopatterning of organic monolayers down to the sub-100 nm range. In this study, we report on laser patterning of thiol-based organic monolayers with sub-wavelength resolution. Au-coated silicon substrates are functionalized with 1-hexadecanethiol. Irradiation with a focused beam of an Ar{sup +} laser operating at {lambda}=514 nm allows one to locally remove the monolayer. Subsequently, the patterns are transferred into the Au film via selective etching in a ferri-/ferrocyanide solution. Despite a 1/e{sup 2} spot diameter of about 2.8 {mu}m, structures with lateral dimensions down to 250 nm are fabricated. The underlying nonlinear dependence of the patterning process on laser intensity is traced back to the interplay between the laser-induced transient local temperature rise and the thermally activated desorption of the thiol molecules. A simple thermokinetic analysis of the data allows us to determine the effective kinetic parameters. These results complement our previous work on photothermal laser patterning of ultrathin organic coatings, such as silane-based organic monolayers, organo/silicon interfaces and supported membranes. A general introduction to nonlinear laser processing of organic monolayers is presented.

  4. Experimental investigation on a diode-pumped cesium-vapor laser stably operated at continuous-wave and pulse regime.

    Science.gov (United States)

    Chen, Fei; Xu, Dongdong; Gao, Fei; Zheng, Changbin; Zhang, Kuo; He, Yang; Wang, Chunrui; Guo, Jin

    2015-05-04

    Employing a fiber-coupled diode-laser with a center wavelength of 852.25 nm and a line width of 0.17 nm, experimental investigation on diode-end-pumped cesium (Cs) vapor laser stably operated at continuous-wave (CW) and pulse regime is carried out. A 5 mm long cesium vapor cell filled with 60 kPa helium and 20 kPa ethane is used as laser medium. Using an output coupler with reflectivity of 48.79%, 1.26 W 894.57 nm CW laser is obtained at an incident pump power of 4.76 W, corresponding an optical-optical efficiency of 26.8% and a slope-efficiency of 28.8%, respectively. The threshold temperature is 67.5 °C. Stable pulsed cesium laser with a maximum average output power of 2.6 W is obtained at a repetition rate of 76 Hz, and the pulse repetition rate can be extend to 1 kHz with a pulse width of 18 μs.

  5. Cluster Observations of Non-Time Continuous Magnetosonic Waves

    Science.gov (United States)

    Walker, Simon N.; Demekhov, Andrei G.; Boardsen, Scott A.; Ganushkina, Natalia Y.; Sibeck, David G.; Balikhin, Michael A.

    2016-01-01

    Equatorial magnetosonic waves are normally observed as temporally continuous sets of emissions lasting from minutes to hours. Recent observations, however, have shown that this is not always the case. Using Cluster data, this study identifies two distinct forms of these non temporally continuous use missions. The first, referred to as rising tone emissions, are characterized by the systematic onset of wave activity at increasing proton gyroharmonic frequencies. Sets of harmonic emissions (emission elements)are observed to occur periodically in the region +/- 10 off the geomagnetic equator. The sweep rate of these emissions maximizes at the geomagnetic equator. In addition, the ellipticity and propagation direction also change systematically as Cluster crosses the geomagnetic equator. It is shown that the observed frequency sweep rate is unlikely to result from the sideband instability related to nonlinear trapping of suprathermal protons in the wave field. The second form of emissions is characterized by the simultaneous onset of activity across a range of harmonic frequencies. These waves are observed at irregular intervals. Their occurrence correlates with changes in the spacecraft potential, a measurement that is used as a proxy for electron density. Thus, these waves appear to be trapped within regions of localized enhancement of the electron density.

  6. Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge.

    Science.gov (United States)

    MacDonald, N A; Cappelli, M A; Hargus, W A

    2012-11-01

    A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s(')[1/2](1)(0)-6p(')[3/2](2) xenon atomic transition at λ = 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

  7. 30 CFR 285.201 - How will MMS issue leases?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS issue leases? 285.201 Section 285... Energy Leases General Lease Information § 285.201 How will MMS issue leases? The MMS will issue leases on... noncompetitively, as provided under §§ 285.230 and 285.232. We will issue leases on forms approved by MMS and will...

  8. Enhancement of 800 nm upconversion emission in a thulium doped tellurite microstructured fiber pumped by a 1560 nm femtosecond fiber laser

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Zhixu; Zheng, Kezhi [State Key Laboratory of Optical Fiber and Cable Manufacture Technology, Yangtze Optical Fiber and Cable Joint Stock Limited Company, Wuhan 430073 (China); State Key Laboratory on Integrated Optoelectronics, College of Electronic Science and Engineering, Jilin University, Changchun 130012 (China); Yao, Chuanfei; Wang, Shunbin; Qin, Guanshi, E-mail: qings@jlu.edu.cn; Qin, Weiping, E-mail: wpqin@jlu.edu.cn [State Key Laboratory on Integrated Optoelectronics, College of Electronic Science and Engineering, Jilin University, Changchun 130012 (China); Xiong, Liangming; Luo, Jie; Lv, Dajuan [State Key Laboratory of Optical Fiber and Cable Manufacture Technology, Yangtze Optical Fiber and Cable Joint Stock Limited Company, Wuhan 430073 (China); Ohishi, Yasutake [Research Center for Advanced Photon Technology, Toyota Technological Institute, 2-12-1 Hisakata, Tempaku, Nagoya 468–8511 (Japan)

    2016-04-28

    We report enhanced upconversion (UC) fluorescence in Tm{sup 3+} doped tellurite microstructured fibers (TDTMFs) fabricated by using a rod-in-tube method. Under the pumping of a 1560 nm femtosecond fiber laser, ultrabroadband supercontinuum light expanding from ∼1050 to ∼2700 nm was generated in a 4 cm long TDTMF. Simultaneously, intense 800 nm UC emission from the {sup 3}H{sub 4} → {sup 3}H{sub 6} transition of Tm{sup 3+} was observed in the same TDTMF. Compared to that pumped by a 1560 nm continuous wave fiber laser, the UC emission intensity was enhanced by ∼4.1 times. The enhancement was due to the spectral broadening in the TDTMF under the pumping of the 1560 nm femtosecond fiber laser.

  9. Inertia-gravity wave radiation from the merging of two co-rotating vortices in the f-plane shallow water system

    International Nuclear Information System (INIS)

    Sugimoto, Norihiko

    2015-01-01

    Inertia-gravity wave radiation from the merging of two co-rotating vortices is investigated numerically in a rotating shallow water system in order to focus on cyclone–anticyclone asymmetry at different values of the Rossby number (Ro). A numerical study is conducted on a model using a spectral method in an unbounded domain to estimate the gravity wave flux with high accuracy. Continuous gravity wave radiation is observed in three stages of vortical flows: co-rotating of the vortices, merging of the vortices, and unsteady motion of the merged vortex. A cyclone–anticyclone asymmetry appears at all stages at smaller Ro (≤20). Gravity waves from anticyclones are always larger than those from cyclones and have a local maximum at smaller Ro (∼2) compared with that for an idealized case of a co-rotating vortex pair with a constant rotation rate. The source originating in the Coriolis acceleration has a key role in cyclone–anticyclone asymmetry in gravity waves. An additional important factor is that at later stages, the merged axisymmetric anticyclone rotates faster than the elliptical cyclone due to the effect of the Rossby deformation radius, since a rotation rate higher than the inertial cutoff frequency is required to radiate gravity waves

  10. Inertia-gravity wave radiation from the merging of two co-rotating vortices in the f-plane shallow water system

    Energy Technology Data Exchange (ETDEWEB)

    Sugimoto, Norihiko, E-mail: nori@phys-h.keio.ac.jp [Department of Physics, Research and Education Center for Natural Sciences, Keio University, 4-1-1 Hiyoshi, Kouhoku-ku, Yokohama, Kanagawa 223-8521 (Japan)

    2015-12-15

    Inertia-gravity wave radiation from the merging of two co-rotating vortices is investigated numerically in a rotating shallow water system in order to focus on cyclone–anticyclone asymmetry at different values of the Rossby number (Ro). A numerical study is conducted on a model using a spectral method in an unbounded domain to estimate the gravity wave flux with high accuracy. Continuous gravity wave radiation is observed in three stages of vortical flows: co-rotating of the vortices, merging of the vortices, and unsteady motion of the merged vortex. A cyclone–anticyclone asymmetry appears at all stages at smaller Ro (≤20). Gravity waves from anticyclones are always larger than those from cyclones and have a local maximum at smaller Ro (∼2) compared with that for an idealized case of a co-rotating vortex pair with a constant rotation rate. The source originating in the Coriolis acceleration has a key role in cyclone–anticyclone asymmetry in gravity waves. An additional important factor is that at later stages, the merged axisymmetric anticyclone rotates faster than the elliptical cyclone due to the effect of the Rossby deformation radius, since a rotation rate higher than the inertial cutoff frequency is required to radiate gravity waves.

  11. Measurements of radiated elastic wave energy from dynamic tensile cracks

    Science.gov (United States)

    Boler, Frances M.

    1990-01-01

    The role of fracture-velocity, microstructure, and fracture-energy barriers in elastic wave radiation during a dynamic fracture was investigated in experiments in which dynamic tensile cracks of two fracture cofigurations of double cantilever beam geometry were propagating in glass samples. The first, referred to as primary fracture, consisted of fractures of intact glass specimens; the second configuration, referred to as secondary fracture, consisted of a refracture of primary fracture specimens which were rebonded with an intermittent pattern of adhesive to produce variations in fracture surface energy along the crack path. For primary fracture cases, measurable elastic waves were generated in 31 percent of the 16 fracture events observed; the condition for radiation of measurable waves appears to be a local abrupt change in the fracture path direction, such as occurs when the fracture intersects a surface flaw. For secondary fractures, 100 percent of events showed measurable elastic waves; in these fractures, the ratio of radiated elastic wave energy in the measured component to fracture surface energy was 10 times greater than for primary fracture.

  12. 7 CFR 285.4 - Audits.

    Science.gov (United States)

    2010-01-01

    ... such audit shall be reported to FNS no later than 120 days from the end of each fiscal year in which the audit is made. (b) Within 120 days of the end of each fiscal year, the Commonwealth of Puerto Rico... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 285.4 Section 285.4 Agriculture Regulations of...

  13. Nonlinear VLF Wave Physics in the Radiation Belts

    Science.gov (United States)

    Crabtree, C. E.; Tejero, E. M.; Ganguli, G.; Mithaiwala, M.; Rudakov, L.; Hospodarsky, G. B.; Kletzing, C.

    2014-12-01

    Electromagnetic VLF waves, such as whistler mode waves, both control the lifetime of trapped electrons in the radiation belts by pitch-angle scattering and are responsible for the energization of electrons during storms. Traditional approaches to understanding the influence of waves on trapped electrons have assumed that the wave characteristics (frequency spectrum, wave-normal angle distribution, etc.) were both stationary in time and amplitude independent from event to event. In situ data from modern satellite missions, such as the Van Allen probes, are showing that this assumption may not be justified. In addition, recent theoretical results [Crabtree et al. 2012] show that the threshold for nonlinear wave scattering can often be met by naturally occurring VLF waves in the magnetosphere, with wave magnetic fields of the order of 50-100 pT inside the plasmapause. Nonlinear wave scattering (Nonlinear Landau Damping) is an amplitude dependent mechanism that can strongly alter VLF wave propagation [Ganguli et al. 2010], primarily by altering the direction of propagation. Laboratory results have confirmed the dramatic change in propagation direction when the pump wave has sufficient amplitude to exceed the nonlinear threshold [Tejero et al. 2014]. Nonlinear scattering can alter the macroscopic dynamics of waves in the radiation belts leading to the formation of a long-lasting wave-cavity [Crabtree et al. 2012] and, when amplification is present, a multi-pass amplifier [Ganguli et al., 2012]. Such nonlinear wave effects can dramatically reduce electron lifetimes. Nonlinear wave dynamics such as these occur when there are more than one wave present, such a condition necessarily violates the assumption of traditional wave-normal analysis [Santolik et al., 2003] which rely on the plane wave assumption. To investigate nonlinear wave dynamics using modern in situ data we apply the maximum entropy method [Skilling and Bryan, 1984] to solve for the wave distribution function

  14. Environmental assessment of the proposed Continuous Wave Deuterium Demonstrator (CWDD)

    International Nuclear Information System (INIS)

    1992-03-01

    An assessment was made of the potential environmental impacts of construction and operation of the Continuous Wave Deuterium Demonstrator (CWDD) at Argonne National Laboratory (ANL), including an evaluation of alternative actions. Key elements considered were on- and off-site radiological effects and potential impacts to cultural resources. The radiological consequences of routine operations of the CWDD are readily reduced to insignificant levels by bulk shielding, confinement, and containment. The radiation dose to the maximally exposed off-site individual would be 0.52 mrem/yr from direct radiation and 1.2 x 10 -3 mrem/yr from airborne radionuclides, based on maximum planned facility operation. The maximum credible postulated accident would result in a dose to the maximally exposed individual of less than 20 mrem. A cultural resource survey has determined that the location for the CWDD has, no cultural resource sites or materials and construction is permitted by the Illinois Historic Preservation Agency. Demands for utility services would require only about two percent of excess capacity already installed at Argonne. Other environmental impact categories were considered, including socioeconomic effects, aquatic and terrestrial flora and fauna, wetlands, and water and air quality

  15. Dissipative-drift wave instability in the presence of impurity radiation

    International Nuclear Information System (INIS)

    Bharuthram, R.; Shukla, P.K.

    1992-01-01

    It is believed that electrostatic fluctuations in edge plasmas are usually triggered by micro and macroscopic plasma instabilities. The latter involve dissipative-drift waves as well as tearing and rippling modes in nonuniform plasmas. However, if the plasma edge contains impurity radiation, then the radiative condensation instability could be the cause of nonthermal fluctuations. The radiative condensation instabilities have been extensively investigated in a homogeneous plasma by many authors. The effect of equilibrium density and electron temperature inhomogeneities in the study of radiative condensation instabilities has been examined by Shukla and Yu. They found new drift-like modes driven by the combined effect of impurity radiation loss and the equilibrium density and temperature gradients. The analyses of Shukla and Yu is, however, limited to low-frequency, long wavelength collisionless drift waves. Since the edge plasma of toroidal devices is highly collisional, the results of collisionless theories cannot be directly applied to explain the origin of nonthermal fluctuations. In this paper, we study the influence of impurity radiation on the dissipative-drift wave instability in a collision-dominated nonuniform plasma embedded in a homogeneous magnetic field. (author) 6 refs

  16. Investigating Degradation Mechanisms in 130 nm and 90 nm Commercial CMOS Technologies Under Extreme Radiation Conditions

    Science.gov (United States)

    Ratti, Lodovico; Gaioni, Luigi; Manghisoni, Massimo; Traversi, Gianluca; Pantano, Devis

    2008-08-01

    The purpose of this paper is to study the mechanisms underlying performance degradation in 130 nm and 90 nm commercial CMOS technologies exposed to high doses of ionizing radiation. The investigation has been mainly focused on their noise properties in view of applications to the design of low-noise, low-power analog circuits to be operated in harsh environment. Experimental data support the hypothesis that charge trapping in shallow trench isolation (STI), besides degrading the static characteristics of interdigitated NMOS transistors, also affects their noise performances in a substantial fashion. The model discussed in this paper, presented in a previous work focused on CMOS devices irradiated with a 10 Mrad(SiO2) gamma -ray dose, has been applied here also to transistors exposed to much higher (up to 100 Mrad(SiO2 )) doses of X-rays. Such a model is able to account for the extent of the observed noise degradation as a function of the device polarity, dimensions and operating point.

  17. An action spectrum for UV-B radiation and the rat lens.

    Science.gov (United States)

    Merriam, J C; Löfgren, S; Michael, R; Söderberg, P; Dillon, J; Zheng, L; Ayala, M

    2000-08-01

    To determine an action spectrum for UV-B radiation and the rat lens and to show the effect of the atmosphere and the cornea on the action spectrum. One eye of young female rats was exposed to 5-nm bandwidths of UV-B radiation (290, 295, 300, 305, 310, and 315 nm). Light scattering of exposed and nonexposed lenses was measured 1 week after irradiation. A quadratic polynomial was fit to the dose-response curve for each wave band. The dose at each wave band that produced a level of light scattering greater than 95% of the nonexposed lenses was defined as the maximum acceptable dose (MAD). Transmittance of the rat cornea was measured with a fiberoptic spectrophotometer. The times to be exposed to the MAD in Stockholm (59.3 degrees N) and La Palma (28 degrees N) were compared. Significant light scattering was detected after UV-B at 295, 300, 305, 310, and 315 nm. The lens was most sensitive to UV-B at 300 nm. Correcting for corneal transmittance showed that the rat lens is at least as sensitive to UV radiation at 295 nm as at 300 nm. The times to be exposed to the MAD at each wave band were greater in Stockholm than in La Palma, and in both locations the theoretical time to be exposed to the MAD was least at 305 nm. After correcting for corneal transmittance, the biological sensitivity of the rat lens to UV-B is at least as great at 295 nm as at 300 nm. After correcting for transmittance by the atmosphere, UV-B at 305 nm is the most likely wave band to injure the rat lens in both Stockholm and La Palma.

  18. Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, N. A.; Cappelli, M. A. [Stanford Plasma Physics Laboratory, Stanford University, Stanford, California 94305 (United States); Hargus, W. A. Jr. [Air Force Research Laboratory, Edwards AFB, California 93524 (United States)

    2012-11-15

    A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s{sup Prime }[1/2]{sub 1}{sup 0}-6p{sup Prime }[3/2]{sub 2} xenon atomic transition at {lambda}= 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

  19. Generation of thermo-acoustic waves from pulsed solar/IR radiation

    Science.gov (United States)

    Rahman, Aowabin

    Acoustic waves could potentially be used in a wide range of engineering applications; however, the high energy consumption in generating acoustic waves from electrical energy and the cost associated with the process limit the use of acoustic waves in industrial processes. Acoustic waves converted from solar radiation provide a feasible way of obtaining acoustic energy, without relying on conventional nonrenewable energy sources. One of the goals of this thesis project was to experimentally study the conversion of thermal to acoustic energy using pulsed radiation. The experiments were categorized into "indoor" and "outdoor" experiments, each with a separate experimental setup. The indoor experiments used an IR heater to power the thermo-acoustic lasers and were primarily aimed at studying the effect of various experimental parameters on the amplitude of sound waves in the low frequency range (below 130 Hz). The IR radiation was modulated externally using a chopper wheel and then impinged on a porous solid, which was housed inside a thermo-acoustic (TA) converter. A microphone located at a certain distance from the porous solid inside the TA converter detected the acoustic signals. The "outdoor" experiments, which were targeted at TA conversion at comparatively higher frequencies (in 200 Hz-3 kHz range) used solar energy to power the thermo-acoustic laser. The amplitudes (in RMS) of thermo-acoustic signals obtained in experiments using IR heater as radiation source were in the 80-100 dB range. The frequency of acoustic waves corresponded to the frequency of interceptions of the radiation beam by the chopper. The amplitudes of acoustic waves were influenced by several factors, including the chopping frequency, magnitude of radiation flux, type of porous material, length of porous material, external heating of the TA converter housing, location of microphone within the air column, and design of the TA converter. The time-dependent profile of the thermo-acoustic signals

  20. Simulations of nonlinear continuous wave pressure fields in FOCUS

    Science.gov (United States)

    Zhao, Xiaofeng; Hamilton, Mark F.; McGough, Robert J.

    2017-03-01

    The Khokhlov - Zabolotskaya - Kuznetsov (KZK) equation is a parabolic approximation to the Westervelt equation that models the effects of diffraction, attenuation, and nonlinearity. Although the KZK equation is only valid in the far field of the paraxial region for mildly focused or unfocused transducers, the KZK equation is widely applied in medical ultrasound simulations. For a continuous wave input, the KZK equation is effectively modeled by the Bergen Code [J. Berntsen, Numerical Calculations of Finite Amplitude Sound Beams, in M. F. Hamilton and D. T. Blackstock, editors, Frontiers of Nonlinear Acoustics: Proceedings of 12th ISNA, Elsevier, 1990], which is a finite difference model that utilizes operator splitting. Similar C++ routines have been developed for FOCUS, the `Fast Object-Oriented C++ Ultrasound Simulator' (http://www.egr.msu.edu/˜fultras-web) to calculate nonlinear pressure fields generated by axisymmetric flat circular and spherically focused ultrasound transducers. This new routine complements an existing FOCUS program that models nonlinear ultrasound propagation with the angular spectrum approach [P. T. Christopher and K. J. Parker, J. Acoust. Soc. Am. 90, 488-499 (1991)]. Results obtained from these two nonlinear ultrasound simulation approaches are evaluated and compared for continuous wave linear simulations. The simulation results match closely in the farfield of the paraxial region, but the results differ in the nearfield. The nonlinear pressure field generated by a spherically focused transducer with a peak surface pressure of 0.2MPa radiating in a lossy medium with β = 3.5 is simulated, and the computation times are also evaluated. The nonlinear simulation results demonstrate acceptable agreement in the focal zone. These two related nonlinear simulation approaches are now included with FOCUS to enable convenient simulations of nonlinear pressure fields on desktop and laptop computers.

  1. Photosensitized inactivation of DNA by monochromatic 334-nm radiation in the presence of 2-thiouracil: genetic activity and backbone breaks

    International Nuclear Information System (INIS)

    Peak, M.J.; Ito, A.; Peak, J.G.; Foote, C.S.

    1988-01-01

    Monochromatic 334-nm radiation delivered under aerobic conditions inactivates the genetic activity (ability to transform auxotrophic recipient cells to nutritional prototrophy) of isolated transforming Bacillus subtilis DNA. The presence of superoxide dismutase (SOD), catalase, and mannitol reduces the 334-nm inactivation. The rate of inactivation of the genetic activity by 334-nm radiation is enhanced fivefold by the sensitizer 2-thiouracil (s 2 Ura). This enhancement is substantially reversed when the irradiations are performed in the presence of mannitol, and, to a lesser extent, SOD. Catalase slightly reduces the s 2 Ura enhancement of 334-nm inactivation of transforming activity. Backbone breaks induced in the same DNA by aerobic 334-nm radiation were also enhanced markedly by the presence of s 2 Ura; this enhancement was reversed by the presence of mannitol and, to a lesser extent, SOD during irradiation. Catalase had no effect upon s 2 Ura-enhanced, 334-nm-induced SSBs. Whereas DNA breakage may be responsible for a portion of the inactivation of the DNA by the photosensitized reaction between s 2 Ura and 334-nm radiation, it is not the only inactivating lesion, because the yield of SSBs per lethal hit per unit length of DNA is not constant for all the irradiation conditions studied. (author)

  2. Radiation Safety of Electromagnetic Waves

    International Nuclear Information System (INIS)

    Hussein, A.Z.

    2009-01-01

    The wide spread of Electromagnetic Waves (EMW) through the power lines, multimedia, communications, devices, appliances, etc., are well known. The probable health hazards associated with EMW and the radiation safety criteria are to be reviewed. However, the principles of the regulatory safety are based on radiation protection procedure, intervention to combat the relevant risk and to mitigate consequences. The oscillating electric magnetic fields (EMF) of the electromagnetic radiation (EMR) induce electrical hazards. The extremely high power EMR can cause fire hazards and explosions of pyrotechnic (Rad Haz). Biological hazards of EMF result as dielectric heat, severe burn, as well as the hazards of eyes. Shielding is among the technical protective measures against EMR hazards. Others are limitation of time of exposure and separation distance apart of the EMR source. Understanding and safe handling of the EMR sources are required to feel safety.

  3. Investigation of 207 nm UV radiation for degradation of organic dye ...

    African Journals Online (AJOL)

    The photo-degradation of organic dye C.I. Acid Red 213 (AR-213) was achieved by 207 nm UV radiation emitted from a planar KrBr* excimer lamp without addition of oxidants at varying initial pH values. Precipitates were found to be generated when the irradiated solution of initial acid pH was adjusted to alkaline pH and ...

  4. 7 CFR 285.1 - General purpose and scope.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 285.1 Section 285.1... COMMONWEALTH OF PUERTO RICO § 285.1 General purpose and scope. This part describes the general terms and... government of the Commonwealth of Puerto Rico for the purpose of designing and conducting a nutrition...

  5. Imitation-tumor targeting based on continuous-wave near-infrared tomography.

    Science.gov (United States)

    Liu, Dan; Liu, Xin; Zhang, Yan; Wang, Qisong; Lu, Jingyang; Sun, Jinwei

    2017-12-01

    Continuous-wave Near-Infrared (NIR) optical spectroscopy has shown great diagnostic capability in the early tumor detection with advantages of low-cost, portable, non-invasive, and non-radiative. In this paper, Modified Lambert-Beer Theory is deployed to address the low-resolution issues of the NIR technique and to design the tumor detecting and imaging system. Considering that tumor tissues have features such as high blood flow and hypoxia, the proposed technique can detect the location, size, and other information of the tumor tissues by comparing the absorbance between pathological and normal tissues. Finally, the tumor tissues can be imaged through tomographic method. The simulation experiments prove that the proposed technique and designed system can efficiently detect the tumor tissues, achieving imaging precision within 1 mm. The work of the paper has shown great potential in the diagnosis of tumor close to body surface.

  6. Clinical applications of continuous infusion chemotherapy ahd concomitant radiation therapy

    International Nuclear Information System (INIS)

    Rosenthal, C.J.; Rotman, M.

    1986-01-01

    This book presents information on the following topics: theoretical basis and clinical applications of 5-FU as a radiosensitizer; treatment of hepatic metastases from gastro intestingal primaries with split course radiation therapy; combined modality therapy with 5-FU, Mitomycin-C and radiation therapy for sqamous cell cancers; treatment of bladder carcinoma with concomitant infusion chemotherapy and irradiation; a treatment of invasiv bladder cancer by the XRT/5FU protocol; concomitant radiation therapy and doxorubicin by continuous infusion in advanced malignancies; cis platin by continuous infusion with concurrent radiation therapy in malignant tumors; combination of radiation with concomitant continuous adriamycin infusion in a patient with partially excised pleomorphic soft tissue sarcoma of the lower extremeity; treatment of recurrent carcinoma of the paranasal sinuses using concomitant infusion cis-platinum and radiation therapy; hepatic artery infusion for hepatic metastases in combination with hepatic resection and hepatic radiation; study of simultaneous radiation therapy, continuous infusion, 5FU and bolus mitomycin-C; cancer of the esophagus; continuous infusion VP-16, bolus cis-platinum and simultaneous radiation therapy as salvage therapy in small cell bronchogenic carcinoma; and concomitant radiation, mitomycin-C and 5-FU infusion in gastro intestinal cancer

  7. Semiconductor lasers with a continuous tuning range above 100 nm in the nearest IR spectral region

    Energy Technology Data Exchange (ETDEWEB)

    Kostin, Yu O; Lobintsov, A A; Shramenko, M V [OOO ' Opton' , Moscow (Russian Federation); Ladugin, M A; Marmalyuk, A A [Open Joint-Stock Company M.F. Stel' makh Polyus Research Institute, Moscow (Russian Federation); Chamorovsky, A Yu [Superlum Ltd., Unit B3, Fota Point Enterprise Park, Carrigtwohill, Co Cork (Ireland); Yakubovich, S D [Moscow State Institute of Radio-Engineering, Electronics and Automation (Technical University), Moscow (Russian Federation)

    2015-08-31

    We have developed two new types of lasers based on quantum-confined semiconductor optical amplifiers with an acousto-optic tunable filter in an external fibre ring cavity. The lasers offer continuous wavelength tuning ranges from 780 to 885 and from 880 to 1010 nm, 20 mW of cw output power, and a tuning rate up to 10{sup 4} nm s{sup -1} at an instantaneous spectral linewidth less than 0.1 nm. (lasers)

  8. Dicty_cDB: VHI285 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHI285 (Link to dictyBase) - - - Contig-U16073-1 - (Link to Or...iginal site) VHI285F 136 - - - - - - Show VHI285 Library VH (Link to library) Clone ID VHI285 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16073-1 Original site URL http://dictycdb.b... DNA Score E Sequences producing significant alignments: (bits) Value N ( BJ423035 ) Dict...yostelium discoideum cDNA clone:ddv47i22, 5' ... 72 2e-27 3 ( BJ419916 ) Dictyostelium discoideum cD

  9. EPILEPTIC ENCEPHALOPATHY WITH CONTINUOUS SPIKES-WAVES ACTIVITY DURING SLEEP

    Directory of Open Access Journals (Sweden)

    E. D. Belousova

    2012-01-01

    Full Text Available The author represents the review and discussion of current scientific literature devoted to epileptic encephalopathy with continuous spikes-waves activity during sleep — the special form of partly reversible age-dependent epileptic encephalopathy, characterized by triad of symptoms: continuous prolonged epileptiform (spike-wave activity on EEG in sleep, epileptic seizures and cognitive disorders. The author describes the aspects of classification, pathogenesis and etiology, prevalence, clinical picture and diagnostics of this disorder, including the peculiar anomalies on EEG. The especial attention is given to approaches to the treatment of epileptic encephalopathy with continuous spikeswaves activity during sleep. Efficacy of valproates, corticosteroid hormones and antiepileptic drugs of other groups is considered. The author represents own experience of treatment this disorder with corticosteroids, scheme of therapy and assessment of efficacy.

  10. A simple equilibrium theoretical model and predictions for a continuous wave exciplex pumped alkali laser

    International Nuclear Information System (INIS)

    Carroll, David L; Verdeyen, Joseph T

    2013-01-01

    The exciplex pumped alkali laser (XPAL) system has been demonstrated in mixtures of Cs vapour, Ar, with and without ethane, by pumping Cs-Ar atomic collision pairs and subsequent dissociation of diatomic, electronically excited CsAr molecules (exciplexes or excimers). The blue satellites of the alkali D 2 lines provide an advantageous pathway for optically pumping atomic alkali lasers on the principal series (resonance) transitions with broad linewidth (>2 nm) semiconductor diode lasers. The development of a simple theoretical analysis of continuous-wave XPAL systems is presented along with predictions as a function of temperature and pump intensity. The model predicts that an optical-to-optical efficiency in the range of 40-50% can be achieved for XPAL.

  11. Net radiation of mountain cultivated Norway spruce [Picea abies (L.) Karst.] stand: evaluation of shortand long-wave radiation ratio

    Czech Academy of Sciences Publication Activity Database

    Marková, I.; Marek, Michal V.

    2011-01-01

    Roč. 53, č. 2 (2011), s. 114-122 ISSN 0071-6677 Institutional research plan: CEZ:AV0Z60870520 Keywords : downward short- and long-wave radiation * upward short- and long-wave radiation * sun elevation * clearness index Subject RIV: GK - Forestry

  12. Radiation from channeled positrons in a hypersonic wave field

    International Nuclear Information System (INIS)

    Mkrtchyan, A.R.; Gasparyan, R.A.; Gabrielyan, R.G.

    1987-01-01

    The radiation emitted by channeled positrons in a longitudinal or transverse standing hypersonic wave field is considered. In the case of plane channeling the spectral distribution of the radiation intensity is shown to be of a resonance nature depending on the hypersound frequency

  13. Blandford's argument: The strongest continuous gravitational wave signal

    International Nuclear Information System (INIS)

    Knispel, Benjamin; Allen, Bruce

    2008-01-01

    For a uniform population of neutron stars whose spin-down is dominated by the emission of gravitational radiation, an old argument of Blandford states that the expected gravitational-wave amplitude of the nearest source is independent of the deformation and rotation frequency of the objects. Recent work has improved and extended this argument to set upper limits on the expected amplitude from neutron stars that also emit electromagnetic radiation. We restate these arguments in a more general framework, and simulate the evolution of such a population of stars in the gravitational potential of our galaxy. The simulations allow us to test the assumptions of Blandford's argument on a realistic model of our galaxy. We show that the two key assumptions of the argument (two dimensionality of the spatial distribution and a steady-state frequency distribution) are in general not fulfilled. The effective scaling dimension D of the spatial distribution of neutron stars is significantly larger than two, and for frequencies detectable by terrestrial instruments the frequency distribution is not in a steady state unless the ellipticity is unrealistically large. Thus, in the cases of most interest, the maximum expected gravitational-wave amplitude does have a strong dependence on the deformation and rotation frequency of the population. The results strengthen the previous upper limits on the expected gravitational-wave amplitude from neutron stars by a factor of 6 for realistic values of ellipticity.

  14. Absolute cross sections for emission of 284.7-nm (Hg II) and 479.7-nm (Hg III) radiation in electron--mercury-ion collisions

    International Nuclear Information System (INIS)

    Phaneuf, R.A.; Taylor, P.O.; Dunn, G.H.

    1976-01-01

    Crossed beams of electrons and Hg + ions have been used to measure absolute cross sections for emission of 284.7-nm radiation, resulting from excitation of a predominantly ground-state Hg + target to the 7s 2 S 1 / 2 state. Values range from 3 x 10 -17 cm 2 near threshold, where the cross section is strongly peaked, to 1.3 x 10 -18 cm 2 at 280 eV. Also reported are some measurements of emission of 479.7-nm (Hg III) radiation, resulting from electron impact on both Hg + and Hg ++ targets. Cross sections range from approximately 5 x 10 -19 to 5 x 10 -20 cm 2 , and in the case of electron-Hg ++ collisions, are more than an order of magnitude smaller than predicted by an available semiclassical binary-encounter calculation

  15. Electromagnetic wave collapse in a radiation background

    International Nuclear Information System (INIS)

    Marklund, Mattias; Brodin, Gert; Stenflo, Lennart

    2003-01-01

    The nonlinear interaction, due to quantum electrodynamical (QED) effects between an electromagnetic pulse and a radiation background, is investigated by combining the methods of radiation hydrodynamics with the QED theory for photon-photon scattering. For the case of a single coherent electromagnetic pulse, we obtain a Zakharov-like system, where the radiation pressure of the pulse acts as a driver of acoustic waves in the photon gas. For a sufficiently intense pulse and/or background energy density, there is focusing and the subsequent collapse of the pulse. The relevance of our results for various astrophysical applications are discussed

  16. Non-thermal continuous and modulated electromagnetic radiation fields effects on sleep EEG of rats☆

    Science.gov (United States)

    Mohammed, Haitham S.; Fahmy, Heba M.; Radwan, Nasr M.; Elsayed, Anwar A.

    2012-01-01

    In the present study, the alteration in the sleep EEG in rats due to chronic exposure to low-level non-thermal electromagnetic radiation was investigated. Two types of radiation fields were used; 900 MHz unmodulated wave and 900 MHz modulated at 8 and 16 Hz waves. Animals has exposed to radiation fields for 1 month (1 h/day). EEG power spectral analyses of exposed and control animals during slow wave sleep (SWS) and rapid eye movement sleep (REM sleep) revealed that the REM sleep is more susceptible to modulated radiofrequency radiation fields (RFR) than the SWS. The latency of REM sleep increased due to radiation exposure indicating a change in the ultradian rhythm of normal sleep cycles. The cumulative and irreversible effect of radiation exposure was proposed and the interaction of the extremely low frequency radiation with the similar EEG frequencies was suggested. PMID:25685416

  17. Non-thermal continuous and modulated electromagnetic radiation fields effects on sleep EEG of rats

    Directory of Open Access Journals (Sweden)

    Haitham S. Mohammed

    2013-03-01

    Full Text Available In the present study, the alteration in the sleep EEG in rats due to chronic exposure to low-level non-thermal electromagnetic radiation was investigated. Two types of radiation fields were used; 900 MHz unmodulated wave and 900 MHz modulated at 8 and 16 Hz waves. Animals has exposed to radiation fields for 1 month (1 h/day. EEG power spectral analyses of exposed and control animals during slow wave sleep (SWS and rapid eye movement sleep (REM sleep revealed that the REM sleep is more susceptible to modulated radiofrequency radiation fields (RFR than the SWS. The latency of REM sleep increased due to radiation exposure indicating a change in the ultradian rhythm of normal sleep cycles. The cumulative and irreversible effect of radiation exposure was proposed and the interaction of the extremely low frequency radiation with the similar EEG frequencies was suggested.

  18. Diagnosis and Treatment of Neurological Disorders by Millimeter-Wave Stimulation

    Science.gov (United States)

    Siegel, Peter H.; Pikov, Victor

    2011-01-01

    Increasingly, millimeter waves are being employed for telecomm, radar, and imaging applications. To date in the U.S, however, very few investigations on the impact of this radiation on biological systems at the cellular level have been undertaken. In the beginning, to examine the impact of millimeter waves on cellular processes, researchers discovered that cell membrane depolarization may be triggered by low levels of integrated power at these high frequencies. Such a situation could be used to advantage in the direct stimulation of neuronal cells for applications in neuroprosthetics and diagnosing or treating neurological disorders. An experimental system was set up to directly monitor cell response on exposure to continuous-wave, fixed-frequency, millimeter-wave radiation at low and modest power levels (0.1 to 100 safe exposure standards) between 50 and 100 GHz. Two immortalized cell lines derived from lung and neuronal tissue were transfected with green fluorescent protein (GFP) that locates on the inside of the cell membrane lipid bi-layer. Oxonol dye was added to the cell medium. When membrane depolarization occurs, the oxonal bound to the outer wall of the lipid bi-layer can penetrate close to the inner wall where the GFP resides. Under fluorescent excitation (488 nm), the normally green GFP (520 nm) optical signal quenches and gives rise to a red output when the oxonol comes close enough to the GFP to excite a fluorescence resonance energy transfer (FRET) with an output at 620 nm. The presence of a strong FRET signature upon exposures of 30 seconds to 2 minutes at 5-10 milliwatts per square centimeter RF power at 50 GHz, followed by a return to the normal 520-nm GFP signal after a few minutes indicating repolarization of the membrane, indicates that low levels of RF energy may be able to trigger non-destructive membrane depolarization without direct cell contact. Such a mechanism could be used to stimulate neuronal cells in the cortex without the need for

  19. Demonstration of optical rogue waves using a laser diode emitting at 980  nm and a fiber Bragg grating.

    Science.gov (United States)

    Lee, Min Won; Baladi, Fadwa; Burie, Jean-René; Bettiati, Mauro A; Boudrioua, Azzedine; Fischer, Alexis P A

    2016-10-01

    Rogue waves are observed for the first time, to the best of our knowledge, in a 980 nm laser diode subject to filtered optical feedback via a fiber Bragg grating. By counting the number of rogue waves in a fixed time window, a rogue wave map is established experimentally as a function of both the optical feedback ratio and the laser current. The comparison with low frequency fluctuations (LFFs) reveals that the rogue waves observed in our system are, in fact, LFF jump-ups.

  20. Experimental study of coherent radiation in the millimeter-wave region at the KURRI-LINAC

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Toshiharu [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst.

    1996-07-01

    Coherent radiation, i.e., synchrotron radiation, transition radiation, Cherenkov radiation, or Smith-Purcell radiation emitted by short bunches of electrons has been observed in the millimeter-wave region. Properties of coherent radiation are characterized by the coherence effect and the relativistic one. The intensity of coherent radiation is enormously enhanced by several orders of magnitude in comparison with the incoherent radiation and the flux of radiation concentrates around the direction of the electron beam. Coherent radiation is useful as the intense light source in the millimeter-wave region. (author)

  1. Radiation of Sawtooth Waves from the End of an Open Pipe

    Science.gov (United States)

    Bakaitis, Rachael; Bodon, Josh; Gee, Kent; Thomas, Derek

    2012-10-01

    It is known, that because of nonlinear propagation distortion, a sinusoidal wave is transformed into a sawtooth-like wave as it travels through a pipe. It has been observed that the sawtooth wave, when measured immediately after it exits a pipe, has a form similar to a delta function. Currently this behavior is not understood, but has potential application to radiation of sound from brass instruments and rocket motors. Building on previous work in the 1970s by Blackstock and Wright, the purpose of the current research is to better understand the radiation of sawtooth waves from the open end of a circular pipe. Nonlinear propagation theory, the experimental apparatus and considerations, and some preliminary results are described.

  2. A monolithic active pixel sensor for ionizing radiation using a 180 nm HV-SOI process

    Energy Technology Data Exchange (ETDEWEB)

    Hemperek, Tomasz; Kishishita, Tetsuichi; Krueger, Hans; Wermes, Norbert [Institute of Physics, University of Bonn, Bonn (Germany)

    2016-07-01

    An improved SOI-MAPS (Silicon On Insulator Monolithic Active Pixel Sensor) for ionizing radiation based on thick-180 nm High Voltage SOI technology (HV-SOI) has been developed. Similar to existing Fully Depleted SOI-based (FD-SOI) MAPS, a buried silicon oxide inter-dielectric (BOX) layer is used to separate the CMOS electronics from the handle wafer which is used as a depleted charge collection layer. Standard FD-SOI MAPS suffer from radiation damage such as transistor threshold voltage shifts due to trapped charge in the buried oxide layer and charged interface states created at the silicon oxide boundaries (back gate effect). The X-FAB 180 nm HV-SOI technology offers an additional isolation using a deep non-depleted implant between the BOX layer and the active circuitry which mitigates this problem. Therefore we see in this technology a high potential to implement radiation-tolerant MAPS with fast charge collection. The design and measurement results from first prototypes are presented including radiation tolerance to total ionizing dose and charge collection properties of neutron irradiated samples.

  3. Non-thermal continuous and modulated electromagnetic radiation fields effects on sleep EEG of rats ?

    OpenAIRE

    Mohammed, Haitham S.; Fahmy, Heba M.; Radwan, Nasr M.; Elsayed, Anwar A.

    2012-01-01

    In the present study, the alteration in the sleep EEG in rats due to chronic exposure to low-level non-thermal electromagnetic radiation was investigated. Two types of radiation fields were used; 900 MHz unmodulated wave and 900 MHz modulated at 8 and 16 Hz waves. Animals has exposed to radiation fields for 1 month (1 h/day). EEG power spectral analyses of exposed and control animals during slow wave sleep (SWS) and rapid eye movement sleep (REM sleep) revealed that the REM sleep is more susc...

  4. 3D conformal external beam radiation therapy for prostate carcinoma: an experiment of Instituto do Radium de Campinas with 285 patients

    International Nuclear Information System (INIS)

    Nakamura, Ricardo Akiyoshi; Monti, Carlos Roberto; Trevisan, Felipe Amstalden; Jacinto, Alexandre Arthur

    2009-01-01

    Objective: To report the outcomes of 3D conformal radiation therapy for prostate cancer in a single institution. Materials and methods: From July 1997 to January 2002, 285 consecutive patients with prostate cancer were submitted to 3D conformal radiation therapy receiving a median dose of 7920 cGy to the prostate, and were retrospectively evaluated. The patients distribution according to the level of risk was the following: low risk - 95 (33.7%); intermediate risk - 66 (23.4%); high risk -121 (42.9%) patients. Results: Median follow-up of 53.6 months (3.6.95.3 months) demonstrated 85.1% actuarial five-year overall survival, 97.0% specific cause survival, 94.2% five-year distant metastasis-free survival, and 75.8% five-year biochemical recurrence-free survival. Rates of five-year actuarial survival free from late rectal and urinary toxicity were 96.4% and 91.1% respectively. Pre-3D conformal radiation therapy transurethral resection of the prostate and doses > 70 Gy in 30% of the bladder volume implied a higher grade 2-3 late urinary toxicity in five years (p = 0.0002 and p = 0.0264, respectively). Conclusion: The first experiment with 3D conformal radiation therapy reported in Brazil allowed high radiation doses with acceptable levels of urinary and rectal toxicity. Pre-3D conformal radiation therapy transurethral resection of prostate may determine a higher risk for post-irradiation grade 2-3 late urinary toxicity. At the tomography planning, the reduction of the radiation dose to . 70 Gy in 30% of the bladder volume may reduce the risk for late urinary complications. (author)

  5. Hough transform search for continuous gravitational waves

    International Nuclear Information System (INIS)

    Krishnan, Badri; Papa, Maria Alessandra; Sintes, Alicia M.; Schutz, Bernard F.; Frasca, Sergio; Palomba, Cristiano

    2004-01-01

    This paper describes an incoherent method to search for continuous gravitational waves based on the Hough transform, a well-known technique used for detecting patterns in digital images. We apply the Hough transform to detect patterns in the time-frequency plane of the data produced by an earth-based gravitational wave detector. Two different flavors of searches will be considered, depending on the type of input to the Hough transform: either Fourier transforms of the detector data or the output of a coherent matched-filtering type search. We present the technical details for implementing the Hough transform algorithm for both kinds of searches, their statistical properties, and their sensitivities

  6. A 50–60 GHz mm-wave rectifier with bulk voltage bias in 65-nm CMOS

    NARCIS (Netherlands)

    Gao, H.; Matters-Kammerer, M.; Harpe, P.; Baltus, P.

    2016-01-01

    This letter presents a 50∼60 GHz fully integrated 3-stage rectifier with bulk voltage bias for threshold voltage modulation in a 65-nm CMOS technology, which can be integrated in a mm-wave hybrid rectifier structure as the main rectifier. In this letter, the new technique of bulk voltage bias is

  7. POWER SCALING IN CONTINUOUS-WAVE YB:YAG MICROCHIP LASER FOR MEASURING APPLICATIONS

    Directory of Open Access Journals (Sweden)

    A. M. Ivashko

    2017-01-01

    Full Text Available Characteristics optimization of lasers used in different measuring systems is of great interest up to now. Diode-pumped microchip lasers is one of the most perspective ways for development of solid-state light sources with minimal size and weight together with low energy power consumption. Increasing of output power with good beam quality is rather difficult task for such type of lasers due to thermal effects in the gain crystal under high pump power.The investigation results of continuous-wave longitudinally diode-pumped Yb:YAG microchip laser are presented. In the presented laser radiation from multiple pump laser diodes were focused into the separate zone in one gain crystal that provides simultaneous generation of multiple laser beams. The energy and spatial laser beam characteristics were investigated.Influence of neighboring pumped regions on energy and spatial laser beams parameters both for separate and for sum laser output was observed. The dependences of laser output power from distance between neighboring pumped regions and their number were determined. Decreasing of laser output power was demonstrated with corresponding distance shortening between pumped regions and increasing their quantity with simultaneous improvement of laser beam quality.Demonstrated mutual influence of neighboring pumped regions in the longitudinally diode pumped Yb:YAG microchip laser allow as to generate diffraction limited Gaussian beam with 2W of continuous-wave output power that 30 % higher than in case of one pumped zone. 

  8. Extremely frequency-widened terahertz wave generation using Cherenkov-type radiation.

    Science.gov (United States)

    Suizu, Koji; Koketsu, Kaoru; Shibuya, Takayuki; Tsutsui, Toshihiro; Akiba, Takuya; Kawase, Kodo

    2009-04-13

    Terahertz (THz) wave generation based on nonlinear frequency conversion is promising way for realizing a tunable monochromatic bright THz-wave source. Such a development of efficient and wide tunable THz-wave source depends on discovery of novel brilliant nonlinear crystal. Important factors of a nonlinear crystal for THz-wave generation are, 1. High nonlinearity and 2. Good transparency at THz frequency region. Unfortunately, many nonlinear crystals have strong absorption at THz frequency region. The fact limits efficient and wide tunable THz-wave generation. Here, we show that Cherenkov radiation with waveguide structure is an effective strategy for achieving efficient and extremely wide tunable THz-wave source. We fabricated MgO-doped lithium niobate slab waveguide with 3.8 microm of thickness and demonstrated difference frequency generation of THz-wave generation with Cherenkov phase matching. Extremely frequency-widened THz-wave generation, from 0.1 to 7.2 THz, without no structural dips successfully obtained. The tuning frequency range of waveguided Cherenkov radiation source was extremely widened compare to that of injection seeded-Terahertz Parametric Generator. The tuning range obtained in this work for THz-wave generation using lithium niobate crystal was the widest value in our knowledge. The highest THz-wave energy obtained was about 3.2 pJ, and the energy conversion efficiency was about 10(-5) %. The method can be easily applied for many conventional nonlinear crystals, results in realizing simple, reasonable, compact, high efficient and ultra broad band THz-wave sources.

  9. Double shock front formation in cylindrical radiative blast waves produced by laser irradiation of krypton gas

    Energy Technology Data Exchange (ETDEWEB)

    Kim, I.; Quevedo, H. J.; Feldman, S.; Bang, W.; Serratto, K.; McCormick, M.; Aymond, F.; Dyer, G.; Bernstein, A. C.; Ditmire, T. [Center for High Energy Density Science, Department of Physics, The University of Texas at Austin, C1510, Austin, Texas 78712 (United States)

    2013-12-15

    Radiative blast waves were created by irradiating a krypton cluster source from a supersonic jet with a high intensity femtosecond laser pulse. It was found that the radiation from the shock surface is absorbed in the optically thick upstream medium creating a radiative heat wave that travels supersonically ahead of the main shock. As the blast wave propagates into the heated medium, it slows and loses energy, and the radiative heat wave also slows down. When the radiative heat wave slows down to the transonic regime, a secondary shock in the ionization precursor is produced. This paper presents experimental data characterizing both the initial and secondary shocks and numerical simulations to analyze the double-shock dynamics.

  10. Evaluation of ground stiffness parameters using continuous surface wave geophysics

    DEFF Research Database (Denmark)

    Gordon, Anne; Foged, Niels

    2000-01-01

    Present day knowledge of the magnitude of the strain levels in the ground associated with geotechnical structures, together with an increasing number of projects requiring the best estimates of ground movements around excavations, has led to, inter alia, increased interest in measuring the very......-small-strain stiffness of the ground Gmax. Continuous surface wave geophysics offers a quick, non-intrusive and economical way of making such measurements. This paper reviews the continuous surface wave techniques and evaluates, in engineering terms, the applicability of the method to the site investigation industry....

  11. Intra-cavity upconversion to 631 nm of images illuminated by an eye-safe ASE source at 1550 nm.

    Science.gov (United States)

    Torregrosa, A J; Maestre, H; Capmany, J

    2015-11-15

    We report an image wavelength upconversion system. The system mixes an incoming image at around 1550 nm (eye-safe region) illuminated by an amplified spontaneous emission (ASE) fiber source with a Gaussian beam at 1064 nm generated in a continuous-wave diode-pumped Nd(3+):GdVO(4) laser. Mixing takes place in a periodically poled lithium niobate (PPLN) crystal placed intra-cavity. The upconverted image obtained by sum-frequency mixing falls around the 631 nm red spectral region, well within the spectral response of standard silicon focal plane array bi-dimensional sensors, commonly used in charge-coupled device (CCD) or complementary metal-oxide-semiconductor (CMOS) video cameras, and of most image intensifiers. The use of ASE illumination benefits from a noticeable increase in the field of view (FOV) that can be upconverted with regard to using coherent laser illumination. The upconverted power allows us to capture real-time video in a standard nonintensified CCD camera.

  12. Diode-pumped thin-disk Nd:GdVO4 laser at 893 nm

    International Nuclear Information System (INIS)

    Li, Y L; Fu, X H; Wang, A G

    2011-01-01

    We report for the first time a Nd:GdVO 4 laser operating in a continuous wave (CW) on the quasi-three-level laser at 893 nm, based on the 4 F 3/2 – 4 I 9/2 transition, generally used for a 912 nm emission. The use of a pump module with 16 passes through the crystal allowed the realization of a Nd:GdVO 4 thin-disk laser with 157 mW of CW output power at 893 nm. Moreover, intracavity second-harmonic generation (SHG) has also been achieved with a power of 23 mW at 447 nm by using a BiB 3 O 6 (BiBO) nonlinear crystal

  13. Growth and continuous-wave laser operation of disordered crystals of Yb3+:NaLa(WO4)2 and Yb3+:NaLa(MoO4)2

    Science.gov (United States)

    Liu, J.; Cano-Torres, J. M.; Cascales, C.; Esteban-Betegón, F.; Serrano, M. D.; Volkov, V.; Zaldo, C.; Rico, M.; Griebner, U.; Petrov, V.

    2005-03-01

    Single crystals of disordered NaLa(WO4)2 and NaLa(MoO4)2 doped with Yb3+ are grown by the Czochralski method from the melt. Continuous-wave laser operation with Ti:sapphire laser pumping is demonstrated at room temperature without special cooling. Tunability from 1017 to 1057 nm and from 1015 to 1053 nm is achieved for Yb:NaLa(WO4)2 and Yb:NaLa(MoO4)2, respectively. A maximum output power of 205 mW is obtained with Yb:NaLa(WO4)2.

  14. Spin wave eigenmodes in single and coupled sub-150 nm rectangular permalloy dots

    Energy Technology Data Exchange (ETDEWEB)

    Carlotti, G., E-mail: giovanni.carlotti@fisica.unipg.it; Madami, M. [Dipartimento di Fisica e Geologia, Università di Perugia, Perugia (Italy); Tacchi, S. [Istituto Officina dei Materiali del CNR (CNR-IOM), Dipartimento di Fisica e Geologia, Perugia (Italy); Gubbiotti, G.; Dey, H.; Csaba, G.; Porod, W. [Center for Nano Science and Technology, Department of Electrical Engineering, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

    2015-05-07

    We present the results of a Brillouin light scattering investigation of thermally excited spin wave eigenmodes in square arrays of either isolated rectangular dots of permalloy or twins of dipolarly coupled elements, placed side-by-side or head-to-tail. The nanodots, fabricated by e-beam lithography and lift-off, are 20 nm thick and have the major size D in the range between 90 nm and 150 nm. The experimental spectra show the presence of two main peaks, corresponding to modes localized either at the edges or in the center of the dots. Their frequency dependence on the dot size and on the interaction with adjacent elements has been measured and successfully interpreted on the basis of dynamical micromagnetic simulations. The latter enabled us also to describe the spatial profile of the eigenmodes, putting in evidence the effects induced by the dipolar interaction between coupled dots. In particular, in twinned dots the demagnetizing field is appreciably modified in proximity of the “internal edges” if compared to the “external” ones, leading to a splitting of the edge mode. These results can be relevant for the exploitation of sub-150 nm magnetic dots in new applications, such as magnonic metamaterials, bit-patterned storage media, and nano-magnetic logic devices.

  15. Continuous particle focusing in a waved microchannel using negative dc dielectrophoresis

    KAUST Repository

    Li, Ming; Li, Shunbo; Cao, Wenbin; Li, Weihua; Wen, Weijia; Alici, Gursel

    2012-01-01

    We present a waved microchannel for continuous focusing of microparticles and cells using negative direct current (dc) dielectrophoresis. The waved channel is composed of consecutive s-shaped curved channels in series to generate an electric field

  16. 30 CFR 285.607 - How do I submit my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a). ...

  17. New silicon photodiodes for detection of the 1064nm wavelength radiation

    Science.gov (United States)

    Wegrzecki, Maciej; Piotrowski, Tadeusz; Puzewicz, Zbigniew; Bar, Jan; Czarnota, Ryszard; Dobrowolski, Rafal; Klimov, Andrii; Kulawik, Jan; Kłos, Helena; Marchewka, Michał; Nieprzecki, Marek; Panas, Andrzej; Seredyński, Bartłomiej; Sierakowski, Andrzej; Słysz, Wojciech; Synkiewicz, Beata; Szmigiel, Dariusz; Zaborowski, Michał

    2016-12-01

    In this paper a concept of a new bulk structure of p+-υ-n+ silicon photodiodes optimized for the detection of fast-changing radiation at the 1064 nm wavelength is presented. The design and technology for two types of quadrant photodiodes, the 8-segment photodiode and the 32-element linear photodiode array that were developed according to the concept are described. Electric and photoelectric parameters of the photodiodes mentioned above are presented.

  18. Excitation of intense shock waves by soft X-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Branitskij, A V; Fortov, V E; Danilenko, K N; Dyabilin, K S; Grabovskij, E V; Vorobev, O Yu; Lebedev, M E; Smirnov, V P; Zakharov, A E; Persyantsev, I V [Troitsk Inst. of Innovative and Fusion Research, Troitsk (Russian Federation)

    1997-12-31

    Investigation of the shock waves generated by soft x radiation in Al, Sn, Fe, and Pb targets is reported. The soft x radiation was induced by the dynamic compression and heating of the cylindrical z-pinch plasma generated in the ANGARA-5-1 pulsed power machine. The temperature of the z-pinch plasma was as high as 60 - 120 eV, and the duration of the x-ray pulse reached 30 ns FWHM. Thick stepped Al/Pb, Sn/Pb, and pure Pb targets were used. The results of experiments show that uniform intense shock waves can be generated by z-pinch plasma soft x-ray radiation. The uniformity of the shock is very high. At a flux power of the order of several TW/cm{sup 2}, a shock pressure of some hundreds of GPa was achieved. (J.U.). 3 figs., 11 refs.

  19. Excitation of intense shock waves by soft X-radiation

    International Nuclear Information System (INIS)

    Branitskij, A.V.; Fortov, V.E.; Danilenko, K.N.; Dyabilin, K.S.; Grabovskij, E.V.; Vorobev, O. Yu.; Lebedev, M.E.; Smirnov, V.P.; Zakharov, A.E.; Persyantsev, I.V.

    1996-01-01

    Investigation of the shock waves generated by soft x radiation in Al, Sn, Fe, and Pb targets is reported. The soft x radiation was induced by the dynamic compression and heating of the cylindrical z-pinch plasma generated in the ANGARA-5-1 pulsed power machine. The temperature of the z-pinch plasma was as high as 60 - 120 eV, and the duration of the x-ray pulse reached 30 ns FWHM. Thick stepped Al/Pb, Sn/Pb, and pure Pb targets were used. The results of experiments show that uniform intense shock waves can be generated by z-pinch plasma soft x-ray radiation. The uniformity of the shock is very high. At a flux power of the order of several TW/cm 2 , a shock pressure of some hundreds of GPa was achieved. (J.U.). 3 figs., 11 refs

  20. High power diode-pumped continuous wave and Q-switch operation of Tm,Ho:YVO4 laser

    International Nuclear Information System (INIS)

    Yao, B Q; Li, G; Meng, P B; Zhu, G L; Ju, Y L; Wang, Y Z

    2010-01-01

    High power diode-pumped continuous wave (CW) and Q-switch operation of Tm,Ho:YVO 4 laser is reported. Using two Tm,Ho:YVO 4 rods in a single cavity, up to 20.2 W of CW output lasing at 2054.7 nm was obtained under cryogenic temperature of 77 K with an optical to optical conversion efficiency of 32.9%. For Q-switch operation, up to 19.4 W of output was obtained under 15 kHz pulse repetition frequency (PRF) with a minimum pulse width of 24.2 ns. In addition, different pulse repetition frequencies of Q-switch operation with 10.0 kHz, 12.5 kHz and 15.0 kHz were investigated comparatively

  1. Effect of long- and short-term exposure to laser light at 1070 nm on growth of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Aabo, Thomas; Perch-Nielsen, Ivan R.; Dam, Jeppe Seidelin

    2010-01-01

    The effect of a 1070-nm continuous and pulsed wave ytterbium fiber laser on the growth of Saccharomyces cerevisiae single cells is investigated over a time span of 4 to 5 h. The cells are subjected to optical traps consisting of two counterpropagating plane wave beams with a uniform flux along th...

  2. Monitoring internal organ motion with continuous wave radar in CT

    International Nuclear Information System (INIS)

    Pfanner, Florian; Maier, Joscha; Allmendinger, Thomas; Flohr, Thomas; Kachelrieß, Marc

    2013-01-01

    Purpose: To avoid motion artifacts in medical imaging or to minimize the exposure of healthy tissues in radiation therapy, medical devices are often synchronized with the patient's respiratory motion. Today's respiratory motion monitors require additional effort to prepare the patients, e.g., mounting a motion belt or placing an optical reflector on the patient's breast. Furthermore, they are not able to measure internal organ motion without implanting markers. An interesting alternative to assess the patient's organ motion is continuous wave radar. The aim of this work is to design, implement, and evaluate such a radar system focusing on application in CT.Methods: The authors designed a radar system operating in the 860 MHz band to monitor the patient motion. In the intended application of the radar system, the antennas are located close to the patient's body inside the table of a CT system. One receive and four transmitting antennas are used to avoid the requirement of exact patient positioning. The radar waves propagate into the patient's body and are reflected at tissue boundaries, for example at the borderline between muscle and adipose tissue, or at the boundaries of organs. At present, the authors focus on the detection of respiratory motion. The radar system consists of the hardware mentioned above as well as of dedicated signal processing software to extract the desired information from the radar signal. The system was evaluated using simulations and measurements. To simulate the radar system, a simulation model based on radar and wave field equations was designed and 4D respiratory-gated CT data sets were used as input. The simulated radar signals and the measured data were processed in the same way. The radar system hardware and the signal processing algorithms were tested with data from ten volunteers. As a reference, the respiratory motion signal was recorded using a breast belt simultaneously with the radar measurements.Results: Concerning the

  3. Resonant four-wave mixing processes in xenon

    International Nuclear Information System (INIS)

    Yiu, Y.M.; Bonin, K.D.; McIlrath, T.J.

    1982-01-01

    Two-photon resonantly enhanced four-wave mixing processes in xenon involving the intermediate states were utilized to generate coherent VUV radiation at several discrete wavelengths between 125.9 nm and 101.8 nm. Maximum efficiencies of the order of 10-4 were achieved. The use of these processes for producing tunable VUV output with Xe is given and generation of tunable VUV using two-photon resonances in other rare gases is discussed

  4. All-solid-state cw frequency-doubling Nd:YLiF4/LBO blue laser with 4.33 W output power at 454 nm under in-band diode pumping at 880 nm.

    Science.gov (United States)

    Lü, Yanfei; Zhang, Xihe; Cheng, Weibo; Xia, Jing

    2010-07-20

    We generated efficient blue laser output at 454 nm by intracavity frequency doubling of a continuous-wave (cw) diode-pumped Nd:YLiF(4) (Nd:YLF) laser at 908 nm based on the (4)F(3/2)-(4)I(9/2) transition. With 32.8 W of incident pump power at 880 nm and the frequency-doubling crystal LiB(3)O(5), a level as high as 4.33 W of cw output power at 454 nm is achieved, corresponding to an optical conversion efficiency of 13.2% with respect to the incident pump power. To the best of our knowledge, this is the first blue laser at 454 nm generated by intracavity frequency doubling of a diode-pumped Nd:YLF.

  5. Two-wave generator of subnanosecond radiation pulses on an yttrium-aluminium garnet

    International Nuclear Information System (INIS)

    Babikov, Yu.I.; Ir, K.S.; Mironov, V.E.

    1988-01-01

    Great attention is paid to the electron accelerator based on the mechanism of electron accelerator in the field of plasma wave, excited by laser radiation. The laser system master generator based on serial LTIPC-8 laser is described. The system is intended for investigating the plasma excitation processes initiated by two-frequency laser radiation beats. Pulse duration is ≤1 ns at 3-4 pulse train. Radiation on 1.0615 and 1.0641 μm wave length is generated. 5 refs.; 3 figs

  6. Millimeter-wave radiation from a Teflon dielectric probe and its imaging application

    International Nuclear Information System (INIS)

    Kume, Eiji; Sakai, Shigeki

    2008-01-01

    The beam profile of a millimeter wave radiated from the tip of a Teflon dielectric probe was characterized experimentally by using a three-dimensional scanning dielectric probe and numerically by using the finite difference time domain (FDTD) method. The measured intensity distribution and polarization of the millimeter wave radiated from the tip of the probe was in good agreement with those of the FDTD simulation. A reflection type of a millimeter- wave imaging system using this dielectric probe was constructed. The resolution of the imaging system was as small as 1 mm, which was slightly smaller than a half wavelength, 1.6 mm, of the radiation wave. Translucent measurement of a commercially manufactured IC card which consists of an IC chip and a leaf-shaped antenna coil was demonstrated. Not only the internal two-dimensional structures but also the vertical information of the card could be provided

  7. Plasma mechanizm for auroral kilometer wave radiation

    International Nuclear Information System (INIS)

    Vlasov, V.G.

    1989-01-01

    The linear mechanism of auroral kilometer radiation (AKR) on the Cherenkov resonance is developed. The point is that plasma waves swinged by the electron beam in a dimer auroral plasma cavern on the Cherenkov resonance excercise 100% transformation under conventional and inconventional AKR modes under definite conditions

  8. Preliminary tests on a new near-infrared continuous-wave tissue oximeter

    Science.gov (United States)

    Casavola, Claudia; Cicco, Giuseppe; Pirrelli, Anna; Lugara, Pietro M.

    2000-11-01

    We present a preliminary study, in vitro and in vivo, with a novel device for near-infrared tissue oximetry. The light sources used are two quasi-continuous-wave LEDs, emitting at 656 and 851 nm, and the detector is a photodiode. The data are acquired in back-scattering configuration, thus allowing the non-invasive characterization of thick tissues. Stability tests were performed by placing the optical probe on a tissue- like phantom and acquiring data for periods of time ranging from 5 to 40 minutes. No significant drifts in the DC signal were observed after a warm-up period of no more than 10 minutes. We performed reproducibility tests by repositioning the optical probe on the phantom for a number of times. We found a reproducibility better than 5% in the DC signal. We also present the results of a preliminary study conducted in vivo, on the calf muscle of human subjects. We report a comparison of the results obtained with the near-infrared oximeter with the values of blood oxygenation ctO2 measured with conventional chemical tests.

  9. The continuous-wave passive mode-locking operation of a diode-pumped mixed Nd:Lu0.5Y0.5VO4 laser

    International Nuclear Information System (INIS)

    Huang, H-T; Xu, J-L; He, J-L; Zhang, S-Y; Xu, J-Q; Zhao, B

    2011-01-01

    We reported a continuous-wave (CW) passively mode-locked Nd:Lu 0.5 Y 0.5 VO 4 laser at 1064 nm. A partially reflective semiconductor saturable absorber mirror was exploited in the Z-typed resonator. The Nd:Lu 0.5 Y 0.5 VO 4 laser generated CW mode-locked pulses with an average output power of 860 mW, a repetition rate of 53.7 MHz, and a pulse duration of 8.7 ps

  10. On the role of lateral waves in the radiation from the dielectric wedge

    DEFF Research Database (Denmark)

    Balling, Peter

    1973-01-01

    The field on the dielectric wedge is approximated by a plane-wave expansion as in [1]. Contributions from this solution to both the surface field and the radiation field are examined. Finally, an experimental radiation field is compared with the plane-wave solution and with a geometric-optical...

  11. Diode-side-pumped 131 W, 1319 nm single-wavelength cw Nd:YAG laser.

    Science.gov (United States)

    Haiyong, Zhu; Ge, Zhang; Chenghui, Huang; Yong, Wei; Lingxiong, Huang; Jing, Chen; Weidong, Chen; Zhenqiang, Chen

    2007-01-20

    A diode-side-pumped high-power 1319 nm single-wavelength Nd:YAG continuous wave (cw) laser is described. Through reasonable coating design of the cavity mirrors, the 1064 nm strongest line as well as the 1338 nm one have been successfully suppressed. The laser output powers corresponding to four groups of different output couplers operating at 1319 nm single wavelength have been compared. The output coupler with the transmission T=5.3% has the highest output power, and a 131 W cw output power was achieved at the pumping power of 555 W. The optical-optical conversion efficiency is 23.6%, and the slope efficiency is 46%. The output power is higher than the total output power of the dual-wavelength laser operating at 1319 nm and 1338 nm in the experiment.

  12. Synchrotron-radiation plane-wave topography

    International Nuclear Information System (INIS)

    Riglet, P.; Sauvage, M.; Petroff, J.F.; Epelboin, Y.

    1980-01-01

    A computer program based on the Takagi-Taupin differential equations for X-ray propagation in distorted crystals has been developed in order to simulate dislocation images in the Bragg case. The program is valid both for thin and thick crystals. Simulated images of misfit dislocations formed either in a thin epilayer or in a thick substrate are compared with experimental images obtained by synchrotron-radiation plane-wave topography. The influence of the various strain components on the image features is discussed. (author)

  13. Continuous particle focusing in a waved microchannel using negative dc dielectrophoresis

    KAUST Repository

    Li, Ming

    2012-07-26

    We present a waved microchannel for continuous focusing of microparticles and cells using negative direct current (dc) dielectrophoresis. The waved channel is composed of consecutive s-shaped curved channels in series to generate an electric field gradient required for the dielectrophoretic effect. When particles move electrokinetically through the channel, the experienced negative dielectrophoretic forces alternate directions within two adjacent semicircular microchannels, leading to a focused continuous-flow stream along the channel centerline. Both the experimentally observed and numerically simulated results of the focusing performance are reported, which coincide acceptably in proportion to the specified dimensions (i.e. inlet and outlet of the waved channel). How the applied electric field, particle size and medium concentration affect the performance was studied by focusing polystyrene microparticles of varying sizes. As an application in the field of biology, the focusing of yeast cells in the waved mcirochannel was tested. This waved microchannel shows a great potential for microflow cytometry applications and is expected to be widely used before different processing steps in lab-on-A-chip devices with integrated functions. © 2012 IOP Publishing Ltd.

  14. Preparation and Characterization of Bragg Fibers for Delivery of Laser Radiation at 1064 nm

    Directory of Open Access Journals (Sweden)

    V. Matejec

    2013-04-01

    Full Text Available Bragg fibers offer new performance for transmission of high laser energies over long distances. In this paper theoretical modeling, preparation and characterization of Bragg fibers for delivery laser radiation at 1064 nm are presented. Investigated Bragg fibers consist of the fiber core with a refractive index equal to that of silica which is surrounded by three pairs of circular layers. Each pair is composed of one layer with a high and one layer with a low refractive index and characterized by a refractive-index difference around 0.03. Propagation constants and radiation losses of the fundamental mode in such a structure were calculated on the basis of waveguide optics. Preforms of the Bragg fibers were prepared by the MCVD method using germanium dioxide, phosphorous pentoxide and fluorine as silica dopants. The fibers with a diameter of 170 m were drawn from the preforms. Refractive-index profiles, angular distributions of the output power and optical losses of the prepared fibers were measured. Results of testing the fibers for delivery radiation of a pulse Nd:YAG laser at 1064 nm are also shown.

  15. New apparatus with high radiation energy between 320 to 460 nm: physical description and dermatological applications

    International Nuclear Information System (INIS)

    Mutzhas, M.F.; Holzle, E.; Hofmann, C.; Plewig, G.

    1981-01-01

    A new apparatus (UVASUN 5000) is presented with high radiation energy between 320 to 460 nm. The radiator is a specially developed source for high uv-A intensity, housing a quartz bulb with a mixture of argon, mercury and metal-halides. The uv-A energy in the range of 320 to 400 nm is about 84% of the total radiation energy. Effects of very high doses of uv-A on human skin were studied. Following single uv-A applications the minimal tanning dose uv-A (MTD) and the immediate pigment darkening (IPD) dose of uv-A were established. Repeated exposure to this uv-A delivering system yields long lasting dark brown skin pigmentation without any clinical or histological signs of sunburn (uv-B) damage, epidermal hyperplasia or thickening of the stratum corneum. Minimal therapeutic results were seen in the phototherapy of vitiligo and inflammatory acne

  16. Generation of continuously tunable, 5-12 {mu}m radiation by difference frequency mixing of output waves of a KTP optical parametric oscillator in a ZnGeP{sub 2} crystal

    Energy Technology Data Exchange (ETDEWEB)

    Haidar, S [Research Institute of Electrical Communication (RIEC), Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai-shi 980-8577 (Japan); Miyamoto, K [Research Institute of Electrical Communication (RIEC), Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai-shi 980-8577 (Japan); Ito, H [Research Institute of Electrical Communication (RIEC), Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai-shi 980-8577 (Japan)

    2004-12-07

    Signal and idlers waves obtained from a Nd : YAG laser pumped KTP optical parametric oscillator (OPO) are difference frequency mixed in a ZnGeP{sub 2} (ZGP) crystal to generate radiation in the mid-infrared. The KTP OPO is operated in the type-II phase matching mode, and the extraordinary and ordinary waves are tunable from 1.76 {mu}m to 2.36 {mu}m and from 2.61 {mu}m to 1.90 {mu}m, respectively. The orthogonally polarized waves are difference frequency mixed in a ZGP crystal to generate mid-IR radiation tunable from 5 to 12 {mu}m.

  17. Efficient four-wave mixing by usage of resonances in mercury; Effizientes Vierwellenmischen durch Ausnutzen von Resonanzen in Quecksilber

    Energy Technology Data Exchange (ETDEWEB)

    Kolbe, Daniel

    2011-05-05

    A continuous, coherent radiation source in the vacuum ultraviolet spectral region is presented. It is based on four-wave-mixing in mercury vapor with fundamental beams at 253.7 nm, 407.9 nm und 545.5 nm wavelength. The fundamental beams are produced by frequency doubling and quadrupling of beams from solid-state laser-systems respectively. Due to the 6{sup 1}S-7{sup 1}S two-photon resonance and additionally the 6{sup 1}S-6{sup 3}P one-photon resonance the efficiency can be increased compared to former sources. A near one-photon resonance reduces the optimal phasematching temperature of the four-wave-mixing process. This leads to smaller Doppler and pressure broadening resulting in a higher four-wave-mixing efficiency. A maximum power of 0.3 nW at 121.56 nm wavelength, the 1S-2P Lyman-{alpha} transition in hydrogen, can be obtained. This Lyman-{alpha} source is needed for future laser cooling of antihydrogen. Apart from the Lyman-{alpha} generation, four-wave-mixing with a slightly different third fundamental wavelength results in radiation near a one-photon resonance in the VUV at the 6{sup 1}S-12{sup 1}P transition in mercury. Due to this additional one-photon resonance the nonlinear susceptibility, responsible for the four-wave-mixing, can be strongly increased without an influence on the phasematching. With such a mixing process the efficiency can be enlarged by three orders of magnitude and powers up to 6 {mu}W in the VUV could be realised. This is an improvement of a factor of 30 to former laser sources in this VUV regime. Furthermore the two-photon resonance of mercury could be investigated in detail. We observed a velocity-selective double resonance at small Rabi frequencies of the fundamental beams, which has the same origin as dark resonances in {lambda}-systems. At high Rabi frequencies excitation to the two-photon level can be high enough to initiate a laser process on the 7{sup 1}S-6{sup 1}P transition. This process could be observed with continuouswave

  18. Continuous wave and tunable laser operation of Yb3+ in disordered NaLa(MoO4)2

    Science.gov (United States)

    Rico, M.; Liu, J.; Cano-Torres, J. M.; García-Cortés, A.; Cascales, C.; Zaldo, C.; Griebner, U.; Petrov, V.

    2005-09-01

    Continuous-wave Yb3+ laser operation is studied in single crystals of disordered NaLa(MoO4)2 at room temperature. The sample used was grown by the Czochralski technique and incorporates an Yb ion density of 3.1×1020 cm-3. The effect of the Yb concentration on some of the crystal properties is described as well as the spectroscopic Yb3+ properties at 5 K. Maximum slope efficiencies of about 40% for π and 38% for σ polarization were obtained under Ti:sapphire laser pumping near 976 nm, respectively. The maximum output power for the π polarization was 400 mW at 1039.5 nm, the threshold in this case amounted to 240 mW (absorbed pump power). The laser emission was tunable between 1016 and 1064 nm with a Lyot filter. Lasing was also realized by pumping with a fiber-coupled diode laser module. Maximum output power of 900 mW at 1035 nm was achieved in this case for the π polarization and the threshold was 280 mW. The results, in terms of output power and tunability, are superior in comparison to all previous reports on Yb-doped disordered double tungstate or molybdate crystals and represent a significant improvement in comparison to earlier experiments with low-doped Yb:NaLa(MoO4)2.

  19. Experimental and numerical investigation of shock wave propagation through complex geometry, gas continuous, two-phase media

    International Nuclear Information System (INIS)

    Liu, J. Chien-Chih

    1993-01-01

    The work presented here investigates the phenomenon of shock wave propagation in gas continuous, two-phase media. The motivation for this work stems from the need to understand blast venting consequences in the HYLIFE inertial confinement fusion (ICF) reactor. The HYLIFE concept utilizes lasers or heavy ion beams to rapidly heat and compress D-T targets injected into the center of a reactor chamber. A segmented blanket of failing molten lithium or Li 2 BeF 4 (Flibe) jets encircles the reactors central cavity, shielding the reactor structure from radiation damage, absorbing the fusion energy, and breeding more tritium fuel

  20. Time series analysis of continuous-wave coherent Doppler Lidar wind measurements

    DEFF Research Database (Denmark)

    Sjöholm, Mikael; Mikkelsen, Torben; Mann, Jakob

    2008-01-01

    The influence of spatial volume averaging of a focused 1.55 mu m continuous-wave coherent Doppler Lidar on observed wind turbulence measured in the atmospheric surface layer over homogeneous terrain is described and analysed. Comparison of Lidar-measured turbulent spectra with spectra simultaneou......The influence of spatial volume averaging of a focused 1.55 mu m continuous-wave coherent Doppler Lidar on observed wind turbulence measured in the atmospheric surface layer over homogeneous terrain is described and analysed. Comparison of Lidar-measured turbulent spectra with spectra...

  1. Comparison of the neuroinflammatory responses to selective retina therapy and continuous-wave laser photocoagulation in mouse eyes.

    Science.gov (United States)

    Han, Jung Woo; Choi, Juhye; Kim, Young Shin; Kim, Jina; Brinkmann, Ralf; Lyu, Jungmook; Park, Tae Kwann

    2018-02-01

    This study investigated microglia and inflammatory cell responses after selective retina therapy (SRT) with microsecond-pulsed laser in comparison to continuous-wave laser photocoagulation (cwPC). Healthy C57BL/6 J mice were treated with either a train of short pulses (SRT; 527-nm, Q-switched, 1.7-μs pulse) or a conventional thermal continuous-wave (532-nm, 100-ms pulse duration) laser. The mice were sacrificed and their eyes were enucleated 1, 3, 7, and 14 days after both laser treatments. Pattern of cell death on retinal section was evaluated by TUNEL assay, and the distribution of activated inflammatory cells and glial cells were observed under immunohistochemistry. Consecutive changes for the expression of cytokines such as IL-1β, TNF-α, and TGF-β were also examined using immunohistochemistry, and compared among each period after quantification by Western blotting. The numbers of TUNEL-positive cells in the retinal pigment epithelium (RPE) layer did not differ in SRT and cwPC lesions, but TUNEL-positive cells in neural retinas were significantly less on SRT. Vague glial cell activation was observed in SRT-treated lesions. The population of inflammatory cells was also significantly decreased after SRT, and the cells were located in the RPE layer and subretinal space. Proinflammatory cytokines, including IL-1β and TNF-α, showed significantly lower levels after SRT; conversely, the level of TGF-β was similar to the cwPC-treated lesion. SRT resulted in selective RPE damage without collateral thermal injury to the neural retina, and apparently produced negligible glial activation. In addition, SRT showed a markedly less inflammatory response than cwPC, which may have important therapeutic implications for several macular diseases.

  2. Wave function continuity and the diagonal Born-Oppenheimer correction at conical intersections.

    Science.gov (United States)

    Meek, Garrett A; Levine, Benjamin G

    2016-05-14

    We demonstrate that though exact in principle, the expansion of the total molecular wave function as a sum over adiabatic Born-Oppenheimer (BO) vibronic states makes inclusion of the second-derivative nonadiabatic energy term near conical intersections practically problematic. In order to construct a well-behaved molecular wave function that has density at a conical intersection, the individual BO vibronic states in the summation must be discontinuous. When the second-derivative nonadiabatic terms are added to the Hamiltonian, singularities in the diagonal BO corrections (DBOCs) of the individual BO states arise from these discontinuities. In contrast to the well-known singularities in the first-derivative couplings at conical intersections, these singularities are non-integrable, resulting in undefined DBOC matrix elements. Though these singularities suggest that the exact molecular wave function may not have density at the conical intersection point, there is no physical basis for this constraint. Instead, the singularities are artifacts of the chosen basis of discontinuous functions. We also demonstrate that continuity of the total molecular wave function does not require continuity of the individual adiabatic nuclear wave functions. We classify nonadiabatic molecular dynamics methods according to the constraints placed on wave function continuity and analyze their formal properties. Based on our analysis, it is recommended that the DBOC be neglected when employing mixed quantum-classical methods and certain approximate quantum dynamical methods in the adiabatic representation.

  3. Experimental determination of radiated internal wave power without pressure field data

    OpenAIRE

    Lee, Frank M.; Paoletti, M. S.; Swinney, Harry L.; Morrison, P. J.

    2014-01-01

    We present a method to determine, using only velocity field data, the time-averaged energy flux $\\left$ and total radiated power $P$ for two-dimensional internal gravity waves. Both $\\left$ and $P$ are determined from expressions involving only a scalar function, the stream function $\\psi$. We test the method using data from a direct numerical simulation for tidal flow of a stratified fluid past a knife edge. The results for the radiated internal wave power given by the stream function method...

  4. Single, composite, and ceramic Nd:YAG 946-nm lasers

    Science.gov (United States)

    Lan, Rui-Jun; Yang, Guang; Zheng-Ping, Wang

    2015-06-01

    Single, composite crystal and ceramic continuous wave (CW) 946-nm Nd:YAG lasers are demonstrated, respectively. The ceramic laser behaves better than the crystal laser. With 5-mm long ceramic, a CW output power of 1.46 W is generated with an optical conversion efficiency of 13.9%, while the slope efficiency is 17.9%. The optimal ceramic length for a 946-nm laser is also calculated. Project supported by the National Natural Science Foundation of China (Grant No. 61405171), the Natural Science Foundation of Shandong Province, China (Grant No. ZR2012FQ014), and the Science and Technology Program of the Shandong Higher Education Institutions of China (Grant No. J13LJ05).

  5. Mutation induction by 365-nm radiation and far-ultraviolet light in Escherichia coli differing in near- and far-ultraviolet light sensitivity

    International Nuclear Information System (INIS)

    Leonardo, J.M.; Reynolds, P.R.; Tuveson, R.W.

    1984-01-01

    The his-4 locus derived from Escherichia coli strain AB1157 has been transduced into 4 E. coli strains that exhibit all 4 possible combinations of genes controlling sensitivity to near-ultraviolet light (nur versus nur + ) and far-ultraviolet light (uvrA6 versus uvrA + ). The 4 strains exhibited the predicted sensitivity to 254-nm radiation based on the sensitivity of the parent strains from which they were derived and the frequency of his + mutations predicted from experiments with AB1157 from which the his-4 locus was derived. When the 4 strains were treated with 365-nm radiation, they exhibited the predicted sensitivity based on the near-ultraviolet light sensitivity of the strains from which they were derived while his + mutations were undetectable with the 4 strains as well as with strain AB1157. When treated with 365-nm radiation, cells of a WP2sub(s) strain (a derivative of B/r transduced to his-4) plated on semi-enriched medium prepared with casamino acids did not yield induced mutations, whereas plating on semi-enriched medium prepared with nutrient broth did yield mutants at both the his-4 and trp loci at frequencies at least an order of magnitude lower than that observed with far-ultraviolet light. The induction of nutritionally independent mutants by 365-nm radiation is strongly dependent on the supplement used for semi-enrichment. When compared at equivalent survival levels, mutant frequencies are significantly less following 365-nm radiation when compared with far-ultraviolet radiation. (Auth.)

  6. 30 CFR 285.1000 - What activities does this subpart regulate?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities does this subpart regulate? 285.1000 Section 285.1000 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Activities § 285.1000 What activities does this subpart regulate? (a) This subpart provides the general...

  7. Characterization of 850nm-15μm GaAs/AlGaAs quantum-well ...

    African Journals Online (AJOL)

    In this report, operating characteristics and performance of 15μm diameter vertical cavity surface emitting lasers (VCSELs) emitting at 850nm and fabricated by gas source molecular beam-epitaxy (GSMBE) is presented. The device characterisation is performed by observing the continuous wave (cw) operation under room ...

  8. 16.7 W 885 nm diode-side-pumped actively Q -switched Nd:YAG/YVO4 intracavity Raman laser at 1176 nm

    International Nuclear Information System (INIS)

    Jiang, Pengbo; Zhang, Guizhong; Liu, Jian; Ding, Xin; Sheng, Quan; Sun, Bing; Shi, Rui; Wu, Liang; Yao, Jianquan; Yu, Xuanyi; Wang, Rui

    2017-01-01

    We proposed and experimentally demonstrated the generation of high-power 1176 nm Stokes wave by frequency shifting of a 885 nm diode-side-pumped Nd:YAG laser using a YVO 4 crystal in a Z -shaped cavity configuration. Employing the 885 nm diode-side-pumped scheme and the Z -shaped cavity, for the first time to our knowledge, we realized the thermal management effectively, achieving excellent 1176 nm Stokes wave consequently. With an incident pump power of ∼190.0 W, a maximum average output power of 16.7 W was obtained at the pulse repetition frequency of 10 kHz. The pulse duration and spectrum linewidth of the Stokes wave at the maximum output power were 20.3 ns and ∼0.08 nm, respectively. (paper)

  9. Time-Frequency-Wavenumber Analysis of Surface Waves Using the Continuous Wavelet Transform

    Science.gov (United States)

    Poggi, V.; Fäh, D.; Giardini, D.

    2013-03-01

    A modified approach to surface wave dispersion analysis using active sources is proposed. The method is based on continuous recordings, and uses the continuous wavelet transform to analyze the phase velocity dispersion of surface waves. This gives the possibility to accurately localize the phase information in time, and to isolate the most significant contribution of the surface waves. To extract the dispersion information, then, a hybrid technique is applied to the narrowband filtered seismic recordings. The technique combines the flexibility of the slant stack method in identifying waves that propagate in space and time, with the resolution of f- k approaches. This is particularly beneficial for higher mode identification in cases of high noise levels. To process the continuous wavelet transform, a new mother wavelet is presented and compared to the classical and widely used Morlet type. The proposed wavelet is obtained from a raised-cosine envelope function (Hanning type). The proposed approach is particularly suitable when using continuous recordings (e.g., from seismological-like equipment) since it does not require any hardware-based source triggering. This can be subsequently done with the proposed method. Estimation of the surface wave phase delay is performed in the frequency domain by means of a covariance matrix averaging procedure over successive wave field excitations. Thus, no record stacking is necessary in the time domain and a large number of consecutive shots can be used. This leads to a certain simplification of the field procedures. To demonstrate the effectiveness of the method, we tested it on synthetics as well on real field data. For the real case we also combine dispersion curves from ambient vibrations and active measurements.

  10. Wave-Particle Interactions in the Radiation Belts, Aurora,and Solar Wind: Opportunities for Lab Experiments

    Science.gov (United States)

    Kletzing, C.

    2017-12-01

    The physics of the creation, loss, and transport of radiation belt particles is intimately connected to the electric and magnetic fields which mediate these processes. A large range of field and particle interactions are involved in this physics from large-scale ring current ion and magnetic field dynamics to microscopic kinetic interactions of whistler-mode chorus waves with energetic electrons. To measure these kinds of radiation belt interactions, NASA implemented the two-satellite Van Allen Probes mission. As part of the mission, the Electric and Magnetic Field Instrument Suite and Integrated Science (EMFISIS) investigation is an integrated set of instruments consisting of a triaxial fluxgate magnetometer (MAG) and a Waves instrument which includes a triaxial search coil magnetometer (MSC). We show a variety of waves thought to be important for wave particle interactionsin the radiation belts: low frequency ULF pulsations, EMIC waves, and whistler mode waves including upper and lower band chorus. Outside ofthe radiation belts, Alfven waves play a key role in both solar wind turbulenceand auroral particle acceleration. Several of these wave modes could benefit (or have benefitted) from laboratory studies to further refineour understanding of the detailed physics of the wave-particle interactionswhich lead to energization, pitch angle scattering, and cross-field transportWe illustrate some of the processes and compare the wave data with particle measurements to show relationships between wave activity and particle processobserved in the inner magnetosphere and heliosphere.

  11. Ultra-broadband mid-wave-IR upconversion detection

    DEFF Research Database (Denmark)

    Barh, Ajanta; Pedersen, Christian; Tidemand-Lichtenberg, Peter

    2017-01-01

    In this Letter, we demonstrate efficient room temperature detection of ultra-broadband mid-wave-infrared (MWIR) light with an almost flat response over more than 1200 nm, exploiting an efficient nonlinear upconversion technique. Black-body radiation from a hot soldering iron rod is used as the IR...... test source. Placing a 20 mm long periodically poled lithium niobate crystal in a compact intra-cavity setup (> 20 WCW pump at 1064 nm), MWIR wavelengths ranging from 3.6 to 4.85 mu m are upconverted to near-infrared (NIR) wavelengths (820-870 nm). The NIR light is detected using a standard low...

  12. Solar Electromagnetic Radiation Study for Solar Cycle 22: Solar Ultraviolet Irradiance, 120 to 300 NM: Report of Working Groups 2 and 3 of SOLERS 22

    Science.gov (United States)

    Rottman, G. J.; Cebula, R. P.; Gillotay, D.; Simon, P. A.

    1996-01-01

    This report summarizes the activities of Working Group 2 and Working Group 3 of the SOLax Electromagnetic Radiation Study for Solar Cycle 22 (SOLERS22) Program. The international (SOLERS22) is Project 1.2 of the Solar-Terrestrial Energy Program (STEP) sponsored by SCOSTEP, a committee of the International Council of Scientific Unions). SOLERS22 is comprised of five Working Groups, each concentrating on a specific wave-length range: WG-1 - visible and infrared, WG-2 - mid-ultraviolet (200 < A < 300 nm), WG-3 - Far-ultraviolet (lambda greater than 100 and lambda less than 200 nanometers), WG-4 - extreme-ultraviolet (lambda greater than 10 and lambda less than 100 nm), and WG-5 - X-ray (lambda greater than 1 and lambda less than 10 nano meters). The overarching goals of SOLERS22 are to: 1) establish daily solar irradiance values in the specified wavelength ranges, 2) consider the evolving solar structures as the cause of temporal variations, and 3) understand the underlying physical processes driving these changes.

  13. Optimally setting up directed searches for continuous gravitational waves in Advanced LIGO O1 data

    Science.gov (United States)

    Ming, Jing; Papa, Maria Alessandra; Krishnan, Badri; Prix, Reinhard; Beer, Christian; Zhu, Sylvia J.; Eggenstein, Heinz-Bernd; Bock, Oliver; Machenschalk, Bernd

    2018-02-01

    In this paper we design a search for continuous gravitational waves from three supernova remnants: Vela Jr., Cassiopeia A (Cas A) and G347.3. These systems might harbor rapidly rotating neutron stars emitting quasiperiodic gravitational radiation detectable by the advanced LIGO detectors. Our search is designed to use the volunteer computing project Einstein@Home for a few months and assumes the sensitivity and duty cycles of the advanced LIGO detectors during their first science run. For all three supernova remnants, the sky positions of their central compact objects are well known but the frequency and spin-down rates of the neutron stars are unknown which makes the searches computationally limited. In a previous paper we have proposed a general framework for deciding on what target we should spend computational resources and in what proportion, what frequency and spin-down ranges we should search for every target, and with what search setup. Here we further expand this framework and apply it to design a search directed at detecting continuous gravitational wave signals from the most promising three supernova remnants identified as such in the previous work. Our optimization procedure yields broad frequency and spin-down searches for all three objects, at an unprecedented level of sensitivity: The smallest detectable gravitational wave strain h0 for Cas A is expected to be 2 times smaller than the most sensitive upper limits published to date, and our proposed search, which was set up and ran on the volunteer computing project Einstein@Home, covers a much larger frequency range.

  14. Investigation of radiant millimeter wave/terahertz radiation from low-infrared signature targets

    Science.gov (United States)

    Aytaç, B.; Alkuş, Ü.; Sivaslıgil, M.; Şahin, A. B.; Altan, H.

    2017-10-01

    Millimeter (mm) and sub-mm wave radiation is increasingly becoming a region of interest as better methods are developed to detect in this wavelength range. The development of sensitive focal plane array (FPA) architectures as well as single pixel scanners has opened up a new field of passive detection and imaging. Spectral signatures of objects, a long standing area of interest in the Short Wave Infrared (SWIR), Mid-Wave (MWIR) and Long Wave-IR (LWIR) bands can now be assessed in the mm-wave/terahertz (THz) region. The advantage is that this form of radiation is not as adversely affected by poor atmospheric conditions compared to other bands. In this study, a preliminary experiment in a laboratory environment is performed to assess the radiance from targets with low infrared signatures in the millimeter wave/terahertz (THz) band (<1 THz). The goal of this approach is to be able to model the experimental results to better understand the mm-wave/THz signature of targets with low observability in the IR bands.

  15. 30 CFR 285.534 - When may MMS cancel my bond?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When may MMS cancel my bond? 285.534 Section 285.534 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE... Assurance Requirements Changes in Financial Assurance § 285.534 When may MMS cancel my bond? When your lease...

  16. New apparatus with high radiation energy between 320-460 nm: physical description and dermatological applications

    International Nuclear Information System (INIS)

    Mutzhas, M.F.; Holzle, E.; Hofmann, C.; Plewig, G.

    1981-01-01

    A new apparatus (UVASUN 5000) is presented with high-radiation energy between 320 to 460 nm. The measureable energy below 320 nm was shown to be many orders of magnitude too low to produce erythema. The radiator is a specially developed source for high uv-A intensity, housing a quartz bulb with a mixture of argon, mercury and metal-halides. At a skin-target distance of 0.2 m the size of the irradiated area is 0.35 x 0.35 m, and the measured mean uv-A intensity is about 1400 W. m-2 (140 mW . cm-2). The uv-A energy in the range of 320 to 400 nm is about 84% of the total radiation energy. Effects of very high doses of uv-A on human skin were studied. Following single uv-a applications the minimal tanning dose uv-A (MTD) and the immediate pigment darkening (IPD) dose of uv-A were established. The calculated IPD threshold time was 1.8 min at 0.2 m. Repeated exposure to this uv-A delivering system yields long lasting dark brown skin pigmentation without any clinical or histological signs of sunburn (uv-B) damage, epidermal hyperplasia or thickening of the stratum corneum. The instrument was also successfully used for photo-patch testing and reproduction of skin lesions of polymorphous light eruption. Minimal therapeutic results were seen in the phototherapy of vitiligo and inflammatory acne

  17. Continuous-wave yellow-green laser at 0.56  μm based on frequency doubling of a diode-end-pumped ceramic Nd:YAG laser.

    Science.gov (United States)

    Yao, Wenming; Gao, Jing; Zhang, Long; Li, Jiang; Tian, Yubing; Ma, Yufei; Wu, Xiaodong; Ma, Gangfei; Yang, Jianming; Pan, Yubai; Dai, Xianjin

    2015-06-20

    We present what is, to the best of our knowledge, the first report on yellow-green laser generation based on the frequency doubling of the 1.1 μm transitions in Nd:YAG ceramics. By employing an 885 nm diode laser as the end-pumping source and a lithium triborate crystal as the frequency doubler, the highest continuous wave output powers of 1.4, 0.5, and 1.1 W at 556, 558, and 561 nm are achieved, respectively. These result in optical-to-optical efficiencies of 6.9%, 2.5%, and 5.4% with respect to the absorbed pump power, respectively.

  18. Optical coherence tomography-guided laser microsurgery for blood coagulation with continuous-wave laser diode.

    Science.gov (United States)

    Chang, Feng-Yu; Tsai, Meng-Tsan; Wang, Zu-Yi; Chi, Chun-Kai; Lee, Cheng-Kuang; Yang, Chih-Hsun; Chan, Ming-Che; Lee, Ya-Ju

    2015-11-16

    Blood coagulation is the clotting and subsequent dissolution of the clot following repair to the damaged tissue. However, inducing blood coagulation is difficult for some patients with homeostasis dysfunction or during surgery. In this study, we proposed a method to develop an integrated system that combines optical coherence tomography (OCT) and laser microsurgery for blood coagulation. Also, an algorithm for positioning of the treatment location from OCT images was developed. With OCT scanning, 2D/3D OCT images and angiography of tissue can be obtained simultaneously, enabling to noninvasively reconstruct the morphological and microvascular structures for real-time monitoring of changes in biological tissues during laser microsurgery. Instead of high-cost pulsed lasers, continuous-wave laser diodes (CW-LDs) with the central wavelengths of 450 nm and 532 nm are used for blood coagulation, corresponding to higher absorption coefficients of oxyhemoglobin and deoxyhemoglobin. Experimental results showed that the location of laser exposure can be accurately controlled with the proposed approach of imaging-based feedback positioning. Moreover, blood coagulation can be efficiently induced by CW-LDs and the coagulation process can be monitored in real-time with OCT. This technology enables to potentially provide accurate positioning for laser microsurgery and control the laser exposure to avoid extra damage by real-time OCT imaging.

  19. Bi-directional ultrasonic wave coupling to FBGs in continuously bonded optical fiber sensing.

    Science.gov (United States)

    Wee, Junghyun; Hackney, Drew; Bradford, Philip; Peters, Kara

    2017-09-01

    Fiber Bragg grating (FBG) sensors are typically spot-bonded onto the surface of a structure to detect ultrasonic waves in laboratory demonstrations. However, to protect the rest of the optical fiber from any environmental damage during real applications, bonding the entire length of fiber, called continuous bonding, is commonly done. In this paper, we investigate the impact of continuously bonding FBGs on the measured Lamb wave signal. In theory, the ultrasonic wave signal can bi-directionally transfer between the optical fiber and the plate at any adhered location, which could potentially produce output signal distortion for the continuous bonding case. Therefore, an experiment is performed to investigate the plate-to-fiber and fiber-to-plate signal transfer, from which the signal coupling coefficient of each case is theoretically estimated based on the experimental data. We demonstrate that the two coupling coefficients are comparable, with the plate-to-fiber case approximately 19% larger than the fiber-to-plate case. Finally, the signal waveform and arrival time of the output FBG responses are compared between the continuous and spot bonding cases. The results indicate that the resulting Lamb wave signal output is only that directly detected at the FBG location; however, a slight difference in signal waveform is observed between the two bonding configurations. This paper demonstrates the practicality of using continuously bonded FBGs for ultrasonic wave detection in structural health monitoring (SHM) applications.

  20. Continuous wave room temperature external ring cavity quantum cascade laser

    Energy Technology Data Exchange (ETDEWEB)

    Revin, D. G., E-mail: d.revin@sheffield.ac.uk; Hemingway, M.; Vaitiekus, D.; Cockburn, J. W. [Physics and Astronomy Department, The University of Sheffield, S3 7RH Sheffield (United Kingdom); Hempler, N.; Maker, G. T.; Malcolm, G. P. A. [M Squared Lasers Ltd., G20 0SP Glasgow (United Kingdom)

    2015-06-29

    An external ring cavity quantum cascade laser operating at ∼5.2 μm wavelength in a continuous-wave regime at the temperature of 15 °C is demonstrated. Out-coupled continuous-wave optical powers of up to 23 mW are observed for light of one propagation direction with an estimated total intra-cavity optical power flux in excess of 340 mW. The uni-directional regime characterized by the intensity ratio of more than 60 for the light propagating in the opposite directions was achieved. A single emission peak wavelength tuning range of 90 cm{sup −1} is realized by the incorporation of a diffraction grating into the cavity.

  1. Continuous wave room temperature external ring cavity quantum cascade laser

    International Nuclear Information System (INIS)

    Revin, D. G.; Hemingway, M.; Vaitiekus, D.; Cockburn, J. W.; Hempler, N.; Maker, G. T.; Malcolm, G. P. A.

    2015-01-01

    An external ring cavity quantum cascade laser operating at ∼5.2 μm wavelength in a continuous-wave regime at the temperature of 15 °C is demonstrated. Out-coupled continuous-wave optical powers of up to 23 mW are observed for light of one propagation direction with an estimated total intra-cavity optical power flux in excess of 340 mW. The uni-directional regime characterized by the intensity ratio of more than 60 for the light propagating in the opposite directions was achieved. A single emission peak wavelength tuning range of 90 cm −1 is realized by the incorporation of a diffraction grating into the cavity

  2. Continuous-wave lasing in an organic-inorganic lead halide perovskite semiconductor

    Science.gov (United States)

    Jia, Yufei; Kerner, Ross A.; Grede, Alex J.; Rand, Barry P.; Giebink, Noel C.

    2017-12-01

    Hybrid organic-inorganic perovskites have emerged as promising gain media for tunable, solution-processed semiconductor lasers. However, continuous-wave operation has not been achieved so far1-3. Here, we demonstrate that optically pumped continuous-wave lasing can be sustained above threshold excitation intensities of 17 kW cm-2 for over an hour in methylammonium lead iodide (MAPbI3) distributed feedback lasers that are maintained below the MAPbI3 tetragonal-to-orthorhombic phase transition temperature of T ≈ 160 K. In contrast with the lasing death phenomenon that occurs for pure tetragonal-phase MAPbI3 at T > 160 K (ref. 4), we find that continuous-wave gain becomes possible at T ≈ 100 K from tetragonal-phase inclusions that are photogenerated by the pump within the normally existing, larger-bandgap orthorhombic host matrix. In this mixed-phase system, the tetragonal inclusions function as carrier recombination sinks that reduce the transparency threshold, in loose analogy to inorganic semiconductor quantum wells, and may serve as a model for engineering improved perovskite gain media.

  3. Diode-pumped CW frequency-doubled Nd:CNGG-BiBO blue laser at 468 nm

    International Nuclear Information System (INIS)

    Lü, Y F; Xia, J; Lin, J Q; Gao, X; Dong, Y; Xu, L J; Sun, G C; Zhao, Z M; Tan, Y; Chen, J F; Liu, Z X; Li, C L; Cai, H X; Liu, Z T; Ma, Z Y; Ning, G B

    2011-01-01

    Efficient and compact blue laser output at 468 nm is generated by intracavity frequency doubling of a continuous-wave (CW) diode-pumped Nd:CNGG laser at 935 nm. With 17.8 W of diode pump power and the frequency-doubling crystal BiB 3 O 6 (BiBO), a maximum output power of 490 mW in the blue spectral range at 468 nm has been achieved, corresponding to an optical-to-optical conversion efficiency of 2.8%; the output power stability over 4 h is better than 2.6%. To the best of our knowledge, this is first work on intracavity frequency doubling of a diode pumped Nd:CNGG laser at 935 nm

  4. 3D conformal external beam radiation therapy for prostate carcinoma: an experiment of Instituto do Radium de Campinas with 285 patients; Radioterapia externa conformada 3D para o carcinoma de prostata: experiencia do Instituto do Radium de Campinas com 285 pacientes

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Ricardo Akiyoshi [Hospital de Caridade Dr. Astrogildo de Azevedo, Santa Maria, RS (Brazil); Monti, Carlos Roberto; Trevisan, Felipe Amstalden [Instituto do Radium de Campinas (IRC), Campinas, SP (Brazil); Jacinto, Alexandre Arthur [Fundacao Pio XII, Barretos, SP (Brazil). Hospital de Cancer de Barretos

    2009-03-15

    Objective: To report the outcomes of 3D conformal radiation therapy for prostate cancer in a single institution. Materials and methods: From July 1997 to January 2002, 285 consecutive patients with prostate cancer were submitted to 3D conformal radiation therapy receiving a median dose of 7920 cGy to the prostate, and were retrospectively evaluated. The patients distribution according to the level of risk was the following: low risk - 95 (33.7%); intermediate risk - 66 (23.4%); high risk -121 (42.9%) patients. Results: Median follow-up of 53.6 months (3.6.95.3 months) demonstrated 85.1% actuarial five-year overall survival, 97.0% specific cause survival, 94.2% five-year distant metastasis-free survival, and 75.8% five-year biochemical recurrence-free survival. Rates of five-year actuarial survival free from late rectal and urinary toxicity were 96.4% and 91.1% respectively. Pre-3D conformal radiation therapy transurethral resection of the prostate and doses > 70 Gy in 30% of the bladder volume implied a higher grade 2-3 late urinary toxicity in five years (p = 0.0002 and p = 0.0264, respectively). Conclusion: The first experiment with 3D conformal radiation therapy reported in Brazil allowed high radiation doses with acceptable levels of urinary and rectal toxicity. Pre-3D conformal radiation therapy transurethral resection of prostate may determine a higher risk for post-irradiation grade 2-3 late urinary toxicity. At the tomography planning, the reduction of the radiation dose to . 70 Gy in 30% of the bladder volume may reduce the risk for late urinary complications. (author)

  5. Continuous-wave cavity ringdown spectroscopy based on the control of cavity reflection.

    Science.gov (United States)

    Li, Zhixin; Ma, Weiguang; Fu, Xiaofang; Tan, Wei; Zhao, Gang; Dong, Lei; Zhang, Lei; Yin, Wangbao; Jia, Suotang

    2013-07-29

    A new type of continuous-wave cavity ringdown spectrometer based on the control of cavity reflection for trace gas detection was designed and evaluated. The technique separated the acquisitions of the ringdown event and the trigger signal to optical switch by detecting the cavity reflection and transmission, respectively. A detailed description of the time sequence of the measurement process was presented. In order to avoid the wrong extraction of ringdown time encountered accidentally in fitting procedure, the laser frequency and cavity length were scanned synchronously. Based on the statistical analysis of measured ringdown times, the frequency normalized minimum detectable absorption in the reflection control mode was 1.7 × 10(-9)cm(-1)Hz(-1/2), which was 5.4 times smaller than that in the transmission control mode. However the signal-to-noise ratio of the absorption spectrum was only 3 times improved since the etalon effect existed. Finally, the peak absorption coefficients of the C(2)H(2) transition near 1530.9nm under different pressures showed a good agreement with the theoretical values.

  6. 30 CFR 285.613 - How will MMS process my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if it...

  7. 30 CFR 285.628 - How will MMS process my COP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my COP? 285.628 Section... Requirements Contents of the Construction and Operations Plan § 285.628 How will MMS process my COP? (a) The MMS will review your submitted COP, and the information provided pursuant to § 285.627, to determine...

  8. Mutagenicity of monoadducts and cross-links induced in Aspergillus nidulans by 8-methoxypsoralen plus 365 nm radiation

    International Nuclear Information System (INIS)

    Scott, B.R.; Maley, M.A.

    1981-01-01

    8-Methoxypsoralen plus 365 nm radiation induces mutation at the methionine supressor loci of Aspergillus inhibitor-deficient conidia at low doses of near-UV radiation with one-hit kinetics and at higher near-UV radiation doses with two-hit kinetics. These results and others suggest that both monoadducts and cross-links, formed by 8-methoxypsoralen and DNA upon exposure to UV radiation, are capable of inducing mutation. Evidence is also presented that induced furocoumarin cross-links are responsible for the inactivation of the Aspergillus conidium. (author)

  9. OPTIMAL STRATEGIES FOR CONTINUOUS GRAVITATIONAL WAVE DETECTION IN PULSAR TIMING ARRAYS

    International Nuclear Information System (INIS)

    Ellis, J. A.; Siemens, X.; Creighton, J. D. E.

    2012-01-01

    Supermassive black hole binaries (SMBHBs) are expected to emit a continuous gravitational wave signal in the pulsar timing array (PTA) frequency band (10 –9 to 10 –7 Hz). The development of data analysis techniques aimed at efficient detection and characterization of these signals is critical to the gravitational wave detection effort. In this paper, we leverage methods developed for LIGO continuous wave gravitational searches and explore the use of the F-statistic for such searches in pulsar timing data. Babak and Sesana have used this approach in the context of PTAs to show that one can resolve multiple SMBHB sources in the sky. Our work improves on several aspects of prior continuous wave search methods developed for PTA data analysis. The algorithm is implemented fully in the time domain, which naturally deals with the irregular sampling typical of PTA data and avoids spectral leakage problems associated with frequency domain methods. We take into account the fitting of the timing model and have generalized our approach to deal with both correlated and uncorrelated colored noise sources. We also develop an incoherent detection statistic that maximizes over all pulsar-dependent contributions to the likelihood. To test the effectiveness and sensitivity of our detection statistics, we perform a number of Monte Carlo simulations. We produce sensitivity curves for PTAs of various configurations and outline an implementation of a fully functional data analysis pipeline. Finally, we present a derivation of the likelihood maximized over the gravitational wave phases at the pulsar locations, which results in a vast reduction of the search parameter space.

  10. Application of multi-parameter chorus and plasmaspheric hiss wave models in radiation belt modeling

    Science.gov (United States)

    Aryan, H.; Kang, S. B.; Balikhin, M. A.; Fok, M. C. H.; Agapitov, O. V.; Komar, C. M.; Kanekal, S. G.; Nagai, T.; Sibeck, D. G.

    2017-12-01

    Numerical simulation studies of the Earth's radiation belts are important to understand the acceleration and loss of energetic electrons. The Comprehensive Inner Magnetosphere-Ionosphere (CIMI) model along with many other radiation belt models require inputs for pitch angle, energy, and cross diffusion of electrons, due to chorus and plasmaspheric hiss waves. These parameters are calculated using statistical wave distribution models of chorus and plasmaspheric hiss amplitudes. In this study we incorporate recently developed multi-parameter chorus and plasmaspheric hiss wave models based on geomagnetic index and solar wind parameters. We perform CIMI simulations for two geomagnetic storms and compare the flux enhancement of MeV electrons with data from the Van Allen Probes and Akebono satellites. We show that the relativistic electron fluxes calculated with multi-parameter wave models resembles the observations more accurately than the relativistic electron fluxes calculated with single-parameter wave models. This indicates that wave models based on a combination of geomagnetic index and solar wind parameters are more effective as inputs to radiation belt models.

  11. Electromagnetic radiation from beam-plasma instabilities

    Science.gov (United States)

    Pritchett, P. L.; Dawson, J. M.

    1983-01-01

    A computer simulation is developed for the generation of electromagnetic radiation in an electron beam-plasma interaction. The plasma is treated as a two-dimensional finite system, and effects of a continuous nonrelativistic beam input are accounted for. Three momentum and three field components are included in the simulation, and an external magnetic field is excluded. EM radiation generation is possible through interaction among Langmuir oscillations, ion-acoustic waves, and the electromagnetic wave, producing radiation perpendicular to the beam. The radiation is located near the plasma frequency, and polarized with the E component parallel to the beam. The scattering of Langmuir waves caused by ion-acoustic fluctuations generates the radiation. Comparison with laboratory data for the three-wave interactions shows good agreement in terms of the radiation levels produced, which are small relative to the plasma thermal energy.

  12. Effects of Rubber Loading on the Ultrasonic Backward Radiation Profile of Leaky Lamb Wave

    International Nuclear Information System (INIS)

    Song, Sung Jin; Jung, Min Ho; Kim, Young H.; Kwon, Sung Duk

    2002-01-01

    The characterization of adhesive property in multi-layer materials has been hot issue for a long time. In order to evaluate adhesive properties, we constructed fully automated system for the backward radiation of leaky Lamb wave. The backward radiation profiles were obtained for the bare steel plate and plates with rubber-loading. The rf waveforms and frequency spectra of backward radiation show the characteristics of involved leaky Lamb wave modes. As the thickness of rubber-loading increased, the amplitude of profile at the incident angle of 13.4' exponentially decreased. Scanning the incident position over the partially rubber-loaded specimen shows good agreement with the actual rubber-loading. The backward radiation of leaky Lamb wave has great potential to evaluate the adhesive condition as well as material properties of plates

  13. Experimental and numerical investigation of shock wave propagation through complex geometry, gas continuous, two-phase media

    Energy Technology Data Exchange (ETDEWEB)

    Liu, James Chien-Chih [Univ. of California, Berkeley, CA (United States)

    1993-01-01

    The work presented here investigates the phenomenon of shock wave propagation in gas continuous, two-phase media. The motivation for this work stems from the need to understand blast venting consequences in the HYLIFE inertial confinement fusion (ICF) reactor. The HYLIFE concept utilizes lasers or heavy ion beams to rapidly heat and compress D-T targets injected into the center of a reactor chamber. A segmented blanket of failing molten lithium or Li2BeF4 (Flibe) jets encircles the reactors central cavity, shielding the reactor structure from radiation damage, absorbing the fusion energy, and breeding more tritium fuel.

  14. Comparative analysis of the effect of the GaAlAs laser irradiation in 780 nm and 660 nm in the hypersensitive dentin; Analise comparativa do efeito da irradiacao do laser de GaAlAs em 780 nm e 660 nm na hipersensibilidade dentinaria

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Sun Chien

    2003-07-01

    This study was to evaluate and compare the effects of the low intensity in laser radiation among GaAlAs 780 nm and GaAlAs 660 nm. The main proposal is to verify if there is any difference of the effects or results in low intensity laser application treatment of hypersensitive dentin, keeping the same parameters, only differing in wavelength. The samples were distributed in two groups. Group A 90 cases, treated with GaAlAs 780 nm and group B irradiated with GaAlAs 660 nm with a total of 76 cases analyzed. The results of application with GaAlAs 660 nm and GaAlAs 780 nm do not differ statistically. Which means using any one of the irradiation gives the same results. However can be noted that the response of reduction of hypersensitivity is faster with the radiation of GaAlAs 780 nm, but the results after three applications is the same for both types of radiation. (author)

  15. The Continuous Wave Deuterium Demonstrator (CWDD) design and status

    Energy Technology Data Exchange (ETDEWEB)

    Todd, A.M.M. (Grumman Space and Electronics Corp., Princeton, NJ (United States)); Nightingale, M.P.S. (AEA Industrial Technology, Culham (United Kingdom)); Yule, T.J. (Argonne National Lab., IL (United States))

    1992-01-01

    The design of the Continuous Wave Deuterium Demonstrator (CWDD) and the status of the fabricated hardware is presented. The CWDD is a high brightness, 352 MHz, CW linear accelerator designed to deliver a 7.54 MeV, 80 mA D[sup [minus

  16. Picosecond ultrasonic study of surface acoustic waves on titanium nitride nanostructures

    International Nuclear Information System (INIS)

    Bjornsson, M. M.; Connolly, A. B.; Mahat, S.; Rachmilowitz, B. E.; Daly, B. C.; Antonelli, G. A.; Myers, A.; Singh, K. J.; Yoo, H. J.; King, S. W.

    2015-01-01

    We have measured surface acoustic waves on nanostructured TiN wires overlaid on multiple thin films on a silicon substrate using the ultrafast pump-probe technique known as picosecond ultrasonics. We find a prominent oscillation in the range of 11–54 GHz for samples with varying pitch ranging from 420 nm down to 168 nm. We find that the observed oscillation increases monotonically in frequency with decrease in pitch, but that the increase is not linear. By comparing our data to two-dimensional mechanical simulations of the nanostructures, we find that the type of surface oscillation to which we are sensitive changes depending on the pitch of the sample. Surface waves on substrates that are loaded by thin films can take multiple forms, including Rayleigh-like waves, Sezawa waves, and radiative (leaky) surface waves. We describe evidence for detection of modes that display characteristics of these three surface wave types

  17. Atmospheric aerosol variability above the Paris Area during the 2015 heat wave - Comparison with the 2003 and 2006 heat waves

    Science.gov (United States)

    Chazette, Patrick; Totems, Julien; Shang, Xiaoxia

    2017-12-01

    The aerosol layers during the heat wave of July 2015 over Paris Area have been studied using a N2-Raman lidar with co- and cross-polarized channels. The lidar observations are examined to allow the identification of main aerosol types and their origins, in synergy with measurements of the AERONET sunphotometer network and back trajectory studies from the HYSPLIT model. The results are compatible with spaceborne observations of MODIS and CALIOP. As for previous heat waves of August 2003 and July 2006 occurring in France, the aerosol optical thickness is very large, up to 0.8 at the lidar wavelength of 355 nm (between 0.5 and 0.7 at 550 nm). However, air mass trajectories highlight that the observed aerosol layers may have multiple and diverse origins during the 2015 heat wave (North America, Northwest Africa, Southern and Northern Europe). Biomass burning, pollution and desert dust aerosols have been identified, using linear particle depolarization ratio, lidar ratio and analysis of back trajectories initiated at the altitudes and arrival times of the plumes. These layers are elevated and are shown to have little impact on surface aerosol concentrations (PM10 < 40 μg m-3 or PM2.5 < 25 μg m-3) and therefore no influence on the local air quality during the 2015 heat wave, unlike in 2003 and 2006. However, they significantly modify the radiative budget by trapping part of the solar ingoing/outgoing fluxes, which leads to a mean aerosol radiative forcing close to +50 ± 17 Wm-2 per aerosol optical thickness unit at 550 nm (AOT550) for solar zenith angles between 55 and 75°, which are available from sunphotometer measurements. This value is smaller than those of the 2003 and 2006 heat waves, which are assessed to be +95 ± 13 and +70 ± 18 Wm-2/AOT550, respectively. The differences between the heat wave of 2015 and the others are mainly due to both the nature and the diversity of aerosols, as indicated by the dispersion of the single scattering albedo distributions at

  18. Growth and continuous-wave laser operation of disordered crystals of Yb3+:NaLa(WO4)2 and Yb3+:NaLa(MoO4)2

    International Nuclear Information System (INIS)

    Liu, J.; Rico, M.; Griebner, U.; Petrov, V.; Cano-Torres, J.M.; Cascales, C.; Esteban-Betegon, F.; Serrano, M.D.; Volkov, V.; Zaldo, C.

    2005-01-01

    Single crystals of disordered NaLa(WO 4 ) 2 and NaLa(MoO 4 ) 2 doped with Yb 3+ are grown by the Czochralski method from the melt. Continuous-wave laser operation with Ti:sapphire laser pumping is demonstrated at room temperature without special cooling. Tunability from 1017 to 1057 nm and from 1015 to 1053 nm is achieved for Yb:NaLa(WO 4 ) 2 and Yb:NaLa(MoO 4 ) 2 , respectively. A maximum output power of 205 mW is obtained with Yb:NaLa(WO 4 ) 2 . (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Multiphoton ionization and fragmentation study of acetone using 308 nm laser radiation

    Science.gov (United States)

    Liu Houxiang, Li Shutao, Han Jingcheng, Zhu Rong, Guan Yifu, Wu Cunkai

    1988-10-01

    Multiphoton ionization and fragmentation (MPI-F) of acetone molecules using 308 nm laser radiation was studied by using a molecular beam and quadrupole mass spectrometer. The ion peaks of acetone molecule appear at m/e=15 and 43, corresponding to the two fragments CH3+ and CH3CO+. It is considered that these two ions are, respectively, formed by direct (2+1) and 2-photon ionization of methyl and acetyl radicals, generated by photodissociation of acetone molecule.

  20. 30 CFR 285.907 - How will MMS process my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.907 Section 285.907 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.907 How will MMS process my decommissioning application? (a...

  1. 30 CFR 285.905 - When must I submit my decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... application? 285.905 Section 285.905 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Decommissioning Applications § 285.905 When must I submit my decommissioning application? You must...

  2. Crystal growth, optical properties, and continuous-wave laser operation of Nd3+-doped Lu2SiO5 crystal

    International Nuclear Information System (INIS)

    Li, D Z; Xu, X D; Zhou, D H; Xia, C T; Wu, F; Xu, J; Cong, Z H; Zhang, J; Tang, D Y

    2011-01-01

    High quality Nd 3+ -doped Lu 2 SiO 5 (Nd:LSO) crystal has been grown by the Czochralski technique. The cell parameters were analyzed with X-ray diffraction (XRD). Room temperature absorption and fluorescence spectra and fluorescence lifetime of the Nd:LSO crystal were measured and analyzed. The Judd-Ofelt intensity parameters Ω 2,4,6 were obtained to be 2.59, 4.90, and 5.96×10 -20 cm 2 , respectively. The absorption and emission cross sections and the branching ratios were calculated. The peak emission cross section is 5.8 and 6.6×10 -20 cm 2 at 1075 and 1079 nm, respectively, with full width at half maximum (FWHM) of 2.8 and 5.1 nm in turn. Pumped by a laser diode, a maximum 2.54 W continuous-wave laser output has been obtained with a slope efficiency of 32%. All the results show that this crystal is a promising laser material

  3. Crystal growth, optical properties, and continuous-wave laser operation of Nd3+-doped Lu2SiO5 crystal

    Science.gov (United States)

    Li, D. Z.; Xu, X. D.; Zhou, D. H.; Xia, C. T.; Wu, F.; Xu, J.; Cong, Z. H.; Zhang, J.; Tang, D. Y.

    2011-01-01

    High quality Nd3+-doped Lu2SiO5 (Nd:LSO) crystal has been grown by the Czochralski technique. The cell parameters were analyzed with X-ray diffraction (XRD). Room temperature absorption and fluorescence spectra and fluorescence lifetime of the Nd:LSO crystal were measured and analyzed. The Judd-Ofelt intensity parameters Ω2,4,6 were obtained to be 2.59, 4.90, and 5.96×10-20 cm2, respectively. The absorption and emission cross sections and the branching ratios were calculated. The peak emission cross section is 5.8 and 6.6×10-20 cm2 at 1075 and 1079 nm, respectively, with full width at half maximum (FWHM) of 2.8 and 5.1 nm in turn. Pumped by a laser diode, a maximum 2.54 W continuous-wave laser output has been obtained with a slope efficiency of 32%. All the results show that this crystal is a promising laser material.

  4. Effects of acoustic radiation force and shear waves for absorption and stiffness sensing in ultrasound modulated optical tomography.

    Science.gov (United States)

    Li, Rui; Elson, Daniel S; Dunsby, Chris; Eckersley, Robert; Tang, Meng-Xing

    2011-04-11

    Ultrasound-modulated optical tomography (UOT) combines optical contrast with ultrasound spatial resolution and has great potential for soft tissue functional imaging. One current problem with this technique is the weak optical modulation signal, primarily due to strong optical scattering in diffuse media and minimal acoustically induced modulation. The acoustic radiation force (ARF) can create large particle displacements in tissue and has been shown to be able to improve optical modulation signals. However, shear wave propagation induced by the ARF can be a significant source of nonlocal optical modulation which may reduce UOT spatial resolution and contrast. In this paper, the time evolution of shear waves was examined on tissue mimicking-phantoms exposed to 5 MHz ultrasound and 532 nm optical radiation and measured with a CCD camera. It has been demonstrated that by generating an ARF with an acoustic burst and adjusting both the timing and the exposure time of the CCD measurement, optical contrast and spatial resolution can be improved by ~110% and ~40% respectively when using the ARF rather than 5 MHz ultrasound alone. Furthermore, it has been demonstrated that this technique simultaneously detects both optical and mechanical contrast in the medium and the optical and mechanical contrast can be distinguished by adjusting the CCD exposure time. © 2011 Optical Society of America

  5. 21 CFR 137.285 - Degerminated yellow corn meal.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Degerminated yellow corn meal. 137.285 Section 137... Cereal Flours and Related Products § 137.285 Degerminated yellow corn meal. Degerminated yellow corn meal, degermed yellow corn meal, conforms to the definition and standard of identity prescribed by § 137.265 for...

  6. A continuous-wave optical parametric oscillator around 5-μm wavelength for high-resolution spectroscopy.

    Science.gov (United States)

    Krieg, J; Klemann, A; Gottbehüt, I; Thorwirth, S; Giesen, T F; Schlemmer, S

    2011-06-01

    We present a continuous-wave optical parametric oscillator (OPO) capable of high resolution spectroscopy at wavelengths between 4.8 μm and 5.4 μm. It is based on periodically poled lithium niobate (PPLN) and is singly resonant for the signal radiation around 1.35 μm. Because of the strong absorption of PPLN at wavelengths longer than 4.5 μm, the OPO threshold rises to the scale of several watts, while it produces idler powers of more than 1 mW and offers continuous tuning over 15 GHz. A supersonic jet spectrometer is used in combination with the OPO to perform measurements of the transient linear molecule Si(2)C(3) at 1968.2 cm(-1). Fifty rovibrational transition frequencies of the ν(3) antisymmetric stretching mode have been determined with an accuracy on the order of 10(-4) cm(-1), and molecular parameters for the ground and the v(3) = 1 state have been determined most precisely. © 2011 American Institute of Physics

  7. Photosensitivity of the Er/Yb-Codoped Schott IOG1 Phosphate Glass Using 248 nm, Femtosecond, and Picosecond Laser Radiation

    International Nuclear Information System (INIS)

    Pissadakis, S.; Michelakaki, I.

    2009-01-01

    The effect of 248 nm laser radiation, with pulse duration of 5 picoseconds, 500 femtosecond, and 120 femtosecond, on the optical properties and the Knoop hardness of a commercial Er/Yb-codoped phosphate glass is presented here. Refractive index changes of the order of few parts of 10-4 are correlated with optical absorption centers induced in the glass volume, using Kramers-Kroning relationship. Accordingly, substantially lower refractive index changes are measured in volume Bragg gratings inscribed in the glass, indicating that, in addition to the optical density changes, volume dilation changes of negative sign may also be associated with the 248 nm ultrafast irradiation. The Knoop hardness experimental results reveal that the glass matrix undergoes an observable initial hardening and then a reversing softening and volume dilation process for modest accumulated energy doses, where the Knoop hardness follows a nonmonotonic trend. Comparative results on the Knoop hardness trend are also presented for the case of 193 nm excimer laser radiation. The above findings denote that the positive or negative evolution of refractive index changes induced by the 248 0nm ultrafast radiation in the glass is dominated by the counteraction of the color center formation and the volume modification effects.

  8. Rapidly tunable continuous-wave optical parametric oscillator pumped by a fiber laser

    NARCIS (Netherlands)

    Klein, M.E.; Gross, P.; Boller, Klaus J.; Auerbach, M.; Wessels, P.; Fallnich, C.

    2003-01-01

    We report on rapid, all-electronically controlled wavelength tuning of a continuous-wave (cw) optical parametric oscillator (OPO) pumped by an ytterbium fiber laser. The OPO is singly resonant for the signal wave and consists of a 40-mm-long periodically poled lithium niobate crystal in a

  9. On the omnipresent background gamma radiation of the continuous spectrum

    Energy Technology Data Exchange (ETDEWEB)

    Banjanac, R.; Maletić, D.; Joković, D., E-mail: yokovic@ipb.ac.rs; Veselinović, N.; Dragić, A.; Udovičić, V.; Aničin, I.

    2014-05-01

    The background spectrum of a germanium detector, shielded from the radiations arriving from the lower and open for the radiations arriving from the upper hemisphere, is studied by means of absorption measurements, both in a ground level and in an underground laboratory. The low-energy continuous portion of this background spectrum that peaks at around 100 keV, which is its most intense component, is found to be of very similar shape at the two locations. It is established that it is mostly due to the radiations of the real continuous spectrum, which is quite similar to the instrumental one. The intensity of this radiation is in our cases estimated to about 8000 photons/(m{sup 2}s·2π·srad) in the ground level laboratory, and to about 5000 photons/(m{sup 2}s·2π·srad) in the underground laboratory, at the depth of 25 m.w.e. Simulations by GEANT4 and CORSIKA demonstrate that this radiation is predominantly of terrestrial origin, due to environmental gamma radiations scattered off the materials that surround the detector (the “skyshine radiation”), and to a far less extent to cosmic rays of degraded energy. - Highlights: • We studied the low-energy part of continuous background spectra of germanium detectors. • The study was performed at the ground level and at the shallow underground sites. • The instrumental spectrum is due to radiations of the similar continuous spectrum. • The low-energy radiation is of both terrestrial and cosmic-ray origin. • In our study, we find that this radiation is of predominantly terrestrial origin.

  10. Interference of laser-induced resonances in the continuous structures of a helium atom

    International Nuclear Information System (INIS)

    Magunov, A I; Strakhova, S I

    2003-01-01

    Coherent effects in the interference of overlapping laser-induced resonances in helium atoms are considered. The simultaneous action of single-mode radiation of the 294-nm second harmonic of a cw dye laser and a 1064-nm Nd:YAG laser on helium atoms provides the overlap of two resonances induced by transitions from the 1s2s 1 S and 1s4s 1 S helium levels. The shape of the overlapping laser-induced resonances in the rotating-wave approximation is described by analytic expressions, which depend on the laser radiation intensities and the ratio of laser frequencies. (nonlinear optical phenomena)

  11. Continuous waves probing in dynamic acoustoelastic testing

    Science.gov (United States)

    Scalerandi, M.; Gliozzi, A. S.; Ait Ouarabi, M.; Boubenider, F.

    2016-05-01

    Consolidated granular media display a peculiar nonlinear elastic behavior, which is normally analysed with dynamic ultrasonic testing exploiting the dependence on amplitude of different measurable quantities, such as the resonance frequency shift, the amount of harmonics generation, or the break of the superposition principle. However, dynamic testing allows measuring effects which are averaged over one (or more) cycles of the exciting perturbation. Dynamic acoustoelastic testing has been proposed to overcome this limitation and allow the determination of the real amplitude dependence of the modulus of the material. Here, we propose an implementation of the approach, in which the pulse probing waves are substituted by continuous waves. As a result, instead of measuring a time-of-flight as a function of the pump strain, we study the dependence of the resonance frequency on the strain amplitude, allowing to derive the same conclusions but with an easier to implement procedure.

  12. 18 CFR 284.285 - Pregrant of abandonment of unbundled sales services.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Pregrant of abandonment of unbundled sales services. 284.285 Section 284.285 Conservation of Power and Water Resources... Sales by Interstate Pipelines § 284.285 Pregrant of abandonment of unbundled sales services. Abandonment...

  13. Relationship of scattering phase shifts to special radiation force conditions for spheres in axisymmetric wave-fields.

    Science.gov (United States)

    Marston, Philip L; Zhang, Likun

    2017-05-01

    When investigating the radiation forces on spheres in complicated wave-fields, the interpretation of analytical results can be simplified by retaining the s-function notation and associated phase shifts imported into acoustics from quantum scattering theory. For situations in which dissipation is negligible, as taken to be the case in the present investigation, there is an additional simplification in that partial-wave phase shifts become real numbers that vanish when the partial-wave index becomes large and when the wave-number-sphere-radius product vanishes. By restricting attention to monopole and dipole phase shifts, transitions in the axial radiation force for axisymmetric wave-fields are found to be related to wave-field parameters for traveling and standing Bessel wave-fields by considering the ratio of the phase shifts. For traveling waves, the special force conditions concern negative forces while for standing waves, the special force conditions concern vanishing radiation forces. An intermediate step involves considering the functional dependence on phase shifts. An appendix gives an approximation for zero-force plane standing wave conditions. Connections with early investigations of acoustic levitation are mentioned and some complications associated with viscosity are briefly noted.

  14. LDRD final report on continuous wave intersubband terahertz sources.

    Energy Technology Data Exchange (ETDEWEB)

    Samora, Sally; Mangan, Michael A.; Foltynowicz, Robert J.; Young, Erik W.; Fuller, Charles T.; Stephenson, Larry L.; Reno, John Louis; Wanke, Michael Clement; Hudgens, James J.

    2005-02-01

    There is a general lack of compact electromagnetic radiation sources between 1 and 10 terahertz (THz). This a challenging spectral region lying between optical devices at high frequencies and electronic devices at low frequencies. While technologically very underdeveloped the THz region has the promise to be of significant technological importance, yet demonstrating its relevance has proven difficult due to the immaturity of the area. While the last decade has seen much experimental work in ultra-short pulsed terahertz sources, many applications will require continuous wave (cw) sources, which are just beginning to demonstrate adequate performance for application use. In this project, we proposed examination of two potential THz sources based on intersubband semiconductor transitions, which were as yet unproven. In particular we wished to explore quantum cascade lasers based sources and electronic based harmonic generators. Shortly after the beginning of the project, we shifted our emphasis to the quantum cascade lasers due to two events; the publication of the first THz quantum cascade laser by another group thereby proving feasibility, and the temporary shut down of the UC Santa Barbara free-electron lasers which were to be used as the pump source for the harmonic generation. The development efforts focused on two separate cascade laser thrusts. The ultimate goal of the first thrust was for a quantum cascade laser to simultaneously emit two mid-infrared frequencies differing by a few THz and to use these to pump a non-linear optical material to generate THz radiation via parametric interactions in a specifically engineered intersubband transition. While the final goal was not realized by the end of the project, many of the completed steps leading to the goal will be described in the report. The second thrust was to develop direct THz QC lasers operating at terahertz frequencies. This is simpler than a mixing approach, and has now been demonstrated by a few groups

  15. Responses of phylloplane yeasts to UV-B (290-320 nm) radiation: interspecific differences in sensitivity

    International Nuclear Information System (INIS)

    Gunasekera, T.S.; Paul, N.D.; Ayres, P.G.

    1997-01-01

    The sensitivity to UV-B (290–320 nm) radiation of common phylloplane yeasts from two contrasting UV-B environments was compared in the laboratory using mixtures of white light (PAR: 400–700 nm) and UV-B radiation from artificial lamp sources. Sporidiobolus salmonicolor, Rhodotorula mucilaginosa and Cryptococcus sp., the dominant yeasts on leaves of tea (Camellia sinensis), were isolated in Sri Lanka (SL), while Sporidiobolus sp. and Bullera alba, dominant on faba bean (Vicia faba), were isolated in the U.K. Dose responses were determined separately for each yeast. UV-B reduced colony forming units (due to cell mortality or inactivation) and colony size (due to reduced multiplication) of all yeasts. The LD 50 values and doses causing 50% reduction of cells per colony were higher for SL isolates than U.K. isolates. Results indicated that each yeast is somewhat vulnerable to UV-B doses representative of its natural habitat. The relative insensitivity of SL isolates was shown when SL and U.K. isolates were irradiated simultaneously with the same dose of UV-B. Of the two U.K. yeasts, B. alba was significantly more sensitive than Sporidiobolus sp. to UV-B. Except for R. mucilaginosa from SL, all yeasts demonstrated some photorepair in the presence of white light. White light provided relatively little protection for the U.K. isolate of Sporidiobolus sp. although it allowed increased colony size. The spectral responses of Sporidiobolus sp. (U.K.) and of B. alba (U.K.) were broadly similar. Wavelengths longer than 320 nm had no measurable effect on colony forming units. However, colony survival was significantly reduced at 310 nm and all shorter wavebands. No colonies were counted at 290 nm or below. (author)

  16. Hawking radiation from a rotating acoustic black hole

    International Nuclear Information System (INIS)

    Zhang Lichun; Li Huaifan; Zhao Ren

    2011-01-01

    Using the new global embedding approach and analytical continuation method of wave function we discuss Hawking radiation of acoustic black holes. Unruh-Hawking temperature of the acoustic black hole is derived. The corresponding relation between these methods calculating Hawking radiation of acoustic black hole is established. The calculation result shows that the contributions of chemical potential to the ingoing wave and the outgoing wave are the same.

  17. 30 CFR 285.202 - What types of leases will MMS issue?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What types of leases will MMS issue? 285.202 Section 285.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... Renewable Energy Leases General Lease Information § 285.202 What types of leases will MMS issue? The MMS may...

  18. ANTENNA RADIATION NEAR THE LOCAL PLASMA FREQUENCY BY LANGMUIR WAVE EIGENMODES

    International Nuclear Information System (INIS)

    Malaspina, David M.; Cairns, Iver H.; Ergun, Robert E.

    2012-01-01

    Langmuir waves (LWs) in the solar wind are generated by electron beams associated with solar flares, interplanetary shock fronts, planetary bow shocks, and magnetic holes. In principle, LWs localized as eigenmodes of density fluctuations can emit electromagnetic (EM) radiation by an antenna mechanism near the local plasma frequency f p and twice the local plasma frequency. In this work, analytic expressions are derived for the radiated electric and magnetic fields and power generated near f p by LW eigenmodes. The EM wave power emitted near f p is predicted as a function of the eigenmode length scale L, maximum electric field, driving electron beam speed, and the ambient plasma density and temperature. The escape to a distant observer of f p radiation from a localized Langmuir eigenmode is also briefly explored as a function of the plasma conditions.

  19. Observations of thunderstorm-related 630 nm airglow depletions

    Science.gov (United States)

    Kendall, E. A.; Bhatt, A.

    2015-12-01

    The Midlatitude All-sky imaging Network for Geophysical Observations (MANGO) is an NSF-funded network of 630 nm all-sky imagers in the continental United States. MANGO will be used to observe the generation, propagation, and dissipation of medium and large-scale wave activity in the subauroral, mid and low-latitude thermosphere. This network is actively being deployed and will ultimately consist of nine all-sky imagers. These imagers form a network providing continuous coverage over the western United States, including California, Oregon, Washington, Utah, Arizona and Texas extending south into Mexico. This network sees high levels of both medium and large scale wave activity. Apart from the widely reported northeast to southwest propagating wave fronts resulting from the so called Perkins mechanism, this network observes wave fronts propagating to the west, north and northeast. At least three of these anomalous events have been associated with thunderstorm activity. Imager data has been correlated with both GPS data and data from the AIRS (Atmospheric Infrared Sounder) instrument on board NASA's Earth Observing System Aqua satellite. We will present a comprehensive analysis of these events and discuss the potential thunderstorm source mechanism.

  20. Accretion-induced spin-wandering effects on the neutron star in Scorpius X-1: Implications for continuous gravitational wave searches

    Science.gov (United States)

    Mukherjee, Arunava; Messenger, Chris; Riles, Keith

    2018-02-01

    The LIGO's discovery of binary black hole mergers has opened up a new era of transient gravitational wave astronomy. The potential detection of gravitational radiation from another class of astronomical objects, rapidly spinning nonaxisymmetric neutron stars, would constitute a new area of gravitational wave astronomy. Scorpius X-1 (Sco X-1) is one of the most promising sources of continuous gravitational radiation to be detected with present-generation ground-based gravitational wave detectors, such as Advanced LIGO and Advanced Virgo. As the sensitivity of these detectors improve in the coming years, so will power of the search algorithms being used to find gravitational wave signals. Those searches will still require integration over nearly year long observational spans to detect the incredibly weak signals from rotating neutron stars. For low mass X-ray binaries such as Sco X-1 this difficult task is compounded by neutron star "spin wandering" caused by stochastic accretion fluctuations. In this paper, we analyze X-ray data from the R X T E satellite to infer the fluctuating torque on the neutron star in Sco X-1. We then perform a large-scale simulation to quantify the statistical properties of spin-wandering effects on the gravitational wave signal frequency and phase evolution. We find that there are a broad range of expected maximum levels of frequency wandering corresponding to maximum drifts of between 0.3 - 50 μ Hz /sec over a year at 99% confidence. These results can be cast in terms of the maximum allowed length of a coherent signal model neglecting spin-wandering effects as ranging between 5-80 days. This study is designed to guide the development and evaluation of Sco X-1 search algorithms.

  1. Laser ablative nanostructuring of Au in liquid ambience in continuous wave illumination regime

    Science.gov (United States)

    Kucherik, A. O.; Kutrovskaya, S. V.; Arakelyan, S. M.; Ryabchikov, Y. V.; Al-Kattan, A.; Kabashin, A. V.; Itina, T. E.

    2016-03-01

    Gold nanoparticles (Au NPs) attract particular attention because of their unique size-dependent chemical, physicochemical and optical properties and, hence, their potential applications in catalysis, nanoelectronics, photovoltaics and medicine. In particular, laser-produced colloidal nanoparticles are not only biocompatible, but also reveal unique chemical properties. Different laser systems can be used for synthesis of these colloids, varying from continuous wave (CW) to ultra-short femtosecond lasers. The choice of an optimum laser system is still a challenge in application development. To bring more light at this issue, we investigate an influence of laser parameters on nanoparticle formation from a gold target immersed in deionized water. First, an optical diagnostics of laser-induced hydrodynamic processes taking place near the gold surface is performed. Then, gold nanoparticle colloids with average particle sizes smaller than 10 nm and a very narrow dispersion are shown to be formed by CW laser ablation. The obtained results are compared with the ones obtained by using the second harmonics and with previous results obtained by using femtosecond laser systems.

  2. Quasi-three-level thin-disk laser at 1024 nm based on diode-pumped Yb:YAG crystal

    International Nuclear Information System (INIS)

    Wang, A G; Li, Y L; Fu, X H

    2011-01-01

    We present for the first time, to the best of our knowledge, a Yb:YAG laser operating in a continuous wave (CW) on the quasi-three-level laser at 1024 nm, based on the 2 F 5/2 – 2 F 7/2 transition, generally used for a 1030 nm emission. The use of a pump module with 16 passes through the crystal allowed the realization of a Yb:YAG thin-disk laser with 370 mW of CW output power at 1024 nm. Moreover, intracavity second-harmonic generation (SHG) has also been achieved with a power of 45 mW at 512 nm by using a LiB 3 O 5 (LBO) nonlinear crystal

  3. Estimating net short-wave radiation with the Bellani pyranometer

    International Nuclear Information System (INIS)

    Bernier, Y.; Plamondon, A.P.

    1983-01-01

    Two methods were developed by which daily net short-wave radiation (K∗) can be evaluated from Bellani pyranometer readings. The first method involves a simple regression equation. The second method uses a physical approach taking into account the effect of the Bellani's geometry on its response to direct and diffuse radiation throughout the day. Both methods, when tested on experimental data, tended to underestimate the measured K∗, the regression approach exhibiting a higher variance of the error [fr

  4. Nonlinear wave propagation in discrete and continuous systems

    Science.gov (United States)

    Rothos, V. M.

    2016-09-01

    In this review we try to capture some of the recent excitement induced by a large volume of theoretical and computational studies addressing nonlinear Schrödinger models (discrete and continuous) and the localized structures that they support. We focus on some prototypical structures, namely the breather solutions and solitary waves. In particular, we investigate the bifurcation of travelling wave solution in Discrete NLS system applying dynamical systems methods. Next, we examine the combined effects of cubic and quintic terms of the long range type in the dynamics of a double well potential. The relevant bifurcations, the stability of the branches and their dynamical implications are examined both in the reduced (ODE) and in the full (PDE) setting. We also offer an outlook on interesting possibilities for future work on this theme.

  5. Radiation assisted thermonuclear burn wave dynamics in heavy ion fast ignition of cylindrical deuterium-tritium fuel target

    International Nuclear Information System (INIS)

    Rehman, S.; Kouser, R.; Nazir, R.; Manzoor, Z.; Tasneem, G.; Jehan, N.; Nasim, M.H.; Salahuddin, M.

    2015-01-01

    Dynamics of thermonuclear burn wave propagation assisted by thermal radiation precursor in a heavy ion fast ignition of cylindrical deuterium-tritium (DT) fuel target are studied by two dimensional radiation hydrodynamic simulations using Multi-2D code. Thermal radiations, as they propagate ahead of the burn wave, suffer multiple reflections and preheat the fuel, are found to play a vital role in burn wave dynamics. After fuel ignition, the burn wave propagates in a steady state manner for some time. Multiple reflection and absorption of radiation at the fuel-tamper interface, fuel ablation and radial implosion driven by ablative shock and fast fusion rates on the fuel axis, at relatively later times, result into filamentary wave front. Strong pressure gradients are developed and sausage like structures behind the front are appeared. The situation leads to relatively reduced and non-uniform radial fuel burning and burn wave propagation. The fuel burning due to DD reaction is also taken into account and overall fusion energy and fusion power density, due to DT and DD reactions, during the burn wave propagation are determined as a function of time. (authors)

  6. Monitoring dynamic reactions of red blood cells to UHF electromagnetic waves radiation using a novel micro-imaging technology.

    Science.gov (United States)

    Ruan, Ping; Yong, Junguang; Shen, Hongtao; Zheng, Xianrong

    2012-12-01

    Multiple state-of-the-art techniques, such as multi-dimensional micro-imaging, fast multi-channel micro-spetrophotometry, and dynamic micro-imaging analysis, were used to dynamically investigate various effects of cell under the 900 MHz electromagnetic radiation. Cell changes in shape, size, and parameters of Hb absorption spectrum under different power density electromagnetic waves radiation were presented in this article. Experimental results indicated that the isolated human red blood cells (RBCs) do not have obviously real-time responses to the ultra-low density (15 μW/cm(2), 31 μW/cm(2)) electromagnetic wave radiation when the radiation time is not more than 30 min; however, the cells do have significant reactions in shape, size, and the like, to the electromagnetic waves radiation with power densities of 1 mW/cm(2) and 5 mW/cm(2). The data also reveal the possible influences and statistical relationships among living human cell functions, radiation amount, and exposure time with high-frequency electromagnetic waves. The results of this study may be significant on protection of human being and other living organisms against possible radiation affections of the high-frequency electromagnetic waves.

  7. Generation of auroral kilometric radiation in upper hybrid wave-lower hybrid soliton interaction

    International Nuclear Information System (INIS)

    Pottelette, R.; Dubouloz, N.; Treumann, R.A.

    1992-01-01

    Sporadic bursts of auroral kilometric radiation (AKR) associated with strong bursty electrostatic turbulence in the vicinity of the lower hybrid frequency have been frequently recorded in the AKR source region by the Viking satellite. The variation time scale of these emissions is typically 1 s, long enough for lower hybrid waves to grow to amplitudes of several hundred millivolts per meter and to evolve nonlinearly into solitons. On the basis on these observations it is suggested that formation of lower hybrid solitons may play a role in the generation of AKR. A theoretical model is proposed which is based on the direct acceleration of electrons in the combined lower hybrid soliton and upper hybrid wave fields. The solitons act as sporadic, localized antennas allowing for efficient conversions of the electrostatic energy stored in upper hybrid waves into electromagnetic radiation at a frequency above the X mode cutoff. Excitation of lower hybrid waves is due to the presence of energetic electron beams in the auroral zone found to be associated with steep plasma density gradients. Upper hybrid waves can be excited by a population of energetic electrons with loss cone distributions. The power of the electromagnetic radiation obtained is only noticeable in regions where the plasma frequency is less than the electron gyrofrequency. The theory predicts spectral power densities of the order of 10 -11 to 10 -9 W m -2 Hz -1 in the source region, in good agreement with the Viking observations. The sporadic nature of the radiation derives from lower hybrid soliton collapses which occur on ∼1-s time scales

  8. Frequency control of a 1163 nm singly resonant OPO based on MgO:PPLN

    NARCIS (Netherlands)

    Gross, P.; Lindsay, I.D.; Lee, Christopher James; Nittmann, M.; Bauer, T.; Bartschke, J.; Warring, U.; Fischer, A.; Kellenbauer, A.; Boller, Klaus J.

    2010-01-01

    We report the realization of a singly resonant optical parametric oscillator (SRO) that is designed to provide narrow-bandwidth, continuously tunable radiation at a wavelength of 1163 nm for optical cooling of osmium ions. The SRO is based on periodically poled, magnesium-oxide-doped lithium niobate

  9. Acoustic radiation force on a rigid elliptical cylinder in plane (quasi)standing waves

    Science.gov (United States)

    Mitri, F. G.

    2015-12-01

    The acoustic radiation force on a 2D elliptical (non-circular) cylinder centered on the axis of wave propagation of plane quasi-standing and standing waves is derived, based on the partial-wave series expansion (PWSE) method in cylindrical coordinates. A non-dimensional acoustic radiation force function, which is the radiation force per unit length, per characteristic energy density and per unit cross-sectional surface of the ellipse, is defined in terms of the scattering coefficients that are determined by applying the Neumann boundary condition for an immovable surface. A system of linear equations involving a single numerical integration procedure is solved by matrix inversion. Numerical simulations showing the transition from the quasi-standing to the (equi-amplitude) standing wave behaviour are performed with particular emphasis on the aspect ratio a/b, where a and b are the ellipse semi-axes, as well as the dimensionless size parameter kb (where k is the wavenumber), without the restriction to a particular range of frequencies. It is found that at high kb values > 1, the radiation force per length with broadside incidence is larger, whereas the opposite situation occurs in the long-wavelength limit (i.e., kb acoustic levitation of elliptical cylinders, the acoustic stabilization of liquid columns in a host medium, acousto-fluidics devices, and other particle dynamics applications to name a few. Moreover, the formalism presented here may be effectively applied to compute the acoustic radiation force on other 2D surfaces of arbitrary shape such as super-ellipses, Chebyshev cylindrical particles, or other non-circular geometries.

  10. Use of Z pinch radiation sources for high pressure shock wave studies

    International Nuclear Information System (INIS)

    Asay, J.R.; Konrad, C.H.; Hall, C.A.; Trott, W.M.; Chandler, G.A.; Holland, K.G.; Fleming, K.J.; Trucano, T.G.

    1998-01-01

    Recent developments in pulsed power technology demonstrate use of intense radiation sources (Z pinches) for driving planar shock waves in samples with spatial dimensions larger than possible with other radiation sources. Initial indications are that the use of Z pinch sources can be used to produce planar shock waves in samples with diameters of a few millimeters and thicknesses approaching one half millimeter. These dimensions allow increased accuracy of both shock velocity and particle velocity measurements. The Z pinch radiation source uses imploding metal plasma induced by self-magnetic fields applied to wire arrays to produce high temperature x-ray environments in vacuum hohlraum enclosures. Previous experiments have demonstrated that planar shock waves can be produced with this approach. A photograph of a wire array located inside the vacuum hohlraum is shown here. Typically, a few hundred individual wires are used to produce the Z pinch source. For the shock wave experiments being designed, arrays of 120 to 240 tungsten wires with a diameter of 40 mm and with individual diameters of about 10 microm are used. Preliminary experiments have been performed on the Z pulsed radiation source to demonstrate the ability to obtain VISAR measurements in the Z accelerator environment. Analysis of these results indicate that another effect, not initially anticipated, is an apparent change in refractive index that occurs in the various optical components used in the system. This effect results in an apparent shift in the frequency of reflected laser light, and causes an error in the measured particle velocity. Experiments are in progress to understand and minimize this effect

  11. Comparative in vitro study of tissue welding using a 808 nm diode laser and a Ho:YAG laser.

    Science.gov (United States)

    Ott, B; Züger, B J; Erni, D; Banic, A; Schaffner, T; Weber, H P; Frenz, M

    2001-01-01

    In vitro porcine arteries and veins have been welded end-to-end using either a 808 nm diode laser combined with an indocyanine green enhanced albumin solder, or with a continuous-wave (cw) Ho:YAG laser without biological solder. The vascular stumps were approached to each other over a coronary dilatation catheter in order to obtain a precise alignment and good coaptation. Standard histology revealed for both welding techniques lateral tissue damage between 2 and 3 mm caused by laser-induced heat. Good solder attachment to the tissue was observed by the use of a scanning electron microscope. The vessels soldered with the 808 nm diode laser using albumin solder showed considerably higher tensile strength (1 N compared to 0.3 N) than vessels welded exclusively by Ho:YAG laser radiation. In contrast, leaking pressure (350 +/- 200 mmHg) and bursting pressure (457 +/- 200 mmHg) were found to be independent of the welding technique used. This study demonstrates that fast (total welding time about 2-5 min), stable and tight microvascular anastomosis can be achieved with the use of a dye-enhanced albumin laser soldering technique and an ancillary coronary dilatation catheter.

  12. Repair of near-UV (365nm or 313 nm) induced DNA strand breaks

    International Nuclear Information System (INIS)

    Miguel, A.G.

    1981-01-01

    The action of near-UV (365 nm or 313 nm) radiation in cellular inactivaton (biological measurements) and induction and repair of breaks (physical measurements) is studied in repair proficient strain and in pol A, rec A and uvr A deficient strains of Escherichia coli K-12. (M.A.C.) [pt

  13. Imprints of relic gravitational waves in cosmic microwave background radiation

    International Nuclear Information System (INIS)

    Baskaran, D.; Grishchuk, L. P.; Polnarev, A. G.

    2006-01-01

    A strong variable gravitational field of the very early Universe inevitably generates relic gravitational waves by amplifying their zero-point quantum oscillations. We begin our discussion by contrasting the concepts of relic gravitational waves and inflationary 'tensor modes'. We explain and summarize the properties of relic gravitational waves that are needed to derive their effects on cosmic microwave background (CMB) temperature and polarization anisotropies. The radiation field is characterized by four invariants I, V, E, B. We reduce the radiative transfer equations to a single integral equation of Voltairre type and solve it analytically and numerically. We formulate the correlation functions C l XX ' for X, X ' =T, E, B and derive their amplitudes, shapes and oscillatory features. Although all of our main conclusions are supported by exact numerical calculations, we obtain them, in effect, analytically by developing and using accurate approximations. We show that the TE correlation at lower l's must be negative (i.e. an anticorrelation), if it is caused by gravitational waves, and positive if it is caused by density perturbations. This difference in TE correlation may be a signature more valuable observationally than the lack or presence of the BB correlation, since the TE signal is about 100 times stronger than the expected BB signal. We discuss the detection by WMAP of the TE anticorrelation at l≅30 and show that such an anticorrelation is possible only in the presence of a significant amount of relic gravitational waves (within the framework of all other common assumptions). We propose models containing considerable amounts of relic gravitational waves that are consistent with the measured TT, TE and EE correlations

  14. 30 CFR 285.706 - How do I nominate a CVA for MMS approval?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I nominate a CVA for MMS approval? 285..., Fabrication, and Installation Certified Verification Agent § 285.706 How do I nominate a CVA for MMS approval... (§ 285.610(a)(9)) or GAP (§ 285.645(c)(5)), you must nominate a CVA for MMS approval. You must specify...

  15. Continuity Conditions on Schrodinger Wave Functions at Discontinuities of the Potential.

    Science.gov (United States)

    Branson, David

    1979-01-01

    Several standard arguments which attempt to show that the wave function and its derivative must be continuous across jump discontinuities of the potential are reviewed and their defects discussed. (Author/HM)

  16. Germ killing by ultraviolet radiation

    International Nuclear Information System (INIS)

    Wawrik, O.

    1975-01-01

    Short-wave UV radiation, in particular the range about 250 nm, has a high germ reducing effect. Corresponding UV burners which above all emit radiation at the line of 254 nm can therefore be used effectively in all cases where the least possible content of germs in the air is aimed at. Apart from this it is also possible to reduce by this process the germs on surfaces and liquids. Especially in the most various ranges of pharmaceutical production one is steadily striving for efficient and last not least economic procedures by which it is possible to reduce the germs present in the air of a room. Numerous scientific investigations have sufficiently proved that short-wave UV radiation is extremely well appropriate for such purposes. Absolutely germ-free air in a room can only be obtained under laboratory conditions. In practice, however, the aim is not to achieve a 100 per cent killing of the germs present in a room but to make sure that the germ rate in certain rooms is constantly reduced to the lowest possible level. If in this connection it is referred to a germ reduction of 100 or 99 per cent this is but theory. (orig.) [de

  17. Radiation tolerance study of a commercial 65 nm CMOS technology for high energy physics applications

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Lili, E-mail: lili03.ding@gmail.com [Department of Information Engineering, Padova University, Via Gradenigo 6/B, 35131 Padova (Italy); INFN, Padova, Via Marzolo 8, 35131 Padova (Italy); State Key Laboratory of Pulsed Radiation Simulation and Effect, Northwest Institute of Nuclear Technology, Xi' an (China); Gerardin, Simone [Department of Information Engineering, Padova University, Via Gradenigo 6/B, 35131 Padova (Italy); INFN, Padova, Via Marzolo 8, 35131 Padova (Italy); Bagatin, Marta [Department of Information Engineering, Padova University, Via Gradenigo 6/B, 35131 Padova (Italy); Bisello, Dario [Department of Physics and Astronomy, Padova University, Via Marzolo 8, 35131 Padova (Italy); INFN, Padova, Via Marzolo 8, 35131 Padova (Italy); Mattiazzo, Serena [Department of Physics and Astronomy, Padova University, Via Marzolo 8, 35131 Padova (Italy); Paccagnella, Alessandro [Department of Information Engineering, Padova University, Via Gradenigo 6/B, 35131 Padova (Italy); INFN, Padova, Via Marzolo 8, 35131 Padova (Italy)

    2016-09-21

    This paper reports the radiation tolerance study of a commercial 65 nm technology, which is a strong candidate for the Large Hadron Collider applications. After exposure to 3 MeV protons till 1 Grad dose, the 65 nm CMOS transistors, especially the pMOSFETs, showed severe long-term degradation mainly in the saturation drain currents. There were some differences between the degradation levels in the nMOSFETs and the pMOSFETs, which were likely attributed to the positive charges trapped in the gate spacers. After exposure to heavy ions till multiple strikes, the pMOSFETs did not show any sudden loss of drain currents, the degradations in the characteristics were negligible.

  18. Neuronal Networks in Children with Continuous Spikes and Waves during Slow Sleep

    Science.gov (United States)

    Siniatchkin, Michael; Groening, Kristina; Moehring, Jan; Moeller, Friederike; Boor, Rainer; Brodbeck, Verena; Michel, Christoph M.; Rodionov, Roman; Lemieux, Louis; Stephani, Ulrich

    2010-01-01

    Epileptic encephalopathy with continuous spikes and waves during slow sleep is an age-related disorder characterized by the presence of interictal epileptiform discharges during at least greater than 85% of sleep and cognitive deficits associated with this electroencephalography pattern. The pathophysiological mechanisms of continuous spikes and…

  19. Characterization of radiation effects in 65 nm digital circuits with the DRAD digital radiation test chip

    International Nuclear Information System (INIS)

    Casas, L.M. Jara; Ceresa, D.; Kulis, S.; Christiansen, J.; Francisco, R.; Miryala, S.; Gnani, D.

    2017-01-01

    A Digital RADiation (DRAD) test chip has been specifically designed to study the impact of Total Ionizing Dose (TID) (<1 Grad) and Single Event Upset (SEU) on digital logic gates in a 65 nm CMOS technology. Nine different versions of standard cell libraries are studied in this chip, basically differing in the device dimensions, V t flavor and layout of the device. Each library has eighteen test structures specifically designed to characterize delay degradation and power consumption of the standard cells. For SEU study, a dedicated test structure based on a shift register is designed for each library. TID results up to 500 Mrad are reported.

  20. 30 CFR 285.543 - Example of how the inverse distance formula works.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Example of how the inverse distance formula works. 285.543 Section 285.543 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Financial Assurance Requirements Revenue Sharing with States § 285.543 Example of how the inverse distance...

  1. Continuous coherent Lyman-alpha excitation of atomic hydrogen.

    NARCIS (Netherlands)

    Eikema, K.S.E.; Waltz, J.; Hänsch, T.

    2001-01-01

    The first near natural linewidth of the 1S-2P transition in atomic hydrogen was reported with a high degree of accuracy. A high yield of continuous Lyman-α radiation based on four wave mixing in mercury was employed. It was shown that laser cooloing and detection with Lyman-α radiation has excellent

  2. Nonequilibrium radiation behind a strong shock wave in CO 2-N 2

    Science.gov (United States)

    Rond, C.; Boubert, P.; Félio, J.-M.; Chikhaoui, A.

    2007-11-01

    This work presents experiments reproducing plasma re-entry for one trajectory point of a Martian mission. The typical facility to investigate such hypersonic flow is shock tube; here we used the free-piston shock tube TCM2. Measurements of radiative flux behind the shock wave are realized thanks to time-resolved emission spectroscopy which is calibrated in intensity. As CN violet system is the main radiator in near UV-visible range, we have focused our study on its spectrum. Moreover a physical model, based on a multi-temperature kinetic code and a radiative code, for calculation of non equilibrium radiation behind a shock wave is developed for CO 2-N 2-Ar mixtures. Comparisons between experiments and calculations show that standard kinetic models (Park, McKenzie) are inefficient to reproduce our experimental results. Therefore we propose new rate coefficients in particular for the dissociation of CO 2, showing the way towards a better description of the chemistry of the mixture.

  3. Subsonic leaky Rayleigh waves at liquid-solid interfaces.

    Science.gov (United States)

    Mozhaev, V G; Weihnacht, M

    2002-05-01

    The paper is devoted to the study of leaky Rayleigh waves at liquid-solid interfaces close to the border of the existence domain of these modes. The real and complex roots of the secular equation are computed for interface waves at the boundary between water and a binary isotropic alloy of gold and silver with continuously variable composition. The change of composition of the alloy allows one to cross a critical velocity for the existence of leaky waves. It is shown that, contrary to popular opinion, the critical velocity does not coincide with the phase velocity of bulk waves in liquid. The true threshold velocity is found to be smaller, the correction being of about 1.45%. Attention is also drawn to the fact that using the real part of the complex phase velocity as a velocity of leaky waves gives only approximate value. The most interesting feature of the waves under consideration is the presence of energy leakage in the subsonic range of the phase velocities where, at first glance, any radiation by harmonic waves is not permitted. A simple physical explanation of this radiation with due regard for inhomogeneity of radiated and radiating waves is given. The controversial question of the existence of leaky Rayleigh waves at a water/ice interface is reexamined. It is shown that the solution considered previously as a leaky wave is in fact the solution of the bulk-wave-reflection problem for inhomogeneous waves.

  4. A Wave-Optics Approach to Paraxial Geometrical Laws Based on Continuity at Boundaries

    Science.gov (United States)

    Linares, J.; Nistal, M. C.

    2011-01-01

    We present a derivation of the paraxial geometrical laws starting from a wave-optics approach, in particular by using simple continuity conditions of paraxial spherical waves at boundaries (discontinuities) between optical media. Paraxial geometrical imaging and magnification laws, under refraction and reflection at boundaries, are derived for…

  5. Atmospheric-radiation boundary conditions for high-frequency waves in time-distance helioseismology

    Science.gov (United States)

    Fournier, D.; Leguèbe, M.; Hanson, C. S.; Gizon, L.; Barucq, H.; Chabassier, J.; Duruflé, M.

    2017-12-01

    The temporal covariance between seismic waves measured at two locations on the solar surface is the fundamental observable in time-distance helioseismology. Above the acoustic cut-off frequency ( 5.3 mHz), waves are not trapped in the solar interior and the covariance function can be used to probe the upper atmosphere. We wish to implement appropriate radiative boundary conditions for computing the propagation of high-frequency waves in the solar atmosphere. We consider recently developed and published radiative boundary conditions for atmospheres in which sound-speed is constant and density decreases exponentially with radius. We compute the cross-covariance function using a finite element method in spherical geometry and in the frequency domain. The ratio between first- and second-skip amplitudes in the time-distance diagram is used as a diagnostic to compare boundary conditions and to compare with observations. We find that a boundary condition applied 500 km above the photosphere and derived under the approximation of small angles of incidence accurately reproduces the "infinite atmosphere" solution for high-frequency waves. When the radiative boundary condition is applied 2 Mm above the photosphere, we find that the choice of atmospheric model affects the time-distance diagram. In particular, the time-distance diagram exhibits double-ridge structure when using a Vernazza Avrett Loeser atmospheric model.

  6. 30 CFR 285.1016 - When will an Alternate Use RUE be cancelled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will an Alternate Use RUE be cancelled? 285.1016 Section 285.1016 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR... Rue Administration § 285.1016 When will an Alternate Use RUE be cancelled? The Secretary may cancel an...

  7. Radiation exposure to patients during extracorporeal shock wave lithotripsy

    International Nuclear Information System (INIS)

    Van Swearingen, F.L.; McCullough, D.L.; Dyer, R.; Appel, B.

    1987-01-01

    Extracorporeal shock wave lithotripsy is rapidly becoming an accepted treatment of renal calculi. Since fluoroscopy is involved to image the stones it is important to know how much radiation the patient receives during this procedure. Surface radiation exposure to the patient was measured in more than 300 fluoroscopic and radiographic procedures using thermoluminescent dosimeters. Initial results showed an average skin exposure of 10.1 rad per procedure for each x-ray unit, comparing favorably with exposure rates for percutaneous nephrostolithotomy and other routine radiological procedures. Factors influencing exposure levels include stone characteristics (location, size and opacity), physician experience and number of shocks required. Suggestions are given that may result in a 50 per cent reduction of radiation exposure

  8. Power and efficiency scaling of diode pumped Cr:LiSAF lasers: 770-1110 nm tuning range and frequency doubling to 387-463 nm.

    Science.gov (United States)

    Demirbas, Umit; Baali, Ilyes

    2015-10-15

    We report significant average power and efficiency scaling of diode-pumped Cr:LiSAF lasers in continuous-wave (cw), cw frequency-doubled, and mode-locked regimes. Four single-emitter broad-area laser diodes around 660 nm were used as the pump source, which provided a total pump power of 7.2 W. To minimize thermal effects, a 20 mm long Cr:LiSAF sample with a relatively low Cr-concentration (0.8%) was used as the gain medium. In cw laser experiments, 2.4 W of output power, a slope efficiency of 50%, and a tuning range covering the 770-1110 nm region were achieved. Intracavity frequency doubling with beta-barium borate (BBO) crystals generated up to 1160 mW of blue power and a record tuning range in the 387-463 nm region. When mode locked with a saturable absorber mirror, the laser produced 195 fs pulses with 580 mW of average power around 820 nm at a 100.3 MHz repetition rate. The optical-to-optical conversion efficiency of the system was 33% in cw, 16% in cw frequency-doubled, and 8% in cw mode-locked regimes.

  9. Effect of a gravitational wave on electromagnetic radiation confined in a cavity

    International Nuclear Information System (INIS)

    Tourrenc, P.

    1978-01-01

    Gravitational radiation is considered within the first-order approximation. A pattern of an electromagnetic cavity is studied: Gravitational waves give rise to a deformation of the planes limiting the cavity. This deformation alters the electromagnetic radiation. Several cases are studied and orders of magnitude are put forward. (author)

  10. The Measurement of Aerosol Optical Properties Using Continuous Wave Cavity Ring-Down Techniques

    Science.gov (United States)

    Strawa, A. W.; Owano, T.; Castaneda, R.; Baer, D. S.; Paldus, B. A.; Gore, Warren J. (Technical Monitor)

    2002-01-01

    Large uncertainties in the effects that aerosols have on climate require improved in-situ measurements of extinction coefficient and single-scattering albedo. This abstract describes the use of continuous wave cavity ring-down (CW-CRD) technology to address this problem. The innovations in this instrument are the use of CW-CRD to measure aerosol extinction coefficient, the simultaneous measurement of scattering coefficient, and small size suitable for a wide range of aircraft applications. Our prototype instrument measures extinction and scattering coefficient at 690 nm and extinction coefficient at 1550 nm. The instrument itself is small (60 x 48 x 15 cm) and relatively insensitive to vibrations. The prototype instrument has been tested in our lab and used in the field. While improvements in performance are needed, the prototype has been shown to make accurate and sensitive measurements of extinction and scattering coefficients. Combining these two parameters, one can obtain the single-scattering albedo and absorption coefficient, both important aerosol properties. The use of two wavelengths also allows us to obtain a quantitative idea of the size of the aerosol through the Angstrom exponent. Minimum sensitivity of the prototype instrument is 1.5 x 10(exp -6)/m (1.5/Mm). Validation of the measurement of extinction coefficient has been accomplished by comparing the measurement of calibration spheres with Mie calculations. This instrument and its successors have potential to help reduce uncertainty currently associated with aerosol optical properties and their spatial and temporal variation. Possible applications include studies of visibility, climate forcing by aerosol, and the validation of aerosol retrieval schemes from satellite data.

  11. Comparative analysis of the effect of the GaAlAs laser irradiation in 780 nm and 660 nm in the hypersensitive dentin

    International Nuclear Information System (INIS)

    Yuan, Sun Chien

    2003-01-01

    This study was to evaluate and compare the effects of the low intensity in laser radiation among GaAlAs 780 nm and GaAlAs 660 nm. The main proposal is to verify if there is any difference of the effects or results in low intensity laser application treatment of hypersensitive dentin, keeping the same parameters, only differing in wavelength. The samples were distributed in two groups. Group A 90 cases, treated with GaAlAs 780 nm and group B irradiated with GaAlAs 660 nm with a total of 76 cases analyzed. The results of application with GaAlAs 660 nm and GaAlAs 780 nm do not differ statistically. Which means using any one of the irradiation gives the same results. However can be noted that the response of reduction of hypersensitivity is faster with the radiation of GaAlAs 780 nm, but the results after three applications is the same for both types of radiation. (author)

  12. Theoretical analysis on radiation and reception characteristics of an oblate spheroidal antenna for electron plasma waves

    International Nuclear Information System (INIS)

    Ohnuki, S.; Adachi, S.; Ohnuma, T.

    1978-01-01

    The radiation and reception characteristics of the oblate spheroidal antenna for electron plasma waves are theoretically investigated. The analysis is carried out as a boundary-value problem. The formulas for the radiation and reception characteristics such as radiation impedance, electron charge distributions, radiated wave potential, directional properties, and receiving voltage of the oblate spheroidal antenna are analytically obtained. As a result, it is concluded that the radiation and reception characteristics of the antennas are not uniquely determined by k/sub p/a (k/sub p/ is the wave number of an electron plasma wave, and a is the radius of the circular-plate antenna), but are determined by two out of three factors, k/sub p/a, zeta (radius divided by Debye length), and ω/ω/sub p/ (angular signal frequency to angular plasma frequency). This conclusion is in marked contrast to the conventional theory in which the charge distribution on the antenna is assumed a priori as uniform and, thus, the antenna characteristics are uniquely determined by k/sub p/a. It is claimed that the experimental results obtained hitherto support the present new theory

  13. Coherent scattering of CO2 light from ion-acoustic waves

    International Nuclear Information System (INIS)

    Peratt, A.L.; Watterson, R.L.; Derfler, H.

    1977-01-01

    Scattering of laser radiation from ion-acoustic waves in a plasma is investigated analytically and experimentally. The formulation predicts a coherent component of the scattered power on a largely incoherent background spectrum when the acoustic analog of Bragg's law and Doppler shift conditions are satisfied. The experiment consists of a hybrid CO 2 laser system capable of either low power continuous wave or high power pulsed mode operation. A heterodyne light mixing scheme is used to detect the scattered power. The proportionality predicted by the theory is verified by scattering from externally excited acoustic and ion-acoustic waves; continuous wave and pulsed modes in each case. Measurement of the ion-acoustic dispersion relation by continuous wave scattering is also presented

  14. Acoustic radiation force on a rigid elliptical cylinder in plane (quasi)standing waves

    International Nuclear Information System (INIS)

    Mitri, F. G.

    2015-01-01

    The acoustic radiation force on a 2D elliptical (non-circular) cylinder centered on the axis of wave propagation of plane quasi-standing and standing waves is derived, based on the partial-wave series expansion (PWSE) method in cylindrical coordinates. A non-dimensional acoustic radiation force function, which is the radiation force per unit length, per characteristic energy density and per unit cross-sectional surface of the ellipse, is defined in terms of the scattering coefficients that are determined by applying the Neumann boundary condition for an immovable surface. A system of linear equations involving a single numerical integration procedure is solved by matrix inversion. Numerical simulations showing the transition from the quasi-standing to the (equi-amplitude) standing wave behaviour are performed with particular emphasis on the aspect ratio a/b, where a and b are the ellipse semi-axes, as well as the dimensionless size parameter kb (where k is the wavenumber), without the restriction to a particular range of frequencies. It is found that at high kb values > 1, the radiation force per length with broadside incidence is larger, whereas the opposite situation occurs in the long-wavelength limit (i.e., kb < 1). The results are particularly relevant in acoustic levitation of elliptical cylinders, the acoustic stabilization of liquid columns in a host medium, acousto-fluidics devices, and other particle dynamics applications to name a few. Moreover, the formalism presented here may be effectively applied to compute the acoustic radiation force on other 2D surfaces of arbitrary shape such as super-ellipses, Chebyshev cylindrical particles, or other non-circular geometries

  15. Acoustic radiation force on a rigid elliptical cylinder in plane (quasi)standing waves

    Energy Technology Data Exchange (ETDEWEB)

    Mitri, F. G., E-mail: F.G.Mitri@ieee.org [Chevron, Area 52 Technology–ETC, Santa Fe, New Mexico 87508 (United States)

    2015-12-07

    The acoustic radiation force on a 2D elliptical (non-circular) cylinder centered on the axis of wave propagation of plane quasi-standing and standing waves is derived, based on the partial-wave series expansion (PWSE) method in cylindrical coordinates. A non-dimensional acoustic radiation force function, which is the radiation force per unit length, per characteristic energy density and per unit cross-sectional surface of the ellipse, is defined in terms of the scattering coefficients that are determined by applying the Neumann boundary condition for an immovable surface. A system of linear equations involving a single numerical integration procedure is solved by matrix inversion. Numerical simulations showing the transition from the quasi-standing to the (equi-amplitude) standing wave behaviour are performed with particular emphasis on the aspect ratio a/b, where a and b are the ellipse semi-axes, as well as the dimensionless size parameter kb (where k is the wavenumber), without the restriction to a particular range of frequencies. It is found that at high kb values > 1, the radiation force per length with broadside incidence is larger, whereas the opposite situation occurs in the long-wavelength limit (i.e., kb < 1). The results are particularly relevant in acoustic levitation of elliptical cylinders, the acoustic stabilization of liquid columns in a host medium, acousto-fluidics devices, and other particle dynamics applications to name a few. Moreover, the formalism presented here may be effectively applied to compute the acoustic radiation force on other 2D surfaces of arbitrary shape such as super-ellipses, Chebyshev cylindrical particles, or other non-circular geometries.

  16. Continuous-wave optically pumped green perovskite vertical-cavity surface-emitter

    KAUST Repository

    Alias, Mohd Sharizal; Liu, Zhixiong; Alatawi, Abdullah; Ng, Tien Khee; Wu, Tao; Ooi, Boon S.

    2017-01-01

    We report an optically pumped green perovskite vertical-cavity surface-emitter operating in continuous-wave (CW) with a power density threshold of ~89 kW/cm2. The device has an active region of CH3NH3PbBr3 embedded in a dielectric microcavity

  17. Scattering of lower-hybrid waves by drift-wave density fluctuations: solutions of the radiative transfer equation

    International Nuclear Information System (INIS)

    Andrews, P.L.; Perkins, F.W.

    1983-01-01

    The investigation of the scattering of lower-hybrid waves by density fluctuations arising from drift waves in tokamaks is distinguished by the presence in the wave equation of a large, random, derivative-coupling term. The propagation of the lower-hybrid waves is well represented by a radiative transfer equation when the scale size of the density fluctuations is small compared to the overall plasma size. The radiative transfer equation is solved in two limits: first, the forward scattering limit, where the scale size of density fluctuations is large compared to the lower-hybrid perpendicular wavelength, and second, the large-angle scattering limit, where this inequality is reversed. The most important features of these solutions are well represented by analytical formulas derived by simple arguments. Based on conventional estimates for density fluctuations arising from drift waves and a parabolic density profile, the optical depth tau for scattering through a significant angle, is given by tauroughly-equal(2/N 2 /sub parallel/) (#betta#/sub p/i0/#betta#) 2 (m/sub e/c 2 /2T/sub i/)/sup 1/2/ [c/α(Ω/sub i/Ω/sub e/)/sup 1/2/ ], where #betta#/sub p/i0 is the central ion plasma frequency and T/sub i/ denotes the ion temperature near the edge of the plasma. Most of the scattering occurs near the surface. The transmission through the scattering region scales as tau - 1 and the emerging intensity has an angular spectrum proportional to cos theta, where sin theta = k/sub perpendicular/xB/sub p//(k/sub perpendicular/B/sub p/), and B/sub p/ is the poloidal field

  18. Threshold response using modulated continuous wave illumination for multilayer 3D optical data storage

    Science.gov (United States)

    Saini, A.; Christenson, C. W.; Khattab, T. A.; Wang, R.; Twieg, R. J.; Singer, K. D.

    2017-01-01

    In order to achieve a high capacity 3D optical data storage medium, a nonlinear or threshold writing process is necessary to localize data in the axial dimension. To this end, commercial multilayer discs use thermal ablation of metal films or phase change materials to realize such a threshold process. This paper addresses a threshold writing mechanism relevant to recently reported fluorescence-based data storage in dye-doped co-extruded multilayer films. To gain understanding of the essential physics, single layer spun coat films were used so that the data is easily accessible by analytical techniques. Data were written by attenuating the fluorescence using nanosecond-range exposure times from a 488 nm continuous wave laser overlapping with the single photon absorption spectrum. The threshold writing process was studied over a range of exposure times and intensities, and with different fluorescent dyes. It was found that all of the dyes have a common temperature threshold where fluorescence begins to attenuate, and the physical nature of the thermal process was investigated.

  19. Acoustic backscattering and radiation force on a rigid elliptical cylinder in plane progressive waves.

    Science.gov (United States)

    Mitri, F G

    2016-03-01

    This work proposes a formal analytical theory using the partial-wave series expansion (PWSE) method in cylindrical coordinates, to calculate the acoustic backscattering form function as well as the radiation force-per-length on an infinitely long elliptical (non-circular) cylinder in plane progressive waves. The major (or minor) semi-axis of the ellipse coincides with the direction of the incident waves. The scattering coefficients for the rigid elliptical cylinder are determined by imposing the Neumann boundary condition for an immovable surface and solving a resulting system of linear equations by matrix inversion. The present method, which utilizes standard cylindrical (Bessel and Hankel) wave functions, presents an advantage over the solution for the scattering that is ordinarily expressed in a basis of elliptical Mathieu functions (which are generally non-orthogonal). Furthermore, an integral equation showing the direct connection of the radiation force function with the square of the scattering form function in the far-field from the scatterer (applicable for plane waves only), is noted and discussed. An important application of this integral equation is the adequate evaluation of the radiation force function from a bistatic measurement (i.e., in the polar plane) of the far-field scattering from any 2D object of arbitrary shape. Numerical predictions are evaluated for the acoustic backscattering form function and the radiation force function, which is the radiation force per unit length, per characteristic energy density, and per unit cross-sectional surface of the ellipse, with particular emphasis on the aspect ratio a/b, where a and b are the semi-axes, as well as the dimensionless size parameter kb, without the restriction to a particular range of frequencies. The results are particularly relevant in acoustic levitation, acousto-fluidics and particle dynamics applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Performance of a 967 nm CW diode end-pumped Er:GSGG laser at 2.79 μm

    International Nuclear Information System (INIS)

    Wu, Z H; Sun, D L; Wang, S Z; Luo, J Q; Li, X L; Huang, L; Hu, A L; Tang, Y Q; Guo, Q

    2013-01-01

    We demonstrated a 967 nm diode end-pumped Er:GSGG laser operated at 2.794 μm with spectral width 3.6 nm in the continuous wave (CW) mode. A maximum output power of 440 mW is obtained at an incident pumping power of 3.4 W, which corresponds to an optical-to-optical efficiency of 13% and slope efficiency of 13.2%. The results suggest that a short cavity and efficient cooling setup for the crystal help to improve laser performance. (paper)

  1. Comparison of Mg-based multilayers for solar He II radiation at 30.4 nm wavelength

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Jingtao; Zhou Sika; Li Haochuan; Huang Qiushi; Wang Zhanshan; Le Guen, Karine; Hu, Min-Hui; Andre, Jean-Michel; Jonnard, Philippe

    2010-07-10

    Mg-based multilayers, including SiC/Mg, Co/Mg, B4C/Mg, and Si/Mg, are investigated for solar imaging and a He II calibration lamp at a 30.4 nm wavelength. These multilayers were fabricated by a magnetron sputtering method and characterized by x-ray reflection. The reflectivities of these multilayers were measured by synchrotron radiation. Near-normal-incidence reflectivities of Co/Mg and SiC/Mg multilayer mirrors are as high as 40.3% and 44.6%, respectively, while those of B4C/Mg and Si/Mg mirrors are too low for application. The measured results suggest that SiC/Mg, Co/Mg multilayers are promising for a 30.4 nm wavelength.

  2. Wave-Particle Interactions in the Earth's Radiation Belts: Recent Advances and Unprecedented Future Opportunities

    Science.gov (United States)

    Li, W.

    2017-12-01

    In the collisionless heliospheric plasmas, wave-particle interaction is a fundamental physical process in transferring energy and momentum between particles with different species and energies. This presentation focuses on one of the important wave-particle interaction processes: interaction between whistler-mode waves and electrons. Whistler-mode waves have frequencies between proton and electron cyclotron frequency and are ubiquitously present in the heliospheric plasmas including solar wind and planetary magnetospheres. I use Earth's Van Allen radiation belt as "local space laboratory" to discuss the role of whistler-mode waves in energetic electron dynamics using multi-satellite observations, theory and modeling. I further discuss solar wind drivers leading to energetic electron dynamics in the Earth's radiation belts, which is critical in predicting space weather that has broad impacts on our technological systems and society. At last, I discuss the unprecedented future opportunities of exploring space science using multi-satellite observations and state-of-the-art theory and modeling.

  3. Effect of variable doses of ultraviolet radiation (253.7 nm) on thermoluminescence NaCl:Ca(T) material

    International Nuclear Information System (INIS)

    Nehate, A.K.; Joshi, T.R.; Kathuria, S.P.; Joshi, R.V.

    1986-01-01

    This paper studies the thermoluminescence (TL) glow curves of NaCl:Ca(T) phosphors to various doses of 253.7-nm ultraviolet (UV) radiation at room temperature. TLD grade NaCl:Ca(T) material was obtained by crystallization from solution and was subsequently annealed at 750 degrees C for 2 h, followed by sudden quenching. We undertook measurement of the effect of variable UV radiation doses (10(2) to 10(6) J m-2) on the TL behaviour of NaCl:Ca(T) phosphors. It was observed that the phosphor exhibits a dominant peak around 167 degrees C along with a weak peak at lower temperature. The high-temperature peak (Peak II) is found to grow linearly with the increase in UV dose in the range of 10(2) to 10(6) J m-2. Since the nature of the glow curves under the influence of different doses remains more or less identical, it is believed that the phosphor does not undergo radiation damage and displays high intrinsic TL around Peak II. Examination of the system for fundamental dosimetry requirements shows that it can be used in dosimetry work at 253.7 nm

  4. Measurement of tissue-radiation dosage using a thermal steady-state elastic shear wave.

    Science.gov (United States)

    Chang, Sheng-Yi; Hsieh, Tung-Sheng; Chen, Wei-Ru; Chen, Jin-Chung; Chou, Chien

    2017-08-01

    A biodosimeter based on thermal-induced elastic shear wave (TIESW) in silicone acellular porcine dermis (SAPD) at thermal steady state has been proposed and demonstrated. A square slab SAPD treated with ionizing radiation was tested. The SAPD becomes a continuous homogeneous and isotropic viscoelastic medium due to the generation of randomly coiled collagen fibers formed from their bundle-like structure in the dermis. A harmonic TIESW then propagates on the surface of the SAPD as measured by a nanometer-scaled strain-stress response under thermal equilibrium conditions at room temperature. TIESW oscillation frequency was noninvasively measured in real time by monitoring the transverse displacement of the TIESW on the SAPD surface. Because the elastic shear modulus is highly sensitive to absorbed doses of ionizing radiation, this proposed biodosimeter can become a highly sensitive and noninvasive method for quantitatively determining tissue-absorbed dosage in terms of TIESW’s oscillation frequency. Detection sensitivity at 1 cGy and dynamic ranges covering 1 to 40 cGy and 80 to 500 cGy were demonstrated.

  5. Saturable absorber Q- and gain-switched all-Yb3+ all-fiber laser at 976 and 1064 nm.

    Science.gov (United States)

    Tsai, Tzong-Yow; Fang, Yen-Cheng; Huang, Huai-Min; Tsao, Hong-Xi; Lin, Shih-Ting

    2010-11-08

    We demonstrate a novel passively pulsed all-Yb3+ all-fiber laser pumped by a continuous-wave 915-nm pump laser diode. The laser was saturable absorber Q-switched at 976 nm and gain-switched at 1064 nm, using the method of mode-field-area mismatch. With a pump power of 
105 mW, the laser iteratively produced a 976-nm pulse with an energy of 2.8 μJ and a duration of 280 ns, followed by a 1064-nm pulse with 1.1 μJ and a 430-ns duration at a repetition rate of 9 kHz. A set of rate equations was established to simulate the self-balancing mechanism and the correlation between the Q- and gain-switched photon numbers and the populations of the gain and absorber fibers.

  6. Different (direct and indirect) mechanisms for the induction of DNA-protein crosslinks in human cells by far- and near-ultraviolet radiations (290 and 405 nm)

    International Nuclear Information System (INIS)

    Peak, M.J.; Peak, J.G.; Jones, C.A.

    1985-01-01

    Apparent DNA-protein crosslinking induced by monochromatic 290 and 405 nm radiations was measured in cultured human P3 teratocarcinoma cells with DNA alkaline elution techniques. The rates of the induction of crosslinks by 290 nm radiation were the same when the cells were irradiated either aerobically or anaerobically or when the cells were in an H 2 O or D 2 O aqueous environment. With 405 nm radiation, anaerobic irradiation reduced the induction of the crosslinks (dose modifying factor is about 0.2), and about twice as many crosslinks were observed when the cells were irradiated in an environment of D 2 O rather than H 2 O. The results are consistent with the hypothesis that far-UV radiation induces DNA-protein crosslinks by a direct mechanism, whereas near-UV radiation induces crosslinks via indirect photodynamic photosensitizations in which unidentified cellular endogenous photosensitizers and reactive species of oxygen are used. (author)

  7. Interactions of electromagnetic radiations and reactive oxygen species on skin

    International Nuclear Information System (INIS)

    Ferramola de Sancovich, A.M.; Sancovich, H.A. . E- mail: ferramol@qb.fcen.uba.ar

    2006-01-01

    The energy of electromagnetic radiation is derived from the fusion in the sun of four hydrogen nuclei to form a helium nucleus. The sun radiates energy representing the entire electromagnetic spectrum. Light is a form of electromagnetic radiation: all electromagnetic radiation has wave characteristics and travels at the same speed (c: speed of light). But radiations differ in wavelength (λ). Light energy is transmitted not in a continuum stream but only in individual units or photons: E = h c / λ. Short wave light is more energetic than photons of light of longer wavelength. Ultraviolet radiations (UV) (λ s 200- 400 nm) can be classified in UV A (λ s 315 - 400 nm.); UV B (λ s 280 - 315 nm) and UV C (λ s 2 content in biological systems promotes ROS synthesis. If ROS are not controlled by endogenous antioxidants, cell redox status is affected and tissue damage is produced ('oxidative stress'). ROS induce lipid peroxidation, protein cross-linking, enzyme inhibition, loss of integrity and function of plasmatic and mitochondrial membranes conducing to inflammation, aging, carcinogenesis and cell death. While infra-red radiations lead to noticeable tissue temperature conducing to severe burns, UV A and UV B undercover react with skin chromophores producing photochemical alterations involved in cellular aging and cancer induction. As UV radiations can reach cellular nucleus, DNA can be damage. Human beings need protection from the damaging sunbeams. This is a very important concern of public health. While humans need to protect their skin with appropriate clothing and/or by use of skin sun blocks of broad spectrum, some bacteria that are extensively exposed to sunlight have developed genomic evolution (plasmid-encoded DNA repair system) which confers protection from the damaging effect of UV radiation. (author) [es

  8. Forecasting noise and radiation hardness of CMOS front-end electronics beyond the 100 nm frontier

    International Nuclear Information System (INIS)

    Re, V.; Gaioni, L.; Manghisoni, M.; Ratti, L.; Traversi, G.

    2010-01-01

    The progress of industrial microelectronic technologies has already overtaken the 130 nm CMOS generation that is currently the focus of IC designers for new front-end chips in LHC upgrades and other detector applications. In a broader time span, sub-100 nm CMOS processes may become appealing for the design of very compact front-end systems with advanced integrated functionalities. This is especially true in the case of pixel detectors, both for monolithic devices (MAPS) and for hybrid implementations where a high resistivity sensor is connected to a CMOS readout chip. Technologies beyond the 100 nm frontier have peculiar features, such as the evolution of the device gate material to reduce tunneling currents through the thin dielectric. These new physical device parameters may impact on functional properties such as noise and radiation hardness. On the basis of experimental data relevant to commercial devices, this work studies potential advantages and challenges associated to the design of low-noise and rad-hard analog circuits in these aggressively scaled technologies.

  9. Continuous-wave room-temperature diamond maser

    Science.gov (United States)

    Breeze, Jonathan D.; Salvadori, Enrico; Sathian, Juna; Alford, Neil Mcn.; Kay, Christopher W. M.

    2018-03-01

    The maser—the microwave progenitor of the optical laser—has been confined to relative obscurity owing to its reliance on cryogenic refrigeration and high-vacuum systems. Despite this, it has found application in deep-space communications and radio astronomy owing to its unparalleled performance as a low-noise amplifier and oscillator. The recent demonstration of a room-temperature solid-state maser that utilizes polarized electron populations within the triplet states of photo-excited pentacene molecules in a p-terphenyl host paves the way for a new class of maser. However, p-terphenyl has poor thermal and mechanical properties, and the decay rates of the triplet sublevel of pentacene mean that only pulsed maser operation has been observed in this system. Alternative materials are therefore required to achieve continuous emission: inorganic materials that contain spin defects, such as diamond and silicon carbide, have been proposed. Here we report a continuous-wave room-temperature maser oscillator using optically pumped nitrogen–vacancy defect centres in diamond. This demonstration highlights the potential of room-temperature solid-state masers for use in a new generation of microwave devices that could find application in medicine, security, sensing and quantum technologies.

  10. A prospective study of levetiracetam efficacy in epileptic syndromes with continuous spikes-waves during slow sleep

    DEFF Research Database (Denmark)

    Atkins, Mary; Nikanorova, Marina

    2011-01-01

    To evaluate the add-on effect of levetiracetam (LEV) treatment on the EEG and clinical status of children with continuous spikes-waves during slow sleep (CSWS).......To evaluate the add-on effect of levetiracetam (LEV) treatment on the EEG and clinical status of children with continuous spikes-waves during slow sleep (CSWS)....

  11. Generation of a continuous-wave squeezed vacuum state at 1.3 μm by employing a home-made all-solid-state laser as pump source

    International Nuclear Information System (INIS)

    Zheng Yao-Hui; Wu Zhi-Qiang; Huo Mei-Ru; Zhou Hai-Jun

    2013-01-01

    We present a continuous-wave squeezed vacuum generation system at a telecommunication wavelength of 1.3 μm. By employing a home-made single-frequency Nd:YVO 4 laser with dual wavelength outputs as the pump source, via an optical parameter oscillator based on periodically poled KTP, a squeezed vacuum of 6.1 dB±0.1 dB below the shot noise limit at 1342 nm is experimentally measured. This system could be utilized for demonstrating practical quantum information networks. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  12. Factors influencing radiation exposure during the extracorporeal shock wave lithotripsy

    Energy Technology Data Exchange (ETDEWEB)

    Wei Chuan Chen; Ying Huei Lee; Ming Tsun Chen; Jong Khing Huang; Luke S Chang (Division of Urology, Dept. of Surgery, National Yang-Ming Medical College and Veterans General Hospital-Taipei, Taiwan (China))

    1991-01-01

    A prospective evaluation of 89 consecutive sessions of extracorporeal shock wave lithotripsy (ESWL) was undertaken to try and find the best way of minimising the amount of exposure to radiation. Forty-two patients were randomly allocated to undergo ESWL treatment by experienced surgeons (group A), and 47 to undergo the treatment by inexperienced surgeons (group B). The mean calculated entrance radiation exposure was 3.01 rads (group A: 2.64 (0.97) rads, range 1.00-4.48, group B: 3.38 (0.86) rads, range 1.11-5.75). Among factors that influenced radiation exposure, the tissue: air ratio should be borne in mind and the level of skill in controlling movement of gantry was the most important in reducing the exposure to radiation. (au).

  13. Factors influencing radiation exposure during the extracorporeal shock wave lithotripsy

    International Nuclear Information System (INIS)

    Wei Chuan Chen; Ying Huei Lee; Ming Tsun Chen; Jong Khing Huang; Luke S Chang

    1991-01-01

    A prospective evaluation of 89 consecutive sessions of extracorporeal shock wave lithotripsy (ESWL) was undertaken to try and find the best way of minimising the amount of exposure to radiation. Forty-two patients were randomly allocated to undergo ESWL treatment by experienced surgeons (group A), and 47 to undergo the treatment by inexperienced surgeons (group B). The mean calculated entrance radiation exposure was 3.01 rads (group A: 2.64 (0.97) rads, range 1.00-4.48, group B: 3.38 (0.86) rads, range 1.11-5.75). Among factors that influenced radiation exposure, the tissue: air ratio should be borne in mind and the level of skill in controlling movement of gantry was the most important in reducing the exposure to radiation. (au)

  14. Development of Radiation-hard Bandgap Reference and Temperature Sensor in CMOS 130 nm Technology

    CERN Document Server

    Kuczynska, Marika; Bugiel, Szymon; Firlej, Miroslaw; Fiutowski, Tomasz; Idzik, Marek; Michelis, Stefano; Moron, Jakub; Przyborowski, Dominik; Swientek, Krzysztof

    2015-01-01

    A stable reference voltage (or current) source is a standard component of today's microelectronics systems. In particle physics experiments such reference is needed in spite of harsh ionizing radiation conditions, i.e. doses exceeding 100 Mrads and fluences above 1e15 n/cm2. After such radiation load a bandgap reference using standard p-n junction of bipolar transistor does not work properly. Instead of using standard p-n junctions, two enclosed layout transistor (ELTMOS) structures are used to create radiation-hard diodes: the ELT bulk diode and the diode obtained using the ELTMOS as dynamic threshold transistor (DTMOS). In this paper we have described several sub-1V references based on ELTMOS bulk diode and DTMOS based diode, using CMOS 130 nm process. Voltage references the structures with additional PTAT (Proportional To Absolute Temperature) output for temperature measurements were also designed. We present and compare post-layout simulations of the developed bandgap references and temperature sensors, w...

  15. Second-order interference of two independent and tunable single-mode continuous-wave lasers

    International Nuclear Information System (INIS)

    Liu Jianbin; Chen Hui; Zheng Huaibin; Xu Zhuo; Wei Dong; Zhou Yu; Gao Hong; Li Fu-Li

    2016-01-01

    The second-order temporal interference of two independent single-mode continuous-wave lasers is discussed by employing two-photon interference in Feynman’s path integral theory. It is concluded that whether the second-order temporal interference pattern can or cannot be retrieved via two-photon coincidence counting rate is dependent on the resolution time of the detection system and the frequency difference between these two lasers. Two identical and tunable single-mode continuous-wave diode lasers are employed to verify the predictions. These studies are helpful to understand the physics of two-photon interference with photons of different spectra. (paper)

  16. Room temperature continuous wave mid-infrared VCSEL operating at 3.35 μm

    Science.gov (United States)

    Jayaraman, V.; Segal, S.; Lascola, K.; Burgner, C.; Towner, F.; Cazabat, A.; Cole, G. D.; Follman, D.; Heu, P.; Deutsch, C.

    2018-02-01

    Tunable vertical cavity surface emitting lasers (VCSELs) offer a potentially low cost tunable optical source in the 3-5 μm range that will enable commercial spectroscopic sensing of numerous environmentally and industrially important gases including methane, ethane, nitrous oxide, and carbon monoxide. Thus far, achieving room temperature continuous wave (RTCW) VCSEL operation at wavelengths beyond 3 μm has remained an elusive goal. In this paper, we introduce a new device structure that has enabled RTCW VCSEL operation near the methane absorption lines at 3.35 μm. This device structure employs two GaAs/AlGaAs mirrors wafer-bonded to an optically pumped active region comprising compressively strained type-I InGaAsSb quantum wells grown on a GaSb substrate. This substrate is removed in processing, as is one of the GaAs mirror substrates. The VCSEL structure is optically pumped at room temperature with a CW 1550 nm laser through the GaAs substrate, while the emitted 3.3 μm light is captured out of the top of the device. Power and spectrum shape measured as a function of pump power exhibit clear threshold behavior and robust singlemode spectra.

  17. High speed video shooting with continuous-wave laser illumination in laboratory modeling of wind - wave interaction

    Science.gov (United States)

    Kandaurov, Alexander; Troitskaya, Yuliya; Caulliez, Guillemette; Sergeev, Daniil; Vdovin, Maxim

    2014-05-01

    Three examples of usage of high-speed video filming in investigation of wind-wave interaction in laboratory conditions is described. Experiments were carried out at the Wind - wave stratified flume of IAP RAS (length 10 m, cross section of air channel 0.4 x 0.4 m, wind velocity up to 24 m/s) and at the Large Air-Sea Interaction Facility (LASIF) - MIO/Luminy (length 40 m, cross section of air channel 3.2 x 1.6 m, wind velocity up to 10 m/s). A combination of PIV-measurements, optical measurements of water surface form and wave gages were used for detailed investigation of the characteristics of the wind flow over the water surface. The modified PIV-method is based on the use of continuous-wave (CW) laser illumination of the airflow seeded by particles and high-speed video. During the experiments on the Wind - wave stratified flume of IAP RAS Green (532 nm) CW laser with 1.5 Wt output power was used as a source for light sheet. High speed digital camera Videosprint (VS-Fast) was used for taking visualized air flow images with the frame rate 2000 Hz. Velocity air flow field was retrieved by PIV images processing with adaptive cross-correlation method on the curvilinear grid following surface wave profile. The mean wind velocity profiles were retrieved using conditional in phase averaging like in [1]. In the experiments on the LASIF more powerful Argon laser (4 Wt, CW) was used as well as high-speed camera with higher sensitivity and resolution: Optronics Camrecord CR3000x2, frame rate 3571 Hz, frame size 259×1696 px. In both series of experiments spherical 0.02 mm polyamide particles with inertial time 7 ms were used for seeding airflow. New particle seeding system based on utilization of air pressure is capable of injecting 2 g of particles per second for 1.3 - 2.4 s without flow disturbance. Used in LASIF this system provided high particle density on PIV-images. In combination with high-resolution camera it allowed us to obtain momentum fluxes directly from

  18. Radiation exposure to patients during extracorporeal shock wave lithotripsy

    International Nuclear Information System (INIS)

    Marti, J.M.; Robles, J.E.; Arbizu, J.; Castro, F. de; Berian, J.M.; Richter, J.A.

    1992-01-01

    We analyzed the radiological exposure to patients during Extracorporeal Shock Wave Lithotripsy (ESWL) using a second generator lithotriptor. Stone location is accomplished by fluoroscopy and 'quick pics' or snapshots. A prospective study over 55 patients showed a mean exposure of 32.2 R. The introduction of the ALARA criterion reduced it to 16.1 R in the following 145 patients. Mean radiation exposure to patient varies according to treatment difficulty. A mean increase of radiation exposure of 1.6 between low and high difficulty treatment groups was observed. This variation was about 96% when the physician who performed the treatment was considered. (author)

  19. Reception of low-intensity millimeter-wave electromagnetic radiation by the electroreceptors in skates

    International Nuclear Information System (INIS)

    Akoev, G.N.; Avelev, V.D.

    1995-01-01

    Low intensity millimeter-wave electromagnetic radiation of less than 10 mW cm -2 power intensity has a nonthermal effect on the body and it is widely used in medical practice for treatment of various diseases. Nevertheless, the effect of EMR on biological tissues is not understood. The skin and its sensory receptors are considered to be responsible for EMR reception, but this has yet to be confirmed. The present experiments were designed to study the effect of millimeter-wave electromagnetic radiation on the ampullae of Lorenzini in skates, which are very sensitive to weak electrical stimuli at low frequency. (author)

  20. Leaf temperature and transpiration of rice plants in relation to short-wave radiation and wind speed

    International Nuclear Information System (INIS)

    Ito, D.; Haseba, T.

    1984-01-01

    Leaf temperature and transpiration amount of rice plants were measured in a steady environment in a laboratory and in field situations. The plants set in Wagner pots were used. Experiments were carried out at the tillering and booting stages, and on the date of maturity. Measured leaf temperatures and transpiration rates were analyzed in connection with incident short-wave radiation on a leaf and wind speed measured simultaneously.Instantaneous supplying and turning-off of steady artificial light caused cyclic changes in leaf temperature and transpiration. Leaf temperature dropped in feeble illumination compared with the steady temperature in the preceeding dark.On the date of maturity, a rice plant leaf was warmer than the air, even in feeble light. Then, the leaf-air temperature difference and transpiration rate showed approximately linear increases with short-wave radiation intensity. On the same date, an increase in wind speed produced a decrease in leaf-air temperature difference, i.e., leaf temperature dropped, and an increase in transpiration rate. The rates of both changes in leaf temperature and transpiration rate were fairly large in a range of wind speed below about 1m/s.For rice plants growing favorably from the tillering stage through the booting stage, the leaves were considerably cooler than the air, even in an intense light and/or solar radiation. The leaf temperature showed the lowest value at short-wave radiations between 0.15 and 0.20ly/min, at above which the leaf temperature rised with an increase in short-wave radiation until it approached the air temperature. Transpiration rate of rice plants increased rapidly with an increase in short-wave radiation ranging below 0.2 or 0.3ly/min, at above which the increase in transpiration rate slowed.The relationships between leaf temperature and/or transpiration rate and wind speed and/or incident short-wave radiation (solar radiation) which were obtained experimentally, supported the relationships

  1. Electromagnetic radiation by parametric decay of upper hybrid waves in ionospheric modification experiments

    International Nuclear Information System (INIS)

    Leyser, T.B.

    1994-01-01

    A nonlinear dispersion relation for the parametric decay of an electrostatic upper hybrid wave into an ordinary mode electromagnetic wave, propagating parallel to the ambient magnetic field, and an electrostatic low frequency wave, being either a lower hybrid wave or a high harmonic ion Bernstein wave, is derived. The coherent and resonant wave interaction is considered to take place in a weakly magnetized and collisionless Vlasov plasma. The instability growth rate is computed for parameter values typical of ionospheric modification experiments, in which a powerful high frequency electromagnetic pump wave is injected into the ionospheric F-region from ground-based transmitters. The electromagnetic radiation which is excited by the decaying upper hybrid wave is found to be consistent with the prominent and commonly observed downshifted maximum (DM) emission in the spectrum of stimulated electromagnetic emission

  2. Broadband pulsed difference frequency generation laser source centered 3326 nm based on ring fiber lasers

    Science.gov (United States)

    Chen, Guangwei; Li, Wenlei

    2018-03-01

    A broadband pulsed mid-infrared difference frequency generation (DFG) laser source based on MgO-doped congruent LiNbO3 bulk is experimentally demonstrated, which employs a homemade pulsed ytterbium-doped ring fiber laser and a continuous wave erbium-doped ring fiber laser to act as seed sources. The experimental results indicate that the perfect phase match crystal temperature is about 74.5∘C. The maximum spectrum bandwidth of idler is about 60 nm with suitable polarization states of fundamental lights. The central wavelength of idlers varies from 3293 nm to 3333 nm over the crystal temperature ranges of 70.4-76∘C. A jump of central wavelength exists around crystal temperature of 72∘C with variation of about 30 nm. The conversion efficiency of DFG can be tuned with the crystal temperature and polarization states of fundamental lights.

  3. Radiation reaction in a continuous focusing channel

    International Nuclear Information System (INIS)

    Huang, Z.; Chen, P.; Ruth, R.D.

    1995-01-01

    We show that the radiation damping rate of the transverse action of a particle in a straight, continuous focusing system is independent of the particle energy, and that no quantum excitation is induced. This absolute damping effect leads to the existence of a transverse ground state to which the particle inevitably decays and yields the minimum beam emittance that one can ever attain, γε min =ℎ/2mc, limited only by the uncertainty principle. Because of adiabatic invariance, the particle can be accelerated along the focusing channel in its ground state without any radiation energy loss

  4. 49 CFR 40.285 - When is a SAP evaluation required?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section... § 40.285 When is a SAP evaluation required? (a) As an employee, when you have violated DOT drug and... unless you complete the SAP evaluation, referral, and education/treatment process set forth in this...

  5. 30 CFR 285.810 - What must I include in my Safety Management System?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my Safety Management System? 285.810 Section 285.810 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR..., COPs and GAPs Safety Management Systems § 285.810 What must I include in my Safety Management System...

  6. Gold-coated copper cone detector as a new standard detector for F2 laser radiation at 157 nm

    International Nuclear Information System (INIS)

    Kueck, Stefan; Brandt, Friedhelm; Taddeo, Mario

    2005-01-01

    A new standard detector for high-accuracy measurements of F2 laser radiation at 157 nm is presented. This gold-coated copper cone detector permits the measurement of average powers up to 2 W with an uncertainty of ∼1%. To the best of our knowledge, this is the first highly accurate standard detector for F2 laser radiation for this power level. It is fully characterized according to Guide to the Expression of Uncertainty in Measurement of the International Organization for Standardization and is connected to the calibration chain for laser radiation established by the German National Metrology Institute

  7. Effects of ultraviolet laser radiation on Venezuelan equine encephalomyelitis virus

    International Nuclear Information System (INIS)

    Nikogosyan, D.N.; Kapituletz, S.P.; Smirnov, Y.A.

    1991-01-01

    The effects of usual low-intensity continuous (λ = 254 nm,I = 10 W/m 2 ) UV radiation and high-intensity laser nanosecond (λ = 266 nm, τ p = 10 ns, I = 10 9 W/m 2 ) or picosecond (λ = 266 nm, τ p = 23 ps, I = 10 12 W/m 2 ) UV radiation on Venezuelan equine encephalomyelitis virus (a member of the Togaviridae family) were compared. The quantum yields of infectivity inactivation, pyrimidine dimer formation and RNA-protein crosslinking were determined. (author)

  8. 30 CFR 285.231 - How will MMS process my unsolicited request for a noncompetitive lease?

    Science.gov (United States)

    2010-07-01

    ... a noncompetitive lease? 285.231 Section 285.231 Mineral Resources MINERALS MANAGEMENT SERVICE... described in §§ 285.640 through 285.648. (e) The MMS will coordinate and consult with affected Federal.... (1) Within 10 business days after you receive the lease copies you must: (i) Execute the lease; (ii...

  9. Radiating sterilization of the venom of snake

    International Nuclear Information System (INIS)

    Abiyev, H.A.; Topchiyeva, Sh.A.; Rustamov, V.R.

    2006-01-01

    Full text: Water solutions of venoms are unstable and they lose toxicity in some day. Snake venoms inactivate under action of some physical factors: the UV-irradiation, x-rays beams. The purpose of the present work was sterilization of venom Vipera lebetina obtusa under influence of small dozes γ-radiations. Object of research was integral venom of adult individuals. Transcaucasian viper, and also the water solutions of venom irradiated with small dozes scale of radiation. An irradiation of venom carried out to radioisotope installation 60NI. For experiment tests of dry venom, and also their water solutions have been taken. Water solutions of venom have been subjected -radiation up to dozes 1.35, 2.7, 4.05, 5.4 kGr simultaneously dry venom of vipers was exposed -radiation before absorption of a doze 5.4 kGr. In comparative aspect action scale of radiation on ultra-violet spectra of absorption of venom was studied. Ultra-violet spectra venom have been taken off on device Specord UV-VIS. In 12 months after an irradiation spectra of absorption of venom have been repeatedly taken off. In spectra irradiated dry and solutions of venom new maxima of absorption have been revealed in the field of 285 nm and 800 nm describing change of toxicity. It is shown, that the increase in absorption of a doze of radiation occurs decrease of intensity of strips of absorption reduction of intensity of absorption.It is revealed at 260 and 300 nm testifying to course of biochemical reactions of separate enzymes zootoxins. It is necessary to note, that at comparison of intensity of absorption of control samples of poison with irradiated up to dozes 1.35 kGr it has not been revealed essential changes. The subsequent increase in a doze scale of radiation up to 2.7, 4.05, 5.4 kGr promotes proportional reduction of intensity of the absorption, describing toxicity of snake venom. At repeated (later 12 months) measurement of the irradiated water solutions of venom are not revealed changes in

  10. Generation of ultrasound in materials using continuous-wave lasers.

    Science.gov (United States)

    Caron, James N; DiComo, Gregory P; Nikitin, Sergei

    2012-03-01

    Generating and detecting ultrasound is a standard method of nondestructive evaluation of materials. Pulsed lasers are used to generate ultrasound remotely in situations that prohibit the use of contact transducers. The scanning rate is limited by the repetition rates of the pulsed lasers, ranging between 10 and 100 Hz for lasers with sufficient pulse widths and energies. Alternately, a high-power continuous-wave laser can be scanned across the surface, creating an ultrasonic wavefront. Since generation is continuous, the scanning rate can be as much as 4 orders of magnitude higher than with pulsed lasers. This paper introduces the concept, comparing the theoretical scanning speed with generation by pulsed laser. © 2012 Optical Society of America

  11. Generation of phase-locked and tunable continuous-wave radiation in the terahertz regime.

    Science.gov (United States)

    Quraishi, Qudsia; Griebel, Martin; Kleine-Ostmann, Thomas; Bratschitsch, Rudolf

    2005-12-01

    Broadly tunable phase-stable single-frequency terahertz radiation is generated with an optical heterodyne photomixer. The photomixer is excited by two near-infrared CW diode lasers that are phase locked to the stabilized optical frequency comb of a femtosecond titanium:sapphire laser. The terahertz radiation emitted by the photomixer is downconverted into RF frequencies with a waveguide harmonic mixer and measurement-limited linewidths at the Hertz level are demonstrated.

  12. Commissioning status of the Continuous Wave Deuterium Demonstrator

    International Nuclear Information System (INIS)

    Hartog, P.D.; Dooling, J.; Lorello, M.; Rathke, J.; Carwardine, J.; Godden, D.; Pile, G.; Yule, T.; Zinneman, T.

    1993-01-01

    Grumman Aerospace Corporation, Argonne National Laboratory, and Culham Laboratory are commissioning the Continuous Wave Deuterium Demonstrator (CWDD) in a facility at Argonne National Laboratory. CWDD is a high-brightness, high-current, 7.5-MeV negative deuterium accelerator. The 352-MHz rf accelerating cavities are cryogenically cooled with supercritical neon to reduce the rf power requirements. Installation of the accelerator into the Argonne facility began in May 1991, and first beam from the injector was extracted in February 1992. The accelerator and facility and described, and current status and future plans are discussed

  13. Subphotospheric fluctuations in magnetized radiative envelopes: contribution from unstable magnetosonic waves

    Science.gov (United States)

    Sen, Koushik; Fernández, Rodrigo; Socrates, Aristotle

    2018-06-01

    We examine the excitation of unstable magnetosonic waves in the radiative envelopes of intermediate- and high-mass stars with a magnetic field of ˜kG strength. Wind clumping close to the star and microturbulence can often be accounted for when including small-scale, subphotospheric density or velocity perturbations. Compressional waves - with wavelengths comparable to or shorter than the gas pressure scale height - can be destabilized by the radiative flux in optically thick media when a magnetic field is present, in a process called the radiation-driven magneto-acoustic instability (RMI). The instability does not require radiation or magnetic pressure to dominate over gas pressure, and acts independently of subsurface convection zones. Here we evaluate the conditions for the RMI to operate on a grid of stellar models covering a mass range 3-40 M⊙ at solar metallicity. For a uniform 1 kG magnetic field, fast magnetosonic modes are unstable down to an optical depth of a few tens, while unstable slow modes extend beyond the depth of the iron convection zone. The qualitative behaviour is robust to magnetic field strength variations by a factor of a few. When combining our findings with previous results for the saturation amplitude of the RMI, we predict velocity fluctuations in the range ˜0.1-10 km s-1. These amplitudes are a monotonically increasing function of the ratio of radiation to gas pressure, or alternatively, of the zero-age main sequence mass.

  14. A large area transition radiation detector for the NOMAD experiment

    Science.gov (United States)

    Bassompierre, G.; Bermond, M.; Berthet, M.; Bertozzi, T.; Détraz, C.; Dubois, J.-M.; Dumps, L.; Engster, C.; Fazio, T.; Gaillard, G.; Gaillard, J.-M.; Gouanère, M.; Manola-Poggioli, E.; Mossuz, L.; Mendiburu, J.-P.; Nédélec, P.; Palazzini, E.; Pessard, H.; Petit, P.; Petitpas, P.; Placci, A.; Sillou, D.; Sottile, R.; Valuev, V.; Verkindt, D.; Vey, H.; Wachnik, M.

    1998-02-01

    A transition radiation detector to identify electrons at 90% efficiency with a rejection factor against pions of 10 3 on an area of 2.85 × 2.85 m 2 has been constructed for the NOMAD experiment. Each of its 9 modules includes a 315 plastic foil radiator and a detector plane of 176 vertical straw tubes filled with a xenon-methane gas mixture. Details of the design, construction and operation of the detector are given.

  15. A large area transition radiation detector for the NOMAD experiment

    CERN Document Server

    Bassompierre, Gabriel; Berthet, M; Bertozzi, T; Détraz, C; Dubois, J M; Dumps, Ludwig; Engster, Claude; Fazio, T; Gaillard, G; Gaillard, Jean-Marc; Gouanère, M; Manola-Poggioli, E; Mossuz, L; Mendiburu, J P; Nédélec, P; Palazzini, E; Pessard, H; Petit, P; Petitpas, P; Placci, Alfredo; Sillou, D; Sottile, R; Valuev, V Yu; Verkindt, D; Vey, H; Wachnik, M

    1997-01-01

    A transition radiation detector to identify electrons at 90% efficiency with a rejection factor against pions of 10 3 on an area of 2.85 × 2.85 m 2 has been constructed for the NOMAD experiment. Each of its 9 modules includes a 315 plastic foil radiator and a detector plane of 176 vertical straw tubes filled with a xenon-methane gas mixture. Details of the design, construction and operation of the detector are given.

  16. A quasi-three-level dual-wavelength thin-disk laser at 1024 and 1030 nm based on a diode-pumped Yb:YAG crystal

    International Nuclear Information System (INIS)

    Sun, G C; Li, Y D; Zhao, M; Chen, X Y; Wang, J B; Chen, G B

    2013-01-01

    A diode-end-pumped Yb:YAG dual-wavelength continuous-wave (cw) laser that generates simultaneous laser action at wavelengths of 1024 and 1030 nm is demonstrated for the first time. A total output power of 897 mW for the dual-wavelength was achieved at an incident pump power of 17.8 W. Furthermore, intracavity sum-frequency mixing at 1024 and 1030 nm was then realized in an LBO crystal to reach the green range. We obtained a total cw output power of 85 mW at 513.5 nm. (paper)

  17. Gravitational waves — A review on the theoretical foundations of gravitational radiation

    Science.gov (United States)

    Dirkes, Alain

    2018-05-01

    In this paper, we review the theoretical foundations of gravitational waves in the framework of Albert Einstein’s theory of general relativity. Following Einstein’s early efforts, we first derive the linearized Einstein field equations and work out the corresponding gravitational wave equation. Moreover, we present the gravitational potentials in the far away wave zone field point approximation obtained from the relaxed Einstein field equations. We close this review by taking a closer look on the radiative losses of gravitating n-body systems and present some aspects of the current interferometric gravitational waves detectors. Each section has a separate appendix contribution where further computational details are displayed. To conclude, we summarize the main results and present a brief outlook in terms of current ongoing efforts to build a spaced-based gravitational wave observatory.

  18. Design for LTE EOS and opacity experiments using supersonic radiation waves

    Science.gov (United States)

    Tierney, T. E.; Peterson, R. R.; Tierney, H. E.

    2007-11-01

    Opacity and EOS at 100-200 eV are important physical parameters in ICF experiments. We describe an experiment design that uses the supersonic propagation of hohlraum radiation in foams to isochorically heat samples. Laser and Z-pinch experiments frequently use 150 to 220-eV quasi-blackbody emission from hohlraums to drive physics experiments. A foam target encapsulated in a gold-wall cylinder is placed next to the hohlraum. The low density and opacity foam captures some hohlraum emission and generates a supersonically-propagating radiation wave. The material heated by the wave is cooler towards the high-albedo gold wall. Modeling and past measurements show that core regions of the foam have small thermal gradients. We place a small, thin sample (e.g., Al, Si, or Fe) in the thermally-uniform region. X-ray emission of tracers and the sample as well as quasi-continuum x-ray absorption will be measured using time-resolved x-ray spectroscopy. The foam's EOS can be measured to ±5% by blast waves with a well characterized drive. This experiment could use the OMEGA, Z-Beamlet, and/or ZR facilities to explore temperature-dependent conditions.

  19. Infrared metaphysics: the elusive ontology of radiator (part 1)

    NARCIS (Netherlands)

    Leonelli, S.; Chang, H.

    2005-01-01

    Hardly any ontological result of modern science is more firmly established than the fact that infrared radiation differs from light only in wavelength; this is part of the modern conception of the continuous spectrum of electromagnetic radiation reaching from radio waves to gamma radiation. Yet,

  20. Wave like signatures in aerosol optical depth and associated radiative impacts over the central Himalayan region

    Energy Technology Data Exchange (ETDEWEB)

    Shukla, K. K.; Phanikumar, D. V.; Kumar, K.  Niranjan; Reddy, Kishore; Kotamarthi, V. R.; Newsom, Rob K.; Ouarda, Taha B. M. J.

    2015-10-01

    Doppler Lidar and Multi-Filter Rotating Shadowband Radiometer (MFRSR) observations are utilized to show wave like signatures in aerosol optical depth (AOD) during daytime boundary layer evolution over the Himalayan region. Fourier analysis depicted 60–80 min periods dominant during afternoon hours, implying that observed modulations could be plausible reason for the AOD forenoon–afternoon asymmetry which was previously reported. Inclusion of wave amplitude in diurnal variation of aerosol radiative forcing estimates showed ~40% additional warming in the atmosphere relative to mean AOD. The present observations emphasize the importance of wave induced variations in AOD and radiation budget over the site.

  1. Nitrogen capillary plasma as a source of intense monochromatic radiation at 2.88 nm

    Energy Technology Data Exchange (ETDEWEB)

    Vrba, P., E-mail: vrbovmir@fbmi.cvut.cz [Institute of Plasma Physics, Academy of Sciences, Za Slovankou 3, Prague 8 (Czech Republic); Vrbova, M. [Faculty of Biomedical Engineering, CTU in Prague, Sitna 3105, Kladno 2 (Czech Republic); Zakharov, S.V. [EPPRA sas, Villebon/Yvette (France); Zakharov, V.S. [EPPRA sas, Villebon/Yvette (France); KIAM RAS, Moscow (Russian Federation); Jancarek, A.; Nevrkla, M. [Faculty of Nuclear Science and Physical Engineering, CTU in Prague, Brehova 7, Prague 1 (Czech Republic)

    2014-10-15

    Highlights: • Pinching capillary discharge is studied as a source of monochromatic SXR. • Modeling of the laboratory device was performed by RMHD Z* code. • Results of computer and laboratory experiments are presented. - Abstract: Capillary discharge plasma related to our laboratory device is modeled and the results are compared with experimental data. Time dependences of selected plasma quantities (e.g. plasma mass density, electron temperature and density and emission intensities) evaluated by 2D Radiation-Magneto-Hydro-Dynamic code Z* describe plasma evolution. The highest output pulse energy at 2.88 nm wavelength is achieved for nitrogen filling pressure ∼100 Pa. The estimated output energy of monochromatic radiation 5.5 mJ sr{sup −1} (∼10{sup 14} photons sr{sup −1}) corresponds properly to observe experimental value ∼3 × 10{sup 13} photons sr{sup −1}. Ray tracing inspection along the capillary axis proves an influence of radiation self-absorption for the investigated wavelength. The spectra, evaluated using the FLY code, agree to the measured ones.

  2. Demonstration of enhanced continuous-wave operation of blue laser diodes on a semipolar 202¯1¯ GaN substrate using indium-tin-oxide/thin-p-GaN cladding layers.

    Science.gov (United States)

    Mehari, Shlomo; Cohen, Daniel A; Becerra, Daniel L; Nakamura, Shuji; DenBaars, Steven P

    2018-01-22

    The benefits of utilizing transparent conductive oxide on top of a thin p-GaN layer for continuous-wave (CW) operation of blue laser diodes (LDs) were investigated. A very low operating voltage of 5.35 V at 10 kA/cm 2 was obtained for LDs with 250 nm thick p-GaN compared to 7.3 V for LDs with conventional 650 nm thick p-GaN. An improved thermal performance was also observed for the thin p-GaN samples resulting in a 40% increase in peak light output power and a 32% decrease in surface temperature. Finally, a tradeoff was demonstrated between low operating voltage and increased optical modal loss in the indium tin oxide (ITO) with thinner p-GaN. LDs lasing at 445 nm with 150 nm thick p-GaN had an excess modal loss while LDs with an optimal 250 nm thick p-GaN resulted in optical output power of 1.1 W per facet without facet coatings and a wall-plug efficiency of 15%.

  3. Picosecond laser texturization of mc-silicon for photovoltaics: A comparison between 1064 nm, 532 nm and 355 nm radiation wavelengths

    Energy Technology Data Exchange (ETDEWEB)

    Binetti, Simona [Department of Materials Science and Milano-Bicocca Solar Energy Research Center (MIB-SOLAR), University of Milano-Bicocca, Via Cozzi 55, 20125 Milano (Italy); Le Donne, Alessia, E-mail: alessia.ledonne@mater.unimib.it [Department of Materials Science and Milano-Bicocca Solar Energy Research Center (MIB-SOLAR), University of Milano-Bicocca, Via Cozzi 55, 20125 Milano (Italy); Rolfi, Andrea [Department of Materials Science and Milano-Bicocca Solar Energy Research Center (MIB-SOLAR), University of Milano-Bicocca, Via Cozzi 55, 20125 Milano (Italy); Jäggi, Beat; Neuenschwander, Beat [Bern University of Applied Sciences, Engineering and Information Technology, Institute for Applied Laser, Photonics and Surface Technologies ALPS, Pestalozzistrasse 20, CH-3400 Burgdorf (Switzerland); Busto, Chiara [ENI Spa, Via Giacomo Fauser, 4, 28100 Novara (Italy); Frigeri, Cesare [CNR-IMEM Institute, Parco Area Delle Scienze 37/A, Fontanini, 43010 Parma (Italy); Scorticati, Davide; Longoni, Luca; Pellegrino, Sergio [Laserpoint Srl, Via Della Burrona 51, 20090 Vimodrone, Milano (Italy)

    2016-05-15

    Highlights: • Self-organized surface structures were produced by picosecond laser pulses on mc-Si. • Three laser wavelengths were used which effectively reduce Si reflectivity up to 8%. • The subsurface damage induced by the three lasers was studied in detail. • μ-Raman, PL and TEM proved that UV laser provides the lowest subsurface damage. • UV laser induced damage is located above the depletion region of the p–n junction. - Abstract: Self-organized surface structures were produced by picosecond laser pulses on multi-crystalline silicon for photovoltaic applications. Three different laser wavelengths were employed (i.e. 1064 nm, 532 nm and 355 nm) and the resulting morphologies were observed to effectively reduce the reflectivity of the samples after laser irradiation. Besides, a comparative study of the laser induced subsurface damage generated by the three different wavelengths was performed by confocal micro-Raman, photoluminescence and transmission electron microscopy. The results of both the structural and optical characterization showed that the mc-Si texturing performed with the laser at 355 nm provides surface reflectivity between 11% and 8% over the spectral range from 400 nm to 1 μm, while inducing the lowest subsurface damage, located above the depletion region of the p–n junction.

  4. Method for generation of THz frequency radiation and sensing of large amplitude material strain waves in piezoelectric materials

    Science.gov (United States)

    Reed, Evan J.; Armstrong, Michael R.

    2010-09-07

    Strain waves of THz frequencies can coherently generate radiation when they propagate past an interface between materials with different piezoelectric coefficients. Such radiation is of detectable amplitude and contains sufficient information to determine the time-dependence of the strain wave with unprecedented subpicosecond, nearly atomic time and space resolution.

  5. Continuous-wave Optically Pumped Lasing of Hybrid Perovskite VCSEL at Green Wavelength

    KAUST Repository

    Alias, Mohd Sharizal

    2017-05-08

    We demonstrate the lasing of a perovskite vertical-cavity surface-emitting laser at green wavelengths, which operates under continuous-wave optical pumping at room-temperature by embedding hybrid perovskite between dielectric mirrors deposited at low-temperature.

  6. Continuous-wave Optically Pumped Lasing of Hybrid Perovskite VCSEL at Green Wavelength

    KAUST Repository

    Alias, Mohd Sharizal; Liu, Zhixiong; Alatawi, Abdullah; Ng, Tien Khee; Wu, Tao; Ooi, Boon S.

    2017-01-01

    We demonstrate the lasing of a perovskite vertical-cavity surface-emitting laser at green wavelengths, which operates under continuous-wave optical pumping at room-temperature by embedding hybrid perovskite between dielectric mirrors deposited at low-temperature.

  7. A diode-pumped Tm:CaYAlO4 laser at 1851 nm

    Science.gov (United States)

    Lan, Jinglong; Guan, Xiaofeng; Xu, Bin; Moncorgé, Richard; Xu, Huiying; Cai, Zhiping

    2017-07-01

    Laser emission at ~1850 nm is of great interest for neural stimulation applications. In this letter, we report on the diode-pumped continuous-wave (CW) and Q-switched (QS) laser operation of Tm:CaYAlO4 at 1851 nm, for the first time to our knowledge. In the CW regime, a maximum output power up to 0.62 W is obtained with a laser slope efficiency of about 18.0%. Using a Cr:ZnSe saturable absorber, QS laser operation is achieved with a maximum average output power of 0.25 W, the narrowest pulse width of 107 ns and the highest repetition rate of 5.85 kHz. The corresponding pulse peak power and pulse energy are about 388 W and 42.8 µJ, respectively. In this Q-switched mode, wavelength tuning is also realized over about 3 nm by slightly tilting the saturable absorber.

  8. Histologic evaluation of laser lipolysis comparing continuous wave vs pulsed lasers in an in vivo pig model.

    Science.gov (United States)

    Levi, Jessica R; Veerappan, Anna; Chen, Bo; Mirkov, Mirko; Sierra, Ray; Spiegel, Jeffrey H

    2011-01-01

    To evaluate acute and delayed laser effects of subdermal lipolysis and collagen deposition using an in vivo pig model and to compare histologic findings in fatty tissue after continuous wave diode (CW) vs pulsed laser treatment. Three CW lasers (980, 1370, and 1470 nm) and 3 pulsed lasers (1064, 1320, and 1440 nm) were used to treat 4 Göttingen minipigs. Following administration of Klein tumescent solution, a laser cannula was inserted at the top of a 10 × 2.5-cm rectangle and was passed subdermally to create separate laser "tunnels." Temperatures at the surface and at intervals of 4-mm to 20-mm depths were recorded immediately after exposure and were correlated with skin injury. Full-thickness cutaneous biopsy specimens were obtained at 1 day, 1 week, and 1 month after exposure and were stained with hematoxylin-eosin and trichrome stain. Qualitative and semiquantitative histopathologic evaluations were performed with attention to vascular damage, lipolysis, and collagen deposition. Skin surface damage occurred at temperatures exceeding 46°C. Histologic examination at 1 day after exposure showed hemorrhage, fibrous collagen fiber coagulation, and adipocyte damage. Adipocytes surrounded by histiocytes, a marker of lipolysis, were present at 1 week and 1 month after exposure. Collagen deposition in subdermal fatty tissue and in reticular dermis of some specimens was noted at 1 week and had increased at 1 month. Tissue treated with CW laser at 1470 nm demonstrated greater hemorrhage and more histiocytes at damage sites than tissue treated with pulsed laser at 1440 nm. There was a trend toward more collagen deposition with pulsed lasers than with CW lasers, but this was not statistically significant. Histopathologic comparison between results of CW laser at 980 nm vs pulsed laser at 1064 nm showed the same trend. Hemorrhage differences may result from pulse duration variations. A theoretical calculation estimating temperature rise in vessels supported this

  9. All-optoelectronic continuous wave THz imaging for biomedical applications

    International Nuclear Information System (INIS)

    Siebert, Karsten J; Loeffler, Torsten; Quast, Holger; Thomson, Mark; Bauer, Tobias; Leonhardt, Rainer; Czasch, Stephanie; Roskos, Hartmut G

    2002-01-01

    We present an all-optoelectronic THz imaging system for ex vivo biomedical applications based on photomixing of two continuous-wave laser beams using photoconductive antennas. The application of hyperboloidal lenses is discussed. They allow for f-numbers less than 1/2 permitting better focusing and higher spatial resolution compared to off-axis paraboloidal mirrors whose f-numbers for practical reasons must be larger than 1/2. For a specific histological sample, an analysis of image noise is discussed

  10. Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited)

    Energy Technology Data Exchange (ETDEWEB)

    Follett, R. K., E-mail: rfollett@lle.rochester.edu; Delettrez, J. A.; Edgell, D. H.; Henchen, R. J.; Katz, J.; Myatt, J. F.; Froula, D. H. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623 (United States)

    2016-11-15

    Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10{sup 21} cm{sup −3}, which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra to show the improvements in plasma characterization.

  11. A Monolithic Active Pixel Sensor for ionizing radiation using a 180 nm HV-SOI process

    Energy Technology Data Exchange (ETDEWEB)

    Hemperek, Tomasz, E-mail: hemperek@uni-bonn.de; Kishishita, Tetsuichi; Krüger, Hans; Wermes, Norbert

    2015-10-01

    An improved SOI-MAPS (Silicon On Insulator Monolithic Active Pixel Sensor) for ionizing radiation based on thick-film High Voltage SOI technology (HV-SOI) has been developed. Similar to existing Fully Depleted SOI-based (FD-SOI) MAPS, a buried silicon oxide inter-dielectric (BOX) layer is used to separate the CMOS electronics from the handle wafer which is used as a depleted charge collection layer. FD-SOI MAPS suffers from radiation damage such as transistor threshold voltage shifts due to charge traps in the oxide layers and charge states created at the silicon oxide boundaries (back gate effect). The X-FAB 180-nm HV-SOI technology offers an additional isolation by deep non-depleted implant between the BOX layer and the active circuitry which mitigates this problem. Therefore we see in this technology a high potential to implement radiation-tolerant MAPS with fast charge collection property. The design and measurement results from a first prototype are presented including charge collection in neutron irradiated samples.

  12. Generation of surface electromagnetic waves in terahertz spectral range by free-electron laser radiation and their refractive index determination

    International Nuclear Information System (INIS)

    Bogomolov, G.D.; Jeong, Uk Young; Zhizhin, G.N.; Nikitin, A.K.; Zavyalov, V.V.; Kazakevich, G.M.; Lee, Byung Cheol

    2005-01-01

    First experiments for observation of surface electromagnetic waves (SEW) in the terahertz spectral range generated on dense aluminum films covering the optical quality glass plates are presented in this paper. Coherent radiation of the new free-electron laser covering the frequency range from 30 to 100cm -1 was used. The interference technique employing SEW propagation in the part of one shoulder of the asymmetric interferometer was applied. From the interference pattern the real part of SEW's effective refractive index ae ' was determined for the two laser emission wavelengths: at λ=150μm-ae ' =1+5x10 -5 , at λ=110μm-ae ' =1+8x10 -4 . High sensitivity of the interference patterns to overlayers made of Ge and Si with thickness of 100nm was demonstrated as well

  13. Sum-frequency nonlinear Cherenkov radiation generated on the boundary of bulk medium crystal.

    Science.gov (United States)

    Wang, Xiaojing; Cao, Jianjun; Zhao, Xiaohui; Zheng, Yuanlin; Ren, Huaijin; Deng, Xuewei; Chen, Xianfeng

    2015-12-14

    We demonstrated experimentally a method to generate the sum-frequency Nonlinear Cherenkov radiation (NCR) on the boundary of bulk medium by using two synchronized laser beam with wavelength of 1300 nm and 800 nm. It is also an evidence that the polarization wave is always confined to the boundary. Critical conditions of surface sum-frequency NCR under normal and anomalous dispersion condition is discussed.

  14. Study on excitation of vibrational levels of osmium tetroxide molecule by the continuous CO2 laser radiation

    International Nuclear Information System (INIS)

    Kompanets, O.N.; Letokhov, V.S.; Minogin, V.G.

    1975-01-01

    The mechanism of nonlinear infrared absorption in OsO 4 has been studied using a single-frequence continuous-wave CO 2 laser (10.6 μ). Measured are relationships between the OsO 4 absorption coefficient and the laser radiation intensity, the week beam transmission through a cell filled with OsO 4 and the frequency of the intensity modulation of the strong beam which saturates the absorption. It is indicated that the thermal mechanism prevails in OsO 4 bleaching under pressure (>=) 1mm Hg. A strong infrared fluorescence observed and studied at 5.3 and 10.6 μ in the molecular OsO 4 in the field of the high-power CO 2 laser has supplied another proof of the conclusion. The thermal diffusion rate and the coefficient of thermal conductivity for OsO 4 vapours have been determined. It has been revealed that the hot bands represent a significant part in thermal mechanism of the laser radiation absorption by the molecule

  15. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Science.gov (United States)

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your SAP...

  16. Highly directive Fabry-Perot leaky-wave nanoantennas based on optical partially reflective surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Lorente-Crespo, M.; Mateo-Segura, C., E-mail: C.Mateo-Segura@hw.ac.uk [Institute of Sensors, Signals and Systems, Heriot-Watt University, EH14 4AS Edinburgh (United Kingdom)

    2015-05-04

    Nanoantennas enhance the conversion between highly localized electromagnetic fields and far-field radiation. Here, we investigate the response of a nano-patch partially reflective surface backed with a silver mirror to an optical source embedded at the centre of the structure. Using full wave simulations, we demonstrate a two orders of magnitude increased directivity compared to the isotropic radiator, 50% power confinement to a 13.8° width beam and a ±16 nm bandwidth. Our antenna does not rely on plasmonic phenomena thus reducing non-radiative losses and conserving source coherence.

  17. Terminal load response law of coaxial cable to continuous wave electromagnetic irradiation

    International Nuclear Information System (INIS)

    Pan Xiaodong; Wei Guanghui; Li Xinfeng; Lu Xinfu

    2012-01-01

    In order to study the coupling response law of continuous wave electromagnetic irradiation to coaxial cable, the typical RF coaxial cable is selected as the object under test. The equipment or subsystem connected by coaxial cable is equivalent to a lumped load. Continuous wave irradiation effect experiments under different conditions are carried out to analyze the terminal load response law of coaxial cable. The results indicate that the coaxial cable has a frequency selecting characteristic under electromagnetic irradiation, and the terminal load response voltage peak appears at a series of discrete frequency points where the test cable's relative lengths equal to semi-integers. When the coaxial cable is irradiated by continuous wave, the induced sheath current converts to the differential-mode induced voltage between inner conductor and shielding layer through transfer impedance, and the internal resistance of induced voltage source is the characteristic impedance of the coaxial cable. The change in terminal load value has no influence on the response curve. The voltages on the terminal load and the internal resistance of equivalent induced voltage source obey the principle of voltage division. Moreover, when the sheath current on the coaxial cable is in resonance, the distributed induced voltage between adjacent current nodes is in the same polarity, which can be equivalent to a single induced voltage source. The induced voltage source which is adjacent to the terminal load plays the leading role in the irradiation response process. (authors)

  18. Biostimulation effects on wheat seeds (Triticum Aestivum L) caused by low level red laser radiation with λ = 660 nm

    International Nuclear Information System (INIS)

    Hernandez, M.; Michtchenko, A.

    2009-01-01

    The principal objective is to study the biostimulation effects caused by a semiconductor low level laser radiation with ? = 660 nm on wheat seeds (Triticum Aestivum L). Seeds were treated before sowing with this laser light source. An increase in the growth of the stem of 12% with respect to control seeds was registered for seeds radiated by an intensity of 15mW/cm 2 and an irradiation time of 60 seconds. (Author)

  19. Integrated simulation of continuous-scale and discrete-scale radiative transfer in metal foams

    Science.gov (United States)

    Xia, Xin-Lin; Li, Yang; Sun, Chuang; Ai, Qing; Tan, He-Ping

    2018-06-01

    A novel integrated simulation of radiative transfer in metal foams is presented. It integrates the continuous-scale simulation with the direct discrete-scale simulation in a single computational domain. It relies on the coupling of the real discrete-scale foam geometry with the equivalent continuous-scale medium through a specially defined scale-coupled zone. This zone holds continuous but nonhomogeneous volumetric radiative properties. The scale-coupled approach is compared to the traditional continuous-scale approach using volumetric radiative properties in the equivalent participating medium and to the direct discrete-scale approach employing the real 3D foam geometry obtained by computed tomography. All the analyses are based on geometrical optics. The Monte Carlo ray-tracing procedure is used for computations of the absorbed radiative fluxes and the apparent radiative behaviors of metal foams. The results obtained by the three approaches are in tenable agreement. The scale-coupled approach is fully validated in calculating the apparent radiative behaviors of metal foams composed of very absorbing to very reflective struts and that composed of very rough to very smooth struts. This new approach leads to a reduction in computational time by approximately one order of magnitude compared to the direct discrete-scale approach. Meanwhile, it can offer information on the local geometry-dependent feature and at the same time the equivalent feature in an integrated simulation. This new approach is promising to combine the advantages of the continuous-scale approach (rapid calculations) and direct discrete-scale approach (accurate prediction of local radiative quantities).

  20. Development of blue lasers, from second harmonic generation using a Nd:YAG laser emitting at 946 nm

    International Nuclear Information System (INIS)

    Nogueira, Gustavo Bernardes

    2010-01-01

    Blue lasers have attracted much attention for applications such as blue-ray, displays and as pumped source for the Ti:sapphire laser. A Nd:YAG crystal with diffusion bonded end-caps was used together with a pump wavelength of 802,3 nm, detuned from the absorption peak at 808 nm in order to minimize the thermal lens effect by providing for a better temperature distribution inside the crystal. Using different input mirror radii, the best relation between pump waist and laser was achieved in a linear cavity and resulted in 6.75W cw (continuous wave) laser power at 946 nm and slope efficiency of 48%. In a second step, a second harmonic generation crystal for blue emission at 473 nm was inserted into different types of resonators, and the blue output power at 473 nm was measured as a function of absorbed pump power. (author)

  1. Stochastic generation of continuous wave spectra

    DEFF Research Database (Denmark)

    Trulsen, J.; Dysthe, K. B.; Pécseli, Hans

    1983-01-01

    Wave packets of electromagnetic or Langmuir waves trapped in a well between oscillating reflectors are considered. An equation for the temporal evolution of the probability distribution for the carrier wave number is derived, and solved analytically in terms of moments in the limits of long...

  2. Acoustic radiation force on cylindrical shells in a plane standing wave

    International Nuclear Information System (INIS)

    Mitri, F G

    2005-01-01

    In this paper, the radiation force per length resulting from a plane standing wave incident on an infinitely long cylindrical shell is computed. The cases of elastic and viscoelastic shells immersed in ideal (non-viscous) fluids are considered with particular emphasis on their thickness and the content of their interior hollow spaces. Numerical calculations of the radiation force function Y st are performed. The fluid-loading effect on the radiation force function curves is analysed as well. The results show several features quite different when the interior hollow space is changed from air to water. Moreover, the theory developed here is more general since it includes the results on cylinders

  3. Nonequilibrium radiation behind a strong shock wave in CO{sub 2}-N{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Rond, C. [Universite de Provence - IUSTI, 5 rue Enrico Fermi, Marseille 13013 (France)], E-mail: rond@coria.fr; Boubert, P.; Felio, J.-M.; Chikhaoui, A. [Universite de Provence - IUSTI, 5 rue Enrico Fermi, Marseille 13013 (France)

    2007-11-09

    This work presents experiments reproducing plasma re-entry for one trajectory point of a Martian mission. The typical facility to investigate such hypersonic flow is shock tube; here we used the free-piston shock tube TCM2. Measurements of radiative flux behind the shock wave are realized thanks to time-resolved emission spectroscopy which is calibrated in intensity. As CN violet system is the main radiator in near UV-visible range, we have focused our study on its spectrum. Moreover a physical model, based on a multi-temperature kinetic code and a radiative code, for calculation of non equilibrium radiation behind a shock wave is developed for CO{sub 2}-N{sub 2}-Ar mixtures. Comparisons between experiments and calculations show that standard kinetic models (Park, McKenzie) are inefficient to reproduce our experimental results. Therefore we propose new rate coefficients in particular for the dissociation of CO{sub 2}, showing the way towards a better description of the chemistry of the mixture.

  4. Risks of exposure to ionizing and millimeter-wave radiation from airport whole-body scanners.

    Science.gov (United States)

    Moulder, John E

    2012-06-01

    Considerable public concern has been expressed around the world about the radiation risks posed by the backscatter (ionizing radiation) and millimeter-wave (nonionizing radiation) whole-body scanners that have been deployed at many airports. The backscatter and millimeter-wave scanners currently deployed in the U.S. almost certainly pose negligible radiation risks if used as intended, but their safety is difficult-to-impossible to prove using publicly accessible data. The scanners are widely disliked and often feared, which is a problem made worse by what appears to be a veil of secrecy that covers their specifications and dosimetry. Therefore, for these and future similar technologies to gain wide acceptance, more openness is needed, as is independent review and regulation. Publicly accessible, and preferably peer-reviewed evidence is needed that the deployed units (not just the prototypes) meet widely-accepted safety standards. It is also critical that risk-perception issues be handled more competently.

  5. Radiation of planar electromagnetic waves by a line source in anisotropic metamaterials

    International Nuclear Information System (INIS)

    Cheng Qiang; Jiang Weixiang; Cui Tiejun

    2010-01-01

    We show experimentally that a line source in an anisotropic metamaterial directly radiates planar electromagnetic waves instead of cylindrical waves, when one component of the permeability tensor approaches zero. The impedance of this material can be perfectly matched to that of free space, which can significantly reduce the reflections between the source and the superstrate, as in traditional highly directive antennas based on zero index metamaterials. Such a unique property determines the two-way propagation of electromagnetic waves excited by a line source, instead of all-way propagation. From this feature, a highly directive emission of electromagnetic waves is achieved using the anisotropic metamaterial with arbitrary shape. We have designed and fabricated the anisotropic metamaterial in the microwave region, and observed the generation of plane waves and their highly directive emission. The proposed plane-wave emission is independent of the shape variance of the anisotropic metamaterial, which can be utilized in the design of conformal antennas.

  6. Repair of 313-nm induced lesions and photoprotection in yeast Candida guilliermondii

    International Nuclear Information System (INIS)

    Fraikin, G.Y.; Pospelov, M.E.; Rubin, L.B.

    1977-01-01

    The present communication is concerned with the effects of near-UV radiation (300-380 nm) on yeast Candida guilliermondii. It was found that certain doses of 313 nm irradiation caused inactivation of the yeast which was exhibited in a way different from the lethal action of far-UV radiation. It was also found that the cells inactivated by 313 nm are capable of recovering vitality, if incubated for some time in a non-nutrient medium. The yeast inactivated by far-UV radiation also proved to be capable of recovering, though to a lesser degree. Both 334 nm radiation and non-lethal doses at 313 nm induced the photoprotective effect against far-UV damage. The effect was exhibited if there was a certain time interval (2-4 h) between the exposures to photoprotective light and subsequent far-UV radiation. Within this time interval the extent of photoprotection was dependent on temperature. (author)

  7. Prism-coupled Cherenkov phase-matched terahertz wave generation using a DAST crystal.

    Science.gov (United States)

    Suizu, Koji; Shibuya, Takayuki; Uchida, Hirohisa; Kawase, Kodo

    2010-02-15

    Terahertz (THz) wave generation based on nonlinear frequency conversion is a promising method for realizing a tunable monochromatic high-power THz-wave source. Unfortunately, many nonlinear crystals have strong absorption in the THz frequency region. This limits efficient and widely tunable THz-wave generation. The Cherenkov phase-matching method is one of the most promising techniques for overcoming these problems. Here, we propose a prism-coupled Cherenkov phase-matching (PCC-PM) method, in which a prism with a suitable refractive index at THz frequencies is coupled to a nonlinear crystal. This has the following advantages. Many crystals can be used as THz-wave emitters; the phase-matching condition inside the crystal does not have to be observed; the absorption of the crystal does not prevent efficient generation of radiation; and pump sources with arbitrary wavelengths can be employed. Here we demonstrate PCC-PM THz-wave generation using the organic crystal 4-dimethylamino-N-metyl-4-stilbazolium tosylate (DAST) and a Si prism coupler. We obtain THz-wave radiation with tunability of approximately 0.1 to 10 THz and with no deep absorption features resulting from the absorption spectrum of the crystal. The obtained spectra did not depend on the pump wavelength in the range 1300 to 1450 nm. This simple technique shows promise for generating THz radiation using a wide variety of nonlinear crystals.

  8. Interaction of electromagnetic waves with plasma in the radiation-dominated regime

    International Nuclear Information System (INIS)

    Bulanov, S.V.; Esirkepov, T.Zh.; Koga, J.; Tajima, T.

    2004-01-01

    A study is made of the main regimes of interaction of relativistically strong electromagnetic waves with plasma under conditions in which the radiation from particles plays a dominant role. The discussion is focused on such issues as the generation of short electromagnetic pulses in the interaction of laser light with clusters and highly efficient ion acceleration in a thin plasma slab under the action of the ponderomotive pressure of the wave. An approach is developed for generating superintense electromagnetic pulses by means of up-to-date laser devices

  9. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct the...

  10. Back radiation suppression through a semi-transparent round ground plane for a mm-Wave monopole antenna

    KAUST Repository

    Klionovski, Kirill; Farooqui, Muhammad Fahad; Shamim, Atif

    2017-01-01

    Omnidirectional radiation pattern with minimum backward radiation is highly desirable for millimeter-wave telecommunication antennas. In this work, we propose a round, semitransparent ground plane of radius 0.8λ with uniform impedance distribution that can reduce the back radiation of a monopole antenna by 8.8 dB as compared with a similar sized metallic ground plane. The value of uniform impedance is obtained through analytical optimization by using asymptotic expressions in the Kirchhoff approximation of the radiation pattern of a toroidal wave scattered by a round semitransparent ground plane. The semitransparent ground plane has been realized using a low-cost carbon paste on a Kapton film. Experimental results match closely with those of simulations and validate the overall concept.

  11. Back radiation suppression through a semi-transparent round ground plane for a mm-Wave monopole antenna

    KAUST Repository

    Klionovski, Kirill

    2017-10-25

    Omnidirectional radiation pattern with minimum backward radiation is highly desirable for millimeter-wave telecommunication antennas. In this work, we propose a round, semitransparent ground plane of radius 0.8λ with uniform impedance distribution that can reduce the back radiation of a monopole antenna by 8.8 dB as compared with a similar sized metallic ground plane. The value of uniform impedance is obtained through analytical optimization by using asymptotic expressions in the Kirchhoff approximation of the radiation pattern of a toroidal wave scattered by a round semitransparent ground plane. The semitransparent ground plane has been realized using a low-cost carbon paste on a Kapton film. Experimental results match closely with those of simulations and validate the overall concept.

  12. The Academic Curriculum of Medical Radiation Technologists: Continuous Development

    International Nuclear Information System (INIS)

    Sergieva, K.; Gagova, P.; Bonninska, N.

    2016-01-01

    Full text: The purpose is to present the activities of Department of Radiation technologists at Medical College Sofia in knowledge management (KM) in human health applications and namely: continuous development of academic curriculum (AC) for medical radiation technologists (MRT) in sense of the conference motto “Nuclear Knowledge Management: Challenges and Approaches”. Our challenge is to realize, in practice, the important role of MRT professionals in healthcare. They are the front line in the patient safety and the last person with the patient before exposure. The existing AC has been periodically peer-reviewed: in 2011, 2014, and ongoing reviews, with the aim to guarantee that we are providing knowledge, skills and competencies that meet modern requirements for the training of radiation technologists. The AC compromises both academic and clinical education. The clinical component occurs throughout the academic course, accenting the role of MRT in radiology, radiotherapy and nuclear medicine. The approach of continuously developing the AC will meet the stringent requirements recently published by IAEA, with the goal that radiological medical practitioners, medical physicists, medical radiation technologists and other health professionals with specific duties in relation to protection and safety for patients in a given radiological procedure are specialized in the appropriate area. (author

  13. Radiation hardness evaluation of the commercial 150 nm CMOS process using 60Co source

    International Nuclear Information System (INIS)

    Carna, M; Havranek, M; Hejtmanek, M; Janoska, Z; Marcisovsky, M; Neue, G; Tomasek, L; Vrba, V

    2014-01-01

    We present a study of radiation effects on MOSFET transistors irradiated with a 60 Co source to a total absorbed dose of 1.5 Mrad. The transistor test structures were manufactured using a commercial 150 nm CMOS process and are composed of transistors of different types (NMOS and PMOS), dimensions and insulation from the bulk material by means of deep n-wells. We have observed a degradation of electrical characteristics of both PMOS and NMOS transistors, namely a large increase of the leakage current of the NMOS transistors after irradiation

  14. Watt-Level Continuous-Wave Emission from a Bi-Functional Quantum Cascade Laser/Detector

    Science.gov (United States)

    2017-04-18

    cally authorized by the U.S. Government may violate any copyrights that exist in this work. Watt-level continuous- wave emission from a bi- functional ... wave bi- functional devices, opens the perspective of on-chip dual comb spectroscopy. Also for discrete sens- ing setups, one can switch to lasers...seas.harvard.edu Abstract Bi- functional active regions, capable of light generation and detection at the same wavelength, allow a straightforward realization of

  15. Experimental Measurement of Wave Field Variations around Wave Energy Converter Arrays

    Directory of Open Access Journals (Sweden)

    Louise O’Boyle

    2017-01-01

    Full Text Available Wave energy converters (WECs inherently extract energy from incident waves. For wave energy to become a significant power provider in the future, large farms of WECs will be required. This scale of energy extraction will increase the potential for changes in the local wave field and coastal environment. Assessment of these effects is necessary to inform decisions on the layout of wave farms for optimum power output and minimum environmental impact, as well as on potential site selection. An experimental campaign to map, at high resolution, the wave field variation around arrays of 5 oscillating water column WECs and a methodology for extracting scattered and radiated waves is presented. The results highlight the importance of accounting for the full extent of the WEC behavior when assessing impacts on the wave field. The effect of radiated waves on the wave field is not immediately apparent when considering changes to the entire wave spectrum, nor when observing changes in wave climate due to scattered and radiated waves superimposed together. The results show that radiated waves may account for up to 50% of the effects on wave climate in the near field in particular operating conditions.

  16. The wave properties of matter and the zeropoint radiation field

    International Nuclear Information System (INIS)

    Pena, L. de la; Cetto, A.M.

    1994-01-01

    The origin of the wave properties of matter is discussed from the point of view of stochastic electrodynamics. A nonrelativistic model of a changed particle with an effective structure embedded in the random zeropoint radiation field reveals that the field induces a high-frequency vibration on the particle; internal consistency of the theory fixes the frequency of this jittering at mc 2 /h. The particle is therefore assumed to interact intensely with stationary zeropoint waves of this frequency as seen from its proper frame of reference; such waves, identified here as de Broglie's phase waves, give rise to a modulated wave in the laboratory frame, with de Broglie's wavelength and phase velocity equal to the particle velocity. The time-independent equation that describes this modulated wave is shown to be the stationary Schroedinger equation (or the Klein-Gordon equation in the relativistic version). In a heuristic analysis applied to simple periodic cases, the quantization rules are recovered from the assumption that for a particle in a stationary state there must correspond a stationary modulation. Along an independent and complementary line of reasoning, an equation for the probability amplitude in configuration space for a particle under a general potential V(x) is constructed, and it is shown that under conditions derived from stochastic electrodynamics it reduces to Schroedinger's equation. This equation reflects therefore the dual nature of the quantum particles, by describing simultaneously the corresponding modulated wave and the ensemble of particles

  17. Continuous-wave operation and 10-Gb/s direct modulation of InAsP/InP sub-wavelength nanowire laser on silicon photonic crystal

    Directory of Open Access Journals (Sweden)

    Masato Takiguchi

    2017-04-01

    Full Text Available We demonstrated sub-wavelength (∼111 nm diameter single nanowire (NW continuous wave (CW lasers on silicon photonic crystal in the telecom-band with direct modulation at 10 Gb/s by optical pumping at cryogenic temperatures. To estimate the small signal response and pseudo-random bit sequence (PRBS modulation of our CW lasers, we employed a new signal detection technique that employs a superconducting single photon detector and a time-correlated single photon counting module. The results showed that our NW laser was unambiguously modulated at above 10 Gb/s and an open eye pattern was obtained. This is the first demonstration of a telecom-band CW NW laser with high-speed PRBS modulation.

  18. Proposal of coherent Cherenkov radiation matched to circular plane wave for intense terahertz light source

    International Nuclear Information System (INIS)

    Sei, Norihiro; Sakai, Takeshi; Hayakawa, Ken; Tanaka, Toshinari; Hayakawa, Yasushi; Nakao, Keisuke; Nogami, Kyoko; Inagaki, Manabu

    2015-01-01

    Highlights: • We proposed a new intense terahertz-wave source based on coherent Cherenkov radiation (CCR). • A hollow conical dielectric is used to generate the CCR beam. • The wave front of the CCR beam can be matched to the basal plane. • The peak-power of the CCR beam is above 1 MW per micropulse with a short interval of 350 ps. - Abstract: We propose a high-peak-power terahertz-wave source based on an electron accelerator. By passing an electron beam through a hollow conical dielectric with apex facing the incident electron beam, the wave front of coherent Cherenkov radiation generated on the inner surface of the hollow conical dielectric matches the basal plane. Using the electron beam generated at the Laboratory for Electron Beam Research and Application at Nihon University, the calculated power of coherent Cherenkov radiation that matched the circular plane (CCR-MCP) was above 1 MW per micropulse with a short interval of 350 ps, for wavelengths ranging from 0.5 to 5 mm. The electron beam is not lost for generating the CCR-MCP beam by using the hollow conical dielectric. It is possible to combine the CCR-MCP beams with other light sources based on an accelerator

  19. 30 CFR 285.436 - Can MMS require lease or grant contraction?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Can MMS require lease or grant contraction? 285... Administration Lease Or Grant Contraction § 285.436 Can MMS require lease or grant contraction? At an interval no more frequent than every 5 years, the MMS may review your lease or grant area to determine whether the...

  20. 30 CFR 285.222 - What does MMS do with my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What does MMS do with my bid? 285.222 Section... Energy Leases Competitive Lease Award Process § 285.222 What does MMS do with my bid? (a) If sealed... any proposal submitted will be made by a panel composed of members selected by MMS. The details of the...

  1. One step linear reconstruction method for continuous wave diffuse optical tomography

    Science.gov (United States)

    Ukhrowiyah, N.; Yasin, M.

    2017-09-01

    The method one step linear reconstruction method for continuous wave diffuse optical tomography is proposed and demonstrated for polyvinyl chloride based material and breast phantom. Approximation which used in this method is selecting regulation coefficient and evaluating the difference between two states that corresponding to the data acquired without and with a change in optical properties. This method is used to recovery of optical parameters from measured boundary data of light propagation in the object. The research is demonstrated by simulation and experimental data. Numerical object is used to produce simulation data. Chloride based material and breast phantom sample is used to produce experimental data. Comparisons of results between experiment and simulation data are conducted to validate the proposed method. The results of the reconstruction image which is produced by the one step linear reconstruction method show that the image reconstruction almost same as the original object. This approach provides a means of imaging that is sensitive to changes in optical properties, which may be particularly useful for functional imaging used continuous wave diffuse optical tomography of early diagnosis of breast cancer.

  2. Aerosol Direct Radiative Forcing and Forcing Efficiencies at Surface from the shortwave Irradiance Measurements in Abu Dhabi, UAE

    Science.gov (United States)

    Beegum S, N.; Ben Romdhane, H.; Ghedira, H.

    2013-12-01

    Atmospheric aerosols are known to affect the radiation balance of the Earth-Atmospheric system directly by scattering and absorbing the solar and terrestrial radiation, and indirectly by affecting the lifetime and albedo of the clouds. Continuous and simultaneous measurements of short wave global irradiance in combination with synchronous spectral aerosol optical depth (AOD) measurements (from 340 nm to 1640 nm in 8 channels), for a period of 1 year from June 2012 to May 2013, were used for the determination of the surface direct aerosol radiative forcing and forcing efficiencies under cloud free conditions in Abu Dhabi (24.42°N, 54.61o E, 7m MSL), a coastal location in United Arab Emirates (UAE) in the Arabian Peninsula. The Rotating Shadow band Pyranometer (RSP, LI-COR) was used for the irradiance measurements (in the spectral region 400-1100 nm), whereas the AOD measurements were carried out using CIMEL Sunphotometer (CE 318-2, under AERONET program). The differential method, which is neither sensitive to calibration uncertainties nor model assumptions, has been employed for estimating forcing efficiencies from the changes in the measured fluxes. The forcing efficiency, which quantifies the net change in irradiance per unit change in AOD, is an appropriate parameter for the characterization of the aerosol radiative effects even if the microphysical and optical properties of the aerosols are not completely understood. The corresponding forcing values were estimated from the forcing efficiencies. The estimated radiative forcing and forcing efficiencies exhibited strong monthly variations. The forcing efficiencies (absolute magnitudes) were highest during March, and showed continuous decrease thereafter to reach the lowest value during September. In contrast, the forcing followed a slightly different pattern of variability, with the highest solar dimming during April ( -60 W m-2) and the minimum during February ( -20 W m-2). The results indicate that the aerosol

  3. [The influence of pulsed low-intensity laser radiation of the red (635 nm) and infrared (904 nm) spectra on the human mesenchymal stem cells in vitro].

    Science.gov (United States)

    Moskvin, S V; Kliuchnikov, D Iu; Antipov, E V; Volchkov, S E; Kiseleva, O N

    2014-01-01

    Mesenchymal stem cells (MSC) have for a long time been an object of investigation with a view to elucidating the prospects for their application in clinical medicine and cosmetology. One of the approaches to the non-specific regulation of the activity of these cells at the stage of preliminary in vitro combination is the treatment with low-intensity laser radiation (LILR). The objective of the present study was to evaluate the possibility of using pulsed LILR of the infrared and red spectra for this purpose. We used the 4th passage adhesive MSC cultures based at the umbilical tissue of a donor who gave the informed consent to participate in the study. The source of illumination was a Lazmik-VLOK laser therapeutic apparatus (RU No RZN 2014/1410 dated 06.02.2014) with the matrix laser infrared radiation heads (wavelength 904 nm, light pulse length 108 ns, frequency 1500 Hz). The apparatus was operated either in the multi-frequency Lazmik regime [Moskvin S.V., 2014] with mean power density 0.05 and 0.14 mW/cm2 and the red spectrum (wavelength 635 nm, light pulse length 144 ns, frequency 1500 Hz) or in the multi-frequency Lazmik regime [Moskvin S.V., 2014] with mean power density 0.03 and 0.12. The exposition was 5 min in both regimes. The study has demonstrated that neither the morphological structure nor the viability of mesenchymal stem cells changed under the influence of energy and time parameters used in experiments. The number of cells was shown to slightly increase in comparison with control. The most pronounced effect was documented after illumination with pulse infrared (904 nm) LILR in the multi-frequency Lazmik regime. The maximum effect was observed during a period between days 1 and 3 of cultivation.

  4. Systematic analysis of DNA damage induction and DNA repair pathway activation by continuous wave visible light laser micro-irradiation

    Directory of Open Access Journals (Sweden)

    Britta Muster

    2017-02-01

    Full Text Available Laser micro-irradiation can be used to induce DNA damage with high spatial and temporal resolution, representing a powerful tool to analyze DNA repair in vivo in the context of chromatin. However, most lasers induce a mixture of DNA damage leading to the activation of multiple DNA repair pathways and making it impossible to study individual repair processes. Hence, we aimed to establish and validate micro-irradiation conditions together with inhibition of several key proteins to discriminate different types of DNA damage and repair pathways using lasers commonly available in confocal microscopes. Using time-lapse analysis of cells expressing fluorescently tagged repair proteins and also validation of the DNA damage generated by micro-irradiation using several key damage markers, we show that irradiation with a 405 nm continuous wave laser lead to the activation of all repair pathways even in the absence of exogenous sensitization. In contrast, we found that irradiation with 488 nm laser lead to the selective activation of non-processive short-patch base excision and single strand break repair, which were further validated by PARP inhibition and metoxyamine treatment. We conclude that these low energy conditions discriminated against processive long-patch base excision repair, nucleotide excision repair as well as double strand break repair pathways.

  5. 7.5 W blue light generation at 452 nm by internal frequency doubling of a continuous-wave Nd-doped fiber laser.

    Science.gov (United States)

    Leconte, Baptiste; Gilles, Hervé; Robin, Thierry; Cadier, Benoit; Laroche, Mathieu

    2018-04-16

    We present the first frequency-doubled neodymium-doped fiber laser generating multi-watt CW power near 450 nm. A bow-tie resonator incorporating a LBO nonlinear crystal is integrated within a Nd-doped fiber laser emitting near 900 nm. This scheme achieves an IR to blue conversion efficiency close to 55% without any active control of the internal resonant cavity. As a result, up to 7.5 W of linearly-polarized blue power is generated, with beam quality factors M x 2 ~1.0 and M y 2 ~1.5. A simple numerical model has been developed to optimize and analyse the IR to blue conversion efficiency in the resonant cavity. Performance limitations and prospects for further improvements are discussed.

  6. Experimental determination of radiated internal wave power without pressure field data

    Science.gov (United States)

    Lee, Frank M.; Paoletti, M. S.; Swinney, Harry L.; Morrison, P. J.

    2014-04-01

    We present a method to determine, using only velocity field data, the time-averaged energy flux left and total radiated power P for two-dimensional internal gravity waves. Both left and P are determined from expressions involving only a scalar function, the stream function ψ. We test the method using data from a direct numerical simulation for tidal flow of a stratified fluid past a knife edge. The results for the radiated internal wave power given by the stream function method agree to within 0.5% with results obtained using pressure and velocity data from the numerical simulation. The results for the radiated power computed from the stream function agree well with power computed from the velocity and pressure if the starting point for the stream function computation is on a solid boundary, but if a boundary point is not available, care must be taken to choose an appropriate starting point. We also test the stream function method by applying it to laboratory data for tidal flow past a knife edge, and the results are found to agree with the direct numerical simulation. The supplementary material includes a Matlab code with a graphical user interface that can be used to compute the energy flux and power from two-dimensional velocity field data.

  7. Experimental determination of radiated internal wave power without pressure field data

    International Nuclear Information System (INIS)

    Lee, Frank M.; Morrison, P. J.; Paoletti, M. S.; Swinney, Harry L.

    2014-01-01

    We present a method to determine, using only velocity field data, the time-averaged energy flux (J) and total radiated power P for two-dimensional internal gravity waves. Both (J) and P are determined from expressions involving only a scalar function, the stream function ψ. We test the method using data from a direct numerical simulation for tidal flow of a stratified fluid past a knife edge. The results for the radiated internal wave power given by the stream function method agree to within 0.5% with results obtained using pressure and velocity data from the numerical simulation. The results for the radiated power computed from the stream function agree well with power computed from the velocity and pressure if the starting point for the stream function computation is on a solid boundary, but if a boundary point is not available, care must be taken to choose an appropriate starting point. We also test the stream function method by applying it to laboratory data for tidal flow past a knife edge, and the results are found to agree with the direct numerical simulation. The supplementary material includes a Matlab code with a graphical user interface that can be used to compute the energy flux and power from two-dimensional velocity field data

  8. Plasma scattering measurement using a submillimeter wave gyrotron as a radiation source

    International Nuclear Information System (INIS)

    Ogawa, I.; Idehara, T.; Itakura, Y.; Myodo, M.; Hori, T.; Hatae, T.

    2004-01-01

    Plasma scattering measurement is an effective technique to observe low frequency density fluctuations excited in plasma. The spatial and wave number resolutions and the S/N ratio of measurement depend on the wavelength range, the size and the intensity of a probe beam. A well-collimated, submillimeter wave beam is suitable for improving the spatial and wave number resolutions. Application of high frequency gyrotron is effective in improving the S/N ratio of the measurement because of its capacity to deliver high power. Unlike the molecular vapor lasers, the gyrotrons generate diverging beam of radiation with TE mn mode structure. It is therefore necessary to convert the output radiation into a Gaussian beam. A quasi-optical antenna is a suitable element for the conversion system under consideration since it is applicable to several TE 0n and TE 1n modes. In order to apply the gyrotron to plasma scattering measurement, we have stabilized the output (P = 110 W, f = 354 GHz) of gyrotron up to the level (ΔP/P < 1 %, Δf< 10 kHz). The gyrotron output can be stabilized by decreasing the fluctuation of the cathode potential. (authors)

  9. Enhancement of terahertz radiation in a Smith-Purcell backward-wave oscillator by an inverse wet-etched grating

    International Nuclear Information System (INIS)

    Kim, Jung-Il; Jeon, Seok-Gy; Kim, Geun-Ju; Kim, Jaehong

    2011-01-01

    A terahertz (THz) Smith-Purcell (SP) backward-wave oscillator with an inverse wet-etched grating based on silicon has been proposed to enhance radiation intensity. This grating strengthens the interactions between an electron beam and the evanescent wave due to the adjacent surface structure between gratings that improves the magnitude of the electric field up to 1.7 times compared to the conventional rectangular gratings. A two-dimensional particle-in-cell (PIC) simulation shows that the radiated power is increased up to 2.3 times higher at the radiated frequency of 0.66 THz for an electron-beam energy of 30 keV.

  10. 30 CFR 285.610 - What must I include in my SAP?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results of...

  11. 30 CFR 285.224 - What happens if MMS accepts my bid?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What happens if MMS accepts my bid? 285.224... Renewable Energy Leases Competitive Lease Award Process § 285.224 What happens if MMS accepts my bid? If we... withdraw an OCS area in which we have held a lease sale before you and MMS execute the lease in that area...

  12. Traveling-wave solutions in continuous chains of unidirectionally coupled oscillators

    Science.gov (United States)

    Glyzin, S. D.; Kolesov, A. Yu; Rozov, N. Kh

    2017-12-01

    Proposed is a mathematical model of a continuous annular chain of unidirectionally coupled generators given by certain nonlinear advection-type hyperbolic boundary value problem. Such problems are constructed by a limit transition from annular chains of unidirectionally coupled ordinary differential equations with an unbounded increase in the number of links. It is shown that any preassigned finite number of stable periodic motions of the traveling-wave type can coexist in the model.

  13. Application of continuous-wave terahertz computed tomography for the analysis of chicken bone structure

    Science.gov (United States)

    Li, Bin; Wang, Dayong; Rong, Lu; Zhai, Changchao; Wang, Yunxin; Zhao, Jie

    2018-02-01

    Terahertz (THz) radiation is able to penetrate many different types of nonpolar and nonmetallic materials without the damaging effects of x-rays. THz technology can be combined with computed tomography (CT) to form THz CT, which is an effective imaging method that is used to visualize the internal structure of a three-dimensional sample as cross-sectional images. Here, we reported an application of THz as the radiation source in CT imaging by replacing the x-rays. In this method, the sample cross section is scanned in all translation and rotation directions. Then, the projection data are reconstructed using a tomographic reconstruction algorithm. Two-dimensional (2-D) cross-sectional images of the chicken ulna were obtained through the continuous-wave (CW) THz CT system. Given by the difference of the THz absorption of different substances, the compact bone and spongy bone inside the chicken ulna are structurally distinguishable in the 2-D cross-sectional images. Using the filtered back projection algorithm, we reconstructed the projection data of the chicken ulna at different projection angle intervals and found that the artifacts and noise in the images are strikingly increased when the projection angle intervals become larger, reflected by the blurred boundary of the compact bone. The quality and fidelity of the 2-D cross-sectional images could be substantially improved by reducing the projection angle intervals. Our experimental data demonstrated a feasible application of the CW THz CT system in biological imaging.

  14. Bound states embedded into continuous spectrum as 'gathered' (compactified) scattering waves

    International Nuclear Information System (INIS)

    Zakhar'ev, B.N.; Chabanov, V.M.

    1995-01-01

    It is shown that states of continuous spectrum (the half-line case) can be considered as bound states normalized by unity but distributed on the infinite interval with vanishing density. Then the algorithms of shifting the range of primary localization of a chosen bound state in potential well of finite width appear to be applicable to scattering functions. The potential perturbations of the same type (but now on half-axis) concentrate the scattering wave in near vicinity of the origin, which leads to creation of bound state embedded into continuous spectrum. (author). 8 refs., 7 figs

  15. Supersonic Ionization Wave Driven by Radiation Transport in a Short-Pulse Laser-Produced Plasma

    International Nuclear Information System (INIS)

    Ditmire, T.; Gumbrell, E.T.; Smith, R.A.; Mountford, L.; Hutchinson, M.H.

    1996-01-01

    Through the use of an ultrashort (2ps) optical probe, we have time resolved the propagation of an ionization wave into solid fused silica. This ionization wave results when a plasma is created by the intense irradiation of a solid target with a 2ps laser pulse. We find that the velocity of the ionization wave is consistent with radiation driven thermal transport, exceeding the velocity expected from simple electron thermal conduction by nearly an order of magnitude. copyright 1996 The American Physical Society

  16. Depth-of-field effects in wiggler radiation sources: Geometrical versus wave optics

    Directory of Open Access Journals (Sweden)

    Richard P. Walker

    2017-02-01

    Full Text Available A detailed analysis is carried out of the optical properties of synchrotron radiation emitted by multipole wigglers, concentrating on the effective source size and brightness and the so-called “depth of field” effects, concerning which there has been some controversy in the literature. By comparing calculations made with both geometrical optics and wave optics methods we demonstrate that the two approaches are not at variance, and that the wave optics results tend towards those of geometrical optics under well-defined conditions.

  17. Prospective study of the 532 nm laser (KTP) versus diode laser 980 nm in the resection of hyperplastic lesions of the oral cavity

    Science.gov (United States)

    Bargiela-Pérez, Patricia; González-Merchán, Jorge; Díaz-Sánchez, Rosa; Serrera-Figallo, Maria-Angeles; Volland, Gerd; Joergens, Martin; Gutiérrez-Pérez, Jose-Luis

    2018-01-01

    Background The aim of this study is to evaluate the resection of hyperplastic lesions on the buccal mucosa comparing the 532nm laser (KTP), versus diode 980nm laser, considering pain, scarring, inflammation and drug consumption that occurred postoperatively with each lasers. Material and Methods A prospective study of consecutive series of 20 patients in two groups that presents hyperplastic lesions on the buccal mucosa. The choice of the KTP laser or diode 980nm laser for the surgery was made randomly. The power used was 1.5W in both groups in a continuous wave mode with a 320 μm optical fiber. Parameters of pain, scarring, inflammation and consumption of drugs were recorded by a Numerical Rating Scale and evaluated postoperatively. These recordings were made the day of the surgery, 24 hours after, 14 and 28 days after. Results Pain and inflammation was light - moderate. The consumption of paracetamol was somewhat higher in the diode 980nm laser versus the KTP laser after 24 hours, although data was not statistically significant; significant differences were found after 28 days in regards to pain (p = 0.023) and inflammation (p = 0.023), but always in the absence parameter so we find no pain in both lasers. Scarring in the two types of laser showed no differences along the visits, with not detected scar retractable. Conclusions Although there is a slight histological difference regarding the KTP laser in the oral soft tissues for clinical use, both wavelengths are very suitable for excision of oral fibroma. Key words:Laser surgery, Laser therapy, oral surgery, soft tissue, 980 nm diode laser, 532 nm KTP laser. PMID:29274158

  18. Nanoshell-mediated targeted photothermal therapy of HER2 human breast cancer cells using pulsed and continuous wave lasers: an in vitro study.

    Science.gov (United States)

    Khosroshahi, Mohammad E; Hassannejad, Zahra; Firouzi, Masoumeh; Arshi, Ahmad R

    2015-09-01

    In this study, we report the apoptosis induction in HER2 overexpressed breast cancer cells using pulsed, continuous wave lasers and polyvinylpyrrolidone (PVP)-stabilized magneto-plasmonic nanoshells (PVP-MPNS) delivered by immunoliposomes. The immunoliposomes containing PVP-MPNS were fabricated and characterized. Heating efficiency of the synthesized nanostructures was calculated. The effect of functionalization on cellular uptake of nanoparticles was assessed using two cell lines of BT-474 and Calu-6. The best uptake result was achieved by functionalized liposome (MPNS-LAb) and BT-474. Also, the interaction of 514 nm argon (Ar) and Nd/YAG second harmonic 532-nm lasers with nanoparticles was investigated based on the temperature rise of the nanoshell suspension and the release value of 5(6)-carboxyfluorescein (CF) from CF/MPNS-loaded liposomes. The temperature increase of the suspensions after ten consecutive pulses of 532 nm and 5 min of irradiation by Ar laser were measured approximately 2 and 12 °C, respectively. The irradiation of CF/MPNS-loaded liposomes by Ar laser for 3 min resulted in 24.3 % release of CF, and in the case of 532 nm laser, the release was laser energy dependent. Furthermore, the comparison of CF release showed a higher efficiency for the Ar laser than by direct heating of nanoshell suspension using circulating water. The percentage of cell apoptosis after irradiation by Ar and 532 nm lasers were 44.6 and 42.6 %, respectively. The obtained results suggest that controlling the NP-laser interaction using optical properties of nanoshells and the laser parameters can be used to develop a new cancer therapy modality via targeted nanoshell and drug delivery.

  19. Blue and Orange Two-Color CW Laser Based on Single-Pass Second-Harmonic and Sum-Frequency Generation in MgO:PPLN

    Directory of Open Access Journals (Sweden)

    Dismas K. Choge

    2018-04-01

    Full Text Available We demonstrate a compact blue and orange-two color continuous wave laser source emitting at 487 nm and from 597.4 to 600.3 nm, respectively. The temperature tunable coherent orange radiation is achieved by frequency mixing 974 nm laser diode (LD and a C-band amplified spontaneous emission laser source while the temperature insensitive blue radiation is generated by second-order quasi-phase-matching frequency doubling of 974 nm LD. We implement the simultaneous nonlinear processes in a single magnesium oxide doped periodically poled lithium niobate bulk crystal without the need of an aperiodic design.

  20. Temporal variability of tidal and gravity waves during a record long 10-day continuous lidar sounding

    Science.gov (United States)

    Baumgarten, Kathrin; Gerding, Michael; Baumgarten, Gerd; Lübken, Franz-Josef

    2018-01-01

    Gravity waves (GWs) as well as solar tides are a key driving mechanism for the circulation in the Earth's atmosphere. The propagation of gravity waves is strongly affected by tidal waves as they modulate the mean background wind field and vice versa, which is not yet fully understood and not adequately implemented in many circulation models. The daylight-capable Rayleigh-Mie-Raman (RMR) lidar at Kühlungsborn (54° N, 12° E) typically provides temperature data to investigate both wave phenomena during one full day or several consecutive days in the middle atmosphere between 30 and 75 km altitude. Outstanding weather conditions in May 2016 allowed for an unprecedented 10-day continuous lidar measurement, which shows a large variability of gravity waves and tides on timescales of days. Using a one-dimensional spectral filtering technique, gravity and tidal waves are separated according to their specific periods or vertical wavelengths, and their temporal evolution is studied. During the measurement period a strong 24 h wave occurs only between 40 and 60 km and vanishes after a few days. The disappearance is related to an enhancement of gravity waves with periods of 4-8 h. Wind data provided by ECMWF are used to analyze the meteorological situation at our site. The local wind structure changes during the observation period, which leads to different propagation conditions for gravity waves in the last days of the measurement period and therefore a strong GW activity. The analysis indicates a further change in wave-wave interaction resulting in a minimum of the 24 h tide. The observed variability of tides and gravity waves on timescales of a few days clearly demonstrates the importance of continuous measurements with high temporal and spatial resolution to detect interaction phenomena, which can help to improve parametrization schemes of GWs in general circulation models.

  1. Experimental verification of theoretical equations for acoustic radiation force on compressible spherical particles in traveling waves

    Science.gov (United States)

    Johnson, Kennita A.; Vormohr, Hannah R.; Doinikov, Alexander A.; Bouakaz, Ayache; Shields, C. Wyatt; López, Gabriel P.; Dayton, Paul A.

    2016-05-01

    Acoustophoresis uses acoustic radiation force to remotely manipulate particles suspended in a host fluid for many scientific, technological, and medical applications, such as acoustic levitation, acoustic coagulation, contrast ultrasound imaging, ultrasound-assisted drug delivery, etc. To estimate the magnitude of acoustic radiation forces, equations derived for an inviscid host fluid are commonly used. However, there are theoretical predictions that, in the case of a traveling wave, viscous effects can dramatically change the magnitude of acoustic radiation forces, which make the equations obtained for an inviscid host fluid invalid for proper estimation of acoustic radiation forces. To date, experimental verification of these predictions has not been published. Experimental measurements of viscous effects on acoustic radiation forces in a traveling wave were conducted using a confocal optical and acoustic system and values were compared with available theories. Our results show that, even in a low-viscosity fluid such as water, the magnitude of acoustic radiation forces is increased manyfold by viscous effects in comparison with what follows from the equations derived for an inviscid fluid.

  2. 30 CFR 285.913 - What happens if I fail to comply with my approved decommissioning application?

    Science.gov (United States)

    2010-07-01

    ... approved decommissioning application? 285.913 Section 285.913 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Decommissioning Compliance with An Approved Decommissioning Application § 285.913 What...

  3. 31 CFR 285.1 - Collection of past-due support by administrative offset.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Collection of past-due support by administrative offset. 285.1 Section 285.1 Money and Finance: Treasury Regulations Relating to Money and Finance... include current basic pay, special pay, incentive pay, retainer pay, overtime, or in the case of an...

  4. Rocket photographs of fine structure and wave patterns in the solar temperature minimum

    Science.gov (United States)

    Bonnet, R. M.; Decaudin, M.; Foing, B.; Bruner, M.; Acton, L. W.; Brown, W. A.

    1982-01-01

    A new series of high resolution pictures of the sun has been obtained during the second flight of the Transition Region Camera which occurred on September 23, 1980. The qualitative analysis of the results indicates that a substantial portion of the solar surface at the temperature minimum radiates in non-magnetic regions and from features below 1 arcsec in size. Wave patterns are observed on the 160 nm temperature minimum pictures. They are absent on the Lyman alpha pictures. Their physical characteristics are compatible with those of gravitational and acoustic waves generated by exploding granules.

  5. Radiation from communication antenna and electrical cable generator

    International Nuclear Information System (INIS)

    Rozaimah Abdul Rahim; Norzehan Ngadiron

    2009-01-01

    Lack of knowledge about radio frequency wave antenna emitter and electrical cable cause misunderstanding among public that make this technologies dangerous, thereby can harm the public hearths. Malaysian Nuclear Agency as one technical body in Malaysia that specialized in this matter had already explained it to the public about this issue long time ago. Basically, non-ionizing radiation are one of the electromagnetic radiation that can be produced naturally or artificially. It consists of two main component, electrical field and magnetic field that propagated with velocity of light. Energy for this radiation less than 12.4 eV, wave distance more than 100 nm with frequency less than 3000 THz. With low energy, this radiation cannot go to ionizing process. Exposure to this radiation also can cause biological effect, acute and chronic. For human that expose to this radiation, direct effect only involved in thermal effect which suddenly increasing of temperature in body. This can cause heat stress, heat stroke and cataract in eyes lens. For infrared, visible light, ultraviolet and laser, the critical organ are eyes and skins. In Malaysia, Telecommunication Department had already produce guideline , Regulatory Framework on the sharing communication infrastructures 1988 that mentioned about all the guideline that must be obey by all the network operator including safety aspect, especially for radio wave and micro wave with frequency from 30 MHz to 300 GHz. The other agencies that produced standards such as SIRIM specialized in level of exposure for electromagnetic radiation until 3 kHz. For the other non-ionizing radiation, guideline from ICNIRP, WHO or others will be referred. For the public the main problem for this issues are psychology problem, political influence and jealously. For Malaysian Nuclear Agency, public awareness must be proceeded in order to give knowledge and understanding about this matter so that the public will not fear in the future.

  6. 2-D FEM Simulation of Propagation and Radiation of Leaky Lamb Wave in a Plate-Type Ultrasonic Waveguide Sensor

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sang-Jin; Kim, Hoe-Woong; Joo, Young-Sang; Kim, Sung-Kyun; Kim, Jong-Bum [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    This paper introduces the 2-D FEM simulation of the propagation and radiation of the leaky Lamb wave in and from a plate-type ultrasonic waveguide sensor conducted for the radiation beam profile analysis. The FEM simulations are performed with three different excitation frequencies and the radiation beam profiles obtained from FEM simulations are compared with those obtained from corresponding experiments. This paper deals with the 2-D FEM simulation of the propagation and radiation of the leaky Lamb wave in and from a plate-type ultrasonic waveguide sensor conducted to analyze the radiation beam profiles. The radiation beam profile results obtained from the FEM simulation show good agreement with the ones obtained from the experiment. This result will be utilized to improve the performance of the developed waveguide sensor. The quality of the visualized image is mainly affected by beam profile characteristics of the leaky wave radiated from the waveguide sensor. However, the relationships between the radiation beam profile and many parameters of the waveguide sensor are not fully revealed yet. Therefore, further parametric studies are necessary to improve the performance of the sensor and the finite element method (FEM) is one of the most effective tools for the parametric study.

  7. Strain-induced modulation of near-field radiative transfer.

    Science.gov (United States)

    Ghanekar, Alok; Ricci, Matthew; Tian, Yanpei; Gregory, Otto; Zheng, Yi

    2018-06-11

    In this theoretical study, we present a near-field thermal modulator that exhibits change in radiative heat transfer when subjected to mechanical stress/strain. The device has two terminals at different temperatures separated by vacuum: one fixed and one stretchable. The stretchable side contains one-dimensional grating. When subjected to mechanical strain, the effective optical properties of the stretchable side are affected upon deformation of the grating. This results in modulation of surface waves across the interfaces influencing near-field radiative heat transfer. We show that for a separation of 100 nm, it is possible to achieve 25% change in radiative heat transfer for a strain of 10%.

  8. Continuous-variable Einstein-Podolsky-Rosen paradox with traveling-wave second-harmonic generation

    International Nuclear Information System (INIS)

    Olsen, M.K.

    2004-01-01

    The Einstein-Podolsky-Rosen paradox and quantum entanglement are at the heart of quantum mechanics. Here we show that single-pass traveling-wave second-harmonic generation can be used to demonstrate both entanglement and the paradox with continuous variables that are analogous to the position and momentum of the original proposal

  9. Structure, spectroscopic properties and laser performance of Nd:YNbO4 at 1066 nm

    Science.gov (United States)

    Ding, Shoujun; Peng, Fang; Zhang, Qingli; Luo, Jianqiao; Liu, Wenpeng; Sun, Dunlu; Dou, Renqin; Sun, Guihua

    2016-12-01

    We have demonstrated continuous wave (CW) laser operation of Nd:YNbO4 crystal at 1066 nm for the first time. A maximum output power of 1.12 W with the incident power of 5.0 W is successfully achieved corresponding to an optical-to-optical conversion efficiency of 22.4% and a slope efficiency of 24.0%. The large absorption cross section (8.7 × 10-20 cm2) and wide absorption band (6 nm) at around 808 nm indicates the good pumping efficiency by laser diodes (LD). The small emission cross section (29 × 10-20 cm2) and relative long lifetime of the 4F3/2 → 4I11/2 transition indicates good energy storage capacity of Nd:YNbO4. Moreover, the raw materials of Nd:YNbO4 are stable, thus, it can grow high-quality and large-size by Czochralski (CZ) method. Therefore the Nd:YNbO4 crystal is a potentially new laser material suitable for LD pumping.

  10. Astigmatism-free high-brightness 1060 nm edge-emitting lasers with narrow circular beam profile.

    Science.gov (United States)

    Miah, Md Jarez; Kalosha, Vladimir P; Bimberg, Dieter; Pohl, Johannes; Weyers, Markus

    2016-12-26

    1060 nm high-brightness vertical broad-area edge-emitting lasers providing anastigmatic high optical power into a narrow circular beam profile are demonstrated. Ridge-waveguide (RW) lasers yield record 2.2 W single-transverse mode power in the 1060-nm wavelength range under continuous-wave (cw) operation at room temperature with excellent beam quality factor M2 ≤ 2. Independent of operating current the astigmatism is only 2.5 µm. 3 mm long broad-area (BA) lasers produce a θvert as narrow as 9° full width at half maximum, which agrees well with our simulation results, being insensitive to drive current. 5 mm long BA lasers deliver highest ever reported cw 12 W multimode output power among lasers showing θvert <10° in the 1060-nm wavelength range. The emitted laser beams from both RW and BA lasers show a perfect circular shape with ≤10° divergence angle at record 2.1 W and 4.2 W cw-mode output power, respectively.

  11. Radiative corrections to the Coulomb law and model of dense quantum plasmas: Dispersion of longitudinal waves in magnetized quantum plasmas

    Science.gov (United States)

    Andreev, Pavel A.

    2018-04-01

    Two kinds of quantum electrodynamic radiative corrections to electromagnetic interactions and their influence on the properties of highly dense quantum plasmas are considered. Linear radiative correction to the Coulomb interaction is considered. Its contribution in the spectrum of the Langmuir waves is presented. The second kind of radiative corrections are related to the nonlinearity of the Maxwell equations for the strong electromagnetic field. Their contribution in the spectrum of transverse waves of magnetized plasmas is briefly discussed. At the consideration of the Langmuir wave spectrum, we included the effect of different distributions of the spin-up and spin-down electrons revealing in the Fermi pressure shift.

  12. Directional radiative cooling thermal compensation for gravitational wave interferometer mirrors

    Energy Technology Data Exchange (ETDEWEB)

    Justin Kamp, Carl [Department of Chemical Reaction Engineering, Chalmers University of Technology, SE-412 96 Goteborg (Sweden)], E-mail: carl.kamp@chalmers.se; Kawamura, Hinata [Yokoyama Junior High School, Sanda, Hachioji, Tokyo 193-0832 (Japan); Passaquieti, Roberto [Dipartimento di Fisica ' Enrico Fermi' and INFN Sezione di Pisa, Universita' di Pisa, Largo Bruno Pontecorvo, I-56127 Pisa (Italy); DeSalvo, Riccardo [LIGO Observatories, California Institute of Technology, Pasadena, CA 91125 (United States)

    2009-08-21

    The concept of utilizing directional radiative cooling to correct the problem of thermal lensing in the mirrors of the LIGO/VIRGO gravitational wave detectors has been shown and has prospects for future use. Two different designs utilizing this concept, referred to as the baffled and parabolic mirror solutions, have been proposed with different means of controlling the cooling power. The technique takes advantage of the power naturally radiated by the mirror surfaces at room temperature to prevent their heating by the powerful stored laser beams. The baffled solution has been simulated via COMSOL Multiphysics as a design tool. Finally, the parabolic mirror concept was experimentally validated with the results falling in close agreement with theoretical cooling calculations. The technique of directional radiative thermal correction can be reversed to image heat rings on the mirrors periphery to remotely and dynamically correct their radius of curvature without subjecting the mirror to relevant perturbations.

  13. Mechanistic comparison of pulse laser induced phase separation of particulates from cellulose paper at 213 nm and 532 nm

    International Nuclear Information System (INIS)

    Arif, S.; Forster, M.; Kautek, W.; Bushuk, S.; Kouzmouk, A.; Tatur, H.; Batishche, S.

    2013-01-01

    The laser-induced phase separation of charcoal particles on additive-free cotton linters cellulose paper was investigated by electron and optical microscopy, colorimetry, and diffuse reflectance FT-IR. The fibre bundles were vaporised in depth of several 10 μm above destruction fluence thresholds using visible 532 nm radiation. This is in contrast to mid-ultraviolet 213 nm radiation, where only the top fibre bundles were modified and partially evaporated. The colorimetric lightness results generally represented the cleaning status, whereas the colorimetric yellowing data represented irreversible chemical and/or photochemical changes. Charcoal-contaminated paper treated with visible and mid-ultraviolet radiation exhibited yellowing, whereas uncontaminated did not. This suggests that the electron-rich plasma generated by the evaporation of the particles heats the adjacent substrate and also excludes oxygen. Mid-ultraviolet, in contrast to visible radiation, shows particle removal always accompanied by paper destruction. IR spectroscopy results suggest cross-linking by ether bonds near the destruction threshold, but do not prove the formation of oxidation products and double bonds as the basis of the yellowing. A ''cleaning window'' between the cleaning threshold (0.1 J/cm 2 ) and the paper destruction threshold (2.9 J/cm 2 ) with a pulse number of 2 is provided by visible 532 nm laser treatment. (orig.)

  14. CdS thin films prepared by continuous wave Nd:YAG laser

    Science.gov (United States)

    Wang, H.; Tenpas, Eric W.; Vuong, Khanh D.; Williams, James A.; Schuesselbauer, E.; Bernstein, R.; Fagan, J. G.; Wang, Xing W.

    1995-08-01

    We report new results on continuous wave Nd:YAG laser deposition of cadmium sulfide thin films. Substrates were soda-lime silicate glass, silica glass, silicon, and copper coated formvar sheets. As deposited films were mixtures of cubic and hexagonal phases, with two different grain sizes. As revealed by SEM micrographs, films had smooth surface morphology. As revealed by TEM analysis, grain sizes were extremely small.

  15. Propagation of synchrotron radiation through nanocapillary structures

    International Nuclear Information System (INIS)

    Bjeoumikhov, A.; Bjeoumikhova, S.; Riesemeier, H.; Radtke, M.; Wedell, R.

    2007-01-01

    The propagation of synchrotron radiation through nanocapillary structures with channel sizes of 200 nm and periods in the micrometer size has been studied experimentally. It was shown that the propagation through individual capillary channels has a mode formation character. Furthermore it was shown that during the propagation through capillary channels the coherence of synchrotron radiation is partially conserved. Interference of beams propagating through different capillary channels is observed which leads to a periodically modulated distribution of the radiation intensity in a plane far from the exit of the structure. These investigations are of high relevance for the understanding of X-ray transmission through nanocapillaries and the appearance of wave properties at this size scale

  16. Guided-wave phase-matched second-harmonic generation in KTiOPO4 waveguide produced by swift heavy-ion irradiation

    Science.gov (United States)

    Cheng, Yazhou; Jia, Yuechen; Akhmadaliev, Shavkat; Zhou, Shengqiang; Chen, Feng

    2014-11-01

    We report on the guided-wave second-harmonic generation in a KTiOPO4 nonlinear optical waveguide fabricated by a 17 MeV O5+ ion irradiation at a fluence of 1.5×1015 ions/cm2. The waveguide guides light along both TE and TM polarizations, which is suitable for phase-matching frequency doubling. Second harmonics of green light at a wavelength of 532 nm have been generated through the KTiOPO4 waveguide platform under an optical pump of fundamental wave at 1064 nm in both continuous-wave and pulsed regimes, reaching optical conversion efficiencies of 5.36%/W and 11.5%, respectively. The propagation losses have been determined to be ˜3.1 and ˜5.7 dB/cm for the TE and TM polarizations at a wavelength of 632.8 nm, respectively.

  17. Thermal Lensing in Ocular Media Exposed to Continuous Wave Near-Infrared Radiation: the 1150-1350-nm Region

    Science.gov (United States)

    2008-10-01

    2.431006 3.02 6 and 7 4 4.86103 3.78 6–8 6 2.31103 1.39 6, 7, and 10 4 6.18102 6.75 6 and 8 4 2.51102 6.75 7 and 8 0 1.88102 6.75 7 and 8 laced ...minor damage reaching nto the choroid with damage centering on the outer neural ayer ONL.35,37 Swelling in the RPE was found to be much ess in the...lengths.41,42,44 Given the variability in pigmentation content and density of the retina between subjects, a trend in absorp- tion of the RPE, neural

  18. Response of sugar beet plants to ultraviolet-B (280-320 nm) radiation and Cercospora leaf spot disease

    International Nuclear Information System (INIS)

    Panagopoulos, I.; Bornman, J.F.; Björn, L.O.

    1992-01-01

    Sugar beet (Beta vulgaris L.) plants injected with Cercospora beticola Sacc. as well as non-infected plants were grown under visible light with or without ultraviolet-B (UV-B, 280-320 nm) radiation for 40 days. An interaction between UV-B radiation and Cercospora leaf spot disease was observed, resulting in a large reduction in leaf chlorophyll content, dry weight of leaf laminae, petioles and storage roots. Lipid peroxidation in leaves also increased the most under the combined treatments. This was also true for ultraweak luminescence from both adaxial and abaxial leaf surfaces. However, no correlation between lipid peroxidation and ultraweak luminescence was observed. Ultraviolet-B radiation given alone appeared to have either a stimulating effect, giving an increase in dry weight of laminac and reducing lipid peroxidation, or no effect. This lack of effect was seen in the absence of change in dry weight of storage roots and chlorophyll content relative to controls. The study demonstrated a harmful interaction between UV-B radiation and Cercospora leaf spot disease on sugar beet

  19. Limitations On The Creation of Continuously Surfable Waves Generated By A Pressure Source Moving In A Circular Path

    NARCIS (Netherlands)

    Schmied, S.A.

    2014-01-01

    The aim of the research presented in this work was to investigate the novel idea to produce continuous breaking waves, whereby a pressure source was rotated within an annular wave pool. The concept was that the pressure source generates non-breaking waves that propagate inward to the inner ring of

  20. Generating Far-Infrared Radiation By Two-Wave Mixing

    Science.gov (United States)

    Borenstain, Shmuel

    1992-01-01

    Far-infrared radiation 1 to 6 GHz generated by two-wave mixing in asymmetrically grown GaAs/AlxGa1-xAs multiple-quantum-well devices. Two near-infrared semiconductor diode lasers phase-locked. Outputs amplified, then combined in semiconductor nonlinear multiple-quantum-well planar waveguide. Necessary to optimize design of device with respect to three factors: high degree of confinement of electromagnetic field in nonlinear medium to maximize power density, phase matching to extend length of zone of interaction between laser beams in non-linear medium, and nonlinear susceptibility. Devices used as tunable local oscillators in heterodyne-detection radiometers.

  1. 30 CFR 285.437 - When can my lease or grant be canceled?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When can my lease or grant be canceled? 285.437... Administration Lease Or Grant Cancellation § 285.437 When can my lease or grant be canceled? (a) The Secretary will cancel any lease or grant issued under this part upon proof that it was obtained by fraud or...

  2. Experimental and numerical investigation of shock wave propagation through complex geometry, gas continuous, two-phase media

    Energy Technology Data Exchange (ETDEWEB)

    Chien-Chih Liu, James [Univ. of California, Berkeley, CA (United States)

    1993-01-01

    The work presented here investigates the phenomenon of shock wave propagation in gas continuous, two-phase media. The motivation for this work stems from the need to understand blast venting consequences in the HYLIFE inertial confinement fusion (ICF) reactor. The HYLIFE concept utilizes lasers or heavy ion beams to rapidly heat and compress D-T targets injected into the center of a reactor chamber. A segmented blanket of falling molten lithium or Li2BeF4 (Flibe) jets encircles the reactor`s central cavity, shielding the reactor structure from radiation damage, absorbing the fusion energy, and breeding more tritium fuel. X-rays from the fusion microexplosion will ablate a thin layer of blanket material from the surfaces which face toward the fusion site. This generates a highly energetic vapor, which mostly coalesces in the central cavity. The blast expansion from the central cavity generates a shock which propagates through the segmented blanket - a complex geometry, gas-continuous two-phase medium. The impulse that the blast gives to the liquid as it vents past, the gas shock on the chamber wall, and ultimately the liquid impact on the wall are all important quantities to the HYLIFE structural designers.

  3. Global Discrete Artificial Boundary Conditions for Time-Dependent Wave Propagation

    Science.gov (United States)

    Ryaben'kii, V. S.; Tsynkov, S. V.; Turchaninov, V. I.

    2001-12-01

    We construct global artificial boundary conditions (ABCs) for the numerical simulation of wave processes on unbounded domains using a special nondeteriorating algorithm that has been developed previously for the long-term computation of wave-radiation solutions. The ABCs are obtained directly for the discrete formulation of the problem; in so doing, neither a rational approximation of “nonreflecting kernels” nor discretization of the continuous boundary conditions is required. The extent of temporal nonlocality of the new ABCs appears fixed and limited; in addition, the ABCs can handle artificial boundaries of irregular shape on regular grids with no fitting/adaptation needed and no accuracy loss induced. The nondeteriorating algorithm, which is the core of the new ABCs, is inherently three-dimensional, it guarantees temporally uniform grid convergence of the solution driven by a continuously operating source on arbitrarily long time intervals and provides unimprovable linear computational complexity with respect to the grid dimension. The algorithm is based on the presence of lacunae, i.e., aft fronts of the waves, in wave-type solutions in odd-dimensional spaces. It can, in fact, be built as a modification on top of any consistent and stable finite-difference scheme, making its grid convergence uniform in time and at the same time keeping the rate of convergence the same as that of the unmodified scheme. In this paper, we delineate the construction of the global lacunae-based ABCs in the framework of a discretized wave equation. The ABCs are obtained for the most general formulation of the problem that involves radiation of waves by moving sources (e.g., radiation of acoustic waves by a maneuvering aircraft). We also present systematic numerical results that corroborate the theoretical design properties of the ABC algorithm.

  4. Four-Wave Mixing of Gigawatt Power, Long-Wave Infrared Radiation in Gases and Semiconductors

    Science.gov (United States)

    Pigeon, Jeremy James

    The nonlinear optics of gigawatt power, 10 microm, 3 and 200 ps long pulses propagating in gases and semiconductors has been studied experimentally and numerically. In this work, the development of a high-repetition rate, picosecond, CO2 laser system has enabled experiments using peak intensities in the range of 1-10 GW/cm2, approximately one thousand times greater than previous nonlinear optics experiments in the long-wave infrared (LWIR) spectral region. The first measurements of the nonlinear refractive index of the atomic and molecular gases Kr, Xe, N2, O2 and the air at a wavelength near 10 microm were accomplished by studying the four-wave mixing (FWM) of dual-wavelength, 200 ps CO2 laser pulses. These measurements indicate that the nonlinearities of the diatomic molecules N2, O2 and the air are dominated by the molecular contribution to the nonlinear refractive index. Supercontinuum (SC) generation covering the infrared spectral range, from 2-20 microm, was realized by propagating 3 ps, 10 microm pulses in an approximately 7 cm long, Cr-doped GaAs crystal. Temporal measurements of the SC radiation show that pulse splitting accompanies the generation of such broadband light in GaAs. The propagation of 3 ps, 10 microm pulses in GaAs was studied numerically by solving the Generalized Nonlinear Schrodinger Equation (GNLSE). These simulations, combined with analytic estimates, were used to determine that stimulated Raman scattering combined with a modulational instability caused by the propagation of intense LWIR radiation in the negative group velocity dispersion region of GaAs are responsible for the SC generation process. The multiple FWM of a 106 GHz, 200 ps CO2 laser beat-wave propagating in GaAs was used to generate a broadband FWM spectrum that was compressed by the negative group velocity dispersion of GaAs and NaCl crystals to form trains of high-power, picosecond pulses at a wavelength near 10 microm. Experimental FWM spectra obtained using 165 and 882

  5. Fast and stable gratings inscription in POFs made of different materials with pulsed 248 nm KrF laser

    DEFF Research Database (Denmark)

    Marques, C. A.F.; Min, R.; Leal, A.

    2018-01-01

    This paper presents fiber Bragg grating (FBG) inscription with a pulsed 248 nm UV KrF laser in polymer optical fibers (POFs) made of different polymers, namely polymethyl methacrylate (PMMA), cyclic-olefin polymer and co-polymer, and Polycarbonate. The inscribed gratings and the corresponding...... inscription parameters are compared with grating inscribed in POFs made of the aforementioned materials but with the hitherto most used laser for inscription, which is a continuous wave 325 nm UV HeCd laser. Results show a reduction of the inscription time of at least 16 times. The maximum time reduction...... is more than 130 times. In addition, a reflectivity and a bandwidth close to or higher than the ones with the 325 nm laser were obtained. The polymer optical fiber Bragg gratings (POFBGs) inscribed with the 248 nm laser setup present high stability with small variations in their central wavelength...

  6. Growth of micro-crystals in solution by in-situ heating via continuous wave infrared laser light and an absorber

    Science.gov (United States)

    Pathak, Shashank; Dharmadhikari, Jayashree A.; Thamizhavel, A.; Mathur, Deepak; Dharmadhikari, Aditya K.

    2016-01-01

    We report on growth of micro-crystals such as sodium chloride (NaCl), copper sulphate (CuSO4), potassium di-hydrogen phosphate (KDP) and glycine (NH2CH2COOH) in solution by in-situ heating using continuous wave Nd:YVO4 laser light. Crystals are grown by adding single walled carbon nanotubes (SWNT). The SWNTs absorb 1064 nm light and act as an in-situ heat source that vaporizes the solvent producing microcrystals. The temporal dynamics of micro-crystal growth is investigated by varying experimental parameters such as SWNT bundle size and incident laser power. We also report crystal growth without SWNT in an absorbing medium: copper sulphate in water. Even though the growth dynamics with SWNT and copper sulphate are significantly different, our results indicate that bubble formation is necessary for nucleation. Our simple method may open up new vistas for rapid growth of seed crystals especially for examining the crystallizability of inorganic and organic materials.

  7. Effects of Millimeter-Wave Electromagnetic Radiation on the Experimental Model of Migraine.

    Science.gov (United States)

    Sivachenko, I B; Medvedev, D S; Molodtsova, I D; Panteleev, S S; Sokolov, A Yu; Lyubashina, O A

    2016-02-01

    Effects of millimeter-wave electromagnetic radiation (40 GHz frequency, 0.01 mW power) on the spontaneous fi ring of convergent neurons of the spinal trigeminal nucleus and their responses to electrical stimulation of the dura mater were studied in neurophysiological experiments on rats. Irradiation of the area of cutaneous receptive fields of spinal trigeminal nucleus reversibly inhibited both spontaneous discharges and activity induced by electrical stimulation of the dura mater. The second and third exposures to electromagnetic radiation with an interval of 10 min were ineffective. These results suggest that suppression of neuronal excitability in the spinal trigeminal ganglion can be a mechanism of the anti-migraine effects of electromagnetic radiation observed in clinical practice.

  8. Mechanisms of Saharan Dust Radiative Effects Coupled to Eddy Energy and Wave Activity

    Science.gov (United States)

    Hosseinpour, F.; Wilcox, E. M.; Colarco, P. R.

    2017-12-01

    We explore mechanisms addressing the relationships between the net radiative forcing of Saharan Air Layer (SAL) and eddy energetics of the African Easterly jet-African easterly wave (AEJ-AEWs) system across the tropical Atlantic storm track. This study indicates that radiatively interactive dust aerosols have the capability to modify the exchange of kinetic energy between the AEWs and AEJ. We find that while dust can have both constructive and destructive effects on eddy activity of the waves, depending on the behavior and structure of waves exhibiting different characteristic time-scales, the local heating by dust tends to change the quadruple pattern of eddy momentum fluxes of the AEWs which can yield feedbacks onto the mean-flow. These results arise from applying an ensemble of large NASA satellite observational data sets, such as MODIS, SeaWiFS and TRMM, as well as the GOCART aerosol model and MERRA reanalysis. Sensitivity studies indicate that the results are consistent when the analysis is performed with multiple different aerosol datasets. While the mechanisms proposed here require further evaluation with numerical model experiments, this study presents a novel approach and new insights into Saharan dust effects on large-scale climate dynamics.

  9. Correlation between cell survival and DNA single-strand break repair proficiency in the Chinese hamster ovary cell lines AA8 and EM9 irradiated with 365-nm ultraviolet-A radiation

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Peak, J.G.; Peak, M.J. (Argonne National Lab., IL (USA))

    1991-02-01

    Cell survival parameters and the induction and repair of DNA single-strand breaks were measured in two Chinese hamster ovary cell lines after irradiation with monochromatic UVA radiation of wavelength 365 nm. The radiosensitive mutant cell line EM9 is known to repair ionizing-radiation-induced single-strand breaks (SSB) more slowly than the parent line AA8. EM9 was determined to be 1.7-fold more sensitive to killing by 365-nm radiation than AA8 at the 10% survival level, and EM9 had a smaller shoulder region on the survival curve ({alpha} = 1.76) than AA8 ({alpha} = 0.62). No significant differences were found between the cell lines in the initial yields of SSB induced either by {gamma}-radiation (as determined by alkaline sucrose gradient sedimentation) or by 365-nm UVA (as determined by alkaline elution). For measurement of initial SSB, cells were irradiated at 0.5{sup o}C to minimize DNA repair processes. Rejoining of 365-nm induced SSB was measured by irradiating cells at 0.5{sup o}C, allowing them to repair at 37{sup o}C in full culture medium, and then quantitating the remaining SSB by alkaline elution. The repair of these breaks followed biphasic kinetics in both cell lines. EM9 repaired the breaks more slowly (T{sub 1/2} values of 1.3 and 61.3 min) than did AA8 (T{sub 1/2} values of 0.9 and 53.3 min), and EM9 also left more breaks unrepaired 90 min after irradiation (24% vs 8% for AA8). Thus, the sensitivity of EM9 to 365-nm radiation correlated with its deficiency in repairing DNA lesions revealed as SSB in alkaline elution. These results suggest that DNA may be a critical target in 365-nm induced cellular lethality and that the ability of AA8 and EM9 cells to repair DNA strand breaks may be related to their ability to survive 365-nm radiation. (author).

  10. INTEGRAL results on the electromagnetic counterparts of gravitational waves

    DEFF Research Database (Denmark)

    Mereghetti, S.; Savchenko, V.; Ferrigno, C.

    2018-01-01

    Thanks to its high orbit and a set of complementary detectors providing continuous coverage of the whole sky, the INTEGRAL satellite has unique capabilities for the identification and study of the electromagnetic radiation associated to gravitational waves signals and, more generally, for multi...

  11. Implicit Monte Carlo methods and non-equilibrium Marshak wave radiative transport

    International Nuclear Information System (INIS)

    Lynch, J.E.

    1985-01-01

    Two enhancements to the Fleck implicit Monte Carlo method for radiative transport are described, for use in transparent and opaque media respectively. The first introduces a spectral mean cross section, which applies to pseudoscattering in transparent regions with a high frequency incident spectrum. The second provides a simple Monte Carlo random walk method for opaque regions, without the need for a supplementary diffusion equation formulation. A time-dependent transport Marshak wave problem of radiative transfer, in which a non-equilibrium condition exists between the radiation and material energy fields, is then solved. These results are compared to published benchmark solutions and to new discrete ordinate S-N results, for both spatially integrated radiation-material energies versus time and to new spatially dependent temperature profiles. Multigroup opacities, which are independent of both temperature and frequency, are used in addition to a material specific heat which is proportional to the cube of the temperature. 7 refs., 4 figs

  12. Pulsar discoveries by volunteer distributed computing and the strongest continuous gravitational wave signal

    Science.gov (United States)

    Knispel, Benjamin

    2011-07-01

    Neutron stars are the endpoints of stellar evolution and one of the most compact forms of matter in the universe. They can be observed as radio pulsars and are promising sources for the emission of continuous gravitational waves. Discovering new radio pulsars in tight binary orbits offers the opportunity to conduct very high precision tests of General Relativity and to further our understanding of neutron star structure and matter at super-nuclear densities. The direct detection of gravitational waves would validate Einstein's theory of Relativity and open a new window to the universe by offering a novel astronomical tool. This thesis addresses both of these scientific fields: the first fully coherent search for radio pulsars in tight, circular orbits has been planned, set up and conducted in the course of this thesis. Two unusual radio pulsars, one of them in a binary system, have been discovered. The other half of this thesis is concerned with the simulation of the Galactic neutron star population to predict their emission of continuous gravitational waves. First realistic statistical upper limits on the strongest continuous gravitational-wave signal and detection predictions for realistic all-sky blind searches have been obtained. The data from a large-scale pulsar survey with the 305-m Arecibo radio telescope were searched for signals from radio pulsars in binary orbits. The massive amount of computational work was done on hundreds of thousands of computers volunteered by members of the general public through the distributed computing project Einstein@Home. The newly developed analysis pipeline searched for pulsar spin frequencies below 250 Hz and for orbital periods as short as 11 min. The structure of the search pipeline consisting of data preparation, data analysis, result post-processing, and set-up of the pipeline components is presented in detail. The first radio pulsar, discovered with this search, PSR J2007+2722, is an isolated radio pulsar, likely from

  13. Searching for continuous gravitational wave signals. The hierarchical Hough transform algorithm

    International Nuclear Information System (INIS)

    Papa, M.; Schutz, B.F.; Sintes, A.M.

    2001-01-01

    It is well known that matched filtering techniques cannot be applied for searching extensive parameter space volumes for continuous gravitational wave signals. This is the reason why alternative strategies are being pursued. Hierarchical strategies are best at investigating a large parameter space when there exist computational power constraints. Algorithms of this kind are being implemented by all the groups that are developing software for analyzing the data of the gravitational wave detectors that will come online in the next years. In this talk I will report about the hierarchical Hough transform method that the GEO 600 data analysis team at the Albert Einstein Institute is developing. The three step hierarchical algorithm has been described elsewhere [8]. In this talk I will focus on some of the implementational aspects we are currently concerned with. (author)

  14. Phase Aberration and Attenuation Effects on Acoustic Radiation Force-Based Shear Wave Generation.

    Science.gov (United States)

    Carrascal, Carolina Amador; Aristizabal, Sara; Greenleaf, James F; Urban, Matthew W

    2016-02-01

    Elasticity is measured by shear wave elasticity imaging (SWEI) methods using acoustic radiation force to create the shear waves. Phase aberration and tissue attenuation can hamper the generation of shear waves for in vivo applications. In this study, the effects of phase aberration and attenuation in ultrasound focusing for creating shear waves were explored. This includes the effects of phase shifts and amplitude attenuation on shear wave characteristics such as shear wave amplitude, shear wave speed, shear wave center frequency, and bandwidth. Two samples of swine belly tissue were used to create phase aberration and attenuation experimentally. To explore the phase aberration and attenuation effects individually, tissue experiments were complemented with ultrasound beam simulations using fast object-oriented C++ ultrasound simulator (FOCUS) and shear wave simulations using finite-element-model (FEM) analysis. The ultrasound frequency used to generate shear waves was varied from 3.0 to 4.5 MHz. Results: The measured acoustic pressure and resulting shear wave amplitude decreased approximately 40%-90% with the introduction of the tissue samples. Acoustic intensity and shear wave displacement were correlated for both tissue samples, and the resulting Pearson's correlation coefficients were 0.99 and 0.97. Analysis of shear wave generation with tissue samples (phase aberration and attenuation case), measured phase screen, (only phase aberration case), and FOCUS/FEM model (only attenuation case) showed that tissue attenuation affected the shear wave generation more than tissue aberration. Decreasing the ultrasound frequency helped maintain a focused beam for creation of shear waves in the presence of both phase aberration and attenuation.

  15. Resonance control for a cw [continuous wave] accelerator

    International Nuclear Information System (INIS)

    Young, L.M.; Biddle, R.S.

    1987-01-01

    A resonance-control technique is described that has been successfully applied to several cw accelerating structures built by the Los Alamos National Laboratory for the National Bureau of Standards and for the University of Illinois. The technique involves sensing the rf fields in an accelerating structure as well as the rf power feeding into the cavity and, then, using the measurement to control the resonant frequency of the structure by altering the temperature of the structure. The temperature of the structure is altered by adjusting the temperature of the circulating cooling water. The technique has been applied to continuous wave (cw) side-coupled cavities only but should have applications with most high-average-power accelerator structures. Some additional effort would be required for pulsed systems

  16. 24 CFR 234.285 - Waived title objections.

    Science.gov (United States)

    2010-04-01

    ... have not been violated to a material extent. (f) Federal tax liens and rights of redemption arising... Commissioner will not object to an outstanding right of redemption in IRS if: (1) The Federal tax lien was... CONDOMINIUM OWNERSHIP MORTGAGE INSURANCE Contract Rights and Obligations-Individually Owned Units § 234.285...

  17. Room-temperature continuous-wave operation of the In(Ga)As/GaAs quantum-dot VCSELs for the 1.3 µm optical-fibre communication

    International Nuclear Information System (INIS)

    Xu Dawei; Tong Cunzhu; Yoon, Soon Fatt; Fan Weijun; Zhang, Dao Hua; Wasiak, Michał; Piskorski, Łukasz; Gutowski, Krzysztof; Sarzała, Robert P; Nakwaski, Włodzimierz

    2009-01-01

    Efficient room-temperature (RT) continuous-wave (CW) lasing operation of the 1.3 µm MBE (molecular-beam epitaxy) In(Ga)As/GaAs quantum-dot (QD) top-emitting oxide-confined vertical-cavity surface-emitting diode lasers (VCSELs) for the second-generation optical-fibre communication has been achieved. In their design, a concept of a QD inside a quantum well (QW) has been utilized. The proposed In(Ga)As/GaAs QD active region is composed of five groups of three 8 nm In 0.15 Ga 0.85 As QWs, each containing one InAs QD sheet layer. In each group located close to successive anti-node positions of the optical standing wave within the 3λ cavity, QWs are separated by 32 nm GaAs barriers. Besides, at both active-region edges, additional single InGaAs QWs are located containing single QD layers. For the 10 µm diameter QD VCSELs, the RT CW threshold current of only 6.2 mA (7.9 kA cm −2 ), differential efficiency of 0.11 W A −1 and the maximal output power of 0.85 mW have been recorded. The experimental characteristics are in excellent agreement with theoretical ones obtained using the optical-electrical-thermal-recombination self-consistent computer model. According to this, for the 10 µm devices, the fundamental linearly polarized LP 01 mode remains the dominating one up to the current of 9.1 mA. The lowest RT CW lasing threshold below 5 mA is expected for 6 µm devices

  18. Radiation-Induced Short Channel (RISCE) and Narrow Channel (RINCE) Effects in 65 and 130 nm MOSFETs

    CERN Document Server

    Faccio, F; Cornale, D; Paccagnella, A; Gerardin, S

    2015-01-01

    The behavior of transistors in commercial-grade complementary metal-oxide semiconductor technologies in the 65 and 130 nm nodes has been explored up to a total ionizing dose of 1 Grad. The large dose tolerance of the thin gate oxide is confirmed, but defects in the spacer and STI oxides have a strong effect on the performance of the transistors. A radiation-induced short channel effect is traced to charge trapping in the spacers used for drain engineering, while a radiation-induced narrow channel effect is due to defect generation in the lateral isolation oxide (STI). These strongly degrade the electrical characteristics of short and narrow channel transistors at high doses, and their magnitude depends on the applied bias and temperature during irradiation in a complex way.

  19. Advanced Sine Wave Modulation of Continuous Wave Laser System for Atmospheric CO2 Differential Absorption Measurements

    Science.gov (United States)

    Campbell, Joel F.; Lin, Bing; Nehrir, Amin R.

    2014-01-01

    NASA Langley Research Center in collaboration with ITT Exelis have been experimenting with Continuous Wave (CW) laser absorption spectrometer (LAS) as a means of performing atmospheric CO2 column measurements from space to support the Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) mission.Because range resolving Intensity Modulated (IM) CW lidar techniques presented here rely on matched filter correlations, autocorrelation properties without side lobes or other artifacts are highly desirable since the autocorrelation function is critical for the measurements of lidar return powers, laser path lengths, and CO2 column amounts. In this paper modulation techniques are investigated that improve autocorrelation properties. The modulation techniques investigated in this paper include sine waves modulated by maximum length (ML) sequences in various hardware configurations. A CW lidar system using sine waves modulated by ML pseudo random noise codes is described, which uses a time shifting approach to separate channels and make multiple, simultaneous online/offline differential absorption measurements. Unlike the pure ML sequence, this technique is useful in hardware that is band pass filtered as the IM sine wave carrier shifts the main power band. Both amplitude and Phase Shift Keying (PSK) modulated IM carriers are investigated that exibit perfect autocorrelation properties down to one cycle per code bit. In addition, a method is presented to bandwidth limit the ML sequence based on a Gaussian filter implemented in terms of Jacobi theta functions that does not seriously degrade the resolution or introduce side lobes as a means of reducing aliasing and IM carrier bandwidth.

  20. Variables influencing radiation exposure during extracorporeal shock wave lithotripsy. Review of 298 treatments

    International Nuclear Information System (INIS)

    Carter, H.B.; Naeslund, E.B.R.; Riehle, R.A. Jr.

    1987-01-01

    Retrospective review of 298 extracorporeal shock wave lithotripsy (ESWL) treatments was undertaken to determine the factors which influence radiation exposure during ESWL. Fluoroscopy time averaged 160 seconds (3-509), and the average number of spot films taken per patient was 26 (5-68). The average stone burden was 19.3 mm (3-64). Average calculated skin surface radiation exposure was 17.8 R per treatment. Radiation exposure increased with increasing stone burden and patient weight. Stones treated in the ureter resulted in a higher average patient radiation exposure than for renal stones (19 R vs 16 R), even though the average size of these ureteral stones (11.3 mm) was significantly less than the mean. However, type of anesthetic (general or regional) used was not a significant factor. Operator training, experience, and familiarity with radiation physics should significantly decrease the amount of imaging time and consequent patient radiation exposure during ESWL

  1. Variables influencing radiation exposure during extracorporeal shock wave lithotripsy. Review of 298 treatments

    Energy Technology Data Exchange (ETDEWEB)

    Carter, H.B.; Naeslund, E.B.R.; Riehle, R.A. Jr.

    1987-12-01

    Retrospective review of 298 extracorporeal shock wave lithotripsy (ESWL) treatments was undertaken to determine the factors which influence radiation exposure during ESWL. Fluoroscopy time averaged 160 seconds (3-509), and the average number of spot films taken per patient was 26 (5-68). The average stone burden was 19.3 mm (3-64). Average calculated skin surface radiation exposure was 17.8 R per treatment. Radiation exposure increased with increasing stone burden and patient weight. Stones treated in the ureter resulted in a higher average patient radiation exposure than for renal stones (19 R vs 16 R), even though the average size of these ureteral stones (11.3 mm) was significantly less than the mean. However, type of anesthetic (general or regional) used was not a significant factor. Operator training, experience, and familiarity with radiation physics should significantly decrease the amount of imaging time and consequent patient radiation exposure during ESWL.

  2. A simulation model for the actual, long wave and net solar radiation computing

    International Nuclear Information System (INIS)

    Kolev, B.; Stoilov, A.; Lyubomirov, L.

    2004-01-01

    The main purpose of this study is to present a calculating procedure for the components of the radiation balance - actual, long-wave and net radiation calculation, using the sunshine duration and the standard meteorological information, through a previously prepared program product.To calculate the actual solar radiation using the total cloudiness only, an empirical regression model has been developed. The results of the coefficient of correlation R(0.75-0.88), respectively for the spring and summer periods (March-May; June-August) show the adequacy of the chosen model. The verification of the model on the independent experimental material prove that the approach that authors suggested, can be successfully applied to the calculation of the actual radiation of the current place

  3. Mechanistic comparison of pulse laser induced phase separation of particulates from cellulose paper at 213 nm and 532 nm

    Energy Technology Data Exchange (ETDEWEB)

    Arif, S.; Forster, M.; Kautek, W. [University of Vienna, Department of Physical Chemistry, Wien (Austria); Bushuk, S.; Kouzmouk, A.; Tatur, H.; Batishche, S. [National Academy of Sciences of the Republic of Belarus, Institute of Physics, Minsk (Belarus)

    2013-02-15

    The laser-induced phase separation of charcoal particles on additive-free cotton linters cellulose paper was investigated by electron and optical microscopy, colorimetry, and diffuse reflectance FT-IR. The fibre bundles were vaporised in depth of several 10 {mu}m above destruction fluence thresholds using visible 532 nm radiation. This is in contrast to mid-ultraviolet 213 nm radiation, where only the top fibre bundles were modified and partially evaporated. The colorimetric lightness results generally represented the cleaning status, whereas the colorimetric yellowing data represented irreversible chemical and/or photochemical changes. Charcoal-contaminated paper treated with visible and mid-ultraviolet radiation exhibited yellowing, whereas uncontaminated did not. This suggests that the electron-rich plasma generated by the evaporation of the particles heats the adjacent substrate and also excludes oxygen. Mid-ultraviolet, in contrast to visible radiation, shows particle removal always accompanied by paper destruction. IR spectroscopy results suggest cross-linking by ether bonds near the destruction threshold, but do not prove the formation of oxidation products and double bonds as the basis of the yellowing. A ''cleaning window'' between the cleaning threshold (0.1 J/cm{sup 2}) and the paper destruction threshold (2.9 J/cm{sup 2}) with a pulse number of 2 is provided by visible 532 nm laser treatment. (orig.)

  4. Exploiting large-scale correlations to detect continuous gravitational waves.

    Science.gov (United States)

    Pletsch, Holger J; Allen, Bruce

    2009-10-30

    Fully coherent searches (over realistic ranges of parameter space and year-long observation times) for unknown sources of continuous gravitational waves are computationally prohibitive. Less expensive hierarchical searches divide the data into shorter segments which are analyzed coherently, then detection statistics from different segments are combined incoherently. The novel method presented here solves the long-standing problem of how best to do the incoherent combination. The optimal solution exploits large-scale parameter-space correlations in the coherent detection statistic. Application to simulated data shows dramatic sensitivity improvements compared with previously available (ad hoc) methods, increasing the spatial volume probed by more than 2 orders of magnitude at lower computational cost.

  5. 30 CFR 285.700 - What reports must I submit to MMS before installing facilities described in my approved SAP, COP...

    Science.gov (United States)

    2010-07-01

    ... installing facilities described in my approved SAP, COP, or GAP? 285.700 Section 285.700 Mineral Resources... § 285.700 What reports must I submit to MMS before installing facilities described in my approved SAP... in your approved COP (§ 285.632(a)) and, when required by this part, your SAP (§ 285.614(b)) or GAP...

  6. Coherently combining data between detectors for all-sky semi-coherent continuous gravitational wave searches

    International Nuclear Information System (INIS)

    Goetz, E; Riles, K

    2016-01-01

    We present a method for coherently combining short data segments from gravitational-wave detectors to improve the sensitivity of semi-coherent searches for continuous gravitational waves. All-sky searches for continuous gravitational waves from unknown sources are computationally limited. The semi-coherent approach reduces the computational cost by dividing the entire observation timespan into short segments to be analyzed coherently, then combined together incoherently. Semi-coherent analyses that attempt to improve sensitivity by coherently combining data from multiple detectors face a computational challenge in accounting for uncertainties in signal parameters. In this article, we lay out a technique to meet this challenge using summed Fourier transform coefficients. Applying this technique to one all-sky search algorithm called TwoSpect, we confirm that the sensitivity of all-sky, semi-coherent searches can be improved by coherently combining the short data segments, e.g., by up to 42% over a single detector for an all-sky search. For misaligned detectors, however, this improvement requires careful attention when marginalizing over unknown polarization parameters. In addition, care must be taken in correcting for differential detector velocity due to the Earth’s rotation for high signal frequencies and widely separated detectors. (paper)

  7. Time series analysis of continuous-wave coherent Doppler Lidar wind measurements

    International Nuclear Information System (INIS)

    Sjoeholm, M; Mikkelsen, T; Mann, J; Enevoldsen, K; Courtney, M

    2008-01-01

    The influence of spatial volume averaging of a focused 1.55 μm continuous-wave coherent Doppler Lidar on observed wind turbulence measured in the atmospheric surface layer over homogeneous terrain is described and analysed. Comparison of Lidar-measured turbulent spectra with spectra simultaneously obtained from a mast-mounted sonic anemometer at 78 meters height at the test station for large wind turbines at Hoevsoere in Western Jutland, Denmark is presented for the first time

  8. Radiation from an equilibrium CO2-N2 plasma in the [250-850 nm] spectral region: II. Spectral modelling

    International Nuclear Information System (INIS)

    Silva, M Lino da; Vacher, D; Andre, P; Faure, G; Dudeck, M

    2008-01-01

    In the first part of this work, described in a previous paper, the thermodynamic conditions in an atmospheric pressure inductively coupled CO 2 -N 2 plasma have been determined, and the radiation emission spectrum has been measured and calibrated in the [250-850 nm] spectral region. In the second part of this work, a synthetic radiation spectrum is obtained taking into account (a) the geometry of the plasma torch and (b) the local thermodynamic conditions of the plasma. This synthetic spectrum has then been compared against the measured spectrum. The good agreement between the two spectra allows validating the spectral database of the line-by-line code SPARTAN for the simulation of the radiative emission of CO 2 -N 2 plasmas from the near-UV to the near-IR spectral region.

  9. Wave fronts of electromagnetic cyclotron harmonic waves

    International Nuclear Information System (INIS)

    Ohnuma, T.; Watanabe, T.

    1982-01-01

    In an inhomogeneous high-density magnetized plasma, the spatial properties of the wave fronts and ray trajectories of electromagnetic ordinary and extraordinary cyclotron harmonic waves are investigated. Those waves which are radiated from a local source are found to have wave fronts which are almost parallel to the magnetic field. Also, the reflective properties of the electromagnetic cyclotron harmonic waves are confirmed

  10. The use of laser-induced shock wave plasma spectroscopy (LISPS) for examining physical characteristics of pharmaceutical products

    Energy Technology Data Exchange (ETDEWEB)

    Abdulmadjid, Syahrun Nur, E-mail: syahrun-madjid@yahoo.com; Lahna, Kurnia, E-mail: kurnialahna@gmail.com [Department of Physics, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23111, Aceh (Indonesia); Desiyana, Lydia Septa, E-mail: lydia-septa@yahoo.com [Department of Pharmacy, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23111, Aceh (Indonesia)

    2016-03-11

    An experimental study has been performed to examine the physical characteristics of pharmaceutical products, such as tablet, by employing an emission plasma induced by Nd-YAG laser at a low pressure of Helium gas. The hardness of tablet is one of the parameters that examined during the production process for standard quality of pharmaceutical products. In the Laser-Induced Shock Wave Plasma Spectroscopy (LISPS), the shock wave has a significant role in inducing atomic excitation. It was known that, the speed of the shock wavefront depends on the hardness of the sample, and it correlates with the ionization rate of the ablated atoms. The hardness of the tablet is examined using the intensity ratio between the ion of Mg (II) 275.2 nm and the neutral of Mg (I) 285.2 nm emission lines detected from the laser-induced plasma. It was observed that the ratio changes with respect to the change in the tablet hardness, namely the ratio is higher for the hard tablet. Besides the ratio measurements, we also measured the depth profile of a tablet by focusing 60 shots of irradiation of laser light at a fixed position on the surface of the tablet. It was found that the depth profile varies differently with the hardness of the tablet. These experiment results show that the technique of LISPS can be applied to examine the quality of pharmaceutical products.

  11. The use of laser-induced shock wave plasma spectroscopy (LISPS) for examining physical characteristics of pharmaceutical products

    International Nuclear Information System (INIS)

    Abdulmadjid, Syahrun Nur; Lahna, Kurnia; Desiyana, Lydia Septa

    2016-01-01

    An experimental study has been performed to examine the physical characteristics of pharmaceutical products, such as tablet, by employing an emission plasma induced by Nd-YAG laser at a low pressure of Helium gas. The hardness of tablet is one of the parameters that examined during the production process for standard quality of pharmaceutical products. In the Laser-Induced Shock Wave Plasma Spectroscopy (LISPS), the shock wave has a significant role in inducing atomic excitation. It was known that, the speed of the shock wavefront depends on the hardness of the sample, and it correlates with the ionization rate of the ablated atoms. The hardness of the tablet is examined using the intensity ratio between the ion of Mg (II) 275.2 nm and the neutral of Mg (I) 285.2 nm emission lines detected from the laser-induced plasma. It was observed that the ratio changes with respect to the change in the tablet hardness, namely the ratio is higher for the hard tablet. Besides the ratio measurements, we also measured the depth profile of a tablet by focusing 60 shots of irradiation of laser light at a fixed position on the surface of the tablet. It was found that the depth profile varies differently with the hardness of the tablet. These experiment results show that the technique of LISPS can be applied to examine the quality of pharmaceutical products.

  12. Cold plasma waves

    International Nuclear Information System (INIS)

    Booker, H.G.

    1984-01-01

    The book aims to present current knowledge concerning the propagation of electromagnetic waves in a homogeneous magnetoplasma for which temperature effects are unimportant. It places roughly equal emphasis on the radio and the hydromagnetic parts of the electromagnetic spectrum. The dispersion properties of a magnetoplasma are treated as a function both of wave frequency (assumed real) and of ionization density. The effect of collisions is included only in so far as this can be done with simplicity. The book describes how pulses are radiated from both small and large antennas embedded in a homogeneous magnetoplasma. The power density radiated from a type of dipole antenna is studied as a function of direction of radiation in all bands of wave frequency. Input reactance is not treated, but the dependence of radiation resistance on wave frequency is described for the entire electromagnetic spectrum. Also described is the relation between beaming and guidance for Alfven waves. (Auth.)

  13. Effect of Early Diagnosis and Treatment on the Prognosis of Children with Epilepsy Accompanied by Continuous Spikes and Waves during Slow Wave Sleep

    Directory of Open Access Journals (Sweden)

    Jiahua Ju

    2014-03-01

    Full Text Available Objective: To emphasize the importance of early diagnosis and treatment on the prognosis of children with epilepsy accompanied by continuous spikes and waves during slow wave sleep (CSCW. Methods: The clinical characteristics, electroencephalogram (ECG features, treatment and prognosis of 12 children with CSCW in our hospital were retrospectively analyzed, and the followup of 6 months to 4 years was given. Results: Imaging showed that 8 children suffered from brain lesions, while other 4 were normal. The initial onset of 10 children was at night, whereas 2 began with absence seizure in lucid interval, and they gradually appeared comprehensive brain function decline, meanwhile, ECG was characterized by continuous discharge during slow wave sleep. After 3 months of treatment with valproic acid, clonazepam, lamotrigine and hormones, the clinical symptoms and ECG of 10 children improved significantly, in which 3 ones recurred after 6 months of comprehensive treatment. Conclusion: The early manifestation of CSWS is untypical, and hence, early diagnosis and treatment can ameliorate the epileptic seizures of children, effectively inhibit epileptic electrical activity and has favorable prognosis.

  14. Search for continuous gravitational waves from neutron stars in globular cluster NGC 6544

    NARCIS (Netherlands)

    Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bejger, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bond, T.C; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. S. Y.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fenyvesi, E.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gehrels, N.; Gemme, G.; Geng, P.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.A.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jian, L.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chi-Woong; Kim, Chunglee; Kim, J.; Kim, K.; Kim, Namjun; Kim, W.; Kim, Y.M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Laxen, M.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Lewis, J. B.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Zertuche, L. Magana; Magee, R. M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A. L.; Miller, B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Nedkova, K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patel, P.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Perri, L. M.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Rizzo, D.M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O. E. S.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoebeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torres, C. V.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D.S.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.; Sigurdsson, S.

    2017-01-01

    We describe a directed search for continuous gravitational waves in data from the sixth initial LIGO science run. The target was the nearby globular cluster NGC 6544 at a distance of approximate to 2.7 kpc. The search covered a broad band of frequencies along with first and second frequency

  15. Distinguishing transient signals and instrumental disturbances in semi-coherent searches for continuous gravitational waves with line-robust statistics

    International Nuclear Information System (INIS)

    Keitel, David

    2016-01-01

    Non-axisymmetries in rotating neutron stars emit quasi-monochromatic gravitational waves. These long-duration ‘continuous wave’ signals are among the main search targets of ground-based interferometric detectors. However, standard detection methods are susceptible to false alarms from instrumental artefacts that resemble a continuous-wave signal. Past work [Keitel, Prix, Papa, Leaci and Siddiqi 2014, Phys. Rev. D 89 064023] showed that a Bayesian approach, based on an explicit model of persistent single-detector disturbances, improves robustness against such artefacts. Since many strong outliers in semi-coherent searches of LIGO data are caused by transient disturbances that last only a few hours or days, I describe in a recent paper [Keitel D 2015, LIGO-P1500159] how to extend this approach to cover transient disturbances, and demonstrate increased sensitivity in realistic simulated data. Additionally, neutron stars could emit transient signals which, for a limited time, also follow the continuous-wave signal model. As a pragmatic alternative to specialized transient searches, I demonstrate how to make standard semi-coherent continuous-wave searches more sensitive to transient signals. Focusing on the time-scale of a single segment in the semi-coherent search, Bayesian model selection yields a simple detection statistic without a significant increase in computational cost. This proceedings contribution gives a brief overview of both works. (paper)

  16. Radiation characteristics of input power from surface wave sustained plasma antenna

    Energy Technology Data Exchange (ETDEWEB)

    Naito, T., E-mail: Naito.Teruki@bc.MitsubishiElectric.co.jp [Advanced Technology R& D Center, Mitsubishi Electric Corporation, Amagasaki, Hyogo 661-8661 (Japan); Yamaura, S. [Information Technology R& D Center, Mitsubishi Electric Corporation, Kamakura, Kanagawa 247-8501 (Japan); Fukuma, Y. [Communication System Center, Mitsubishi Electric Corporation, Amagasaki, Hyogo 661-8661 (Japan); Sakai, O. [Department of Electronic System Engineering, The University of Shiga Prefecture, Hikone, Shiga 522-8533 (Japan)

    2016-09-15

    This paper reports radiation characteristics of input power from a surface wave sustained plasma antenna investigated theoretically and experimentally, especially focusing on the power consumption balance between the plasma generation and the radiation. The plasma antenna is a dielectric tube filled with argon and small amount of mercury, and the structure is a basic quarter wavelength monopole antenna at 2.45 GHz. Microwave power at 2.45 GHz is supplied to the plasma antenna. The input power is partially consumed to sustain the plasma, and the remaining part is radiated as a signal. The relationship between the antenna gain and the input power is obtained by an analytical derivation and numerical simulations. As a result, the antenna gain is kept at low values, and most of the input power is consumed to increase the plasma volume until the tube is filled with the plasma whose electron density is higher than the critical electron density required for sustaining the surface wave. On the other hand, the input power is consumed to increase the electron density after the tube is fully filled with the plasma, and the antenna gain increases with increasing the electron density. The dependence of the antenna gain on the electron density is the same as that of a plasma antenna sustained by a DC glow discharge. These results are confirmed by experimental results of the antenna gain and radiation patterns. The antenna gain of the plasma is a few dB smaller than that of the identical metal antenna. The antenna gain of the plasma antenna is sufficient for the wireless communication, although it is difficult to substitute the plasma antenna for metal antennas completely. The plasma antenna is suitable for applications having high affinity with the plasma characteristics such as low interference and dynamic controllability.

  17. Radiation characteristics of input power from surface wave sustained plasma antenna

    International Nuclear Information System (INIS)

    Naito, T.; Yamaura, S.; Fukuma, Y.; Sakai, O.

    2016-01-01

    This paper reports radiation characteristics of input power from a surface wave sustained plasma antenna investigated theoretically and experimentally, especially focusing on the power consumption balance between the plasma generation and the radiation. The plasma antenna is a dielectric tube filled with argon and small amount of mercury, and the structure is a basic quarter wavelength monopole antenna at 2.45 GHz. Microwave power at 2.45 GHz is supplied to the plasma antenna. The input power is partially consumed to sustain the plasma, and the remaining part is radiated as a signal. The relationship between the antenna gain and the input power is obtained by an analytical derivation and numerical simulations. As a result, the antenna gain is kept at low values, and most of the input power is consumed to increase the plasma volume until the tube is filled with the plasma whose electron density is higher than the critical electron density required for sustaining the surface wave. On the other hand, the input power is consumed to increase the electron density after the tube is fully filled with the plasma, and the antenna gain increases with increasing the electron density. The dependence of the antenna gain on the electron density is the same as that of a plasma antenna sustained by a DC glow discharge. These results are confirmed by experimental results of the antenna gain and radiation patterns. The antenna gain of the plasma is a few dB smaller than that of the identical metal antenna. The antenna gain of the plasma antenna is sufficient for the wireless communication, although it is difficult to substitute the plasma antenna for metal antennas completely. The plasma antenna is suitable for applications having high affinity with the plasma characteristics such as low interference and dynamic controllability.

  18. Enhanced polarization of the cosmic microwave background radiation from thermal gravitational waves.

    Science.gov (United States)

    Bhattacharya, Kaushik; Mohanty, Subhendra; Nautiyal, Akhilesh

    2006-12-22

    If inflation was preceded by a radiation era, then at the time of inflation there will exist a decoupled thermal distribution of gravitons. Gravitational waves generated during inflation will be amplified by the process of stimulated emission into the existing thermal distribution of gravitons. Consequently, the usual zero temperature scale invariant tensor spectrum is modified by a temperature dependent factor. This thermal correction factor amplifies the B-mode polarization of the cosmic microwave background radiation by an order of magnitude at large angles, which may now be in the range of observability of the Wilkinson Microwave Anisotropy Probe.

  19. Continuity of Earth Radiation Budget Observations

    Science.gov (United States)

    Loeb, N. G.; Su, W.; Wong, T.; Priestley, K.

    2017-12-01

    Earth's climate is determined by the exchange of radiant energy between the Sun, Earth and space. The absorbed solar radiation at the top-of-atmosphere (TOA) fuels the climate system, providing the energy required for atmospheric and oceanic motions. Earth's radiation budget (ERB) involves a balance between how much solar energy Earth absorbs and how much terrestrial thermal infrared radiation is emitted to space. Because of its critical role in climate, continuous monitoring of the ERB is necessary for improved understanding and prediction of climate variability and change. NASA's long history in observing the TOA ERB is acknowledged in the 2007 and 2013 reports of the IPCC (IPCC 2007, 2013), the 2007 NRC Decadal Survey (NRC 2007), and the GCOS implementation plan of the WMO (GCOS 2016). A key reason for NASA's success in this area is due to its support of the CERES Project and its predecessor, ERBE. During ERBE, the TOA ERB was observed using both scanner and nonscanner broadband instruments. The CERES project consists of six scanner instruments flying alongside high-resolution spectral imagers (MODIS, VIIRS) in morning and afternoon sun-synchronous orbits. In addition to extending the ERBE TOA radiation budget record, CERES also provides observations of Earth's surface radiation budget with unprecedented accuracy. Here we assess the likelihood of a measurement gap in the ERB record. We show that unless a follow-on ERB instrument to the last available CERES copy (FM6) is built and launched, there is a significant risk of a measurement gap in the ERB record by the mid-2020s. A gap is of concern not only because the ERB would not be monitored during the gap period but also because it would be exceedingly difficult to tie the records before and after the gap together with sufficient accuracy for climate analyses. While ERB instruments are highly stable temporally, they lack the absolute accuracy needed to bridge a gap. Consequently, there is a requirement that

  20. CARS Measurement of Vibrational/Rotational Temperatures with Total Radiation Visualization behind Strong Shock Waves of 5-7 km/s

    Science.gov (United States)

    Sakurai, K.; Bindu, V. Hima; Niinomi, S.; Ota, M.; Maeno, K.

    2011-05-01

    In the development of aerospace technology the design of space vehicles is important in phase of reentry flight. The space vehicles reenter into the atmosphere with range of 6-8 km/s. The non-equilibrium flow with radiative heating from strongly shocked air ahead of the vehicles plays an important role on the heat flux to the wall surface structure as well as convective heating. The experimental data for re-entry analyses, however, have remained in classical level. Recent development of optical instruments enables us to have novel approach of diagnostics to the re-entry problems. We employ the CARS (Coherent Anti-Stokes Raman Spectroscopy) method for measurement of real gas temperatures of N2 with radiation of the strong shock wave. The CARS signal can be acquired even in the strong radiation area behind the strong shock waves. In addition, we try to use the CCD camera to obtain 2D images of total radiation simultaneously. The strong shock wave in front of the reentering space vehicles is experimentally realigned by free-piston, double-diaphragm shock tube with low density test gas.