WorldWideScience

Sample records for contiguous gene deletions

  1. Xp21 contiguous gene syndromes: Deletion quantitation with bivariate flow karyotyping allows mapping of patient breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, E.R.B.; Towbin, J.A. (Baylor College of Medicine, Houston, TX (United States)); Engh, G. van den; Trask, B.J. (Lawrence Livermore National Lab., CA (United States))

    1992-12-01

    Bivariate flow karyotyping was used to estimate the deletion sizes for a series of patients with Xp21 contiguous gene syndromes. The deletion estimates were used to develop an approximate scale for the genomic map in Xp21. The bivariate flow karyotype results were compared with clinical and molecular genetic information on the extent of the patients' deletions, and these various types of data were consistent. The resulting map spans >15 Mb, from the telomeric interval between DXS41 (99-6) and DXS68 (1-4) to a position centromeric to the ornithine transcarbamylase locus. The deletion sizing was considered to be accurate to [plus minus]1 Mb. The map provides information on the relative localization of genes and markers within this region. For example, the map suggests that the adrenal hypoplasia congenita and glycerol kinase genes are physically close to each other, are within 1-2 Mb of the telomeric end of the Duchenne muscular dystrophy (DMD) gene, and are nearer to the DMD locus than to the more distal marker DXS28 (C7). Information of this type is useful in developing genomic strategies for positional cloning in Xp21. These investigations demonstrate that the DNA from patients with Xp21 contiguous gene syndromes can be valuable reagents, not only for ordering loci and markers but also for providing an approximate scale to the map of the Xp21 region surrounding DMD. 44 refs., 3 figs.

  2. First contiguous gene deletion causing biotinidase deficiency: The enzyme deficiency in three Sri Lankan children

    Directory of Open Access Journals (Sweden)

    Danika Nadeen Senanayake

    2015-03-01

    Full Text Available We report three symptomatic children with profound biotinidase deficiency from Sri Lanka. All three children presented with typical clinical features of the disorder. The first is homozygous for a missense mutation in the BTD gene (c.98_104 del7insTCC; p.Cys33PhefsX36 that is commonly seen in the western countries, the second is homozygous for a novel missense mutation (p.Ala439Asp, and the third is the first reported instance of a contiguous gene deletion causing the enzyme deficiency. In addition, this latter finding exemplifies the importance of considering a deletion within the BTD gene for reconciling enzymatic activity with genotype, which can occur in asymptomatic children who are identified by newborn screening.

  3. Chronic granulomatous disease, the McLeod phenotype and the contiguous gene deletion syndrome-a review

    Directory of Open Access Journals (Sweden)

    Watkins Casey E

    2011-11-01

    Full Text Available Abstract Chronic Granulomatous Disease (CGD, a disorder of the NADPH oxidase system, results in phagocyte functional defects and subsequent infections with bacterial and fungal pathogens (such as Aspergillus species and Candida albicans. Deletions and missense, frameshift, or nonsense mutations in the gp91phox gene (also termed CYBB, located in the Xp21.1 region of the X chromosome, are associated with the most common form of CGD. When larger X-chromosomal deletions occur, including the XK gene deletion, a so-called "Contiguous Gene Deletion Syndrome" may result. The contiguous gene deletion syndrome is known to associate the Kell phenotype/McLeod syndrome with diseases such as X-linked chronic granulomatous disease, Duchenne muscular dystrophy, and X-linked retinitis pigmentosa. These patients are often complicated and management requires special attention to the various facets of the syndrome.

  4. Kallmann syndrome and ichthyosis: a case of contiguous gene deletion syndrome

    Directory of Open Access Journals (Sweden)

    Irene Berges-Raso

    2017-09-01

    Full Text Available Kallmann syndrome is a genetically heterogeneous form of hypogonadotropic hypogonadism caused by gonadotropin-releasing hormone deficiency and characterized by anosmia or hyposmia due to hypoplasia of the olfactory bulbs; osteoporosis and metabolic syndrome can develop due to longstanding untreated hypogonadism. Kallmann syndrome affects 1 in 10 000 men and 1 in 50 000 women. Defects in 17 genes, including KAL1, have been implicated. Kallmann syndrome can be associated with X-linked ichthyosis, a skin disorder characterized by early onset dark, dry, irregular scales affecting the limb and trunk, caused by a defect of the steroid sulfatase gene (STS. Both KAL1 and STS are located in the Xp22.3 region; therefore, deletions in this region cause a contiguous gene syndrome. We report the case of a 32-year-old man with ichthyosis referred for evaluation of excessive height (2.07 m and weight (BMI: 29.6 kg/m2, microgenitalia and absence of secondary sex characteristics. We diagnosed Kallmann syndrome with ichthyosis due to a deletion in Xp22.3, a rare phenomenon.

  5. Central precocious puberty in a patient with X-linked adrenal hypoplasia congenita and Xp21 contiguous gene deletion syndrome

    Directory of Open Access Journals (Sweden)

    Ji Won Koh

    2013-06-01

    Full Text Available X-linked adrenal hypoplasia congenita is caused by the mutation of DAX-1 gene (dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1, and can occur as part of a contiguous gene deletion syndrome in association with glycerol kinase (GK deficiency, Duchenne muscular dystrophy and X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1 gene deficiency. It is usually associated with hypogonadotropic hypogonadism, although in rare cases, it has been reported to occur in normal puberty or even central precocious puberty. This study addresses a case in which central precocious puberty developed in a boy with X-linked adrenal hypoplasia congenita who had complete deletion of the genes DAX-1, GK and IL1RAPL1 (Xp21 contiguous gene deletion syndrome. Initially he was admitted for the management of adrenal crisis at the age of 2 months, and managed with hydrocortisone and florinef. At 45 months of age, his each testicular volumes of 4 mL and a penile length of 5 cm were noted, with pubic hair of Tanner stage 2. His bone age was advanced and a gonadotropin-releasing hormone (GnRH stimulation test showed a luteinizing hormone peak of 8.26 IU/L, confirming central precocious puberty. He was then treated with a GnRH agonist, as well as steroid replacement therapy. In Korea, this is the first case of central precocious puberty developed in a male patient with X-linked adrenal hypoplasia congenita.

  6. A novel contiguous deletion involving NDP, MAOBitalic> and ...

    Indian Academy of Sciences (India)

    The contiguous deletion of NDP and its neighbouring genes, MAOA/B and EFHC2, reportedly leads to syndromic clinical features such as microcephaly, intellectual disability, and epilepsy. Herewe report a novel contiguous microdeletion of theNDPregion containing theMAOBandEFHC2genes,which causes eye defects but ...

  7. Greig cephalopolysyndactyly syndrome: Altered phenotype of a contiguous gene syndrome by the presence of a chromosomal deletion

    Energy Technology Data Exchange (ETDEWEB)

    Hersh, J.H.; Williams, P.G.; Yen, F.F. [Univ. of Louisville, KY (United States)] [and others

    1994-09-01

    Greig cephalopolysyndactyly syndrome (GCPS) is characterized by craniofacial anomalies, broad thumbs and halluces, polydactyly of the hands and feet, and variable syndactyly. Intellectual abilities are usually normal. Inheritance is in an autosomal dominant fashion. The disorder has been mapped to chromosome 7p13, suggesting that the condition represents a contiguous gene syndrome (CGS). A male infant presented with multiple congenital anomalies, including omphalocele, dysgenesis of the corpus callosum, hydrocephalus, esotropia, broad thumbs and halluces, syndactyly, polydactyly of one foot, hypotonia and developmental delay. A de novo interstitial deletion of chromosome 7p was detected, 46,XY,del(7)(p13p15). Although clinical findings in this case were reminiscent of GCPS, and the chromosomal abnormality included the region assigned to the candidate gene for this syndrome, additional physical abnormalities were present, as well as cognitive deficits. Some of these features have been previously described in patients with chromosomal deletions of 7p. The chromosomal abnormality in our case provides supportive evidence of the gene locus in GCPS, and that GCPS represents a new CGS. However, a larger deletion, extending beyond the limits of the gene, significantly altered the phenotype. Isolation of the gene responsible for GCPS, and identification of additional patients with chromosomal abnormalities in this region of chromosome 7, should help to provide more accurate genotype-phenotype correlations.

  8. Genotype-phenotype correlation of contiguous gene deletions of SLC6A8, BCAP31 and ABCD1.

    Science.gov (United States)

    van de Kamp, J M; Errami, A; Howidi, M; Anselm, I; Winter, S; Phalin-Roque, J; Osaka, H; van Dooren, S J M; Mancini, G M; Steinberg, S J; Salomons, G S

    2015-02-01

    The BCAP31 gene is located between SLC6A8, associated with X-linked creatine transporter deficiency, and ABCD1, associated with X-linked adrenoleukodystrophy. Recently, loss-of-function mutations in BCAP31 were reported in association with severe developmental delay, deafness and dystonia. We characterized the break points in eight patients with deletions of SLC6A8, BCAP31 and/or ABCD1 and studied the genotype-phenotype correlations. The phenotype in patients with contiguous gene deletions involving BCAP31 overlaps with the phenotype of isolated BCAP31 deficiency. Only deletions involving both BCAP31 and ABCD1 were associated with hepatic cholestasis and death before 1 year, which might be explained by a synergistic effect. Remarkably, a patient with an isolated deletion at the 3'-end of SLC6A8 had a similar severe phenotype as seen in BCAP31 deficiency but without deafness. This might be caused by the disturbance of a regulatory element between SLC6A8 and BCAP31. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Goldenhar and cri-du-chat syndromes: a contiguous gene deletion syndrome?

    Science.gov (United States)

    Choong, Yee Fong; Watts, Patrick; Little, Elizabeth; Beck, Lyn

    2003-06-01

    We report a full-term male infant born to nonconsanguinous parents who had clinical features of Goldenhar syndrome and cri du chat syndrome. At birth, the infant was noted to have dysmorphic features with bilateral preauricular tags, rotated ears, bilateral epicanthic folds, a left epibulbar lipodermoid, and an accessory left nipple. After he was assessed for feeding difficulty and tachypnea, he was found to have esophageal atresia with tracheoesophageal fistula. In addition, he had a high-pitched, cat-like cry, characteristic of cri-du-chat syndrome. He also failed a hearing test. Chromosomal analysis and fluorescence in situ hybridisation studies showed an unbalanced karyotype with a terminal deletion of the segment p14 on the short arm of chromosome 5, which is consistent with the cri-du-chat locus. The association of Goldenhar syndrome and cri-du-chat syndrome in this patient suggests that the chromosome 5p14 locus may harbor a gene implicated with Goldenhar syndrome.

  10. Osteopathia striata congenita with cranial sclerosis and intellectual disability due to contiguous gene deletions involving the WTX locus.

    Science.gov (United States)

    Holman, S K; Morgan, T; Baujat, G; Cormier-Daire, V; Cho, T-J; Lees, M; Samanich, J; Tapon, D; Hove, H D; Hing, A; Hennekam, R; Robertson, S P

    2013-03-01

    Osteopathia striata congenita with cranial sclerosis (OSCS) is a skeletal dysplasia caused by germline deletions of or truncating point mutations in the X-linked gene WTX (FAM123B, AMER1). Females present with longitudinal striations of sclerotic bone along the long axis of long bones and cranial sclerosis, with a high prevalence of cleft palate and hearing loss. Intellectual disability or neurodevelopmental delay is not observed in females with point mutations in WTX leading to OSCS. One female has been described with a deletion spanning multiple neighbouring genes suggesting that deletion of some neighbouring loci may result in abnormal neurodevelopment. In this cohort of 13 females with OSCS resulting from deletions of WTX, a relationship is observed where deletion of ARHGEF9 and/or MTMR8 in conjunction with WTX results in an additional neurodevelopmental phenotype whereas deletion of ASB12 along with WTX is associated with a good neurodevelopmental prognosis. © 2012 John Wiley & Sons A/S.

  11. A novel contiguous deletion involving MAOB and EFHC2 gene in a ...

    Indian Academy of Sciences (India)

    BEI JIA

    2017-12-18

    Dec 18, 2017 ... of theNDPregion containing theMAOBandEFHC2genes, which causes eye defects but no cognitive disability. We detected ... irides, corneal opacification, and cataracts, but no symptoms of microcephaly, intellectual disability, and epilepsy. This familial ..... and MAOB. This theory is also supported by a study.

  12. Distal Xq28 microdeletions: clarification of the spectrum of contiguous gene deletions involving ABCD1, BCAP31, and SLC6A8 with a new case and review of the literature.

    Science.gov (United States)

    Calhoun, Amy R U L; Raymond, Gerald V

    2014-10-01

    The contiguous ABCD1/DXS1375E (BCAP31) deletion syndrome (CADDS) is a rare X-linked contiguous gene deletion syndrome with a severe clinical phenotype that includes marked delays, significant growth failure, liver dysfunction, and early death. The X-linked creatine transporter deficiency is a considerably more common and a cause of X-linked intellectual disability; however, multi-exon deletions of the creatine transporter are rare. We report the fifth case of CADDS, who also has a deletion of the X-linked creatine transporter. We also review reported cases of deletions in this region in order to clarify the clinical spectrum of contiguous microdeletions in this region. © 2014 Wiley Periodicals, Inc.

  13. Contiguous Deletion of the X-Linked Adrenoleukodystrophy Gene (ABCD1) and DXS1357E: A Novel Neonatal Phenotype Similar to Peroxisomal Biogenesis Disorders

    Science.gov (United States)

    Corzo, Deyanira; Gibson, William; Johnson, Kisha; Mitchell, Grant; LePage, Guy; Cox, Gerald F.; Casey, Robin; Zeiss, Carolyn; Tyson, Heidi; Cutting, Garry R.; Raymond, Gerald V.; Smith, Kirby D.; Watkins, Paul A.; Moser, Ann B.; Moser, Hugo W.; Steinberg, Steven J.

    2002-01-01

    X-linked adrenoleukodystrophy (X-ALD) results from mutations in ABCD1. ABCD1 resides on Xq28 and encodes an integral peroxisomal membrane protein (ALD protein [ALDP]) that is of unknown function and that belongs to the ATP-binding cassette–transporter superfamily. Individuals with ABCD1 mutations accumulate very-long-chain fatty acids (VLCFA) (carbon length >22). Childhood cerebral X-ALD is the most devastating form of the disease. These children have the earliest onset (age 7.2 ± 1.7 years) among the clinical phenotypes for ABCD1 mutations, but onset does not occur at syndromes and individuals with ABCD1 mutations, on the basis of the clinical presentation and measurement of other biochemical markers. We have identified three newborn boys who had clinical symptoms and initial biochemical results consistent with PBD or SED. In further study, however, we showed that they lacked ALDP, and we identified deletions that extended into the promoter region of ABCD1 and the neighboring gene, DXS1357E. Mutations in DXS1357E and the ABCD1 promoter region have not been described previously. We propose that the term “contiguous ABCD1 DXS1357E deletion syndrome” (CADDS) be used to identify this new contiguous-gene syndrome. The three patients with CADDS who are described here have important implications for genetic counseling, because individuals with CADDS may previously have been misdiagnosed as having an autosomal recessive PBD or SED PMID:11992258

  14. Osteopathia striata congenita with cranial sclerosis and intellectual disability due to contiguous gene deletions involving the WTX locus

    DEFF Research Database (Denmark)

    Holman, Sk; Morgan, T; Baujat, G

    2013-01-01

    Osteopathia striata congenita with cranial sclerosis (OSCS) is a skeletal dysplasia caused by germline deletions of or truncating point mutations in the X-linked gene WTX (FAM123B, AMER1). Females present with longitudinal striations of sclerotic bone along the long axis of long bones and cranial...

  15. Microcephaly, Intellectual Impairment, Bilateral Vesicoureteral Reflux, Distichiasis and Glomuvenous Malformations Associated with a 16q24.3 Contiguous Gene Deletion and a Glomulin Mutation

    Science.gov (United States)

    Butler, Matthew G.; Dagenais, Susan L.; Garcia-Perez, José L.; Brouillard, Pascal; Vikkula, Miikka; Strouse, Peter; Innis, Jeffrey W.; Glover, Thomas W.

    2012-01-01

    Two hereditary syndromes, lymphedema-distichiasis syndrome (LD) and blepharo-chelio-dontic (BCD) syndrome include the aberrant growth of eyelashes from the meibomian glands, known as distichiasis. LD is an autosomal dominant syndrome primarily characterized by distichiasis and the onset of lymphedema usually during puberty. Mutations in the forkhead transcription factor FOXC2 are the only known cause of LD. BCD syndrome consists of autosomal dominant abnormalities of the eyelid, lip, and teeth, and the etiology remains unknown. In this report, we describe a proband that presented with distichiasis, microcephaly, bilateral grade IV vesicoureteral reflux requiring ureteral re-implantation, mild intellectual impairment and apparent glomuvenous malformations. Distichiasis was present in three generations of the proband’s maternal side of the family. The glomuvenous malformations were severe in the proband, and maternal family members exhibited lower extremity varicosities of variable degree. A GLMN (glomulin) gene mutation was identified in the proband that accounts for the observed glomuvenous malformations; no other family member could be tested. TIE2 sequencing revealed no mutations. In the proband, an additional submicroscopic 265 kb contiguous gene deletion was identified in 16q24.3, located 609 kb distal to the FOXC2 locus, which was inherited from the proband’s mother. The deletion includes the C16ORF95, FBXO31, MAP1LC3B, and ZCCHC14 loci and 115 kb of a gene desert distal to FOXC2 and FOXL1. Thus, it is likely that the microcephaly, distichiasis, vesicoureteral and intellectual impairment in this family may be caused by the deletion of one or more of these genes and/or deletion of distant cis-regulatory elements of FOXC2 expression. PMID:22407726

  16. Greig cephalopolysyndactyly (GCPS) contiguous gene syndrome in a boy with a 14 Mb deletion in region 7p13-14 caused by a paternal balanced insertion (5; 7).

    Science.gov (United States)

    Schulz, Solveig; Volleth, Marianne; Muschke, Petra; Wieland, Ilse; Wieacker, Peter

    2008-01-01

    We report on a six years old boy with several features of Greig cephalopolysyndactyly syndrome (GCPS) including craniofacial dysmorphism, hypertelorism, heart defect, preaxial hexadactyly of toes, partial agenesis of corpus callosum, and severe developmental delay. Greig cephalopolysyndactyly (GCPS) can be caused by GLI3 deletions. In patients with large deletions which include additional genes, it is termed Greig cephalopolysyndactyly-contiguous gene syndrome (GCPS-CGS). It is generally believed that the deletion size correlates with disease severity. Nearly all cases appear to be a result of GLI3 de novo deletions. Chromosome analysis of our patient revealed a large deletion in chromosome 7(p13-p14). Unlike most previously described cases, we found that this deletion resulted from a paternal balanced insertional translocation of 7p13-14 into the long arm of chromosome 5.

  17. Chromosome 19p13.3 deletion in a child with Peutz-Jeghers syndrome, congenital heart defect, high myopia, learning difficulties and dysmorphic features: clinical and molecular characterization of a new contiguous gene syndrome

    Directory of Open Access Journals (Sweden)

    Josiane Souza

    2011-01-01

    Full Text Available The Peutz-Jeghers syndrome (PJS is an autosomal-dominant hamartomatous polyposis syndrome characterized by mucocutaneous pigmentation, gastrointestinal polyps and the increased risk of multiple cancers. The causative point mutation in the STK11 gene of most patients accounts for about 30% of the cases of partial and complete gene deletion. This is a report on a girl with PJS features, learning difficulties, dysmorphic features and cardiac malformation, bearing a de novo 1.1 Mb deletion at 19p13.3. This deletion encompasses at least 47 genes, including STK11. This is the first report on 19p13.3 deletion associated with a PJS phenotype, as well as other atypical manifestations, thereby implying a new contiguous gene syndrome.

  18. Genotype-phenotype correlation of contiguous gene deletions of SLC6A8, BCAP31 and ABCD1

    NARCIS (Netherlands)

    van de Kamp, J.M.; Errami, A.; Howidi, M.; Anselm, I.; Winter, S.; Phalin-Roque, J.; Osaka, H.; van Dooren, S.J.M.; Mancini, G.M.; Steinberg, S.J.; Salomons, G.

    2015-01-01

    The BCAP31 gene is located between SLC6A8, associated with X-linked creatine transporter deficiency, and ABCD1, associated with X-linked adrenoleukodystrophy. Recently, loss-of-function mutations in BCAP31 were reported in association with severe developmental delay, deafness and dystonia. We

  19. Tuberous sclerosis complex and polycystic kidney disease contiguous gene syndrome with Moyamoya disease.

    Science.gov (United States)

    Lai, Jonathan; Modi, Lopa; Ramai, Daryl; Tortora, Matthew

    2017-04-01

    Tuberous sclerosis complex (TSC) and autosomal dominant polycystic kidney disease (ADPKD) are two diseases sharing close genetic loci on chromosome 16. Due to contiguous gene syndrome, also known as contiguous gene deletion syndrome, the proximity of TSC2 and PKD1 genes increases the risk of co-deletion resulting in a shared clinical presentation. Furthermore, Moyamoya disease (MMD) is a rare vaso-occlusive disease in the circle of Willis. We present the first case of TSC2/PKD1 contiguous gene syndrome in a patient with MMD along with detailed histopathologic, radiologic, and cytogenetic analyses. We also highlight the clinical presentation and surgical complications in this case. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. Contiguous deletion of SLC6A8 and BAP31 in a patient with severe dystonia and sensorineural deafness.

    Science.gov (United States)

    Osaka, Hitoshi; Takagi, Atsushi; Tsuyusaki, Yu; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Shimbo, Hiroko; Saitsu, Hirotomo; Salomons, Gajja S; Jakobs, Cornelis; Aida, Noriko; Toshihiro, Shinka; Kuhara, Tomiko; Matsumoto, Naomichi

    2012-05-01

    We report here a 6-year-old boy exhibiting severe dystonia, profound intellectual and developmental disability with liver disease, and sensorineural deafness. A deficient creatine peak in brain (1)H-MR spectroscopy and high ratio of creatine/creatinine concentration in his urine lead us to suspect a creatine transporter (solute carrier family 6, member 8; SLC6A8) deficiency, which was confirmed by the inability to take up creatine into fibroblasts. We found a large ~19 kb deletion encompassing exons 5-13 of SLC6A8 and exons 5-8 of the B-cell receptor-associated protein (BAP31) gene. This case is the first report in which the SLC6A8 and BAP31 genes are both deleted. The phenotype of BAP31 mutations has been reported only as a part of Xq28 deletion syndrome or contiguous ATP-binding cassette, sub-family D, member 1 (ABCD1)/DXS1375E (BAP31) deletion syndrome [MIM ID #300475], where liver dysfunction and sensorineural deafness have been suggested to be attributed to the loss of function of BAP31. Our case supports the idea that the loss of BAP31 is related to liver dysfunction and hearing loss. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Seven gene deletions in seven days

    DEFF Research Database (Denmark)

    Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering...... genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system...... enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains...

  2. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Erah

    Pharmacotherapy Group,. Faculty of Pharmacy, University of Benin,. Benin City, 300001 Nigeria. All rights reserved. Available online at http://www.tjpr.org. Research Article. Angiotensin Converting Enzyme Insertion/Deletion. Gene Polymorphism: An Observational Study among. Diabetic Hypertensive Subjects in Malaysia.

  3. Are there ethnic differences in deletions in the dystrophin gene?

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, M.; Verma, I.C. [All India Inst. of Medical Sciences, New Delhi (India)

    1997-01-20

    We studied 160 cases of Duchenne muscular dystrophy (DMD) drawn from all parts of India, using multiplex PCR of 27 exons. Of these, 103 (64.4%) showed intragenic deletions. Most (69.7%) of the deletions involved exons 45-51. The phenotype of cases with deletion of single exons did not differ significantly from those with deletion of multiple exons. The distribution of deletions in studies from different countries was variable, but this was accounted for either by the small number of cases studied, or by fewer exons analyzed. It is concluded that there is likely to be no ethnic difference with respect to deletions in the DMD gene. 38 refs., 2 figs., 3 tabs.

  4. Frequency of KLK3 gene deletions in the general population.

    Science.gov (United States)

    Rodriguez, Santiago; Al-Ghamdi, Osama A; Guthrie, Philip Ai; Shihab, Hashem A; McArdle, Wendy; Gaunt, Tom; Alharbi, Khalid K; Day, Ian Nm

    2017-07-01

    Background One of the kallikrein genes ( KLK3) encodes prostate-specific antigen, a key biomarker for prostate cancer. A number of factors, both genetic and non-genetic, determine variation of serum prostate-specific antigen concentrations in the population. We have recently found three KLK3 deletions in individuals with very low prostate-specific antigen concentrations, suggesting a link between abnormally reduced KLK3 expression and deletions of KLK3. Here, we aim to determine the frequency of kallikrein gene 3 deletions in the general population. Methods The frequency of KLK3 deletions in the general population was estimated from the 1958 Birth Cohort sample ( n = 3815) using amplification ratiometry control system. In silico analyses using PennCNV were carried out in the same cohort and in NBS-WTCCC2 in order to provide an independent estimation of the frequency of KLK3 deletions in the general population. Results Amplification ratiometry control system results from the 1958 cohort indicated a frequency of KLK3 deletions of 0.81% (3.98% following a less stringent calling criterion). From in silico analyses, we found that potential deletions harbouring the KLK3 gene occurred at rates of 2.13% (1958 Cohort, n = 2867) and 0.99% (NBS-WTCCC2, n = 2737), respectively. These results are in good agreement with our in vitro experiments. All deletions found were in heterozygosis. Conclusions We conclude that a number of individuals from the general population present KLK3 deletions in heterozygosis. Further studies are required in order to know if interpretation of low serum prostate-specific antigen concentrations in individuals with KLK3 deletions may offer false-negative assurances with consequences for prostate cancer screening, diagnosis and monitoring.

  5. Interstitial deletion of 11q-implicating the KIRREL3 gene in the neurocognitive delay associated with Jacobsen syndrome.

    Science.gov (United States)

    Guerin, Andrea; Stavropoulos, Dimitri J; Diab, Yaser; Chénier, Sébastien; Christensen, Hilary; Kahr, Walter H A; Babul-Hirji, Riyana; Chitayat, David

    2012-10-01

    Jacobsen syndrome (JS) is a rare contiguous gene disorder characterized by a deletion within the distal part of the long arm of chromosome 11 ranging in size from 7 to 20 Mb. The clinical findings include characteristic dysmorphic features, growth and psychomotor delays and developmental anomalies involving the brain, eyes, heart, kidneys, immune, hematologic, endocrine, and gastrointestinal systems. The majority of cases are due to a terminal deletion of 11q; however interstitial deletions have also been reported. We report on a child with clinical manifestations consistent with JS who had a 2.899 Mb interstitial deletion at 11q24.2-q24.3 which is the smallest interstitial deletion reported so far to our knowledge. This deletion includes the KIRREL3 gene, and given our patient's history of neurocognitive delay and autism spectrum disorder, it raises the possibility that this gene is a candidate for the social and expressive language delay observed in our patient. Copyright © 2012 Wiley Periodicals, Inc.

  6. Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Back, Susan J. [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Andronikou, Savvas [University of the Witwatersrand, Radiology Department, Faculty of Health Sciences, Johannesburg (South Africa); Kilborn, Tracy [University of Cape Town, Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); Kaplan, Bernard S. [The Children' s Hospital of Philadelphia, Division of Nephrology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States); Darge, Kassa [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States)

    2015-03-01

    Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

  7. Xp22.3 interstitial deletion: a recognizable chromosomal abnormality encompassing VCX3A and STS genes in a patient with X-linked ichthyosis and mental retardation.

    Science.gov (United States)

    Ben Khelifa, Hela; Soyah, Najla; Ben-Abdallah-Bouhjar, Inesse; Gritly, Ryma; Sanlaville, Damien; Elghezal, Hatem; Saad, Ali; Mougou-Zerelli, Soumaya

    2013-09-25

    X-linked ichthyosis is a genetic disorder affecting the skin and caused by a deficit in the steroid sulfatase enzyme (STS), often associated with a recurrent microdeletion at Xp22.31. Most of the STS deleted patients have X-linked ichthyosis as the only clinical feature and it is believed that patients with more complex disorders including mental retardation could be present as a result of contiguous gene deletion. In fact, VCX3A gene, a member of the VCX (variable charge, X chromosome) gene family, was previously proposed as the candidate gene for X-linked non-specific mental retardation in patients with X-linked ichthyosis. We report on a boy with familial ichthyosis, dysmorphic features and moderate mental retardation with approximately 2 Mb interstitial deletion on Xp22.3 involving VCX3A and STS genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Microarray based analysis of an inherited terminal 3p26.3 deletion, containing only the CHL1 gene, from a normal father to his two affected children

    Directory of Open Access Journals (Sweden)

    Lerone Margherita

    2011-04-01

    Full Text Available Abstract Background terminal deletions of the distal portion of the short arm of chromosome 3 cause a rare contiguous gene disorder characterized by growth retardation, developmental delay, mental retardation, dysmorphisms, microcephaly and ptosis. The phenotype of individuals with deletions varies from normal to severe. It was suggested that a 1,5 Mb minimal terminal deletion including the two genes CRBN and CNTN4 is sufficient to cause the syndrome. In addition the CHL1 gene, mapping at 3p26.3 distally to CRBN and CNTN4, was proposed as candidate gene for a non specific mental retardation because of its high level of expression in the brain. Methods and Results we describe two affected siblings in which array-CGH analysis disclosed an identical discontinuous terminal 3p26.3 deletion spanning less than 1 Mb. The deletion was transmitted from their normal father and included only the CHL1 gene. The two brothers present microcephaly, light mental retardation, learning and language difficulties but not the typical phenotype manifestations described in 3p- syndrome. Conclusion a terminal 3p26.3 deletion including only the CHL1 gene is a very rare finding previously reported only in one family. The phenotype of the affected individuals in the two families is very similar and the deletion has been inherited from an apparently normal parent. As already described for others recurrent syndromes with variable phenotype, these findings are challenging in genetic counselling because of an evident variable penetrance.

  9. Two new large deletions of the AVPR2 gene causing nephrogenic diabetes insipidus and a review of previously published deletions.

    Science.gov (United States)

    Anesi, Laura; de Gemmis, Paola; Galla, Daniela; Hladnik, Uros

    2012-10-01

    In this paper, we report two new original deletions and present an extended review of the previously characterized AVPR2 gene deletions to better understand the underlying deletion mechanisms. The two novel deletions were defined using polymerase chain reaction mapping and junction fragment sequencing. Bioinformatic analysis was performed on both the previously mapped deletions and the novel ones through several web tools. In our two patients with nephrogenic diabetes insipidus, we found a 23 755 bp deletion and a 9264 bp deletion both comprising the entire AVPR2 gene and part of the ARHGAP4 gene. Through bioinformatic studies, the smallest overlapping region as well as several motifs and repeats that are known to promote rearrangements were confirmed. Through this study, it was determined that the deletion mechanisms in the AVPR2 region do not follow the rules of non-allelic homologous recombination. Two of the 13 deletions can be attributed to the fork stalling and template switching (FoSTeS) mechanism, whereas the remaining 11 deletions could be caused either by non-homologous end joining or by the FoSTeS mechanism. Although no recurrence was found, several groupings of deletion breakpoints were identified.

  10. Variations in angiotensin-converting enzyme gene insertion/deletion ...

    Indian Academy of Sciences (India)

    Unknown

    The pattern of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an ...

  11. Association of insertion–deletion polymorphism of ACE gene and ...

    African Journals Online (AJOL)

    Introduction: Alzheimer's disease (AD) is a progressive, neurodegenerative disease. Many studies proposed an association of the insertion (I)/deletion (D) polymorphism (indel) in intron 16 of the gene for angiotensin I-converting enzyme (ACE) on chromosome 17q23 with Alzheimer's disease. ACE indel and related ...

  12. Insertion/deletion gene variants of angiotensin converting enzyme ...

    African Journals Online (AJOL)

    The insertion/deletion (I/D) polymorphism in the angiotensin-converting enzyme gene has been reported to be implicated in the predisposition to essential hypertension (EH). This association may depend on ethnic and genetic backgrounds. The objective of this study was to determine if the possible I/D polymorphism in the ...

  13. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Purpose: This study investigated the influence of angiotensin-1 converting enzyme (ACE) insertiondeletion (ID) gene polymorphism on the treatment responses of type 2 diabetic subjects at varying stages of nephropathy to ACE inhibitors (ACEI) with regard to blood pressure (MAP) and renal response (GFR). Methods: The ...

  14. Population stratification of a common APOBEC gene deletion polymorphism.

    Directory of Open Access Journals (Sweden)

    Jeffrey M Kidd

    2007-04-01

    Full Text Available The APOBEC3 gene family plays a role in innate cellular immunity inhibiting retroviral infection, hepatitis B virus propagation, and the retrotransposition of endogenous elements. We present a detailed sequence and population genetic analysis of a 29.5-kb common human deletion polymorphism that removes the APOBEC3B gene. We developed a PCR-based genotyping assay, characterized 1,277 human diversity samples, and found that the frequency of the deletion allele varies significantly among major continental groups (global FST = 0.2843. The deletion is rare in Africans and Europeans (frequency of 0.9% and 6%, more common in East Asians and Amerindians (36.9% and 57.7%, and almost fixed in Oceanic populations (92.9%. Despite a worldwide frequency of 22.5%, analysis of data from the International HapMap Project reveals that no single existing tag single nucleotide polymorphism may serve as a surrogate for the deletion variant, emphasizing that without careful analysis its phenotypic impact may be overlooked in association studies. Application of haplotype-based tests for selection revealed potential pitfalls in the direct application of existing methods to the analysis of genomic structural variation. These data emphasize the importance of directly genotyping structural variation in association studies and of accurately resolving variant breakpoints before proceeding with more detailed population-genetic analysis.

  15. Molecular analysis of deletions in the human beta-globin gene cluster: deletion junctions and locations of breakpoints.

    Science.gov (United States)

    Henthorn, P S; Smithies, O; Mager, D L

    1990-02-01

    DNA fragments that contain the deletion junction regions of four independent deletions involving the human beta-globin gene cluster have been isolated and cloned. The fragments were isolated from individuals with the conditions referred to as Sicilian (delta beta)zero-thalassemia, Turkish G gamma+(A gamma delta beta)zero-thalassemia, Black G gamma+(A gamma delta beta)zero-thalassemia, and HPFH-2. The sequences of the deletion junctions and of the normal DNA surrounding their 3' breakpoints were determined and compared to the previously determined sequences of normal DNA surrounding their 5' breakpoints. These comparisons show that the deletions were the result of nonhomologous recombinational events. Two of the deletion junctions contain "orphan" nucleotides, while the other two show very limited amounts of "junctional homology." Both types of junctions are common among recombination events in mammalian cells and we discuss a simple joining scheme that could account for the junctions reported here. Unlike other deletions in this cluster and in other gene clusters, none of the eight deletion breakpoints examined here occurred within Alu family repeats. To examine the significance of deletion breakpoints within various sequence categories, we analyzed the data from a well-defined set of deletions within this locus. In contrast to deletions in the alpha-globin gene cluster, the occurrence of breakpoints in Alu family repetitive sequences is not statistically significant within the beta-globin gene cluster. However, breakpoints do occur within transcriptional units of the beta-globin gene cluster more frequently than expected by chance alone. We conclude from our analysis that the mechanisms of DNA joining are not locus or location specific, but at least a portion of the mechanisms of chromosomal breakages do show locus specificity.

  16. Precise mapping of 17 deletion breakpoints within the central hotspot deletion region (introns 50 and 51) of the DMD gene.

    Science.gov (United States)

    Esposito, Gabriella; Tremolaterra, Maria Roberta; Marsocci, Evelina; Tandurella, Igor Cm; Fioretti, Tiziana; Savarese, Maria; Carsana, Antonella

    2017-12-01

    Exon deletions in the human DMD gene, which encodes the dystrophin protein, are the molecular defect in 50-70% of cases of Duchenne/Becker muscular dystrophies. Deletions are preferentially clustered in the 5' (exons 2-20) and the central (exons 45-53) region of DMD, likely because local DNA structure predisposes to specific breakage or recombination events. Notably, innovative therapeutic strategies may rescue dystrophin function by homology-based specific targeting of sequences within the central DMD hot spot deletion region. To further study molecular mechanisms that generate such frequent genome variations and to identify residual intronic sequences, we sequenced 17 deletion breakpoints within introns 50 and 51 of DMD and analyzed the surrounding genomic architecture. There was no breakpoint clustering within the introns nor extensive homology between sequences adjacent to each junction. However, at or near the breakpoint, we found microhomology, short tandem repeats, interspersed repeat elements and short sequence stretches that predispose to DNA deletion or bending. Identification of such structural elements contributes to elucidate general mechanisms generating deletion within the DMD gene. Moreover, precise mapping of deletion breakpoints and localization of repeated elements are of interest, because residual intronic sequences may be targeted by therapeutic strategies based on genome editing correction.

  17. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    Energy Technology Data Exchange (ETDEWEB)

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

    2013-05-20

    Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

  18. Effect Alpha Globlin Gene Deletion And Gamma Globin Gene -158 ...

    African Journals Online (AJOL)

    We studied the Xmn1 polymorphism (C/T) in γ- globin gene position -158 of β- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a ...

  19. Potential complications when developing gene deletion clones in Xylella fastidiosa.

    Science.gov (United States)

    Johnson, Kameka L; Cursino, Luciana; Athinuwat, Dusit; Burr, Thomas J; Mowery, Patricia

    2015-04-16

    The Gram-negative xylem-limited bacterium, Xylella fastidiosa, is an important plant pathogen that infects a number of high value crops. The Temecula 1 strain infects grapevines and induces Pierce's disease, which causes symptoms such as scorching on leaves, cluster collapse, and eventual plant death. In order to understand the pathogenesis of X. fastidiosa, researchers routinely perform gene deletion studies and select mutants via antibiotic markers. Site-directed pilJ mutant of X. fastidiosa were generated and selected on antibiotic media. Mutant cultures were assessed by PCR to determine if they were composed of purely transformant cells or included mixtures of non-transformants cells. Then pure pilJ mutant and wildtype cells were mixed in PD2 medium and following incubation and exposure to kanamycin were assessed by PCR for presence of mutant and wildtype populations. We have discovered that when creating clones of targeted mutants of X. fastidiosa Temecula 1 with selection on antibiotic plates, X. fastidiosa lacking the gene deletion often persist in association with targeted mutant cells. We believe this phenomenon is due to spontaneous antibiotic resistance and/or X. fastidiosa characteristically forming aggregates that can be comprised of transformed and non-transformed cells. A combined population was confirmed by PCR, which showed that targeted mutant clones were mixed with non-transformed cells. After repeated transfer and storage the non-transformed cells became the dominant clone present. We have discovered that special precautions are warranted when developing a targeted gene mutation in X. fastidiosa because colonies that arise following transformation and selection are often comprised of transformed and non-transformed cells. Following transfer and storage the cells can consist primarily of the non-transformed strain. As a result, careful monitoring of targeted mutant strains must be performed to avoid mixed populations and confounding results.

  20. A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat

    Directory of Open Access Journals (Sweden)

    Li Zhongyi

    2010-11-01

    Full Text Available Abstract Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L. is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from

  1. [Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

    Science.gov (United States)

    Cheng, L H; Liu, Y; Niu, T

    2017-05-14

    Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

  2. Glucocerebrosidase 2 gene deletion rescues type 1 Gaucher disease.

    Science.gov (United States)

    Mistry, Pramod K; Liu, Jun; Sun, Li; Chuang, Wei-Lien; Yuen, Tony; Yang, Ruhua; Lu, Ping; Zhang, Kate; Li, Jianhua; Keutzer, Joan; Stachnik, Agnes; Mennone, Albert; Boyer, James L; Jain, Dhanpat; Brady, Roscoe O; New, Maria I; Zaidi, Mone

    2014-04-01

    The inherited deficiency of the lysosomal glucocerebrosidase (GBA) due to mutations in the GBA gene results in Gaucher disease (GD). A vast majority of patients present with nonneuronopathic, type 1 GD (GD1). GBA deficiency causes the accumulation of two key sphingolipids, glucosylceramide (GL-1) and glucosylsphingosine (LysoGL-1), classically noted within the lysosomes of mononuclear phagocytes. How metabolites of GL-1 or LysoGL-1 produced by extralysosomal glucocerebrosidase GBA2 contribute to the GD1 pathophysiology is not known. We recently recapitulated hepatosplenomegaly, cytopenia, hypercytokinemia, and the bone-formation defect of human GD1 through conditional deletion of Gba in Mx1-Cre(+):GD1 mice. Here we show that the deletion of Gba2 significantly rescues the GD1 clinical phenotype, despite enhanced elevations in GL-1 and LysoGL-1. Most notably, the reduced bone volume and bone formation rate are normalized. These results suggest that metabolism of GL-1 or LysoGL-1 into downstream bioactive lipids is a major contributor to the bone-formation defect. Direct testing revealed a strong inhibition of osteoblast viability by nanomolar concentrations of sphingosine, but not of ceramide. These findings are consistent with toxicity of high circulating sphingosine levels in GD1 patients, which decline upon enzyme-replacement therapy; serum ceramide levels remain unchanged. Together, complementary results from mice and humans affected with GD1 not only pinpoint sphingosine as being an osteoblast toxin, but also set forth Gba2 as a viable therapeutic target for the development of inhibitors to ameliorate certain disabling consequences of GD1.

  3. Congenital cytoplasmic body myopathy with survival motor neuron gene deletion or Werdnig-Hoffmann disease

    DEFF Research Database (Denmark)

    Vajsar, J; Balslev, T; Ray, P N

    1998-01-01

    bodies. However, molecular analysis revealed a homozygous deletion of exons 7 and 8 of the survival motor neuron (SMN) gene, suggesting that the patient had Werdnig-Hoffmann disease. We recommend that every patient with congenital cytoplasmic body myopathy be tested for SMN gene deletion....

  4. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  5. Deciphering the effects of gene deletion on yeast longevity using network and machine learning approaches.

    Science.gov (United States)

    Huang, Tao; Zhang, Jian; Xu, Zhong-Ping; Hu, Le-Le; Chen, Lei; Shao, Jian-Lin; Zhang, Lei; Kong, Xiang-Yin; Cai, Yu-Dong; Chou, Kuo-Chen

    2012-04-01

    Longevity is one of the most basic and one of the most essential properties of all living organisms. Identification of genes that regulate longevity would increase understanding of the mechanisms of aging, so as to help facilitate anti-aging intervention and extend the life span. In this study, based on the network features and the biochemical/physicochemical features of the deletion network and deletion genes, as well as their functional features, a two-layer model was developed for predicting the deletion effects on yeast longevity. The first stage of our prediction approach was to identify whether the deletion of one gene would change the life span of yeast; if it did, the second stage of our procedure would automatically proceed to predict whether the deletion of one gene would increase or decrease the life span. It was observed by analyzing the predicted results that the functional features (such as mitochondrial function and chromatin silencing), the network features (such as the edge density and edge weight density of the deletion network), and the local centrality of deletion gene, would have important impact for predicting the deletion effects on longevity. It is anticipated that our model may become a useful tool for studying longevity from the angle of genes and networks. Moreover, it has not escaped our notice that, after some modification, the current model can also be used to study many other phenotype prediction problems from the angle of systems biology. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  6. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth

    2009-01-01

    factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  7. Deletions of recessive disease genes: CNV contribution to carrier states and disease-causing alleles

    Science.gov (United States)

    Boone, Philip M.; Campbell, Ian M.; Baggett, Brett C.; Soens, Zachry T.; Rao, Mitchell M.; Hixson, Patricia M.; Patel, Ankita; Bi, Weimin; Cheung, Sau Wai; Lalani, Seema R.; Beaudet, Arthur L.; Stankiewicz, Pawel; Shaw, Chad A.; Lupski, James R.

    2013-01-01

    Over 1200 recessive disease genes have been described in humans. The prevalence, allelic architecture, and per-genome load of pathogenic alleles in these genes remain to be fully elucidated, as does the contribution of DNA copy-number variants (CNVs) to carrier status and recessive disease. We mined CNV data from 21,470 individuals obtained by array-comparative genomic hybridization in a clinical diagnostic setting to identify deletions encompassing or disrupting recessive disease genes. We identified 3212 heterozygous potential carrier deletions affecting 419 unique recessive disease genes. Deletion frequency of these genes ranged from one occurrence to 1.5%. When compared with recessive disease genes never deleted in our cohort, the 419 recessive disease genes affected by at least one carrier deletion were longer and located farther from known dominant disease genes, suggesting that the formation and/or prevalence of carrier CNVs may be affected by both local and adjacent genomic features and by selection. Some subjects had multiple carrier CNVs (307 subjects) and/or carrier deletions encompassing more than one recessive disease gene (206 deletions). Heterozygous deletions spanning multiple recessive disease genes may confer carrier status for multiple single-gene disorders, for complex syndromes resulting from the combination of two or more recessive conditions, or may potentially cause clinical phenotypes due to a multiply heterozygous state. In addition to carrier mutations, we identified homozygous and hemizygous deletions potentially causative for recessive disease. We provide further evidence that CNVs contribute to the allelic architecture of both carrier and recessive disease-causing mutations. Thus, a complete recessive carrier screening method or diagnostic test should detect CNV alleles. PMID:23685542

  8. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    Energy Technology Data Exchange (ETDEWEB)

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y. [Tel Aviv Univ. (Israel)

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  9. "PCR Application In Reognition Of Prevelant Deletion Of α Globin Gene In Alpha Thalasemia Carriers "

    Directory of Open Access Journals (Sweden)

    R. Kiani-Shirazi

    2006-06-01

    Full Text Available Background and Aim:-thalassemia is the most common inherited disorder of hemoglobin (Hb synthesis in the world. Alpha thalassemia most frequently results from the loss of one (-  or both (- - of the duplicated  genes ( on chromosome 16. Carriers of deletional forms of -thalassemia (-/- /-, or --/ are clinically normal but have a mild hypochromic, microcytic anemia. Compound heterozygotes (--/-  called Hb H disease. Fetuses who inherit no  genes (--/-- (Hb Bart's Hydrops fetalis syndrome die either inutero or shortly after birth, More than 95% of recognized -thalassemia involves deletion of one or both  globin genes on chromosome 16. Materials and Methods: The assay was tested on 114 Iranian individuals with low MCV and MCH levels but normal HbA2 who had not responded to Iron treatment. patients was referred to the Department of Biotechnology, Pasteur Institute of Iran by Health Centers. Genomic DNA was isolated from white blood cells by salting out method. We have developed a reliable, single - tube multiplex polymerase chain reaction (PCR assay for the 7 most frequent - thalassemia deletions (-- SEA , --THAI, --FIL , -α20.5 , --MED, -α4.2 , -α3.7. Results: DNA fromd thalassemia carriers was tested for the presence of different types of  globin gene deletion (s. The - 3.7 and - 4.2 single gene deletions, and the Mediterranean (-- MED and - 20.5 double gene deletions were found in some samples. Conclusion: The - 3.7 deletion was found to be the most common cause of  globin gene deletion in our samples. Multiplex PCR for α gene deletion analysis is simple, rapid and sensitive.

  10. New recurrent deletions in the PPARgamma and TP53 genes are associated with childhood myelodysplastic syndrome

    DEFF Research Database (Denmark)

    Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T

    2009-01-01

    observed in 17 and 18 cases, respectively. Using quantitative RT-PCR, it was detected PPARgamma transcript downexpression in a subset of these cases. G-banding analysis revealed 17p deletions in a small number of these cases. One MDS therapy-related patient had neither a loss of PPARgamma nor TP53......Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were....... These data suggest that the PPARgamma and TP53 genes may be candidates for molecular markers in pediatric MDS, and that these potentially recurrent deletions could contribute to the identification of therapeutic approaches in primary pediatric MDS....

  11. Deletion of a single-copy DAAM1 gene in congenital heart defect: a case report

    Directory of Open Access Journals (Sweden)

    Bao Bihui

    2012-08-01

    Full Text Available Abstract Background With an increasing incidence of congenital heart defects (CHDs in recent years, genotype-phenotype correlation and array-based methods have contributed to the genome-wide analysis and understanding of genetic variations in the CHD population. Here, we report a copy number deletion of chromosomal 14q23.1 in a female fetus with complex congenital heart defects. This is the first description of DAAM1 gene deletion associated with congenital heart anomalies. Case Presentation Compared with the control population, one CHD fetus showed a unique copy number deletion of 14q23.1, a region that harbored DAAM1 and KIAA0666 genes. Conclusions Results suggest that the copy number deletion on chromosome 14q23.1 may be critical for cardiogenesis. However, the exact relationship and mechanism of how DAAM1 and KIAA0666 deletion contributes to the onset of CHD is yet to be determined.

  12. Sensitivity to Lovastatin of Saccharomyces cerevisiae Strains Deleted for Pleiotropic Drug Resistance (PDR) Genes

    DEFF Research Database (Denmark)

    Formenti, Luca Riccardo; Kielland-Brandt, Morten

    2011-01-01

    based on the use of statins. We investigated the susceptibility to lovastatin of S. cerevisiae strains deleted for PDR genes, responsible for exporting hydrophobic and amphi-philic drugs, such as lovastatin. Strains deleted for the genes tested, PDR1, PDR3, PDR5 and SNQ2, exhibited remarkably different...... phenotypes, with deletion of PDR5 causing the highest sensitivity to lovastatin. The study helped clarifying which pdr mutants to use in studies of physiological actions of statins in yeast. Copyright (C) 2011 S. Karger AG, Basel...

  13. Constitutional and mosaic large NF1 gene deletions in neurofibromatosis type 1.

    OpenAIRE

    Rasmussen, S. A.; Colman, S. D.; Ho, V.T.; Abernathy, C R; Arn, P H; Weiss, L; Schwartz, C.; Saul, R A; Wallace, M. R.

    1998-01-01

    A set of neurofibromatosis type 1 (NF1) patients was screened for large NF1 gene deletions by comparing patient and parent genotypes at 10 intragenic polymorphic loci. Of 67 patient/parent sets (47 new mutation patients and 20 familial cases), five (7.5%) showed loss of heterozygosity (LOH), indicative of NF1 gene deletion. These five patients did not have severe NF1 manifestations, mental retardation, or dysmorphic features, in contrast to previous reports of large NF1 deletions. All five de...

  14. Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions

    Directory of Open Access Journals (Sweden)

    I.J.P. Arnhold

    1998-04-01

    Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions

  15. Deletion of a target gene in Indica rice via CRISPR/Cas9.

    Science.gov (United States)

    Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

    2017-08-01

    Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

  16. Deletion of the "OPHN1" Gene Detected by aCGH

    Science.gov (United States)

    Madrigal, I.; Rodriguez-Revenga, L.; Badenas, C.; Sanchez, A.; Mila, M.

    2008-01-01

    Background: The oligophrenin 1 gene ("OPHN1") is an Rho-GTPase-activating protein involved in the regulation of the G-protein cycle required for dendritic spine morphogenesis. Mutations in this gene are implicated in X-linked mental retardation (XLMR). Methods: We report a deletion spanning exons 21 and 22 of the "OPHN1" gene identified by a…

  17. Variations in angiotensin-converting enzyme gene insertion/deletion ...

    Indian Academy of Sciences (India)

    deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an ...

  18. Deletion analysis of SMN and NAIP genes in Tunisian patients with spinal muscular atrophy

    Directory of Open Access Journals (Sweden)

    Imen Rekik

    2013-01-01

    Full Text Available Background: Spinal muscular atrophy (SMA is an autosomal recessive neuromuscular disorder involving degeneration of anterior horn cells of spinal cord, resulting in progressive muscle weakness and atrophy. Aims: The purpose of our study was to determine the frequency of SMN and NAIP deletions in Tunisian SMA patients. Materials and Methods: Polymerase chain reaction (PCR combined with restriction fragment length polymorphism (RFLP was used to detect the deletion of exon 7 and exon 8 of SMN1 gene, as well as multiplex PCR for exon 5 and 13 of NAIP gene. Results: Fifteen (45.4% out of 33 SMA patients were homozygously deleted for exons 7 and/or 8 of SMN1. Homozygous deletion of NAIP gene was observed in 20% (3 / 15 of patients. Conclusions: The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis, and pre-implantation genetic diagnosis of SMA.

  19. [Unexpected discovery of a fetus with DMD gene deletion using single nucleotide polymorphism array].

    Science.gov (United States)

    Lin, Shaobin; Zhou, Yu; Zhou, Bingyi; Gu, Heng

    2017-08-10

    To investigate the value of single nucleotide polymorphism array (SNP array) for the identification of de novo mutations in the DMD gene among fetuses. G-banded karyotyping and SNP array were performed on a fetus with intrauterine growth restriction but without family history of Duchenne/Becker muscular dystrophy (DMD/BMD). Multiplex ligation-dependent probe amplification (MLPA) was subsequently applied on amniocytes and maternal peripheral blood sample to detect DMD gene deletion/duplication mutations. Karyotyping of amniocytes showed a normal 46, XY karyotype. SNP array on amniocytes detected a 116 kb deletion (chrX: 32 455 741-32 571 504) at Xp21.1 with breakpoints at introns 16 and 30 respectively, encompassing exons 17-29 of the DMD gene. In addition, MLPA analysis of the DMD gene on amniocytes confirmed the deletion of exons 17 to 29 identified by SNP array. However, no deletion/duplication mutation was detected by MLPA in the mother. The de novo deletion of exons 17 to 29 of the DMD gene detected in the fetus may result in BMD or DMD. SNP array can improve the efficiency for detecting genomic disorders in fetuses with unidentified pathogenic genes, negative family history and nonspecific phenotypes.

  20. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  1. Different spectra of genomic deletions within the CCM genes between Italian and American CCM patient cohorts.

    Science.gov (United States)

    Liquori, Christina L; Penco, Silvana; Gault, Judith; Leedom, Tracey P; Tassi, Laura; Esposito, Teresa; Awad, Issam A; Frati, Luigi; Johnson, Eric W; Squitieri, Ferdinando; Marchuk, Douglas A; Gianfrancesco, Fernando

    2008-02-01

    Cerebral cavernous malformations (CCMs) are vascular abnormalities of the brain that can result in hemorrhagic stroke and seizures. Familial forms of CCM are inherited in an autosomal-dominant fashion, and three CCM genes have been identified. We recently determined that large genomic deletions in the CCM2 gene represent 22% of mutations in a large CCM cohort from the USA. In particular, a 77.6 kb deletion spanning CCM2 exons 2-10 displays an identical recombination event in eight CCM probands/families and appears to be common in the US population. In the current study, we report the identification of six additional probands/families from the USA with this same large deletion. Haplotype analysis strongly suggests that this common deletion derives from an ancestral founder. We also examined an Italian CCM cohort consisting of 24 probands/families who tested negative for mutations in the CCM1, CCM2, and CCM3 genes by DNA sequence analysis. Surprisingly, the common CCM2 deletion spanning exons 2-10 is not present in this population. Further analysis of the Italian cohort by multiplex ligation-dependent probe analysis identified a total of ten deletions and one duplication. The overall spectrum of genomic rearrangements in the Italian cohort is thus quite different than that seen in a US cohort. These results suggest that there are elements within all three of the CCM genes that predispose them to large deletion/duplication events but that the common deletion spanning CCM2 exons 2-10 appears to be specific to the US population due to a founder effect.

  2. Multi-exon deletion in the XDH gene as a cause of classical xanthinuria.

    Science.gov (United States)

    Eggermann, Thomas; Spengler, Sabrina; Denecke, Bernd; Zerres, Klaus; Mache, Christoph J

    2013-01-01

    Xanthinuria Type I is caused by mutations in the xanthine dehydrogenase gene (XDH). We report on a patient suffering from xanthinuria. Genomic DNA was screened for point mutations and imbalances in the XDH gene by sequencing and microarray typing. We could identify homozygosity of a multiexon deletion in the XDH gene; large genomic imbalances have not yet been reported in this disease. As our case and other studies on genetic alterations in kidney diseases show, large deletions (and duplications) significantly contribute to the etiology of these entities, specific assays to discover these imbalances should therefore be included in genetic testing approaches.

  3. Physical mapping of the globin gene deletion in (δβ)° - thalassaemia

    NARCIS (Netherlands)

    Bernards, R.A.; Kooter, J.M.; Flavell, R.A.

    1979-01-01

    We have constructed a physical map of restriction endonuclease cleavage sites in the (δ+β)-globin gene region in the DNA of patients with (δβ)°-thalassaemia. This map shows that a 10 kb deletion has occurred in (δβ)°-thalassaemia to remove the entire β-globin gene and the 3′ portion of the δ-globin

  4. The detection of steroid sulfatase gene deletion (STS) in Egyptian males with X-linked ichthyosis.

    Science.gov (United States)

    Abdel-Hamed, Mahmoud F; Hussein, Hassan A; Helmy, Nivine A; Elsaie, Mohamed L

    2010-10-01

    Ichthyosis is a disorder of keratinization characterized by diffuse uniform and persistent scales resulting from abnormal epidermal differentiation or metabolism. The identification of steroid sulfatase (STS) as the cause of X-linked ichthyosis (XLI) points to the importance of this enzyme in skin desquamation. Fluorescent in situ hybridization (FISH) analysis is a good diagnostic technique with which to detect a common deletion of the STS gene. In this study, the authors set out to detect the X-linked type of ichthyosis, diagnosed by detection of STS gene deletions among Egyptian males. Egyptian males complaining of X-linked ichthyosis were clinically examined, evaluating pedigree analysis of the family, cytogenetic studies using G-banding technique and FISH using locus specific probe for steroid sulfatase (STS) gene which is located at chromosome Xp22.3. Of patients, 11.11 percent had nocturnal enuresis and 33.33 percent showed STS gene deletion by FISH analysis. This study underlines a difficulty in diagnosing X-linked ichthyosis on the clinical features or familial pedigree analysis in Egypt and the importance of cytogenetic and molecular cytogenetic studies for diagnosis. FISH analysis is a good, reliable and rapid diagnostic tool with which to detect STS gene deletion. Since FISH will not detect partial deletion or point mutations, the authors recommend further molecular studies to reach the proper diagnosis of X-linked ichthyosis.

  5. Stable disruption of ethanol production by deletion of the genes encoding alcohol dehydrogenase isozymes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ida, Yoshihiro; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi

    2012-02-01

    We analyzed the effects of the deletions of genes encoding alcohol dehydrogenase (ADH) isozymes of Saccharomyces cerevisiae. The decrease in ethanol production by ADH1 deletion alone could be partially compensated by the upregulation of other isozyme genes, while the deletion of all known ADH isozyme genes stably disrupted ethanol production. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Detection p53 gene deletion in hematological malignancies using fluorescence in situ hybridization: a pilot study. .

    Science.gov (United States)

    Annooz, Aaedah F; Melconian, Alice K; Abdul-Majeed, Ban A; Jawad, Ali M

    2014-07-01

    P53 as a tumor suppressor gene plays a major role in cancer development, it is essential for cell growth regulation and apoptosis. The deletion of p53 is known to be associated with aggressive diseases in several hematological malignancies. The evidence indicated that p53 deletions can be acquired as a result of chemotherapy. Therefore, a follow-up study for p53 gene deletion by fluorescence in situ hybridization technique (FISH) was carried out for the patients group who affected with different hematological malignancies before and after chemotherapy. The main goals from screening of p53 deletion were to assess the correlation between p53 deletion and chemotherapy resistance, overall median survival and chromosomal abnormalities. It is concluded from the present study that p53 deletion has a cardinal effect on the clinical outcome (chemotherapy resistance, overall median survival) and outcome of chromosomal abnormalities (quality and quantity of chromosomal abnormalities) of the patients who were affected with hematological malignancies before and after chemotherapy.

  7. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background...... mating a library gene deletion haploid to such a conditional centromere strain, which corresponds to the chromosome carrying the gene deletion, loss of heterozygosity (LOH) at the gene deletion locus can be generated in these otherwise hybrid diploids. The use of hybrid diploid strains permits...

  8. Multiplex ligation-dependent probe amplification detects DCX gene deletions in band heterotopia.

    Science.gov (United States)

    Mei, D; Parrini, E; Pasqualetti, M; Tortorella, G; Franzoni, E; Giussani, U; Marini, C; Migliarini, S; Guerrini, R

    2007-02-06

    Subcortical band heterotopia (SBH, or double cortex syndrome) is a neuronal migration disorder consisting of heterotopic bands of gray matter located between the cortex and the ventricular surface, with or without concomitant pachygyria. Most cases show diffuse or anteriorly predominant (A>P) migration abnormality. All familial and 53% to 84% of sporadic cases with diffuse or A>P SBH harbor a mutation of the DCX gene, leaving the genetic causes unexplained, and genetic counseling problematic, in the remaining patients. Our purpose was to verify the extent to which exonic deletions or duplications of the DCX gene would account for sporadic SBH with A>P gradient but normal gene sequencing. We identified 23 patients (22 women, 1 man) with sporadic, diffuse, or anteriorly predominant SBH. After sequencing the DCX gene and finding mutations in 12 (11 women, 1 man), we used multiplex ligation-dependent probe amplification (MLPA) to search for whole-exon deletions or duplications in the 11 remaining women. We used semiquantitative fluorescent multiplex PCR (SQF-PCR) and Southern blot to confirm MLPA findings. MLPA assay uncovered two deletions encompassing exons 3 to 5, and one involving exon 6, in 3 of 11 women (27%) and raised the percentage of DCX mutations from 52% to 65% in our series. SQF-PCR performed in all three women and Southern blot analysis performed in two confirmed the deletions. MLPA uncovers large genomic deletions of the DCX gene in a subset of patients with SBH in whom no mutations are found after gene sequencing. Deletions of DCX are an underascertained cause of SBH.

  9. Molecular refinement of the 1p36 deletion syndrome reveals size diversity and a preponderance of maternally derived deletions.

    Science.gov (United States)

    Wu, Y Q; Heilstedt, H A; Bedell, J A; May, K M; Starkey, D E; McPherson, J D; Shapira, S K; Shaffer, L G

    1999-02-01

    The deletion of chromosome 1p36 is a newly recognized, relatively common contiguous gene deletion syndrome with a variable phenotype. The clinical features have recently been delineated and molecular analysis indicates that the prevalence of certain phenotypic features appears to correlate with deletion size. Phenotype/genotype comparisons have allowed the assignment of certain clinical features to specific deletion intervals, significantly narrowing the regions within which to search for candidate genes. We have extensively characterized the deletion regions in 30 cases using microsatellite markers and fluorescence in situ hybridization analyses. The map order of 28 microsatellite markers spanning the deletion region was obtained by a combination of genotypic analysis and physical mapping. The deletion region was divided into six intervals and breakpoints were found to cluster in mainly two regions. Molecular analysis of the deletions showed that two patients had complex re-arrangements; these cases shared their distal and proximal breakpoints in the two common breakpoint regions. Of the de novo deletions ( n = 28) in whichparental samples were available and the analysis was informative ( n = 27), there were significantly morematernally derived deletions ( n = 21) than paternally derived deletions ( n = 6) (chi1(2) = 8.35, P deletion panel have delineated specific areas in which to focus the search for the causative genes for the features of this syndrome.

  10. de novo interstitial deletions at the 11q23.3-q24.2 region

    OpenAIRE

    Su, Jiasun; Chen, Rongyu; Luo, Jingsi; Fan, Xin; Fu, Chunyun; Wang, Jin; He, Sheng; Hu, Xuyun; Zhang, ShuJie; Yi, Shang; Chen, Shaoke; Shen, Yiping

    2016-01-01

    Background Jacobsen syndrome (JBS) is a contiguous gene deletion syndrome involving 11q terminal deletion. Interstitial deletions at distal 11q are rare and their contributions to the clinical phenotype of JBS are unknown. Case presentation We presented the chromosome microarray (CMA) data and the clinical features of two individuals carrying a non-overlapping de novo deletion each at the 11q23.3-q24.2 region in an effort to analyze the correlation between region of deletion at 11q and phenot...

  11. Gene deletions in alpha thalassemia prove that the 5' zeta locus is functional.

    Science.gov (United States)

    Pressley, L; Higgs, D R; Clegg, J B; Weatherall, D J

    1980-01-01

    The deletions in the zeta-alpha globin gene cluster in two infants with the hemoglobin Bart's hydrops fetalis syndrome (homozygous alpha thalassemia 1) have been mapped by restriction endonuclease analysis using a zeta-specific probe. DNA from a Thai infant lacked the psi alpha 1 gene and both alpha genes, but the zeta genes were present. A Greek infant's DNA had also lost the 3' zeta 1 gene. Because zeta globin was synthesized in the infant's cord blood, this indicates that the 5' zeta 2 gene recently identified by Lauer et al. [Lauer, J., Shen, C. J. & Maniatis, T. (1980) Cell, in press] must be functional. Images PMID:6158051

  12. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    Science.gov (United States)

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

    2010-01-01

    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  13. Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses

    Directory of Open Access Journals (Sweden)

    Kyung-Do Park

    2014-09-01

    Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.

  14. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.; Woloschak, G.E. [Argonne National Lab., IL (United States). Center for Mechanistic Biology and Biotechnology

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  15. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    Science.gov (United States)

    Effat, Laila K.; El-Harouni, Ashraf A.; Amr, Khalda S.; El-Minisi, Tarik I.; Abdel Meguid, Nagwa; El-Awady, Mostafa

    2000-01-01

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK) levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program. PMID:11381192

  16. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Laila K. Effat

    2000-01-01

    Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.

  17. Type I oculocutaneous albinism (OCA1) associated with a large deletion of the tyrosinase (TYR) gene

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.A.; Wick, P.A.; Holmes, S.A.; Schnur, R.E. [Univ. of Wisconsin, Madison, WI (United States)]|[Children`s Hospital of Philadelphia, PA (United States)

    1994-09-01

    OCA1 is an autosomal recessive disorder in which the biosynthesis of melanin is reduced or absent in skin, hair, and eyes, due to deficient enzymatic activity of tyrosinase. TYR consists of 5 exons spanning over 65 kb at 11q14-q21. Analyses of TYR in >400 unrelated patients with OCA1 have identified more than 50 different point mutations; however, no large deletions have been detected. Here we report a large deletion of TYR in a Caucasian boy with OCA1B. Simultaneous SSCP/heteroduplex screening and DNA sequence analysis indicated that the patient was apparently homozygous for a previously described TYR mutation, adjacent to the 3` splice site of IVS2 (-7, t{r_arrow}a). To distinguish between possible gene deletion vs. maternal uniparental isodisomy, we characterized several chromosome 11 polymorphisms. Maternal uniparental isodisomy was excluded by the patient`s heterozygosity for alleles at D11S35 (11q21-122) and HBG2 (11p15.5). In addition, the patient failed to inherit paternal alleles at an MboI RFLP in exon 1 of TYR and at a TaqI RFLP in the promoter region of the gene. To detect a possible submicroscopic deletion, we performed quantitative Southern blot hybridization using a full length TYR cDNA. Compared with controls, both the patient and his father appeared deleted for two or three TYR-derived PstI fragments; the two TYRL-derived fragments appeared normal. These data indicate that the patient and his father have a partial TYR deletion, including at least exons 1, 2, and IVS2. Based on the organization of the gene, this deletion is at least 50 kb in size. The patient is thus hemizygous for the maternally-inherited mutation in IVS2, accounting for his OCA1B phenotype.

  18. Serological detection of attenuated HIV-1 variants with nef gene deletions.

    Science.gov (United States)

    Greenway, A L; Mills, J; Rhodes, D; Deacon, N J; McPhee, D A

    1998-04-16

    To investigate whether members of a transfusion-linked cohort (the Sydney Bloodbank Cohort) infected with a nef-deleted strain of HIV-1 could be differentiated from individuals infected with wild-type strains of HIV-1 by characterizing the Nef antibody response of cohort members. Retrospective and prospective analysis of the nef gene sequence and the antibody response to Nef peptides in HIV-infected subjects. Plasma was obtained from all individuals of the Sydney cohort, and from a variety of HIV-1-infected and uninfected controls. Antibodies recognizing full-length recombinant HIV-1NL43 Nef protein and synthetic peptide analogues were assessed by enzyme-linked immunosorbent assay. All 34 individuals infected with wild-type HIV-1 had antibodies reacting with full-length Nef protein as well as with a series of synthetic peptides (6-23-mers) spanning most of the Nef protein of HIV-1NL43. Although the HIV-1 quasispecies infecting the Sydney cohort had a consensus deletion of the nef gene corresponding to amino-acids 165-206, HIV-1 strains from individual members of the cohort had additional deletions comprising up to 80% of the nef gene. Members of the cohort had antibodies to peptides homologous to all regions of the Nef protein tested, except for a single peptide (amino-acids 162-177) that lies within the consensus nef deletion for the cohort quasispecies. These data show that nef-deleted strains of HIV-1 can be detected serologically. In the Sydney cohort, detection of antibodies to all regions of Nef tested, except that corresponding to amino-acids 162-177, suggests that observed deletions outside this domain occurred after this virus had infected these subjects and stimulated an immune response. A Nef peptide serological assay may be useful for identifying further examples of individuals infected with nef-deleted, attenuated HIV-1 quasispecies and for assessing the evolution of those variants in vivo.

  19. Optimal in silico target gene deletion through nonlinear programming for genetic engineering.

    Science.gov (United States)

    Hong, Chung-Chien; Song, Mingzhou

    2010-02-24

    Optimal selection of multiple regulatory genes, known as targets, for deletion to enhance or suppress the activities of downstream genes or metabolites is an important problem in genetic engineering. Such problems become more feasible to address in silico due to the availability of more realistic dynamical system models of gene regulatory and metabolic networks. The goal of the computational problem is to search for a subset of genes to knock out so that the activity of a downstream gene or a metabolite is optimized. Based on discrete dynamical system modeling of gene regulatory networks, an integer programming problem is formulated for the optimal in silico target gene deletion problem. In the first result, the integer programming problem is proved to be NP-hard and equivalent to a nonlinear programming problem. In the second result, a heuristic algorithm, called GKONP, is designed to approximate the optimal solution, involving an approach to prune insignificant terms in the objective function, and the parallel differential evolution algorithm. In the third result, the effectiveness of the GKONP algorithm is demonstrated by applying it to a discrete dynamical system model of the yeast pheromone pathways. The empirical accuracy and time efficiency are assessed in comparison to an optimal, but exhaustive search strategy. Although the in silico target gene deletion problem has enormous potential applications in genetic engineering, one must overcome the computational challenge due to its NP-hardness. The presented solution, which has been demonstrated to approximate the optimal solution in a practical amount of time, is among the few that address the computational challenge. In the experiment on the yeast pheromone pathways, the identified best subset of genes for deletion showed advantage over genes that were selected empirically. Once validated in vivo, the optimal target genes are expected to achieve higher genetic engineering effectiveness than a trial

  20. Angiotensin-converting enzyme insertion/deletion gene ...

    Indian Academy of Sciences (India)

    2016-03-02

    Haemoglobinopathies and Cystic fibrosis,. LR00SP03', Tunis 1007, Tunisia ... of mutations emphasizes the role of genetic background (modifier gene) and environment. (Cutting ... Journal of Genetics, Vol. 95, No. 1, March 2016. 193 ...

  1. Deletion of the DNA Ligase IV Gene in Candida glabrata Significantly Increases Gene-Targeting Efficiency.

    Science.gov (United States)

    Cen, Yuke; Fiori, Alessandro; Van Dijck, Patrick

    2015-08-01

    Candida glabrata is reported as the second most prevalent human opportunistic fungal pathogen in the United States. Over the last decades, its incidence increased, whereas that of Candida albicans decreased slightly. One of the main reasons for this shift is attributed to the inherent tolerance of C. glabrata toward the commonly used azole antifungal drugs. Despite a close phylogenetic distance to Saccharomyces cerevisiae, homologous recombination works with poor efficiency in C. glabrata compared to baker's yeast, in fact limiting targeted genetic alterations of the pathogen's genome. It has been shown that nonhomologous DNA end joining is dominant over specific gene targeting in C. glabrata. To improve the homologous recombination efficiency, we have generated a strain in which the LIG4 gene has been deleted, which resulted in a significant increase in correct gene targeting. The very specific function of Lig4 in mediating nonhomologous end joining is the reason for the absence of clear side effects, some of which affect the ku80 mutant, another mutant with reduced nonhomologous end joining. We also generated a LIG4 reintegration cassette. Our results show that the lig4 mutant strain may be a valuable tool for the C. glabrata research community. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Gene deletions in alpha thalassemia prove that the 5' zeta locus is functional.

    OpenAIRE

    Pressley, L; Higgs, D R; Clegg, J B; Weatherall, D J

    1980-01-01

    The deletions in the zeta-alpha globin gene cluster in two infants with the hemoglobin Bart's hydrops fetalis syndrome (homozygous alpha thalassemia 1) have been mapped by restriction endonuclease analysis using a zeta-specific probe. DNA from a Thai infant lacked the psi alpha 1 gene and both alpha genes, but the zeta genes were present. A Greek infant's DNA had also lost the 3' zeta 1 gene. Because zeta globin was synthesized in the infant's cord blood, this indicates that the 5' zeta 2 gen...

  3. Multi-exon deletions of the FBN1 gene in Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Schrijver Iris

    2001-10-01

    Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.

  4. A novel deletion mutation of the ADAR1 gene in a Chinese patient ...

    Indian Academy of Sciences (India)

    A novel deletion mutation of the ADAR1 gene in a Chinese patient with dyschromatosis symmetrica hereditaria ... University School of Medicine, 305 East Zhongshan Road, Nanjing 210002, People's Republic of China. [Li W.-W., Wu Q.-Y., Li N., Deng D.-Q., ... The products were sequenced directly using an ABI Prism 3700 ...

  5. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Science.gov (United States)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  6. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    H. Schelleman (Hedi); O.H. Klungel (Olaf); C.M. van Duijn (Cornelia); J.C.M. Witteman (Jacqueline); A. Hofman (Albert); A.C. de Boer (Anthonius); B.H.Ch. Stricker (Bruno)

    2005-01-01

    textabstractAims: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. Methods: This was a cohort study among 239 subjects who

  7. Molecular characterization of the porcine deleted in malignant brain tumors 1 gene (DMBT1)

    DEFF Research Database (Denmark)

    Haase, Bianca; Humphray, Sean J; Lyer, Stefan

    2006-01-01

    The human gene deleted in malignant brain tumors 1 (DMBT1) is considered to play a role in tumorigenesis and pathogen defense. It encodes a protein with multiple scavenger receptor cysteine-rich (SRCR) domains, which are involved in recognition and binding of a broad spectrum of bacterial pathogens...

  8. deletion polymorphism of ACE gene and Alzheimerв€™s disease

    African Journals Online (AJOL)

    Omayma M. Hassanin

    2014-06-27

    Jun 27, 2014 ... Abstract Introduction: Alzheimer's disease (AD) is a progressive, neurodegenerative disease. Many studies proposed an association of the insertion (I)/deletion (D) polymorphism (indel) in intron 16 of the gene for angiotensin I-converting enzyme (ACE) on chromosome 17q23 with Alz- heimer's disease.

  9. Primary cutaneous T-cell lymphomas do not show specific NAV3 gene deletion or translocation.

    Science.gov (United States)

    Marty, Marion; Prochazkova, Martina; Laharanne, Elodie; Chevret, Edith; Longy, Michel; Jouary, Thomas; Vergier, Béatrice; Beylot-Barry, Marie; Merlio, Jean-Philippe; Philippe, Merlio Jean

    2008-10-01

    The mapping of a balanced t(12;18)(q21;q21.2) translocation in a Sézary syndrome (SS) case led Karenko et al. to identify NAV3 gene (12q21-22) deletion by interphase fluorescence in situ hybridization (FISH) in 15/21 patients with mycosis fungoides (MF) or SS. To determine whether the NAV3 deletion is the result of a specific gene breakpoint, we used FISH with dual-color split or break-apart bacterial artificial chromosome (BAC) probes covering the NAV3 locus. A total of 31 samples (18 skin, 11 blood, 1 lymph node, and 1 spleen) from 24 patients with advanced MF/SS (18 with large-cell transformation) were studied. Chromosome 12 imbalances were analyzed by comparative genomic hybridization (CGH) array with a 3K BAC probes in 24 samples from 22 patients. Both normal FISH and CGH array patterns were observed in 22 samples from 18 patients. In 6 patients, abnormal patterns were observed with an abnormal number of chromosome 12 set in 5 of them. Chromosome 12 structural abnormalities were seen in four of these six patients. An imbalanced FISH pattern between NAV3 and pericentromeric control probes was seen in three patients in accordance with CGH array data (one with a pericentromeric deletion and two with a large 12q deletion including NAV3). No NAV3 specific breakpoint or partial deletion was detected.

  10. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

  11. Deletion of exons 1-5 of the STS gene causing X-linked ichthyosis.

    Science.gov (United States)

    Valdes-Flores, M; Kofman-Alfaro, S H; Vaca, A L; Cuevas-Covarrubias, S A

    2001-03-01

    X-linked ichthyosis is an inherited disorder due to steroid sulfatase deficiency. It is clinically characterized by dark, adhesive, and regular scales of the skin. Most X-linked ichthyosis patients present large deletions of the STS gene and flanking markers; a minority show a point mutation or partial deletion of the STS gene. In this study we analyzed the STS gene in a family with simultaneous occurrence of X-linked ichthyosis and ichthyosis vulgaris. X-linked ichthyosis diagnosis was confirmed through steroid sulfatase assay in leukocytes using 7-[3H]-dehydroepiandrosterone sulfate as a substrate. Exons 1, 2, 5, and 6-10, and the 5' flanking markers DXS1130, DXS1139, and DXS996 of the STS gene were analyzed by polymerase chain reaction. X-linked ichthyosis patients of the family (n = 4 males) had undetectable levels of STS activity (0.00 pmol per mg protein per h). The DNA analysis showed that only exons 6-10 and the 5' flanking markers of the STS gene were present. We report the first partial deletion of the STS gene spanning exons 1-5 in X-linked ichthyosis patients.

  12. Tackling the issue of environmental survival of live Salmonella Typhimurium vaccines: deletion of the lon gene.

    Science.gov (United States)

    Leyman, Bregje; Boyen, Filip; Van Parys, Alexander; Verbrugghe, Elin; Haesebrouck, Freddy; Pasmans, Frank

    2012-12-01

    Vaccination is an important measure to control Salmonella contamination in the meat production chain. A previous study showed that both the ΔrfaJ and ΔrfaL strains are suitable markers and allow serological differentiation of infected and vaccinated animals. The aim of this study was to verify whether deletion of the lon gene in a Salmonella Typhimurium ΔrfaJ marker strain resulted in decreased environmental survival. Our results indicate that deletion of the lon gene in the ΔrfaJ strain did not affect invasiveness in IPEC-J2 cells and resulted in an increased susceptibility to UV, disinfectants (such as hydrogen peroxide and tosylchloramide sodium) and citric acid. Immunization of pigs with inactivated ΔrfaJ or ΔlonΔrfaJ vaccines allowed differentiation of infected and vaccinated pigs. Furthermore, deletion of the lon gene did not reduce the protection conferred by live wild type or ΔrfaJ vaccines against subsequent challenge with a virulent Salmonella Typhimurium strain in BALB/c mice. Based on our results in mice, we conclude that deletion of lon in ΔrfaJ contributes to environmental safety of the ΔrfaJ DIVA strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  14. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M. [Kapiolani Medical Center, Honolulu, HI (United States)] [and others

    1994-09-01

    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms; {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).

  15. Gene-targeted deletion of OPCML and Neurotrimin in mice does not yield congenital heart defects.

    Science.gov (United States)

    Ye, Maoqing; Parente, Fabienne; Li, Xiaodong; Perryman, M Benjamin; Zelante, Leopoldo; Wynshaw-Boris, Anthony; Chen, Ju; Grossfeld, Paul

    2014-04-01

    Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal11q. Many of the most common and severe congenital heart defects that occur in the general population occur in 11q-. Previous studies have demonstrated that gene-targeted deletion in mice of ETS-1, a cardiac transcription factor in distal 11q, causes ventricular septal defects with 100% penetrance. It is unclear whether deletion of other genes in distal 11q contributes to the full spectrum of congenital heart defects that occur in 11q-. Three patients with congenital heart defects have been identified that carry a translocation or paracentric inversion with a breakpoint in distal 11q disrupting one of two functionally related genes, OPCML and Neurotrimin. OPCML and Neurotrimin are two members of the IgLON subfamily of cell adhesion molecules. In this study, we report the generation and cardiac phenotype of single and double heterozygous gene-targeted OPCML and Neurotrimin knockout mice. No cardiac phenotype was detected, consistent with a single gene model as the cause of the congenital heart defects in 11q-. © 2014 Wiley Periodicals, Inc.

  16. Early-onset severe obesity due to complete deletion of the leptin gene in a boy.

    Science.gov (United States)

    Ozsu, Elif; Ceylaner, Serdar; Onay, Huseyin

    2017-10-26

    Monogenic obesity results from single gene mutations. Extreme obesity starting at an early age, especially in infancy, which is associated with endocrinopathy and metabolic disturbances is key to the diagnosis of monogenic obesity. A 6-month-old boy was admitted to our clinic with severe obesity and food craving. He was born with a birth weight of 3400 g to first-cousin parents. He started to gain weight at an abnormal rate at the age of 2 months. He had hyperinsulinemia, dyslipidemia and grade 2 hepatosteatosis. He had a 7-year-old, healthy brother with a normal body weight. Because of severe early-onset obesity and abnormal food addiction, his leptin level was measured and found to be 0.55 ng/mL (normal range for his age and sex is 0.7-21 ng/mL). A LEP gene mutation was screened for and a gross leptin gene deletion was detected. To date, no report on a gross deletion of the LEP gene has been published in the literature. To the best of our knowledge, a gross deletion of the LEP gene has not been reported so far in the literature. Here we report a unique case with congenital leptin deficiency. Thus, clinicians should search for monogenic obesity in patients with early-onset severe obesity and endocrinopathy. Measuring the leptin level could aid clinicians to identify children with monogenic obesity.

  17. Deletion of the TNFAIP3/A20 gene detected by FICTION analysis in classical Hodgkin lymphoma

    Science.gov (United States)

    2012-01-01

    Background The TNFAIP3 gene, which encodes a ubiquitin-modifying enzyme (A20) involved in the negative regulation of NF-κB signaling, is frequently inactivated by gene deletions/mutations in a variety of B-cell malignancies. However, the detection of this in primary Hodgkin lymphoma (HL) specimens is hampered by the scarcity of Hodgkin Reed-Sternberg (HR-S) cells even after enrichment by micro-dissection. Methods We used anti-CD30 immunofluorescence with fluorescence in-situ hybridization (FISH) to evaluate the relative number of TNFAIP3/CEP6 double-positive signals in CD30-positive cells. Results From a total of 47 primary classical Hodgkin lymphoma (cHL) specimens, 44 were evaluable. We found that the relative numbers of TNFAIP3/CD30 cells were distributed among three groups, corresponding to those having homozygous (11%), heterozygous (32%), and no (57%) deletions in TNFAIP3. This shows that TNFAIP3 deletions could be sensitively detected using our chosen methods. Conclusions Comparing the results with mutation analysis, TNFAIP3 inactivation was shown to have escaped detection in many samples with homozygous deletions. This suggests that TNFAIP3 inactivation in primary cHL specimens might be more frequent than previously reported. PMID:23039325

  18. Treacher Collins Syndrome with a de Novo 5-bp Deletion in the TCOF1 Gene

    Directory of Open Access Journals (Sweden)

    Pen-Hua Su

    2006-01-01

    Full Text Available Treacher Collins syndrome (TCS is an autosomal dominant disorder of craniofacial development with features including malar hypoplasia, micrognathia, microtia, downward slanting palpebral fissures, lower eyelid coloboma, conductive hearing loss, and cleft palate. TCS is caused by mutations in the TCOF1 gene, which encodes the nuclear phosphoprotein treacle. Here, we describe a 1-day-old male infant with classical TCS presentation. A 5-bp deletion in exon 22 of the TCOF1 gene (3469del ACTCT was found to cause a premature stop codon. This is the first report of TCOF1 gene mutation in the Taiwanese population.

  19. A new method for simultaneous gene deletion and down-regulation in Brucella melitensis Rev.1.

    Science.gov (United States)

    Saeedinia, Ali Reza; Zeinoddini, Mehdi; Soleimani, Masoud; Sadeghizadeh, Majid

    2015-01-01

    In this study, our aim was to integrate an antisense expression cassette in bacterial chromosome for providing a long-term expression down-regulation in a bid to develop a new approach for simultaneous deletion and down-regulation of target genes in bacterial system. Therefore, we were used this approach for simultaneous deletion of the perosamine synthetase (per) gene and down-regulation of the virB1 expression in Brucella melitensis Rev.1. The per gene, which is one of the LPS O-chain coding genes, was replaced by homologous recombination with an antisense virB1 expression cassette together with kanamycin resistance cassette (kan(R)). Deletion of the per gene was characterized by PCR analysis and DNA sequencing. The expression of antisense virB1 cassette was confirmed by RT-PCR. Down-regulation of the virB1 mRNA expression was quantified by real-time RT-PCR using virB1 specific primers relative to the groEL reference gene. The survival rate of mutant strain was evaluated by CFU count in the BALB/c mice. The virB1 mRNA expression was down-regulated on average 10-fold in mutant strain as compared to parental strain. The loss of per gene function and decrease of the virB1 mRNA expression resulted in reduced entry and survival of the mutant Rev.1 strain in BALB/c mice splenocytes. We propose that this method can be used for simultaneous regulation of multiple genes expression. Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. Characterisation of a new alpha thalassemia 1 defect due to a partial deletion of the alpha globin gene complex.

    Science.gov (United States)

    Pressley, L; Higgs, D R; Aldridge, B; Metaxatou-Mavromati, A; Clegg, J B; Weatherall, D J

    1980-01-01

    A new deletion causing alpha thalassemia has been characterised in a Greek family. Detailed mapping of the alpha gene complex shows that the deletion extends for 5.2 kb and removes the whole of the alpha 2 gene and the 5' end of the alpha 1 gene. The affected chromosome, therefore produces no normal alpha chains and results in a phenotype of alpha thalassemia 1. Images PMID:6255436

  1. Large-scale evaluation of in silico gene deletions in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Förster, Jochen; Famili, Iman; Palsson, Bernhard Ø

    2003-01-01

    A large-scale in silico evaluation of gene deletions in Saccharomyces cerevisiae was conducted using a genome-scale reconstructed metabolic model. The effect of 599 single gene deletions on cell viability was simulated in silico and compared to published experimental results. In 526 cases (87.......8%), the in silico results were in agreement with experimental observations when growth on synthetic complete medium was simulated. Viable phenotypes were correctly predicted in 89.4% (496 out of 555) and lethal phenotypes were correctly predicted in 68.2% (30 out of 44) of the cases considered. The in silico...... inadequacies of the in silico model: (1) incomplete media composition, (2) substitutable biomass components, (3) incomplete biochemical information, and (4) missing regulation. This analysis eliminated a number of false predictions and suggested a number of experimentally testable hypotheses. A genome...

  2. de novo interstitial deletions at the 11q23.3-q24.2 region.

    Science.gov (United States)

    Su, Jiasun; Chen, Rongyu; Luo, Jingsi; Fan, Xin; Fu, Chunyun; Wang, Jin; He, Sheng; Hu, Xuyun; Zhang, ShuJie; Yi, Shang; Chen, Shaoke; Shen, Yiping

    2016-01-01

    Jacobsen syndrome (JBS) is a contiguous gene deletion syndrome involving 11q terminal deletion. Interstitial deletions at distal 11q are rare and their contributions to the clinical phenotype of JBS are unknown. We presented the chromosome microarray (CMA) data and the clinical features of two individuals carrying a non-overlapping de novo deletion each at the 11q23.3-q24.2 region in an effort to analyze the correlation between region of deletion at 11q and phenotype. Both deletions are likely pathogenic for patient's condition. The deletion at 11q23.3q24.1 is associated with short stature, relative microcephaly, failure to thrive, hypotonia and sleeping disorder. The deletion at 11q24.2 involves HEPACAM and our patient's clinical presentation (relative macrocephaly, abnormal MRI, mild developmental delay and seizure) is not inconsistent with Megalencephalic leukoencephalopathy with subcortical cysts 2B. Our finds support the notion that more than one critical region at 11q23.3-qter are responsible for the variable clinical presentation of JBS, thus JBS is a true contiguous gene deletion syndrome where multiple loci contributed to the clinical characteristics of JBS. Small interstitial deletions at 11q23.3-q24.2 and their associated unique features also suggest emerging novel genomic disorders.

  3. Analysis of conditional gene deletion using probe based Real-Time PCR

    OpenAIRE

    Lyko Frank; Schmidt Joachim; Weis Britta; Linhart Heinz G

    2010-01-01

    Abstract Background Conditional gene deletion using Cre-lox recombination is frequently used in mouse genetics; however recombination is frequently incomplete, resulting in a mixture of cells containing the functional (2lox) allele and the truncated (1lox) allele. Conventional analysis of 1lox/2lox allele ratios using Southern Blotting is time consuming, requires relatively large amounts of DNA and has a low sensitivity. We therefore evaluated the utility of Real-Time PCR to measure 1lox/2lox...

  4. Deletion of a Stay-Green Gene Associates with Adaptive Selection in Brassica napus.

    Science.gov (United States)

    Qian, Lunwen; Voss-Fels, Kai; Cui, Yixin; Jan, Habib U; Samans, Birgit; Obermeier, Christian; Qian, Wei; Snowdon, Rod J

    2016-12-05

    Chlorophyll levels provide important information about plant growth and physiological plasticity in response to changing environments. The stay-green gene NON-YELLOWING 1 (NYE1) is believed to regulate chlorophyll degradation during senescence, concomitantly affecting the disassembly of the light-harvesting complex and hence indirectly influencing photosynthesis. We identified Brassica napus accessions carrying an NYE1 deletion associated with increased chlorophyll content, and with upregulated expression of light-harvesting complex and photosynthetic reaction center (PSI and PSII) genes. Comparative analysis of the seed oil content of accessions with related genetic backgrounds revealed that the B. napus NYE1 gene deletion (bnnye1) affected oil accumulation, and linkage disequilibrium signatures suggested that the locus has been subject to artificial selection by breeding in oilseed B. napus forms. Comparative analysis of haplotype diversity groups (haplogroups) between three different ecotypes of the allopolyploid B. napus and its A-subgenome diploid progenitor, Brassica rapa, indicated that introgression of the bnnye1 deletion from Asian B. rapa into winter-type B. napus may have simultaneously improved its adaptation to cooler environments experienced by autumn-sown rapeseed. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  5. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. (Royal Postgraduate Medical School, London (United Kingdom)); Vulliamy, T. (Hammersmith Hospital, London (United Kingdom))

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  6. Reduced natriuretic response to acute sodium loading in COMT Gene deleted mice

    Directory of Open Access Journals (Sweden)

    Uhlén Staffan

    2002-08-01

    Full Text Available Abstract Background The intrarenal natriuretic hormone dopamine (DA is metabolised by catechol-O-methyltransferase (COMT and monoamine oxidase (MAO. Inhibition of COMT, as opposed to MAO, results in a potent natriuretic response in the rat. The present study in anaesthetized homozygous and heterozygous COMT gene deleted mice attempted to further elucidate the importance of COMT in renal DA and sodium handling. After acute intravenous isotonic sodium loading, renal function was followed. Results COMT activity in heterozygous mice was about half of that in wild type mice and was zero in the homozygous mice. MAO activity did not differ between the genotypes. Urinary sodium excretion increased 10-fold after sodium loading in wild type mice. In heterozygous and homozygous mice, the natriuretic effects of sodium loading were only 29 % and 39 %, respectively, of that in wild type mice. Arterial pressure and glomerular filtration rate did not differ between genotypes. Baseline norepinephrine and DA excretions in urine were elevated in the homozygous, but not in heterozygous, COMT gene deleted mice. Urinary DA excretion increased after isotonic sodium loading in the wild type mice but not in the COMT gene deleted mice. Conclusions Mice with reduced or absent COMT activity have altered metabolism of catecholamines and are unable to increase renal DA activity and produce normal natriuresis in response to acute sodium loading. The results support the hypothesis that COMT has an important role in the DA-mediated regulation of renal sodium excretion.

  7. SMN1 and NAIP Genes Deletions in Different Types of Spinal Muscular Atrophy in Khuzestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Gholamreza Mohamadian

    2011-12-01

    Full Text Available Background: Spinal muscular atrophy (SMA is the second most common lethal autosomal recessive disease. It is a neuromuscular disorder caused by degenerative of lower motor neurons and occasionally bulbar neurons leading to progressive limb paralysis and muscular atrophy. The SMN1 gene is recognized as a SMA causing gene while NAIP has been characterized as a modifying factor for the clinical severity and age at disease onset in SMA patients (SMA subtypes. The relationship between NAIP deletion and type of SMA remains to be clarified; we investigated this gene alteration in all types of SMA patients. Methods: Molecular analysis was performed on fifty patients with a clinical diagnosis of SMA in Khuzestan province. In addition to common PCR-RFLP analysis for exon 7 and 8 of SMN1 gene, as an internal control we analysed NAIP deletion with PCR of exon 5 of this gene in a multiplex PCR with exon 13 of it. Results: Homozygous-deletion frequency rate for the telomeric copy of SMN (SMN1 exon 7 in all types (type I, II, Ш of SMA was approximately 90% and the frequency of deletion in exon 7 and 8 together in all types estimated about 70%. Moreover NAIP gene was deleted in about 60% of these patients and this shows deletion in 91% of type I SMA patients. The correlation between NAIP-deletion and SMN1 mutation showed a high frequency rate. Conclusion: In this study, high frequency of NAIP gene deletion in all type of disease shows the importance role of it in disease pathogenesis. High frequency of NAIP deletion in SMA type I, also shows the importance of the gene in type and severity of disease so it may be a modifier factor in severity of disease.

  8. A Codon Deletion at the Beginning of Green Fluorescent Protein Genes Enhances Protein Expression.

    Science.gov (United States)

    Rodríguez-Mejía, José-Luis; Roldán-Salgado, Abigail; Osuna, Joel; Merino, Enrique; Gaytán, Paul

    2017-01-01

    Recombinant protein expression is one of the key issues in protein engineering and biotechnology. Among the different models for assessing protein production and structure-function studies, green fluorescent protein (GFP) is one of the preferred models because of its importance as a reporter in cellular and molecular studies. In this research we analyze the effect of codon deletions near the amino terminus of different GFP proteins on fluorescence. Our study includes Gly4 deletions in the enhanced GFP (EGFP), the red-shifted GFP and the red-shifted EGFP. The Gly4 deletion mutants and their corresponding wild-type counterparts were transcribed under the control of the T7 or Trc promoters and their expression patterns were analyzed. Different fluorescent outcomes were observed depending on the type of fluorescent gene versions. In silico analysis of the RNA secondary structures near the ribosome binding site revealed a direct relationship between their minimum free energy and GFP production. Integrative analysis of these results, including SDS-PAGE analysis, led us to conclude that the fluorescence improvement of cells expressing different versions of GFPs with Gly4 deleted is due to an enhancement of the accessibility of the ribosome binding site by reducing the stability of the RNA secondary structures at their mRNA leader regions. © 2016 S. Karger AG, Basel.

  9. Spontaneous deletion in the FMR-1 gene in a patient with fragile X syndrome and cherubism

    Energy Technology Data Exchange (ETDEWEB)

    Popovich, B.W.; Anoe, K.S.; Johnson, D.B. [Oregon Health Sciences Univ., Portland, OR (United States)] [and others

    1994-09-01

    Fragile X mental retardation results from the transcriptional inactivation of the FMR-1 gene and is commonly caused by the expansion of an unstable CGG trinucleotide repeat located in the first exon of the FMR-1 gene. We describe here a two generation fragile X family in which expansion of the CGG repeat may have resulted in a deletion of a least portion of the FMR-1 gene. One member of this family, AB, carries an apparent deletion of the FMR-1 gene and presents with mental retardation and also cherubism, a feature not usually associated with fragile X syndrome. Cherubism is a condition characterized by a swelling of the lower face and is caused by giant cell lesions of the mandible and maxilla, and often the anterior ends of the ribs. The size of the CGG repeat region in this family was determined by Southern analysis of BglII, EcoRI, and PstI digested genomic DNA, isolated from peripheral blood lymphocytes, using a 558 bp PstI-Xhol fragment specific for the 5{prime}-end of the FMR-1 gene. SB and TB, the mother and maternal half-brother of AB, respectively, were both found to carry an expanded FMR-1 allele with greater than 200 CGG repeats. Negligible hybridization was observed in the DNA of AB. In addition, no amplification was observed when the polymerase chain reaction (PCR) was performed using primers flanking the CGG repeat region. These results are consistent with a deletion of at least the 5{prime} portion of the FMR-1 gene in the majority of peripheral blood lymphocytes. Further work is underway using FMR-1 cDNA probes and additional PCR primers to determine the nature of the molecular lesion in AB`s DNA and determine the relationship of this lesion to his cherubism.

  10. The 11q Terminal Deletion Disorder Jacobsen Syndrome is a Syndromic Primary Immunodeficiency

    NARCIS (Netherlands)

    V.A.S.H. Dalm (Virgil); G.J.A. Driessen (Gertjan); B.H. Barendregt (Barbara); P.M. van Hagen (Martin); M. van der Burg (Mirjam)

    2015-01-01

    textabstractBackground: Jacobsen syndrome (JS) is a rare contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11. Clinical features include physical and mental growth retardation, facial dysmorphism, thrombocytopenia, impaired platelet function and pancytopenia. In case

  11. Cockayne Syndrome due to a maternally-inherited whole gene deletion of ERCC8 and a paternally-inherited ERCC8 exon 4 deletion.

    Science.gov (United States)

    Ting, T W; Brett, M S; Tan, E S; Shen, Y; Lee, S P; Lim, E C; Vasanwala, R F; Lek, N; Thomas, T; Lim, K W; Tan, E C

    2015-11-10

    Cockayne Syndrome (CS) is an autosomal recessive disorder that causes neurological regression, growth failure and dysmorphic features. We describe a Chinese female child with CS caused by deletions of exon 4 of ERCC8 on one chromosome and exons 1-12 on the other chromosome. By using chromosomal microarray, multiplex ligation-dependant probe analysis and long range PCR, we showed that she inherited a 277 kb deletion affecting the whole ERCC8 gene from the mother and a complex rearrangement resulting in deletion of exon 4 together with a 1,656 bp inversion of intron 4 from the father. A similar complex rearrangement has been reported in four unrelated Japanese CS patients. Analysis of the deletion involving exon 4 identified LINE and other repeat elements that may predispose the region to deletions, insertions and inversions. The patient also had insulin-dependent diabetes mellitus, a rare co-existing feature in patients with CS. More research will be needed to further understand the endocrine manifestations in CS patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. One Base Deletion (c.2422delT) in the TPO Gene Causes Severe Congenital Hypothyroidism.

    Science.gov (United States)

    Cangül, Hakan; Doğan, Murat; Sağlam, Yaman; Kendall, Michaela; Boelaert, Kristien; Barrett, Timothy G; Maher, Eamonn R

    2014-09-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder and mutations in the TPO gene have been reported to cause CH. Our aim in this study was to determine the genetic basis of CH in two affected individuals coming from a consanguineous family. Since CH is usually inherited in autosomal recessive manner in consanguineous/multi-case families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus using microsatellite markers and then screened for mutations in linked-gene by Sanger sequencing. The family showed potential linkage to the TPO gene and we detected a deletion (c.2422delT) in both cases. The mutation segregated with disease status in the family. This study demonstrates that a single base deletion in the carboxyl-terminal coding region of the TPO gene could cause CH and helps to establish a genotype/phenotype correlation associated with the mutation. The study also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH.

  13. A Novel Deletion Mutation in ASPM Gene in an Iranian Family with Autosomal Recessive Primary Microcephaly.

    Science.gov (United States)

    Akbariazar, Elinaz; Ebrahimpour, Mohammad; Akbari, Saeedeh; Arzhanghi, Sanaz; Abedini, Seydeh Sedigheh; Najmabadi, Hossein; Kahrizi, Kimia

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is a neurodevelopmental and genetically heterogeneous disorder with decreased head circumference due to the abnormality in fetal brain growth. To date, nine loci and nine genes responsible for the situation have been identified. Mutations in the ASPM gene (MCPH5) is the most common cause of MCPH. The ASPM gene with 28 exons is essential for normal mitotic spindle function in embryonic neuroblasts. We have ascertained twenty-two consanguineous families with intellectual disability and different ethnic backgrounds from Iran. Ten out of twenty-two families showed primary microcephaly in clinical examination. We investigated MCPH5 locus using homozygosity mapping by microsatellite marker. Sequence analysis of exon 8 revealed a deletion of nucleotide (T) in donor site of splicing site of ASPM in one family. The remaining nine families were not linked to any of the known loci .More investigation will be needed to detect the causative defect in these families. [corrected] We detected a novel mutation in the donor splicing site of exon 8 of the ASPM gene. This deletion mutation can alter the ASPM transcript leading to functional impairment of the gene product.

  14. Systematic phenotyping of a large-scale Candida glabrata deletion collection reveals novel antifungal tolerance genes.

    Directory of Open Access Journals (Sweden)

    Tobias Schwarzmüller

    2014-06-01

    Full Text Available The opportunistic fungal pathogen Candida glabrata is a frequent cause of candidiasis, causing infections ranging from superficial to life-threatening disseminated disease. The inherent tolerance of C. glabrata to azole drugs makes this pathogen a serious clinical threat. To identify novel genes implicated in antifungal drug tolerance, we have constructed a large-scale C. glabrata deletion library consisting of 619 unique, individually bar-coded mutant strains, each lacking one specific gene, all together representing almost 12% of the genome. Functional analysis of this library in a series of phenotypic and fitness assays identified numerous genes required for growth of C. glabrata under normal or specific stress conditions, as well as a number of novel genes involved in tolerance to clinically important antifungal drugs such as azoles and echinocandins. We identified 38 deletion strains displaying strongly increased susceptibility to caspofungin, 28 of which encoding proteins that have not previously been linked to echinocandin tolerance. Our results demonstrate the potential of the C. glabrata mutant collection as a valuable resource in functional genomics studies of this important fungal pathogen of humans, and to facilitate the identification of putative novel antifungal drug target and virulence genes.

  15. Identification of a novel functional deletion variant in the 5'-UTR of the DJ-1 gene

    Directory of Open Access Journals (Sweden)

    Warnich Louise

    2009-10-01

    Full Text Available Abstract Background DJ-1 forms part of the neuronal cellular defence mechanism against oxidative insults, due to its ability to undergo self-oxidation. Oxidative stress has been implicated in the pathogenesis of central nervous system damage in different neurodegenerative disorders including Alzheimer's disease and Parkinson's disease (PD. Various mutations in the DJ-1 (PARK7 gene have been shown to cause the autosomal recessive form of PD. In the present study South African PD patients were screened for mutations in DJ-1 and we aimed to investigate the functional significance of a novel 16 bp deletion variant identified in one patient. Methods The possible effect of the deletion on promoter activity was investigated using a Dual-Luciferase Reporter assay. The DJ-1 5'-UTR region containing the sequence flanking the 16 bp deletion was cloned into a pGL4.10-Basic luciferase-reporter vector and transfected into HEK293 and BE(2-M17 neuroblastoma cells. Promoter activity under hydrogen peroxide-induced oxidative stress conditions was also investigated. Computational (in silico cis-regulatory analysis of DJ-1 promoter sequence was performed using the transcription factor-binding site database, TRANSFAC via the PATCH™ and rVISTA platforms. Results A novel 16 bp deletion variant (g.-6_+10del was identified in DJ-1 which spans the transcription start site and is situated 93 bp 3' from a Sp1 site. The deletion caused a reduction in luciferase activity of approximately 47% in HEK293 cells and 60% in BE(2-M17 cells compared to the wild-type (P Conclusion This is the first report of a functional DJ-1 promoter variant, which has the potential to influence transcript stability or translation efficiency. Further work is necessary to determine the extent to which the g.-6_+10del variant affects the normal function of the DJ-1 promoter and whether this variant confers a risk for PD.

  16. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.

    Science.gov (United States)

    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M

    2014-01-01

    The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

  17. Identifying Relationships among Genomic Disease Regions: Predicting Genes at Pathogenic SNP Associations and Rare Deletions

    Science.gov (United States)

    Raychaudhuri, Soumya; Plenge, Robert M.; Rossin, Elizabeth J.; Ng, Aylwin C. Y.; Purcell, Shaun M.; Sklar, Pamela; Scolnick, Edward M.; Xavier, Ramnik J.; Altshuler, David; Daly, Mark J.

    2009-01-01

    Translating a set of disease regions into insight about pathogenic mechanisms requires not only the ability to identify the key disease genes within them, but also the biological relationships among those key genes. Here we describe a statistical method, Gene Relationships Among Implicated Loci (GRAIL), that takes a list of disease regions and automatically assesses the degree of relatedness of implicated genes using 250,000 PubMed abstracts. We first evaluated GRAIL by assessing its ability to identify subsets of highly related genes in common pathways from validated lipid and height SNP associations from recent genome-wide studies. We then tested GRAIL, by assessing its ability to separate true disease regions from many false positive disease regions in two separate practical applications in human genetics. First, we took 74 nominally associated Crohn's disease SNPs and applied GRAIL to identify a subset of 13 SNPs with highly related genes. Of these, ten convincingly validated in follow-up genotyping; genotyping results for the remaining three were inconclusive. Next, we applied GRAIL to 165 rare deletion events seen in schizophrenia cases (less than one-third of which are contributing to disease risk). We demonstrate that GRAIL is able to identify a subset of 16 deletions containing highly related genes; many of these genes are expressed in the central nervous system and play a role in neuronal synapses. GRAIL offers a statistically robust approach to identifying functionally related genes from across multiple disease regions—that likely represent key disease pathways. An online version of this method is available for public use (http://www.broad.mit.edu/mpg/grail/). PMID:19557189

  18. Novel 9q34.11 gene deletions encompassing combinations of four Mendelian disease genes: STXBP1, SPTAN1, ENG, and TOR1A.

    Science.gov (United States)

    Campbell, Ian M; Yatsenko, Svetlana A; Hixson, Patricia; Reimschisel, Tyler; Thomas, Matthew; Wilson, William; Dayal, Usha; Wheless, James W; Crunk, Amy; Curry, Cynthia; Parkinson, Nicole; Fishman, Leona; Riviello, James J; Nowaczyk, Malgorzata J M; Zeesman, Susan; Rosenfeld, Jill A; Bejjani, Bassem A; Shaffer, Lisa G; Cheung, Sau Wai; Lupski, James R; Stankiewicz, Pawel; Scaglia, Fernando

    2012-10-01

    A number of genes in the 9q34.11 region may be haploinsufficient. However, studies analyzing genotype-phenotype correlations of deletions encompassing multiple dosage-sensitive genes in the region are lacking. We mapped breakpoints of 10 patients with 9q34.11 deletions using high-resolution 9q34-specific array comparative genomic hybridization (CGH) to determine deletion size and gene content. The 9q34.11 deletions range in size from 67 kb to 2.8 Mb. Six patients exhibit intellectual disability and share a common deleted region including STXBP1; four manifest variable epilepsy. In five subjects, deletions include SPTAN1, previously associated with early infantile epileptic encephalopathy, infantile spasms, intellectual disability, and hypomyelination. In four patients, the deletion includes endoglin (ENG), causative of hereditary hemorrhagic telangiectasia. Finally, in four patients, deletions involve TOR1A, of which molecular defects lead to early-onset primary dystonia. Ninety-four other RefSeq genes also map to the genomic intervals investigated. STXBP1 haploinsufficiency results in progressive encephalopathy characterized by intellectual disability and may be accompanied by epilepsy, movement disorders, and autism. We propose that 9q34.11 genomic deletions involving ENG, TOR1A, STXBP1, and SPTAN1 are responsible for multisystemic vascular dysplasia, early-onset primary dystonia, epilepsy, and intellectual disability, therefore revealing cis-genetic effects leading to complex phenotypes.

  19. Deleting the Arntl clock gene in the granular layer of the mouse cerebellum

    DEFF Research Database (Denmark)

    Bering, Tenna; Carstensen, Mikkel Bloss; Rath, Martin Fredensborg

    2017-01-01

    The suprachiasmatic nucleus houses the central circadian clock and is characterized by the timely regulated expression of clock genes. However, neurons of the cerebellar cortex also contain a circadian oscillator with circadian expression of clock genes being controlled by the suprachiasmatic...... is involved in circadian physiology and food anticipation, we therefore by use of Cre-LoxP technology generated a conditional knockout mouse with the core clock gene Arntl deleted specifically in granule cells of the cerebellum, since expression of clock genes in the cerebellar cortex is mainly located...... nucleus. It has been suggested that the cerebellar circadian oscillator is involved in food anticipation, but direct molecular evidence of the role of the circadian oscillator of the cerebellar cortex is currently unavailable. To investigate the hypothesis that the circadian oscillator of the cerebellum...

  20. Reduced production of diacetyl by overexpressing BDH2 gene and ILV5 gene in yeast of the lager brewers with one ILV2 allelic gene deleted.

    Science.gov (United States)

    Shi, Ting-Ting; Li, Ping; Chen, Shi-Jia; Chen, Ye-Fu; Guo, Xue-Wu; Xiao, Dong-Guang

    2017-03-01

    Diacetyl causes an unwanted buttery off-flavor in lager beer. The production of diacetyl is reduced by modifying the metabolic pathway of yeast in the beer fermentation process. In this study, BDH2 and ILV5 genes, coding diacetyl reductase and acetohydroxy acid reductoisomerase, respectively, were expressed using a PGK1 promoter in Saccharomyces cerevisiae, which deleted one ILV2 allelic gene. Diacetyl contents and fermentation performances were examined and compared. Results showed that the diacetyl content in beer was remarkably reduced by 16.52% in QI2-KP (one ILV2 allelic gene deleted), 55.65% in QI2-B2Y (overexpressed BDH2 gene and one ILV2 allelic gene deleted), and 69.13% in QI2-I5Y (overexpressed ILV5 gene and one ILV2 allelic gene deleted) compared with the host strain S2. The fermentation ability of mutant strains was similar to that of S2. Results of the present study can lead to further advances in this technology and its broad application in scientific investigations and industrial beer production.

  1. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9

    Science.gov (United States)

    Carroll, Kelli J.; Makarewich, Catherine A.; McAnally, John; Anderson, Douglas M.; Zentilin, Lorena; Liu, Ning; Giacca, Mauro; Bassel-Duby, Rhonda; Olson, Eric N.

    2016-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)9 genomic editing has revolutionized the generation of mutant animals by simplifying the creation of null alleles in virtually any organism. However, most current approaches with this method require zygote injection, making it difficult to assess the adult, tissue-specific functions of genes that are widely expressed or which cause embryonic lethality when mutated. Here, we describe the generation of cardiac-specific Cas9 transgenic mice, which express high levels of Cas9 in the heart, but display no overt defects. In proof-of-concept experiments, we used Adeno-Associated Virus 9 (AAV9) to deliver single-guide RNA (sgRNA) that targets the Myh6 locus exclusively in cardiomyocytes. Intraperitoneal injection of postnatal cardiac-Cas9 transgenic mice with AAV9 encoding sgRNA against Myh6 resulted in robust editing of the Myh6 locus. These mice displayed severe cardiomyopathy and loss of cardiac function, with elevation of several markers of heart failure, confirming the effectiveness of this method of adult cardiac gene deletion. Mice with cardiac-specific expression of Cas9 provide a tool that will allow rapid and accurate deletion of genes following a single injection of AAV9-sgRNAs, thereby circumventing embryonic lethality. This method will be useful for disease modeling and provides a means of rapidly editing genes of interest in the heart. PMID:26719419

  2. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.

    Science.gov (United States)

    Carroll, Kelli J; Makarewich, Catherine A; McAnally, John; Anderson, Douglas M; Zentilin, Lorena; Liu, Ning; Giacca, Mauro; Bassel-Duby, Rhonda; Olson, Eric N

    2016-01-12

    Clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)9 genomic editing has revolutionized the generation of mutant animals by simplifying the creation of null alleles in virtually any organism. However, most current approaches with this method require zygote injection, making it difficult to assess the adult, tissue-specific functions of genes that are widely expressed or which cause embryonic lethality when mutated. Here, we describe the generation of cardiac-specific Cas9 transgenic mice, which express high levels of Cas9 in the heart, but display no overt defects. In proof-of-concept experiments, we used Adeno-Associated Virus 9 (AAV9) to deliver single-guide RNA (sgRNA) that targets the Myh6 locus exclusively in cardiomyocytes. Intraperitoneal injection of postnatal cardiac-Cas9 transgenic mice with AAV9 encoding sgRNA against Myh6 resulted in robust editing of the Myh6 locus. These mice displayed severe cardiomyopathy and loss of cardiac function, with elevation of several markers of heart failure, confirming the effectiveness of this method of adult cardiac gene deletion. Mice with cardiac-specific expression of Cas9 provide a tool that will allow rapid and accurate deletion of genes following a single injection of AAV9-sgRNAs, thereby circumventing embryonic lethality. This method will be useful for disease modeling and provides a means of rapidly editing genes of interest in the heart.

  3. Enhancement or Attenuation of Disease by Deletion of Genes from Citrus Tristeza Virus

    Science.gov (United States)

    Tatineni, Satyanarayana

    2012-01-01

    Stem pitting is a common virus-induced disease of perennial woody plants induced by a range of different viruses. The phenotype results from sporadic areas of the stem in which normal xylem and phloem development is prevented during growth of stems. These alterations interfere with carbohydrate transport, resulting in reduced plant growth and yield. Citrus tristeza virus (CTV), a phloem-limited closterovirus, induces economically important stem-pitting diseases of citrus. CTV has three nonconserved genes (p33, p18, and p13) that are not related to genes of other viruses and that are not required for systemic infection of some species of citrus, which allowed us to examine the effect of deletions of these genes on symptom phenotypes. In the most susceptible experimental host, Citrus macrophylla, the full-length virus causes only very mild stem-pitting symptoms. Surprisingly, we found that certain deletion combinations (p33 and p18 and/or p13) induced greatly increased stem-pitting symptoms, while other combinations (p13 or p13 plus p18) resulted in reduced stem pitting. These results suggest that the stem-pitting phenotype, which is one of more economically important disease phenotypes, can result not from a specific sequence or protein but from a balance between the expression of different viral genes. Unexpectedly, using green fluorescent protein-tagged full-length virus and deletion mutants (CTV9Δp33 and CTV9Δp33Δp18Δp13), the virus was found at pitted areas in abnormal locations outside the normal ring of phloem. Thus, increased stem pitting was associated not only with a prevention of xylem production but also with a proliferation of cells that supported viral replication, suggesting that at random areas of stems the virus can elicit changes in cellular differentiation and development. PMID:22593155

  4. Enhancement or attenuation of disease by deletion of genes from Citrus tristeza virus.

    Science.gov (United States)

    Tatineni, Satyanarayana; Dawson, William O

    2012-08-01

    Stem pitting is a common virus-induced disease of perennial woody plants induced by a range of different viruses. The phenotype results from sporadic areas of the stem in which normal xylem and phloem development is prevented during growth of stems. These alterations interfere with carbohydrate transport, resulting in reduced plant growth and yield. Citrus tristeza virus (CTV), a phloem-limited closterovirus, induces economically important stem-pitting diseases of citrus. CTV has three nonconserved genes (p33, p18, and p13) that are not related to genes of other viruses and that are not required for systemic infection of some species of citrus, which allowed us to examine the effect of deletions of these genes on symptom phenotypes. In the most susceptible experimental host, Citrus macrophylla, the full-length virus causes only very mild stem-pitting symptoms. Surprisingly, we found that certain deletion combinations (p33 and p18 and/or p13) induced greatly increased stem-pitting symptoms, while other combinations (p13 or p13 plus p18) resulted in reduced stem pitting. These results suggest that the stem-pitting phenotype, which is one of more economically important disease phenotypes, can result not from a specific sequence or protein but from a balance between the expression of different viral genes. Unexpectedly, using green fluorescent protein-tagged full-length virus and deletion mutants (CTV9Δp33 and CTV9Δp33Δp18Δp13), the virus was found at pitted areas in abnormal locations outside the normal ring of phloem. Thus, increased stem pitting was associated not only with a prevention of xylem production but also with a proliferation of cells that supported viral replication, suggesting that at random areas of stems the virus can elicit changes in cellular differentiation and development.

  5. Analysis of p16 gene mutations and deletions in childhood acute lymphoblastic leukemias

    Directory of Open Access Journals (Sweden)

    José Alexandre Rodrigues Lemos

    Full Text Available CONTEXT: The p16 tumor suppressor gene encodes a cyclin-dependent kinase 4 inhibitor that blocks cell division during the G1 phase of the cell cycle. Alterations in this gene have been reported for various neoplasia types, including acute lymphoblastic leukemias (ALL, especially T-cell acute lymphoblastic leukemias (ALL. OBJECTIVE: To determine probable alterations in the p16 gene in children with acute lymphoblastic leukemias using the polymerase chain reaction (PCR and direct DNA sequencing and also to analyze event-free survival (EFS. DESIGN: Retrospective study. SETTING: Department of Child Care and Pediatrics, Faculty of Medicine of Ribeirão Preto, Universidade Federal de São Paulo. PARTICIPANTS: Fifty-six children with ALL (mean age 4 years. Forty (71.43% had B-cell and 12 (21.43% had T-cell ALL; 4 (7.1% were biphenotypic. SAMPLE: DNA samples were extracted from bone marrow upon diagnosis and/or relapse. In 2 T-cell cases, DNA from cerebrospinal fluid (CSF was analyzed. MAIN MEASUREMENTS: Deletions or nucleotide substitutions in exons 1, 2 and 3 of the p16 gene were determined by PCR and nucleotide sequencing. Event-free survival was determined by the Kaplan-Meyer and log-rank test for patients carrying normal and altered p16. RESULTS: Deletions in exon 3 were observed in five cases. Abnormal migration in PCR was observed in seven cases for exon 1, six for exon 2, and five for exon 3. Mutations in exon 1 were confirmed by direct DNA sequencing in four cases and in exon 2 in two cases. The Kaplan-Meyer survival curves and the log-rank test showed no significant differences in 5-year EFS between children with normal or altered p16, or between patients with B-ALL carrying normal or altered p16 gene. Patients with T-ALL could not be evaluated via Kaplan-Meier due to the small number of cases. CONCLUSIONS: Our results, particularly regarding deletion frequency, agree with others suggesting that deletions in the p16 are initial events in

  6. Identification of two point mutations and a one base deletion in exon 19 of the dystrophin gene by heteroduplex formation.

    Science.gov (United States)

    Prior, T W; Papp, A C; Snyder, P J; Burghes, A H; Sedra, M S; Western, L M; Bartello, C; Mendell, J R

    1993-03-01

    Two thirds of the Duchenne muscular dystrophy population have either gene deletions or duplications. The nondeletion/duplication cases are most likely the result of point mutations or small deletions and duplications that cannot be easily identified by current strategies. The major obstacle in identifying small mutations is due to the large size of the dystrophin gene. We selectively screened 5 DMD exons containing CpG dinucleotides in 110 DMD patients without detectable deletions or duplications. Nonsenses mutations are frequently due to a C- to -T transition within a CG dinucleotide pair. To screen for the nonsense mutations, we used the heteroduplex method. Utilizing this approach, we identified 2 different nonsense mutations and a single base deletion all occurring in exon 19. This is the first report of a clustering of small mutations in the dystrophin gene.

  7. Effect of deletion polymorphism of angiotensin converting enzyme gene on progression of diabetic nephropathy during inhibition of angiotensin converting enzyme

    DEFF Research Database (Denmark)

    Parving, H H; Jacobsen, P; Tarnow, L

    1996-01-01

    showed that haemoglobin A1c concentration, albuminuria, and the double deletion genotype independently influenced the sustained rate of decline in glomerular filtration rate (R1 (adjusted) = 0.51). CONCLUSION: The deletion polymorphism in the angiotensin converting enzyme gene reduces the long term......OBJECTIVE: To evaluate the concept that an insertion/deletion polymorphism of the angiotensin converting enzyme gene predicts the therapeutic efficacy of inhibition of angiotensin converting enzyme on progression of diabetic nephropathy. DESIGN: Observational follow up study of patients...... (median 75 mg/day (range 12.5 to 150 mg/day)) that was in many cases combined with a loop diuretic, 11 patients were homozygous for the deletion allele and 24 were heterozygous or homozygous for the insertion allele of the angiotensin converting enzyme gene. MAIN OUTCOME MEASURES: Albuminuria, arterial...

  8. Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

    Science.gov (United States)

    Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

    2003-07-30

    Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.

  9. Total beta-globin gene deletion has high frequency in Filipinos

    Energy Technology Data Exchange (ETDEWEB)

    Patrick, N.; Miyakawa, F.; Hunt, J.A. [Univ. of Hawaii, Honolulu, HI (United States)] [and others

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  10. Mapping of polyketide biosynthesis pathways in Aspergillus nidulans using a genome wide PKS gene deletion library

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Rank, Christian; Klejnstrup, Marie Louise

    approaches for triggering “cryptic” or “silent” genes to see production of compounds not previously observed under laboratory conditions. We therefore decided to challenge our deletion library on eight different complex media, spanning a large variety of alternating carbon and nitrogen sources, vitamins...... and other nutrients. Comparative UHPLC-DAD analyses indeed revealed that a large number of secondary metabolites were produced by the A. nidulans reference strain on the different media. Careful investigation, also including LC-DAD-HRMS data, has lead to the linking of several known compounds to their PKS...

  11. Familial spinal neurofibromatosis due to a multiexonic NF1 gene deletion.

    Science.gov (United States)

    Pizzuti, Antonio; Bottillo, Irene; Inzana, Francesca; Lanari, Valentina; Buttarelli, Francesca; Torrente, Isabella; Giallonardo, Anna Teresa; De Luca, Alessandro; Dallapiccola, Bruno

    2011-08-01

    We report the detailed clinical presentation and molecular features of a spinal neurofibromatosis familial case where a 40-year-old woman, presenting with multiple bilateral spinal neurofibromas and no other clinical feature of neurofibromatosis type 1 (NF1), inherited a paternal large multiexonic deletion (c.5944-?_7126+?del) which resulted in NF1 gene haploinsufficiency at the RNA level. In the clinically unaffected 73-year-old father, spinal cord MRI disclosed bilateral and symmetrical hypertrophy of spinal lumbosacral roots. Our study widens the phenotypic and mutational spectrum of NF1 and illustrates the difficulties of counseling patients with border-line or atypical presentation of this disorder.

  12. A Genetic Screen for Fission Yeast Gene Deletion Mutants Exhibiting Hypersensitivity to Latrunculin A

    Directory of Open Access Journals (Sweden)

    Farzad Asadi

    2016-10-01

    Full Text Available Fission yeast cells treated with low doses of the actin depolymerizing drug, latrunculin A (LatA, delay entry into mitosis via a mechanism that is dependent on both the Clp1p and Rad24p proteins. During this delay, cells remain in a cytokinesis-competent state that is characterized by continuous repair and/or reestablishment of the actomyosin ring. In this manner, cells ensure the faithful completion of the preceding cytokinesis in response to perturbation of the cell division machinery. To uncover other genes with a role in this response, or simply genes with roles in adapting to LatA-induced stress, we carried out a genome-wide screen and identified a group of 38 gene deletion mutants that are hyper-sensitive to the drug. As expected, we found genes affecting cytokinesis and/or the actin cytoskeleton within this set (ain1, acp2, imp2. We also identified genes with roles in histone modification (tra1, ngg1, intracellular transport (apl5, aps3, and glucose-mediated signaling (git3, git5, git11, pka1, cgs2. Importantly, while the identified gene deletion mutants are prone to cytokinesis failure in the presence of LatA, they are nevertheless fully capable of cell division in the absence of the drug. These results indicate that fission yeast cells make use of a diverse set of regulatory modules to counter abnormal cytoskeletal perturbations, and furthermore, that these modules act redundantly to ensure cell survival and proliferation.

  13. A large novel deletion downstream of PAX6 gene in a Chinese family with ocular coloboma.

    Directory of Open Access Journals (Sweden)

    Hong Guo

    Full Text Available PURPOSE: The paired box gene 6 (PAX6 is an essential transcription factor for eye formation. Genetic alterations in PAX6 can lead to various ocular malformations including aniridia. The purpose of this study was to identify genetic defects as the underlying cause of familial ocular coloboma in a large Chinese family. METHODS: After linkage analysis was carried out in this family, all exons of PAX6 in the proband were sequenced by the Sanger sequencing technique. Then the genome of the proband was evaluated by a microarray-based comparative genomic hybridization (aCGH. Quantitative real-time PCR was applied to verify the abnormal aCGH findings. RESULTS: All patients presented bilateral partial coloboma of iris, severe congenital nystagmus, hyperpresbyopia and congenital posterior polar cataracts. Two-point linkage analysis in the autosomal dominant family showed loss of heterozygosity at the D11S914 locus. There was no pathogenic mutation in the exons of PAX6. The aCGH analysis revealed a 681 kb heterozygous deletion on chromosome 11p13. Quantitative real-time PCR verified the deletion in the patients and further confirmed this deletion cosegregation with the ocular coloboma phenotype in the family. CONCLUSIONS: The 681 kb large deletion of chromosome 11p13 downstream of PAX6 is the genetic cause of the familial ocular coloboma in this large Chinese family. aCGH should be applied if there is a negative result for the mutation detection of PAX6 in patients with ocular coloboma.

  14. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  15. A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder

    Directory of Open Access Journals (Sweden)

    Anina Bauer

    2017-09-01

    Full Text Available In heterozygous females affected by an X-linked skin disorder, lesions often appear in a characteristic pattern, the so-called Blaschko’s lines. We investigated a female Labrador Retriever and her crossbred daughter, which both showed similar clinical lesions that followed Blaschko’s lines. The two male littermates of the affected daughter had died at birth, suggesting a monogenic X-chromosomal semidominant mode of inheritance. Whole genome sequencing of the affected daughter, and subsequent automated variant filtering with respect to 188 nonaffected control dogs of different breeds, revealed 332 hetero-zygous variants on the X-chromosome private to the affected dog. None of these variants was protein-changing. By visual inspection of candidate genes located on the X-chromosome, we identified a large deletion in the NSDHL gene, encoding NAD(P dependent steroid dehydrogenase-like, a 3β-hydroxysteroid dehydrogenase involved in cholesterol biosynthesis. The deletion spanned >14 kb, and included the last three exons of the NSDHL gene. By PCR and fragment length analysis, we confirmed the presence of the variant in both affected dogs, and its absence in 50 control Labrador Retrievers. Variants in the NSDHL gene cause CHILD syndrome in humans, and the bare patches (Bpa and striated (Str phenotypes in mice. Taken together, our genetic data and the known role of NSDHL in X-linked skin disorders strongly suggest that the identified structural variant in the NSDHL gene is causative for the phenotype in the two affected dogs.

  16. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  17. A glycoprotein E gene-deleted bovine herpesvirus 1 as a candidate vaccine strain

    Directory of Open Access Journals (Sweden)

    M. Weiss

    2015-01-01

    Full Text Available A bovine herpesvirus 1 (BoHV-1 defective in glycoprotein E (gE was constructed from a Brazilian genital BoHV-1 isolate, by replacing the full gE coding region with the green fluorescent protein (GFP gene for selection. Upon co-transfection of MDBK cells with genomic viral DNA plus the GFP-bearing gE-deletion plasmid, three fluorescent recombinant clones were obtained out of approximately 5000 viral plaques. Deletion of the gE gene and the presence of the GFP marker in the genome of recombinant viruses were confirmed by PCR. Despite forming smaller plaques, the BoHV-1△gE recombinants replicated in MDBK cells with similar kinetics and to similar titers to that of the parental virus (SV56/90, demonstrating that the gE deletion had no deleterious effects on replication efficacy in vitro. Thirteen calves inoculated intramuscularly with BoHV-1△gE developed virus neutralizing antibodies at day 42 post-infection (titers from 2 to 16, demonstrating the ability of the recombinant to replicate and to induce a serological response in vivo. Furthermore, the serological response induced by recombinant BoHV-1△gE could be differentiated from that induced by wild-type BoHV-1 by the use of an anti-gE antibody ELISA kit. Taken together, these results indicated the potential application of recombinant BoHV-1 △gE in vaccine formulations to prevent the losses caused by BoHV-1 infections while allowing for differentiation of vaccinated from naturally infected animals.

  18. Deleting multiple lytic genes enhances biomass yield and production of recombinant proteins by Bacillus subtilis.

    Science.gov (United States)

    Wang, Yi; Chen, Zhenmin; Zhao, Ruili; Jin, Tingting; Zhang, Xiaoming; Chen, Xiangdong

    2014-08-31

    Bacillus subtilis is widely used in agriculture and industrial biotechnology; however, cell autolysis significantly decreases its yield in liquid cultures. Numerous factors mediate the lysis of B. subtilis, such as cannibalism factors, prophages, and peptidoglycan (PG) hydrolases. The aim of this work was to use molecular genetic techniques to develop a new strategy to prevent cell lysis and enhance biomass as well as the production of recombinant proteins. Five genes or genetic elements representing three different functional categories were studied as follows: lytC encoding PG hydrolases, the prophage genes xpf and yqxG-yqxH-cwlA (yGlA), and skfA and sdpC that encode cannibalism factors. Cell lysis was reduced and biomass was enhanced by deleting individually skfA, sdpC, xpf, and lytC. We constructed the multiple deletion mutant LM2531 (skfA sdpC lytC xpf) and found that after 4 h of culture, its biomass yield was significantly increased compared with that of prototypical B. subtilis 168 (wild-type) strain and that 15% and 92% of the cells were lysed in cultures of LM2531 and wild-type, respectively. Moreover, two expression vectors were constructed for producing recombinant proteins (β-galactosidase and nattokinase) under the control of the P43 promoter. Cultures of LM2531 and wild-type transformants produced 13741 U/ml and 7991 U/ml of intracellular β-galactosidase, respectively (1.72-fold increase). Further, the level of secreted nattokinase produced by strain LM2531 increased by 2.6-fold compared with wild-type (5226 IU/ml vs. 2028 IU/ml, respectively). Our novel, systematic multigene deletion approach designed to inhibit cell lysis significantly increased the biomass yield and the production of recombinant proteins by B. subtilis. These findings show promise for guiding efforts to manipulate the genomes of other B. subtilis strains that are used for industrial purposes.

  19. Antiviral resistance due to deletion in the neuraminidase gene and defective interfering-like viral polymerase basic 2 RNA of influenza A virus subtype H3N2

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Christiansen, Claus Bohn; Fischer, Thea Kølsen

    2018-01-01

    two major out-of-frame deletions in the polymerase basic 2 (PB2) gene, indicating defective interfering-like viral RNA. Conclusions: The viruses harboring the 245–248 deletion in the neuraminidase gene were still present after discontinuation of oseltamivir treatment and passages in cell cultures...... to zanamivir. Nine days after discontinuation of oseltamivir treatment the deleted H3N2 virus was still present in the patient. After three passages of the deleted virus in cell culture, the deletion was retained. Several variant mutations appeared in the other genes of the H3N2 virus, where most striking were...

  20. Improved techniques for endogenous epitope tagging and gene deletion in Toxoplasma gondii.

    Science.gov (United States)

    Upadhya, Rajendra; Kim, Kami; Hogue-Angeletti, Ruth; Weiss, Louis M

    2011-05-01

    Toxoplasma gondii is an excellent model organism for studies on the biology of the Apicomplexa due to its ease of in vitro cultivation and genetic manipulation. Large-scale reverse genetic studies in T. gondii have, however, been difficult due to the low frequency of homologous recombination. Efforts to ensure homologous recombination have necessitated engineering long flanking regions in the targeting construct. This requirement makes it difficult to engineer chromosomally targeted epitope tags or gene knock out constructs only by restriction enzyme mediated cloning steps. To address this issue we employed multisite Gateway® recombination techniques to generate chromosomal gene manipulation targeting constructs. Incorporation of 1.5 to 2.0 kb flanking homologous sequences in PCR generated targeting constructs resulted in 90% homologous recombination events in wild type T. gondii (RH strain) as determined by epitope tagging and target gene deletion experiments. Furthermore, we report that split marker constructs were equally efficient for targeted gene disruptions using the T. gondii UPRT gene locus as a test case. The methods described in this paper represent an improved strategy for efficient epitope tagging and gene disruptions in T. gondii. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Distribution of a 27-bp deletion in the band 3 gene in South Pacific islanders.

    Science.gov (United States)

    Kimura, Masako; Tamam, Moedrik; Soemantri, Augustinus; Nakazawa, Minato; Ataka, Yuji; Ohtsuka, Ryutaro; Ishida, Takafumi

    2003-01-01

    Distribution of a 27-bp deletion in the band 3 gene (B3Delta27) that causes Southeast Asian/Melanesian ovalocytosis has scarcely been studied in remote insular Southeast Asia and New Guinea. Here the presence of the B3Delta27 was surveyed among a total of 756 subjects from the indigenous populations inhabiting New Guinean islands and remote insular Southeast Asia by using a polymerase chain reaction method. In remote insular Southeast Asia where Austronesian-speaking peoples inhabit, the B3Delta27 frequency ranged between 0.04 and 0.15. In New Guinea Island, hinterland or Papuan groups showed the absence of the B3Delta27 or a very low gene frequency (0.01 in the Gidra) of the B3Delta27. However, groups of the coastal regions (Asmat, Sorong, and others) and of the nearby islands (Biak and Manus) where Austronesian infiltration had occurred showed substantial frequencies of the deletion (0.02-0.09). It is likely that the B3Delta27 was introduced into this region about 3,500 years ago with the arrival of Austronesian-speaking peoples. Once being introduced, the B3Delta27 may have been selected because of its resistance against malaria, while founder effect and genetic drift might have occurred in the New Guinean tribes with small population size, which helped to generate a variety of the B3Delta27 frequencies.

  2. Angiotensin-converting-enzyme gene insertion/deletion polymorphism and response to physical training.

    Science.gov (United States)

    Montgomery, H; Clarkson, P; Barnard, M; Bell, J; Brynes, A; Dollery, C; Hajnal, J; Hemingway, H; Mercer, D; Jarman, P; Marshall, R; Prasad, K; Rayson, M; Saeed, N; Talmud, P; Thomas, L; Jubb, M; World, M; Humphries, S

    1999-02-13

    The function of local renin-angiotensin systems in skeletal muscle and adipose tissue remains largely unknown. A polymorphism of the human angiotensin converting enzyme (ACE) gene has been identified in which the insertion (I) rather than deletion (D) allele is associated with lower ACE activity in body tissues and increased response to some aspects of physical training. We studied the association between the ACE gene insertion or deletion polymorphism and changes in body composition related to an intensive exercise programme, to investigate the metabolic effects of local human renin-angiotensin systems. We used three independent methods (bioimpedance, multiple skinfold-thickness assessment of whole-body composition, magnetic resonance imaging of the mid-thigh) to study changes in body composition in young male army recruits over 10 weeks of intensive physical training. Participants with the II genotype had a greater anabolic response than those with one or more D alleles for fat mass (0.55 vs -0.20 kg, p=0.04 by bioimpedance) and non-fat mass (1.31 vs -0.15 kg, p=0.01 by bioimpedance). Changes in body morphology with training measured by the other methods were also dependent on genotype. II genotype, as a marker of low ACE activity in body tissues, may conserve a positive energy balance during rigorous training, which suggests enhanced metabolic efficiency. This finding may explain some of the survival and functional benefits of therapy with ACE inhibitors.

  3. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Science.gov (United States)

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

    2015-01-01

    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  4. A novel type of deletion in the CDKN2A gene identified in a melanoma-prone family.

    Science.gov (United States)

    Knappskog, Stian; Geisler, Jürgen; Arnesen, Thomas; Lillehaug, Johan R; Lønning, Per E

    2006-12-01

    Linkage to the CDKN2A locus has been demonstrated in approximately 50% of families with hereditary malignant melanoma but only a subgroup of these harbor identified mutations. We here report a Norwegian melanoma-prone family with a novel large germline deletion removing 13707 bps of the CDKN2A gene, including exon 1alpha and approximately half of exon 2. Our finding is the first reported large CDKN2A germline deletion with a breakpoint located within an exon. This type of deletion is not detectable through the direct exon sequencing and may also escape identification by use of multiplex ligation-dependent probe amplification (MLPA) analysis. Here, the defect was identified through detection of a truncated p14(ARF) mRNA and loss of p16(INK4a) mRNA expression from the affected allele. Our finding suggests that atypical, large deletions in the CDKN2A gene may explain linkage to the 9p21 chromosome band without identified gene mutations among melanoma-prone families. Thus, it illustrates the need to include p14(ARF)- and p16(INK4a) transcript analysis when searching for unknown mutations within the CDKN2A locus in melanoma-prone families. Similar deletions with atypical breakpoints may affect other genes involved in cancer disposition, and the need to examine gene transcripts in high-risk families with no mutation identified through conventional testing should be considered. (c) 2006 Wiley-Liss, Inc.

  5. Identification of critical regions and candidate genes for cardiovascular malformations and cardiomyopathy associated with deletions of chromosome 1p36.

    Directory of Open Access Journals (Sweden)

    Hitisha P Zaveri

    Full Text Available Cardiovascular malformations and cardiomyopathy are among the most common phenotypes caused by deletions of chromosome 1p36 which affect approximately 1 in 5000 newborns. Although these cardiac-related abnormalities are a significant source of morbidity and mortality associated with 1p36 deletions, most of the individual genes that contribute to these conditions have yet to be identified. In this paper, we use a combination of clinical and molecular cytogenetic data to define five critical regions for cardiovascular malformations and two critical regions for cardiomyopathy on chromosome 1p36. Positional candidate genes which may contribute to the development of cardiovascular malformations associated with 1p36 deletions include DVL1, SKI, RERE, PDPN, SPEN, CLCNKA, ECE1, HSPG2, LUZP1, and WASF2. Similarly, haploinsufficiency of PRDM16-a gene which was recently shown to be sufficient to cause the left ventricular noncompaction-SKI, PRKCZ, RERE, UBE4B and MASP2 may contribute to the development of cardiomyopathy. When treating individuals with 1p36 deletions, or providing prognostic information to their families, physicians should take into account that 1p36 deletions which overlie these cardiac critical regions may portend to cardiovascular complications. Since several of these cardiac critical regions contain more than one positional candidate gene-and large terminal and interstitial 1p36 deletions often overlap more than one cardiac critical region-it is likely that haploinsufficiency of two or more genes contributes to the cardiac phenotypes associated with many 1p36 deletions.

  6. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

    1987-08-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 (steroid 21-monooxygenase (steroid 21-hydroxylase)), which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions.

  7. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia.

    Science.gov (United States)

    Matteson, K J; Phillips, J A; Miller, W L; Chung, B C; Orlando, P J; Frisch, H; Ferrandez, A; Burr, I M

    1987-08-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase), EC 1.14.99.10], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. We have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, we conclude that the P450XXIA2 gene "deletions" widely reported in CAH patients probably represent gene conversions, unequal crossovers, or polymorphisms rather than simple gene deletions.

  8. Inadequate lung development and bronchial hyperplasia in mice with a targeted deletion in the Dutt1/Robo1 gene.

    Science.gov (United States)

    Xian, J; Clark, K J; Fordham, R; Pannell, R; Rabbitts, T H; Rabbitts, P H

    2001-12-18

    Chromosome 3 allele loss in preinvasive bronchial abnormalities and carcinogen-exposed, histologically normal bronchial epithelium indicates that it is an early, possibly the first, somatic genetic change in lung tumor development. Candidate tumor suppressor genes have been isolated from within distinct 3p regions implicated by heterozygous and homozygous allele loss. We have proposed that DUTT1, nested within homozygously deleted regions at 3p12-13, is the tumor suppressor gene that deletion-mapping and tumor suppression assays indicate is located in proximal 3p. The same gene, ROBO1 (accession number ), was independently isolated as the human homologue of the Drosophila gene, Roundabout. The gene, coding for a receptor with a domain structure of the neural-cell adhesion molecule family, is widely expressed and has been implicated in the guidance and migration of axons, myoblasts, and leukocytes in vertebrates. A deleted form of the gene, which mimics a naturally occurring, tumor-associated human homozygous deletion of exon 2 of DUTT1/ROBO1, was introduced into the mouse germ line. Mice homozygous for this targeted mutation, which eliminates the first Ig domain of Dutt1/Robo1, frequently die at birth of respiratory failure because of delayed lung maturation. Lungs from these mice have reduced air spaces and increased mesenchyme, features that are present some days before birth. Survivors acquire extensive bronchial epithelial abnormalities including hyperplasia, providing evidence of a functional relationship between a 3p gene and the development of bronchial abnormalities associated with early lung cancer.

  9. Deletion of psychiatric risk gene Cacna1c impairs hippocampal neurogenesis in cell-autonomous fashion.

    Science.gov (United States)

    Völkening, Bianca; Schönig, Kai; Kronenberg, Golo; Bartsch, Dusan; Weber, Tillmann

    2017-05-01

    Ca(2+) is a universal signal transducer which fulfills essential functions in cell development and differentiation. CACNA1C, the gene encoding the alpha-1C subunit (i.e., Cav 1.2) of the voltage-dependent l-type calcium channel (LTCC), has been implicated as a risk gene in a variety of neuropsychiatric disorders. To parse the role of Cav 1.2 channels located on astrocyte-like stem cells and their descendants in the development of new granule neurons, we created Tg(GLAST-CreERT2) /Cacna1c(fl/fl) /RCE:loxP mice, a transgenic tool that allows cell-type-specific inducible deletion of Cacna1c. The EGFP reporter was used to trace the progeny of recombined type-1 cells. FACS-sorted Cacna1c-deficient neural precursor cells from the dentate gyrus showed reduced proliferative activity in neurosphere cultures. Moreover, under differentiation conditions, Cacna1c-deficient NPCs gave rise to fewer neurons and more astroglia. Similarly, under basal conditions in vivo, Cacna1c gene deletion in type-1 cells decreased type-1 cell proliferation and reduced the neuronal fate-choice decision of newly born cells, resulting in reduced net hippocampal neurogenesis. Unexpectedly, electroconvulsive seizures completely compensated for the proliferation deficit of Cacna1c deficient type-1 cells, indicating that there must be Cav 1.2-independent mechanisms of controlling proliferation related to excitation. In the aggregate, this is the first report demonstrating the presence of functional L-type 1.2 channels on type-1 cells. Cav 1.2 channels promote type-1 cell proliferation and push the glia-to-neuron ratio in the direction of a neuronal fate choice and subsequent neuronal differentiation. Cav 1.2 channels expressed on NPCs and their progeny possess the ability to shape neurogenesis in a cell-autonomous fashion. © 2017 Wiley Periodicals, Inc.

  10. Familial glucocorticoid resistance caused by a splice site deletion in the human glucocorticoid receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Karl, M.; Lamberts, S.W.J.; Detera-Wadleigh, S.D.; Encio, I.J.; Stratakis, C.A.; Hurley, D.M.; Accili, D.; Chrousos, G.P. (National Institutes of Health, Bethesda, MD (United States) Erasmus Univ. of Rotterdam (Netherlands))

    1993-03-01

    The clinical syndrome of generalized, compensated glucocorticoid resistance is characterized by increased cortisol secretion without clinical evidence of hyper- or hypocortisolism, and manifestations of androgen and/or mineralocorticoid excess. This condition results from partial failure of the glucocorticoid receptor (GR) to modulate transcription of its target genes. The authors studied the molecular mechanisms of this syndrome in a Dutch kindred, whose affected members had hypercortisolism and approximately half of normal GRs, and whose proband was a young woman with manifestations of hyperandrogenism. Using the polymerase chain reaction to amplify and sequence each of the nine exons of the GR gene [alpha], along with their 5[prime]- and 3[prime]-flanking regions, the authors identified a 4-base deletion at the 3[prime]-boundary of exon 6 in one GR allele ([Delta][sub 4]), which removed a donor splice site in all three affected members studied. In contrast, the sequence of exon 6 in the two unaffected siblings was normal. A single nucleotide substitution causing an amino acid substitution in the amino terminal domain of the GR (asparagine to serine, codon 363) was also discovered in exon 2 of the other allele (G[sub 1220]) in the proband, in one of her affected brothers and in her unaffected sister. This deletion in the glucocorticoid receptor gene was associated with the expression of only one allele and a decrease of GR protein by 50% in affected members of this glucocorticoid resistant family. The mutation identified in exon 2 did not segregate with the disease and appears to be of no functional significance. The presence of the null allele was apparently compensated for by increased cortisol production at the expense of concurrent hyperandrogenism. 40 refs., 3 figs.

  11. Deletion of exon 26 of the dystrophin gene is associated with a mild Becker muscular dystrophy phenotype

    DEFF Research Database (Denmark)

    Witting, Nanna; Duno, Morten; Vissing, John

    2011-01-01

    With the possible introduction of exon skipping therapy in Duchenne muscular dystrophy, it has become increasingly important to know the role of each exon of the dystrophin gene to protein expression, and thus the phenotype. In this report, we present two related men with an unusually mild BMD...... calf hypertrophy was noted. Creatine kinase was normal or raised maximally to 500 U/l. The muscle biopsy was myopathic with increased fiber size variation and many internal nuclei, but no dystrophy. No comorbidity was found. In both cases, western blot showed a reduced dystrophin band. Genetic...... evaluation revealed a deletion of exon 26 of the dystrophin gene in both. This is the first description of patients with a exon 26 deletion of the dystrophin gene. Assuming the proband's comorbidity is unrelated, exon 26 deletion results in a very mild phenotype. This might be of interest in planning exon...

  12. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    DEFF Research Database (Denmark)

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M

    2003-01-01

    Interferons (IFNs) are a family of cytokines with growth inhibitory, and antiviral functions. IFNs exert their biological actions through the expression of more than 1000 IFN stimulated genes, ISGs. ISG12 is an IFN type I induced gene encoding a protein of Mr 12,000. We have identified a novel, IFN...... inducible splice variant of ISG12 lacking exon 2 leading to a putative truncated protein isoform of Mr 7400, ISG12-S. In cells from blood and cervical cytobrush material from healthy women, the level of ISG12-S expression was higher than ISG12 expression, whereas the expression pattern was more evenly...... distributed between ISG12 and ISG12-S in breast carcinoma cells, in cancer cell lines and in cervical cytobrush material with neoplastic lesions. In addition, we have found a nine-nucleotide deletion situated in exon 4 of the ISG12 gene. This deletion leads to a three-amino-acid deletion (AMA) in the putative...

  13. MicroRNA-1-associated effects of neuron-specific brain-derived neurotrophic factor gene deletion in dorsal root ganglia

    NARCIS (Netherlands)

    Neumann, Elena; Brandenburger, Timo; Santana-Varela, Sonia; Deenen, René; Köhrer, Karl; Bauer, Inge; Hermanns, Henning; Wood, John N.; Zhao, Jing; Werdehausen, Robert

    2016-01-01

    MicroRNAs (miRNAs) regulate gene expression in physiological as well as in pathological processes, including chronic pain. Whether deletion of a gene can affect expression of the miRNAs that associate with the deleted gene mRNA remains elusive. We investigated the effects of brain-derived

  14. Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes

    NARCIS (Netherlands)

    Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y.; Braga, Eleonora A.; Klimov, Eugene A.; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I.; Buys, Charles H. C. M.

    Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung

  15. MicroRNA-1-associated effects of neuron-specific brain-derived neurotrophic factor gene deletion in dorsal root ganglia

    NARCIS (Netherlands)

    Neumann, Elena; Brandenburger, Timo; Santana-Varela, Sonia; Deenen, René; Köhrer, Karl; Bauer, Inge; Hermanns, Henning; Wood, John N.; Zhao, Jing; Werdehausen, Robert

    2016-01-01

    Background: MicroRNAs (miRNAs) regulate gene expression in physiological as well as in pathological processes, including chronic pain. Whether deletion of a gene can affect expression of the miRNAs that associate with the deleted gene mRNA remains elusive. We investigated the effects of

  16. Heme oxygenase-2 gene deletion attenuates oxidative stress in neurons exposed to extracellular hemin

    Directory of Open Access Journals (Sweden)

    Benvenisti-Zarom Luna

    2004-09-01

    Full Text Available Abstract Background Hemin, the oxidized form of heme, accumulates in intracranial hematomas and is a potent oxidant. Growing evidence suggests that it contributes to delayed injury to surrounding tissue, and that this process is affected by the heme oxygenase enzymes. In a prior study, heme oxygenase-2 gene deletion increased the vulnerability of cultured cortical astrocytes to hemin. The present study tested the effect of HO-2 gene deletion on protein oxidation, reactive oxygen species formation, and cell viability after mixed cortical neuron/astrocyte cultures were incubated with neurotoxic concentrations of hemin. Results Continuous exposure of wild-type cultures to 1–10 μM hemin for 14 h produced concentration-dependent neuronal death, as detected by both LDH release and fluorescence intensity after propidium iodide staining, with an EC50 of 1–2 μM; astrocytes were not injured by these low hemin concentrations. Cell death was consistently reduced by at least 60% in knockout cultures. Exposure to hemin for 4 hours, a time point that preceded cell lysis, increased protein oxidation in wild-type cultures, as detected by staining of immunoblots for protein carbonyl groups. At 10 μM hemin, carbonylation was increased 2.3-fold compared with control sister cultures subjected to medium exchanges only; this effect was reduced by about two-thirds in knockout cultures. Cellular reactive oxygen species, detected by fluorescence intensity after dihydrorhodamine 123 (DHR staining, was markedly increased by hemin in wild-type cultures and was localized to neuronal cell bodies and processes. In contrast, DHR fluorescence intensity in knockout cultures did not differ from that of sham-washed controls. Neuronal death in wild-type cultures was almost completely prevented by the lipid-soluble iron chelator phenanthroline; deferoxamine had a weaker but significant effect. Conclusions These results suggest that HO-2 gene deletion protects neurons in mixed

  17. COOH-terminal deletion of HBx gene is a frequent event in HBV-associated hepatocellular carcinoma

    Science.gov (United States)

    Liu, Xiao-Hong; Lin, Jing; Zhang, Shu-Hui; Zhang, Shun-Min; Feitelson, Mark A; Gao, Heng-Jun; Zhu, Ming-Hua

    2008-01-01

    AIM: To investigate the hepatitis B virus (HBV) x gene (HBx) state in the tissues of HBV-related hepatocellular carcinoma (HCC) in Chinese patients and whether there were particular HBx mutations. METHODS: HBx gene was amplified and direct sequencing was used in genomic DNA samples from 20 HCC and corresponding non-cancerous liver tissues from HBsAg-positive patients. HBV DNA integration and HBx deleted mutation were validated in 45 HCC patients at different stages by Southern blot analysis and polymerase chain reaction methods. RESULTS: The frequencies of HBx point mutations were significantly lower in HCC than their corresponding non-cancerous liver tissues (11/19 vs 18/19, P = 0.019). In contrast, deletions in HBx gene were significantly higher in HCC than their non-cancerous liver tissues (16/19 vs 4/19, P < 0.001). The deletion of HBx COOH-terminal was detected in 14 HCC tissues. A specific integration of HBx at 17p13 locus was also found in 8 of 16 HCC, and all of them also exhibited full-length HBx deletions. Integrated or integrated coexistence with replicated pattern was obtained in 45.5% (20/45) - 56.8% (25/45) tumors and 40.9% (18/45) - 52.3% (23/45) non-tumor tissues. CONCLUSION: HBx deletion, especially the COOH-terminal deletion of HBx is a frequent event in HBV-associated HCC tissues in China. HBV integration had also taken place in partial HCC tissues. This supporting the hypothesis that deletion and probably integrated forms of the HBx gene may be implicated in liver carcinogenesis. PMID:18322946

  18. Deletion of Rictor in brain and fat alters peripheral clock gene expression and increases blood pressure.

    Science.gov (United States)

    Drägert, Katja; Bhattacharya, Indranil; Pellegrini, Giovanni; Seebeck, Petra; Azzi, Abdelhalim; Brown, Steven A; Georgiopoulou, Stavroula; Held, Ulrike; Blyszczuk, Przemyslaw; Arras, Margarete; Humar, Rok; Hall, Michael N; Battegay, Edouard; Haas, Elvira

    2015-08-01

    The mammalian target of rapamycin complex 2 (mTORC2) contains the essential protein RICTOR and is activated by growth factors. mTORC2 in adipose tissue contributes to the regulation of glucose and lipid metabolism. In the perivascular adipose tissue, mTORC2 ensures normal vascular reactivity by controlling expression of inflammatory molecules. To assess whether RICTOR/mTORC2 contributes to blood pressure regulation, we applied a radiotelemetry approach in control and Rictor knockout (Rictor(aP2KO)) mice generated using adipocyte protein-2 gene promoter-driven CRE recombinase expression to delete Rictor. The 24-hour mean arterial pressure was increased in Rictor(aP2KO) mice, and the physiological decline in mean arterial pressure during the dark period was impaired. In parallel, heart rate and locomotor activity were elevated during the dark period with a pattern similar to blood pressure changes. This phenotype was associated with mild cardiomyocyte hypertrophy, decreased cardiac natriuretic peptides, and their receptor expression in adipocytes. Moreover, clock gene expression was reduced or phase-shifted in perivascular adipose tissue. No differences in clock gene expression were observed in the master clock suprachiasmatic nucleus, although Rictor gene expression was also lower in brain of Rictor(aP2KO) mice. Thus, this study highlights the importance of RICTOR/mTORC2 for interactions between vasculature, adipocytes, and brain to tune physiological outcomes, such as blood pressure and locomotor activity. © 2015 American Heart Association, Inc.

  19. Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant

    Science.gov (United States)

    Okay, Sezer; Ünsaldı, Eser; Taşkın, Bilgin; Liras, Paloma; Piret, Jacqueline

    2010-01-01

    In this study, the effect of homologous multiple copies of the ask gene, which encodes aspartokinase catalyzing the first step of the aspartate pathway, on cephamycin C biosynthesis in S. clavuligerus NRRL 3585 and its hom mutant was investigated. The intracellular pool levels of aspartate pathway amino acids accorded well with the Ask activity levels in TB3585 and AK39. When compared with the control strain carrying vector alone without any gene insert, amplification of the ask gene in the wild strain resulted in a maximum of 3.1- and 3.3-fold increase in specific, 1.7- and 1.9-fold increase in volumetric cephamycin C production when grown in trypticase soy broth (TSB) and a modified chemically defined medium (mCDM), respectively. However, expression of multicopy ask gene in a hom-deleted background significantly decreased cephamycin C yields when the cells were grown in either TSB or mCDM, most probably due to physiological disturbance resulting from enzyme overexpression and high copy number plasmid burden in an auxotrophic host, respectively. PMID:21326925

  20. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    Directory of Open Access Journals (Sweden)

    Kristen L Zuloaga

    2015-01-01

    Full Text Available Soluble epoxide hydrolase (sEH, a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs, is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15-18 month old and young (3-4 month old female sEH knockout (sEHKO mice and wild type (WT mice were subjected to 45 min middle cerebral artery occlusion (MCAO with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24hrs thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography. Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice.

  1. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

    Science.gov (United States)

    Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

    2016-05-10

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Confirmation that a deletion in the POMC gene is associated with body weight of Labrador Retriever dogs.

    Science.gov (United States)

    Mankowska, M; Krzeminska, P; Graczyk, M; Switonski, M

    2017-06-01

    A 14-bp deletion present in the proopiomelanocortin (POMC) gene of Labrador and Flat Coat Retrievers (FCR), but absent in POMC of other breeds, disrupts the β-MSH and β-endorphin coding sequences. This deletion was recently reported as strongly associated with increased body weight and obesity. We searched for this mutation in a cohort of 272 dogs, representing four breeds with a known predisposition to obesity (Labrador and Golden Retrievers, Beagle, and Cocker Spaniel) and, as expected, we found it only in Labradors. Further, we confirmed the association between the deletion variant and body weight of Labradors but not with a 5-point body condition score (BCS). We suspect that the deletion variant in our cohort may act as a recessive allele, unlike the previous study, which suggested its additive effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Deletion and gene expression analyses define the paxilline biosynthetic gene cluster in Penicillium paxilli.

    Science.gov (United States)

    Scott, Barry; Young, Carolyn A; Saikia, Sanjay; McMillan, Lisa K; Monahan, Brendon J; Koulman, Albert; Astin, Jonathan; Eaton, Carla J; Bryant, Andrea; Wrenn, Ruth E; Finch, Sarah C; Tapper, Brian A; Parker, Emily J; Jameson, Geoffrey B

    2013-08-14

    The indole-diterpene paxilline is an abundant secondary metabolite synthesized by Penicillium paxilli. In total, 21 genes have been identified at the PAX locus of which six have been previously confirmed to have a functional role in paxilline biosynthesis. A combination of bioinformatics, gene expression and targeted gene replacement analyses were used to define the boundaries of the PAX gene cluster. Targeted gene replacement identified seven genes, paxG, paxA, paxM, paxB, paxC, paxP and paxQ that were all required for paxilline production, with one additional gene, paxD, required for regular prenylation of the indole ring post paxilline synthesis. The two putative transcription factors, PP104 and PP105, were not co-regulated with the pax genes and based on targeted gene replacement, including the double knockout, did not have a role in paxilline production. The relationship of indole dimethylallyl transferases involved in prenylation of indole-diterpenes such as paxilline or lolitrem B, can be found as two disparate clades, not supported by prenylation type (e.g., regular or reverse). This paper provides insight into the P. paxilli indole-diterpene locus and reviews the recent advances identified in paxilline biosynthesis.

  4. Comparative deletion mapping at 1p31.3-p32.2 implies NFIA responsible for intellectual disability coupled with macrocephaly and the presence of several other genes for syndromic intellectual disability.

    Science.gov (United States)

    Labonne, Jonathan D J; Shen, Yiping; Kong, Il-Keun; Diamond, Michael P; Layman, Lawrence C; Kim, Hyung-Goo

    2016-01-01

    While chromosome 1 is the largest chromosome in the human genome, less than two dozen cases of interstitial microdeletions in the short arm have been documented. More than half of the 1p microdeletion cases were reported in the pre-microarray era and as a result, the proximal and distal boundaries containing the exact number of genes involved in the microdeletions have not been clearly defined. We revisited a previous case of a 10-year old female patient with a 1p32.1p32.3 microdeletion displaying syndromic intellectual disability. We performed microarray analysis as well as qPCR to define the proximal and distal deletion breakpoints and revised the karyotype from 1p32.1p32.3 to 1p31.3p32.2. The deleted chromosomal region contains at least 35 genes including NFIA. Comparative deletion mapping shows that this region can be dissected into five chromosomal segments containing at least six candidate genes (DAB1, HOOK1, NFIA, DOCK7, DNAJC6, and PDE4B) most likely responsible for syndromic intellectual disability, which was corroborated by their reduced transcript levels in RT-qPCR. Importantly, one patient with an intragenic microdeletion within NFIA and an additional patient with a balanced translocation disrupting NFIA display intellectual disability coupled with macrocephaly. We propose NFIA is responsible for intellectual disability coupled with macrocephaly, and microdeletions at 1p31.3p32.2 constitute a contiguous gene syndrome with several genes contributing to syndromic intellectual disability.

  5. Estrogen-mediated renoprotection following cardiac arrest and cardiopulmonary resuscitation is robust to GPR30 gene deletion.

    Directory of Open Access Journals (Sweden)

    Michael P Hutchens

    Full Text Available Acute kidney injury is a serious,sexually dimorphic perioperative complication, primarily attributed to hypoperfusion. We previously found that estradiol is renoprotective after cardiac arrest and cardiopulmonary resuscitation in ovariectomized female mice. Additionally, we found that neither estrogen receptor alpha nor beta mediated this effect. We hypothesized that the G protein estrogen receptor (GPR30 mediates the renoprotective effect of estrogen.Ovariectomized female and gonadally intact male wild-type and GPR30 gene-deleted mice were treated with either vehicle or 17β-estradiol for 7 days, then subjected to cardiac arrest and cardiopulmonary resuscitation. Twenty four hours later, serum creatinine and urea nitrogen were measured, and histologic renal injury was evaluated by unbiased stereology.In both males and females, GPR30 gene deletion was associated with reduced serum creatinine regardless of treatment. Estrogen treatment of GPR30 gene-deleted males and females was associated with increased preprocedural weight. In ovariectomized female mice, estrogen treatment did not alter resuscitation, but was renoprotective regardless of GPR30 gene deletion. In males, estrogen reduced the time-to-resuscitate and epinephrine required. In wild-type male mice, serum creatinine was reduced, but neither serum urea nitrogen nor histologic outcomes were affected by estrogen treatment. In GPR30 gene-deleted males, estrogen did not alter renal outcomes. Similarly, renal injury was not affected by G1 therapy of ovariectomized female wild-type mice.Treatment with 17β-estradiol is renoprotective after whole-body ischemia-reperfusion in ovariectomized female mice irrespective of GPR30 gene deletion. Treatment with the GPR30 agonist G1 did not alter renal outcome in females. We conclude GPR30 does not mediate the renoprotective effect of estrogen in ovariectomized female mice. In males, estrogen therapy was not renoprotective. Estrogen treatment of GPR30

  6. Variants in linkage disequilibrium with the late cornified envelope gene cluster deletion are associated with susceptibility to psoriatic arthritis.

    LENUS (Irish Health Repository)

    Bowes, John

    2010-12-01

    A common deletion mapping to the psoriasis susceptibility locus 4 on chromosome 1q21, encompassing two genes of the late cornified envelope (LCE) gene cluster, has been associated with an increased risk of psoriasis vulgaris (PsV). One previous report found no association of the deletion with psoriatic arthritis (PsA), suggesting it may be a specific risk factor for PsV. Given the genetic overlap between PsA and PsV, a study was undertaken to investigate whether single nucleotide polymorphisms (SNPs) mapping to this locus are risk factors for PsA in a UK and Irish population.

  7. 11p13 deletions can be more frequent than the PAX6 gene point mutations in Polish patients with aniridia.

    Science.gov (United States)

    Wawrocka, Anna; Sikora, Agata; Kuszel, Lukasz; Krawczynski, Maciej R

    2013-08-01

    Aniridia is a rare, bilateral, congenital ocular disorder causing incomplete formation of the iris, usually characterized by iris aplasia/hypoplasia. It can also appear with other ocular anomalies, such as cataracts, glaucoma, corneal pannus, optic nerve hypoplasia, macular hypoplasia, or ectopia lentis. In the majority of cases, it is caused by mutation in the PAX6 gene, but it can also be caused by microdeletions that involve the 11p13 region. Twelve unrelated patients of Polish origin with a clinical diagnosis of aniridia were screened for the presence of microdeletions in the 11p13 region by means of multiplex ligation probe amplification (MLPA). Additionally, the coding regions of the PAX6 gene were sequenced in all probands. MLPA examination revealed different size deletions of the 11p13 region in five patients. In three cases, deletions encompassed the entire PAX6 gene and a few adjacent genes. In one case, a fragment of the PAX6 gene was deleted only. In the final case, the deletion did not include any PAX6 sequence. Our molecular findings provide further evidence of the existence of the distant 3' regulatory elements in the downstream region of the PAX6 gene, which is known from other studies to influence the level of protein expression. Sequence analysis of the PAX6 gene revealed the three different point mutations in the remaining four patients with aniridia. All the detected mutations were reported earlier. Based on accomplished results, the great diversity of the molecular basis of aniridia was found. It varies from point mutations to different size deletions in the 11p13 region which encompass partly or completely the PAX6 gene or cause a position effect.

  8. 2 Novel deletions of the sterol 27-hydroxylase gene in a Chinese Family with Cerebrotendinous Xanthomatosis

    Directory of Open Access Journals (Sweden)

    Tian Di

    2011-10-01

    Full Text Available Abstract Background Cerebrotendinous xanthomatosis (CTX is a rare lipid-storage disease. We investigated the clinic manifestation, histopathology and sterol 27-hydroxylase gene (CYP27A1 in a Chinese family with Cerebrotendinous Xanthomatosis (CTX. Case Presentation A 36-year-old female with typical CTX clinical manifestation had Spindle-shaped lipid crystal clefts in xanthomas and "onion-like demyelination" in sural nerve. The patient was compound heterozygote carrying two deletions in exon 1 (c.73delG and exon 2 (c.369_375delGTACCCA. The family memebers were carriers. Conclusions A Chinese family with Cerebrotendinous Xanthomatosis had typical clinical manifestation. CYP27A1 mutations were found in the proband and all other family members.

  9. Analysis of conditional gene deletion using probe based Real-Time PCR.

    Science.gov (United States)

    Weis, Britta; Schmidt, Joachim; Lyko, Frank; Linhart, Heinz G

    2010-10-15

    Conditional gene deletion using Cre-lox recombination is frequently used in mouse genetics; however recombination is frequently incomplete, resulting in a mixture of cells containing the functional (2lox) allele and the truncated (1lox) allele. Conventional analysis of 1lox/2lox allele ratios using Southern Blotting is time consuming, requires relatively large amounts of DNA and has a low sensitivity. We therefore evaluated the utility of Real-Time PCR to measure 1lox/2lox allele ratios. We show that SYBR Green based Real-Time PCR analysis of 1lox/2lox allele ratios can generate erroneous peaks in the melting curve that are possibly caused by alternate hybridization products promoted by the palindromic loxP sequence motif. Since abnormal melting curves frequently contribute to dismissal of SYBR Green based data, we developed a convenient method with improved specificity that avoids such erroneous signals. Our data show that probe based Real-Time PCR, using a universal probe directed against the loxP site, can accurately detect small differences in 1lox/2lox allele ratios. We also validated this method in Fabpl4× at -132-Cre transgenic mice, measuring 1lox/2lox allele ratios that are in agreement with published data. Our Real-Time PCR protocol requires the use of one probe only for all reactions. Also the universal probe established in our assay is generally applicable to any experiment analyzing Cre-lox recombination efficiency, such that only primer sequences have to be adapted. Our data show that 1lox/2lox allele ratios are detected with high accuracy and high sensitivity with Real-Time PCR analysis using a probe directed against the loxP site. Due to the generally applicable probe the assay is conveniently adapted to all models of Cre-lox mediated gene deletion.

  10. Analysis of conditional gene deletion using probe based Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Lyko Frank

    2010-10-01

    Full Text Available Abstract Background Conditional gene deletion using Cre-lox recombination is frequently used in mouse genetics; however recombination is frequently incomplete, resulting in a mixture of cells containing the functional (2lox allele and the truncated (1lox allele. Conventional analysis of 1lox/2lox allele ratios using Southern Blotting is time consuming, requires relatively large amounts of DNA and has a low sensitivity. We therefore evaluated the utility of Real-Time PCR to measure 1lox/2lox allele ratios. Results We show that SYBR Green based Real-Time PCR analysis of 1lox/2lox allele ratios can generate erroneous peaks in the melting curve that are possibly caused by alternate hybridization products promoted by the palindromic loxP sequence motif. Since abnormal melting curves frequently contribute to dismissal of SYBR Green based data, we developed a convenient method with improved specificity that avoids such erroneous signals. Our data show that probe based Real-Time PCR, using a universal probe directed against the loxP site, can accurately detect small differences in 1lox/2lox allele ratios. We also validated this method in Fabpl4× at -132-Cre transgenic mice, measuring 1lox/2lox allele ratios that are in agreement with published data. Our Real-Time PCR protocol requires the use of one probe only for all reactions. Also the universal probe established in our assay is generally applicable to any experiment analyzing Cre-lox recombination efficiency, such that only primer sequences have to be adapted. Conclusions Our data show that 1lox/2lox allele ratios are detected with high accuracy and high sensitivity with Real-Time PCR analysis using a probe directed against the loxP site. Due to the generally applicable probe the assay is conveniently adapted to all models of Cre-lox mediated gene deletion.

  11. ZnT3 Gene Deletion Reduces Colchicine-Induced Dentate Granule Cell Degeneration

    Directory of Open Access Journals (Sweden)

    Bo Young Choi

    2017-10-01

    Full Text Available Our previous study demonstrated that colchicine-induced dentate granule cell death is caused by blocking axonal flow and the accumulation of intracellular zinc. Zinc is concentrated in the synaptic vesicles via zinc transporter 3 (ZnT3, which facilitates zinc transport from the cytosol into the synaptic vesicles. The aim of the present study was to identify the role of ZnT3 gene deletion on colchicine-induced dentate granule cell death. The present study used young (3–5 months mice of the wild-type (WT or the ZnT3−/− genotype. Colchicine (10 µg/kg was injected into the hippocampus, and then brain sections were evaluated 12 or 24 h later. Cell death was evaluated by Fluoro-Jade B; oxidative stress was analyzed by 4-hydroxy-2-nonenal; and dendritic damage was detected by microtubule-associated protein 2. Zinc accumulation was detected by N-(6-methoxy-8-quinolyl-para-toluenesulfonamide (TSQ staining. Here, we found that ZnT3−/− reduced the number of degenerating cells after colchicine injection. The ZnT3−/−-mediated inhibition of cell death was accompanied by suppression of oxidative injury, dendritic damage and zinc accumulation. In addition, ZnT3−/− mice showed more glutathione content than WT mice and inhibited neuronal glutathione depletion by colchicine. These findings suggest that increased neuronal glutathione by ZnT3 gene deletion prevents colchicine-induced dentate granule cell death.

  12. Deletions of the survival motor neuron gene in unaffected siblings of patients with spinal muscular atrophy

    NARCIS (Netherlands)

    Cobben, J. M.; van der Steege, G.; Grootscholten, P.; de Visser, M.; Scheffer, H.; Buys, C. H.

    1995-01-01

    DNA studies in 103 spinal muscular atrophy (SMA) patients from The Netherlands revealed homozygosity for a survival motor neuron (SMN) deletion in 96 (93%) of 103. Neuronal apoptosis inhibitory protein deletions were found in 38 (37%) of 103 and occurred most frequently in SMA type I. SMN deletions

  13. Transcriptional and epigenetic effects of deleting large regions, alone or in combination, from their natural context in the chicken Ig-β gene.

    Science.gov (United States)

    Chayahara, K; Itaya, K; Ono, M

    2011-10-15

    Previously, we used homologous recombination to delete six groups of cell-type-specific DNase I hypersensitive sites (DHSs), potential transcriptional and epigenetic regulators, scattered in and around the Ig-β gene from their natural context in B-lymphocyte-derived chicken DT40 cells. Simultaneous deletion of all six groups completely shut down transcription and epigenetic regulation of the Ig-β gene; therefore, the cooperation of the scattered regulatory regions was essential for transcription and epigenetic regulation. In this study, we regrouped the cell-type-specific DHSs of Ig-β, those in the original six deletions and three additional ones, into three larger regional groups-the long upstream region, the intron, and the long downstream region-and deleted these groups individually or in combination. Combinatorial deletion of all three regional groups decreased Ig-β mRNA levels to 0.4% of the control, which was significantly higher than epigenetic regulation at the chicken Ig-β gene than combinatorial deletion of shorter ones. Analysis of several combinatorial deletions, where combinations included two larger deletions and one smaller deletion, revealed the relative effects of each deletion on transcription of the Ig-β gene. Investigation of the CG methylation status at the Ig-β promoter in one combinatorial deletion demonstrated that USI was involved in the maintenance of CG methylation. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Need-based up-regulation of protein levels in response to deletion of their duplicate genes.

    Directory of Open Access Journals (Sweden)

    Alexander DeLuna

    2010-03-01

    Full Text Available Many duplicate genes maintain functional overlap despite divergence over long evolutionary time scales. Deleting one member of a paralogous pair often has no phenotypic effect, unless its paralog is also deleted. It has been suggested that this functional compensation might be mediated by active up-regulation of expression of a gene in response to deletion of its paralog. However, it is not clear how prevalent such paralog responsiveness is, nor whether it is hardwired or dependent on feedback from environmental conditions. Here, we address these questions at the genomic scale using high-throughput flow cytometry of single-cell protein levels in differentially labeled cocultures of wild-type and paralog-knockout Saccharomyces cerevisiae strains. We find that only a modest fraction of proteins (22 out of 202 show significant up-regulation to deletion of their duplicate genes. However, these paralog-responsive proteins match almost exclusively duplicate pairs whose overlapping function is required for growth. Moreover, media conditions that add or remove requirements for the function of a duplicate gene pair specifically eliminate or create paralog responsiveness. Together, our results suggest that paralog responsiveness in yeast is need-based: it appears only in conditions in which the gene function is required. Physiologically, such need-based responsiveness could provide an adaptive mechanism for compensation of genetic, environmental, or stochastic perturbations in protein abundance.

  15. Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.

    Science.gov (United States)

    Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P

    2016-11-01

    Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10+/+ mice. After total body irradiation (TBI), Grb10m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10+/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes

    Science.gov (United States)

    Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

    2017-01-01

    Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients. PMID:28356564

  17. Chromosome 5q deletion and epigenetic suppression of the gene encoding alpha-catenin (CTNNA1) in myeloid cell transformation.

    Science.gov (United States)

    Liu, Ting Xi; Becker, Michael W; Jelinek, Jaroslav; Wu, Wen-Shu; Deng, Min; Mikhalkevich, Natallia; Hsu, Karl; Bloomfield, Clara D; Stone, Richard M; DeAngelo, Daniel J; Galinsky, Ilene A; Issa, Jean-Pierre; Clarke, Michael F; Look, A Thomas

    2007-01-01

    Interstitial loss of all or part of the long arm of chromosome 5, or del(5q), is a frequent clonal chromosomal abnormality in human myelodysplastic syndrome (MDS, a preleukemic disorder) and acute myeloid leukemia (AML), and is thought to contribute to the pathogenesis of these diseases by deleting one or more tumor-suppressor genes. Although a major commonly deleted region (CDR) has been delineated on chromosome band 5q31.1 (refs. 3-7), attempts to identify tumor suppressors within this band have been unsuccessful. We focused our analysis of gene expression on RNA from primitive leukemia-initiating cells, which harbor 5q deletions, and analyzed 12 genes within the CDR that are expressed by normal hematopoietic stem cells. Here we show that the gene encoding alpha-catenin (CTNNA1) is expressed at a much lower level in leukemia-initiating stem cells from individuals with AML or MDS with a 5q deletion than in individuals with MDS or AML lacking a 5q deletion or in normal hematopoietic stem cells. Analysis of HL-60 cells, a myeloid leukemia line with deletion of the 5q31 region, showed that the CTNNA1 promoter of the retained allele is suppressed by both methylation and histone deacetylation. Restoration of CTNNA1 expression in HL-60 cells resulted in reduced proliferation and apoptotic cell death. Thus, loss of expression of the alpha-catenin tumor suppressor in hematopoietic stem cells may provide a growth advantage that contributes to human MDS or AML with del(5q).

  18. Rhomboids of Mycobacteria: characterization using an aarA mutant of Providencia stuartii and gene deletion in Mycobacterium smegmatis.

    Science.gov (United States)

    Kateete, David Patrick; Katabazi, Fred Ashaba; Okeng, Alfred; Okee, Moses; Musinguzi, Conrad; Asiimwe, Benon Byamugisha; Kyobe, Samuel; Asiimwe, Jeniffer; Boom, W Henry; Joloba, Moses Lutaakome

    2012-01-01

    Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. Using in silico analysis we identified in M. tuberculosis genome the genes encoding two putative rhomboid proteins; Rv0110 (referred to as "rhomboid protease 1") and Rv1337 ("rhomboid protease 2"). Genes encoding orthologs of these proteins are widely represented in all mycobacterial species. When transformed into P. stuartii null-rhomboid mutant (ΔaarA), genes encoding mycobacterial orthologs of "rhomboid protease 2" fully restored AarA activity (AarA is the rhomboid protein of P. stuartii). However, most genes encoding mycobacterial "rhomboid protease 1" orthologs did not. Furthermore, upon gene deletion in M. smegmatis, the ΔMSMEG_4904 single mutant (which lost the gene encoding MSMEG_4904, orthologous to Rv1337, "rhomboid protease 2") formed the least biofilms and was also more susceptible to ciprofloxacin and novobiocin, antimicrobials that inhibit DNA gyrase. However, the ΔMSMEG_5036 single mutant (which lost the gene encoding MSMEG_5036, orthologous to Rv0110, "rhomboid protease 1") was not as susceptible. Surprisingly, the double rhomboid mutant ΔMSMEG_4904-ΔMSMEG_5036 (which lost genes encoding both homologs) was also not as susceptible suggesting compensatory effects following deletion of both rhomboid-encoding genes. Indeed, transforming the double mutant with a plasmid encoding MSMEG_5036 produced phenotypes of the ΔMSMEG_4904 single mutant (i.e. susceptibility to ciprofloxacin and novobiocin). Mycobacterial rhomboid-encoding genes exhibit differences in complementing aarA whereby it's only genes encoding "rhomboid protease 2" orthologs that fully restore AarA activity

  19. Deletion of the Pichia pastoris KU70 homologue facilitates platform strain generation for gene expression and synthetic biology.

    Directory of Open Access Journals (Sweden)

    Laura Näätsaari

    Full Text Available Targeted gene replacement to generate knock-outs and knock-ins is a commonly used method to study the function of unknown genes. In the methylotrophic yeast Pichia pastoris, the importance of specific gene targeting has increased since the genome sequencing projects of the most commonly used strains have been accomplished, but rapid progress in the field has been impeded by inefficient mechanisms for accurate integration. To improve gene targeting efficiency in P. pastoris, we identified and deleted the P. pastoris KU70 homologue. We observed a substantial increase in the targeting efficiency using the two commonly known and used integration loci HIS4 and ADE1, reaching over 90% targeting efficiencies with only 250-bp flanking homologous DNA. Although the ku70 deletion strain was noted to be more sensitive to UV rays than the corresponding wild-type strain, no lethality, severe growth retardation or loss of gene copy numbers could be detected during repetitive rounds of cultivation and induction of heterologous protein production. Furthermore, we demonstrated the use of the ku70 deletion strain for fast and simple screening of genes in the search of new auxotrophic markers by targeting dihydroxyacetone synthase and glycerol kinase genes. Precise knock-out strains for the well-known P. pastoris AOX1, ARG4 and HIS4 genes and a whole series of expression vectors were generated based on the wild-type platform strain, providing a broad spectrum of precise tools for both intracellular and secreted production of heterologous proteins utilizing various selection markers and integration strategies for targeted or random integration of single and multiple genes. The simplicity of targeted integration in the ku70 deletion strain will further support protein production strain generation and synthetic biology using P. pastoris strains as platform hosts.

  20. Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome

    DEFF Research Database (Denmark)

    Bisschoff, Izak J; Zeschnigk, Christine; Horn, Denise

    2013-01-01

    have studied 55 sporadic and six familial cases of suspected OFD1. Comprehensive mutation analysis in OFD1 revealed mutations in 37 female patients from 30 families; 22 mutations have not been previously described including two heterozygous deletions spanning OFD1 and neighbouring genes. Analysis...

  1. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    Science.gov (United States)

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest.

  2. Identification of a Novel Deletion in AVP-NPII Gene in a Patient with Central Diabetes Insipidus.

    Science.gov (United States)

    Deniz, Ferhat; Acar, Ceren; Saglar, Emel; Erdem, Beril; Karaduman, Tugce; Yonem, Arif; Cagiltay, Eylem; Ay, Seyit Ahmet; Mergen, Hatice

    2015-01-01

    Central Diabetes Insipidus (CDI) is caused by a deficiency of antidiuretic hormone and characterized by polyuria, polydipsia and inability to concentrate urine. Our objective was to present the results of the molecular analyses of AVP-neurophysin II (AVP-NPII) gene in a large familial neurohypophyseal (central) DI pedigree. A male patient and his family members were analyzed and the prospective clinical data were collected. The proband applied to hospital for eligibility to be a recruit in Armed Forces. The patient had severe polyuria (20 L/day), polydipsia (20.5 L/day), fatique, and deep thirstiness. CDI was confirmed with the water deprivation-desmopressin test according to an increase in urine osmolality from 162 mOsm/kg to 432 mOsm/kg after desmopressin acetate injection. To evaluate the coding regions of AVP-NPII gene, polymerase chain reactions were performed and amplified regions were submitted to direct sequence analysis. We detected a heterozygous three base pair deletion at codon 69-70 (207_209delGGC) in exon 2, which lead to a deletion of the amino acid alanine. A three-dimensional protein structure prediction was shown for the deleted AVP-NPII and compared with the wild type. The three base pair deletion may yield an abnormal AVP precursor in neurophysin moiety, but further functional analyses are needed to understand the function of the deleted protein. © 2015 by the Association of Clinical Scientists, Inc.

  3. Increased frequency of DNA deletions in pink-eyed unstable mice carrying a mutation in the Werner syndrome gene homologue.

    Science.gov (United States)

    Lebel, Michel

    2002-01-01

    Werner syndrome (WS) is a rare autosomal recessive disorder characterized by genomic instability and the premature onset of a number of age-related diseases, including cancers. Accumulating evidence indicates that the WS gene product is involved in resolving aberrant DNA structures that may arise during the process of DNA replication and/or transcription. To estimate the frequency of DNA deletions directly in the skin of mouse embryos, mice with a deletion of part of the murine WRN helicase domain were created. These mutant mice were then crossed to the pink-eyed unstable animals, which have a 70 kb internal duplication at the pink-eyed dilution (p) gene. This report indicates that the frequency of deletion of the duplicated sequence at the p locus is elevated in mice with a mutation in the WRN allele when compared with wild-type mice. In addition, the inhibitor of topoisomerase I camptothecin also increases the frequency of deletion at the p locus. This frequency is even more elevated in WRN mutant mice treated with camptothecin. In contrast, while the inhibition of poly(ADP-ribose) polymerase (PARP) activity by 3-aminobenzamide increases the frequency of DNA deletion, mutant WRN mice are not significantly more sensitive to the inhibition of PARP activity than wild-type animals.

  4. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    Energy Technology Data Exchange (ETDEWEB)

    Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  5. Deletion of 5' sequences of the CSB gene provides insight into the pathophysiology of Cockayne syndrome.

    Science.gov (United States)

    Laugel, Vincent; Dalloz, Cecile; Stary, Anne; Cormier-Daire, Valerie; Desguerre, Isabelle; Renouil, Michel; Fourmaintraux, Alain; Velez-Cruz, Renier; Egly, Jean-Marc; Sarasin, Alain; Dollfus, Helene

    2008-03-01

    Cockayne syndrome is an autosomal recessive neurodegenerative disorder characterized by a specific defect in the repair of UV-induced DNA lesions. Most cases of Cockayne syndrome are caused by mutations in the CSB gene but the pathophysiological mechanisms are poorly understood. We report the clinical and molecular data of two severely affected Cockayne patients with undetectable CSB protein and mRNA. Both patients showed severe growth failure, microcephaly, mental retardation, congenital cataracts, retinal pigmentary degeneration, photosensitivity and died at the ages of 6 and 8 years. UV irradiation assays demonstrated that both patients had the classical DNA repair defect. Genomic DNA sequencing of the CSB gene showed a homozygous deletion involving non-coding exon 1 and upstream regulatory sequences, but none of the coding exons. Functional complementation using a wild-type CSB expression plasmid fully corrected the DNA repair defect in transfected fibroblasts. Horibata et al recently proposed that all type of CSB mutations result in a defect in UV damage repair that is responsible for the photosensitivity observed in the syndrome, but that only truncated CSB polypeptides generated by nonsense mutations have some additional inhibitory functions in transcription or in oxidative damage repair, which are necessary to lead to the other features of the phenotype. Our patients do not fit the proposed paradigm and new hypotheses are required to account for the pathophysiology of Cockayne syndrome, at the crossroads between DNA repair and transcription.

  6. A novel heterozygous deletion in the EVC2 gene causes Weyers acrofacial dysostosis.

    Science.gov (United States)

    Ye, Xiaoqian; Song, Guangtai; Fan, Mingwen; Shi, Lisong; Jabs, Ethylin Wang; Huang, Shangzhi; Guo, Ruiqiang; Bian, Zhuan

    2006-03-01

    Weyers acrofacial dysostosis (MIM 193530) is an autosomal dominant disorder clinically characterized by mild short stature, postaxial polydactyly, nail dystrophy and dysplastic teeth. Ellis-van Creveld syndrome (EvC, MIM 225500) is an autosomal recessive disorder with a similar, but more severe phenotype. Mutations in the EVC have been identified in both syndromes. However, the EVC mutations only occur in a small proportion of EvC patients. Recently, mutations in a new gene, EVC2, were found to be associated with other EvC cases. The EVC and EVC2 are located close to each other in a head-to-head configuration and may be functionally related. In this study, we report identification of a novel heterozygous deletion in the EVC2 that is responsible for autosomal dominant Weyers acrofacial dysostosis in a large Chinese family. This constitutes the first report of Weyers acrofacial dysostosis caused by this gene. Hence, the spectrum of malformation syndromes due to EVC2 mutations is further extended. Our data provides conclusive evidence that Weyers acrofacial dysostosis and EvC syndrome are allelic and genetically heterogeneous conditions.

  7. Global Deletion of TSPO Does Not Affect the Viability and Gene Expression Profile.

    Directory of Open Access Journals (Sweden)

    Huaishan Wang

    Full Text Available Translocator Protein (18kDa, TSPO is a mitochondrial outer membrane transmembrane protein. Its expression is elevated during inflammation and injury. However, the function of TSPO in vivo is still controversial. Here, we constructed a TSPO global knockout (KO mouse with a Cre-LoxP system that abolished TSPO protein expression in all tissues and showed normal phenotypes in the physiological condition. The birth rates of TSPO heterozygote (Het x Het or KO x KO breeding were consistent with Mendel's Law, suggesting a normal viability of TSPO KO mice at birth. RNA-seq analysis showed no significant difference in the gene expression profile of lung tissues from TSPO KO mice compared with wild type mice, including the genes associated with bronchial alveoli immune homeostasis. The alveolar macrophage population was not affected by TSPO deletion in the physiological condition. Our findings contradict the results of Papadopoulos, but confirmed Selvaraj's findings. This study confirms TSPO deficiency does not affect viability and bronchial alveolar immune homeostasis.

  8. Metabolic flux balance analysis and the in silico analysis of Escherichia coli K-12 gene deletions

    Directory of Open Access Journals (Sweden)

    Edwards Jeremy S

    2000-07-01

    Full Text Available Abstract Background Genome sequencing and bioinformatics are producing detailed lists of the molecular components contained in many prokaryotic organisms. From this 'parts catalogue' of a microbial cell, in silico representations of integrated metabolic functions can be constructed and analyzed using flux balance analysis (FBA. FBA is particularly well-suited to study metabolic networks based on genomic, biochemical, and strain specific information. Results Herein, we have utilized FBA to interpret and analyze the metabolic capabilities of Escherichia coli. We have computationally mapped the metabolic capabilities of E. coli using FBA and examined the optimal utilization of the E. coli metabolic pathways as a function of environmental variables. We have used an in silico analysis to identify seven gene products of central metabolism (glycolysis, pentose phosphate pathway, TCA cycle, electron transport system essential for aerobic growth of E. coli on glucose minimal media, and 15 gene products essential for anaerobic growth on glucose minimal media. The in silico tpi-, zwf, and pta- mutant strains were examined in more detail by mapping the capabilities of these in silico isogenic strains. Conclusions We found that computational models of E. coli metabolism based on physicochemical constraints can be used to interpret mutant behavior. These in silica results lead to a further understanding of the complex genotype-phenotype relation. Supplementary information: http://gcrg.ucsd.edu/supplementary_data/DeletionAnalysis/main.htm

  9. Deletion in the EVC2 gene causes chondrodysplastic dwarfism in Tyrolean Grey cattle.

    Science.gov (United States)

    Murgiano, Leonardo; Jagannathan, Vidhya; Benazzi, Cinzia; Bolcato, Marilena; Brunetti, Barbara; Muscatello, Luisa Vera; Dittmer, Keren; Piffer, Christian; Gentile, Arcangelo; Drögemüller, Cord

    2014-01-01

    During the summer of 2013 seven Italian Tyrolean Grey calves were born with abnormally short limbs. Detailed clinical and pathological examination revealed similarities to chondrodysplastic dwarfism. Pedigree analysis showed a common founder, assuming autosomal monogenic recessive transmission of the defective allele. A positional cloning approach combining genome wide association and homozygosity mapping identified a single 1.6 Mb genomic region on BTA 6 that was associated with the disease. Whole genome re-sequencing of an affected calf revealed a single candidate causal mutation in the Ellis van Creveld syndrome 2 (EVC2) gene. This gene is known to be associated with chondrodysplastic dwarfism in Japanese Brown cattle, and dwarfism, abnormal nails and teeth, and dysostosis in humans with Ellis-van Creveld syndrome. Sanger sequencing confirmed the presence of a 2 bp deletion in exon 19 (c.2993_2994ACdel) that led to a premature stop codon in the coding sequence of bovine EVC2, and was concordant with the recessive pattern of inheritance in affected and carrier animals. This loss of function mutation confirms the important role of EVC2 in bone development. Genetic testing can now be used to eliminate this form of chondrodysplastic dwarfism from Tyrolean Grey cattle.

  10. Deletion in the EVC2 gene causes chondrodysplastic dwarfism in Tyrolean Grey cattle.

    Directory of Open Access Journals (Sweden)

    Leonardo Murgiano

    Full Text Available During the summer of 2013 seven Italian Tyrolean Grey calves were born with abnormally short limbs. Detailed clinical and pathological examination revealed similarities to chondrodysplastic dwarfism. Pedigree analysis showed a common founder, assuming autosomal monogenic recessive transmission of the defective allele. A positional cloning approach combining genome wide association and homozygosity mapping identified a single 1.6 Mb genomic region on BTA 6 that was associated with the disease. Whole genome re-sequencing of an affected calf revealed a single candidate causal mutation in the Ellis van Creveld syndrome 2 (EVC2 gene. This gene is known to be associated with chondrodysplastic dwarfism in Japanese Brown cattle, and dwarfism, abnormal nails and teeth, and dysostosis in humans with Ellis-van Creveld syndrome. Sanger sequencing confirmed the presence of a 2 bp deletion in exon 19 (c.2993_2994ACdel that led to a premature stop codon in the coding sequence of bovine EVC2, and was concordant with the recessive pattern of inheritance in affected and carrier animals. This loss of function mutation confirms the important role of EVC2 in bone development. Genetic testing can now be used to eliminate this form of chondrodysplastic dwarfism from Tyrolean Grey cattle.

  11. Exploiting gene deletion fitness effects in yeast to understand the modular architecture of protein complexes under different growth conditions

    Directory of Open Access Journals (Sweden)

    Babu M Madan

    2009-07-01

    Full Text Available Abstract Background Understanding how individual genes contribute towards the fitness of an organism is a fundamental problem in biology. Although recent genome-wide screens have generated abundant data on quantitative fitness for single gene knockouts, very few studies have systematically integrated other types of biological information to understand how and why deletion of specific genes give rise to a particular fitness effect. In this study, we combine quantitative fitness data for single gene knock-outs in yeast with large-scale interaction discovery experiments to understand the effect of gene deletion on the modular architecture of protein complexes, under different growth conditions. Results Our analysis reveals that genes in complexes show more severe fitness effects upon deletion than other genes but, in contrast to what has been observed in binary protein-protein interaction networks, we find that this is not related to the number of complexes in which they are present. We also find that, in general, the core and attachment components of protein complexes are equally important for the complex machinery to function. However, when quantifying the importance of core and attachments in single complex variations, or isoforms, we observe that this global trend originates from either the core or the attachment components being more important for strain fitness, both being equally important or both being dispensable. Finally, our study reveals that different isoforms of a complex can exhibit distinct fitness patterns across growth conditions. Conclusion This study presents a powerful approach to unveil the molecular basis for various complex phenotypic profiles observed in gene deletion experiments. It also highlights some interesting cases of potential functional compensation between protein paralogues and suggests a new piece to fit into the histone-code puzzle.

  12. DNA methylation and gene deletion analysis of brain metastases in melanoma patients identifies mutually exclusive molecular alterations.

    Science.gov (United States)

    Marzese, Diego M; Scolyer, Richard A; Roqué, Maria; Vargas-Roig, Laura M; Huynh, Jamie L; Wilmott, James S; Murali, Rajmohan; Buckland, Michael E; Barkhoudarian, Garni; Thompson, John F; Morton, Donald L; Kelly, Daniel F; Hoon, Dave S B

    2014-11-01

    The brain is a common target of metastases for melanoma patients. Little is known about the genetic and epigenetic alterations in melanoma brain metastases (MBMs). Unraveling these molecular alterations is a key step in understanding their aggressive nature and identifying novel therapeutic targets. Genome-wide DNA methylation analyses of MBMs (n = 15) and normal brain tissues (n = 91) and simultaneous multigene DNA methylation and gene deletion analyses of metastatic melanoma tissues (99 MBMs and 43 extracranial metastases) were performed. BRAF and NRAS mutations were evaluated in MBMs by targeted sequencing. MBMs showed significant epigenetic heterogeneity. RARB, RASSF1, ESR1, APC, PTEN, and CDH13 genes were frequently hypermethylated. Deletions were frequently detected in the CDKN2A/B locus. Of MBMs, 46.1% and 28.8% had BRAF and NRAS missense mutations, respectively. Compared with lung and liver metastases, MBMs exhibited higher frequency of CDH13 hypermethylation and CDKN2A/B locus deletion. Mutual exclusivity between hypermethylated genes and CDKN2A/B locus deletion identified 2 clinically relevant molecular subtypes of MBMs. CDKN2A/B deletions were associated with multiple MBMs and frequently hypermethylated genes with shorter time to brain metastasis. Melanoma cells that colonize the brain harbor numerous genetically and epigenetically altered genes. This study presents an integrated genomic and epigenomic analysis that reveals MBM-specific molecular alterations and mutually exclusive molecular subtypes. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Shawana Kamran

    2015-01-01

    Full Text Available The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL. The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9(q23;q34. Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH studies, and Chromosomal Microarray Analysis (CMA. The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9(q24;q34 and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

  14. Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-11-01

    Full Text Available Abstract Background Axenfeld-Rieger syndrome (ARS is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Case presentation Two members of this family (father and daughter presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Conclusion Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments.

  15. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  16. Impact of rli87 gene deletion on response of Listeria monocytogenes to environmental stress.

    Science.gov (United States)

    Kun, Xie; Qingling, Meng; Qiao, Jun; Yelong, Peng; Tianli, Liu; Cheng, Chen; Yu, Ma; Zhengxiang, Hu; Xuepeng, Cai; Chuangfu, Chen

    2014-10-01

    Listeria monocytogenes (LM) is a zoonotic pathogen that widely adapts to various environments. Recent studies have found that noncoding RNAs (ncRNAs) play regulatory roles in LM responses to environmental stress. To understand the role of ncRNA rli87 in the response regulation, a rli87 deletion strain LM-Δrli87 was constructed by homologous recombination and tested for stress responses to high temperature, low temperature, high osmotic pressure, alcohol, acidity, alkaline and oxidative environments, along with LM EGD-e strain (control). The results showed that compared with LM EGD-e, LM-Δrli87 grew faster (P  0.05) in acidic and high osmatic pressure (10% NaCl) conditions. When cultured in medium containing 3.8% ethanol, the growth was not significantly different between the two strains (P > 0.05). When cultured at pH 9, they had similar growth rates in the first 5 h (P > 0.05), but the rates were significantly different after 6 h (P < 0.05). The expression of rsbV, rsbW, hpt, clpP, and ctsR was upregulated in LM-∆rli87 compared with LM EGD-e at pH 9, indicating that the rli87 gene regulated the expression of the five genes in alkaline environment. Our results suggest that the rli87 gene has an important regulatory role in LM's response to temperature (30 and 42 °C), alkaline stresses. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. Detection of an atypical teratoid rhabdoid brain tumor gene deletion in circulating blood using next-generation sequencing.

    Science.gov (United States)

    Chakravadhanula, Madhavi; Tembe, Waibhav; Legendre, Christophe; Carpentieri, David; Liang, Winnie S; Bussey, Kimberly J; Carpten, John; Berens, Michael E; Bhardwaj, Ratan D

    2014-09-01

    Circulating biomarkers such as somatic chromosome mutations are novel diagnostic tools to detect cancer noninvasively. We describe focal deletions found in a patient with atypical teratoid rhabdoid tumor, a highly aggressive early childhood pediatric tumor. First, we used magnetic resonance imaging (MRI) and histopathology to study the tumor anatomy. Next, we used whole genome sequencing (Next Gen Sequencing) and Bioinformatics interrogation to discover the presence of 3 focal deletions in tumor tissue and 2 of these 3 focal deletions in patient's blood also. About 20% of the blood DNA sequencing reads matched the tumor DNA reads at the SMARCB1 gene locus. Circulating, tumor-specific DNA aberrations are a promising biomarker for atypical teratoid rhabdoid tumor patients. The high percentage of tumor DNA detected in blood indicates that either circulating brain tumor cells lyse in the blood or that contents of brain tumor cells traverse a possibly compromised blood-brain barrier in this patient. © The Author(s) 2013.

  18. Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families

    Directory of Open Access Journals (Sweden)

    Sólyom Szilvia

    2008-05-01

    Full Text Available Abstract Background BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Methods Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. Results We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13 in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. Conclusion In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility.

  19. Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia) guyanensis.

    Science.gov (United States)

    Monte-Neto, Rubens; Laffitte, Marie-Claude N; Leprohon, Philippe; Reis, Priscila; Frézard, Frédéric; Ouellette, Marc

    2015-02-01

    Antimony resistance complicates the treatment of infections caused by the parasite Leishmania. Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR) mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1). Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion. This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

  20. Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia guyanensis.

    Directory of Open Access Journals (Sweden)

    Rubens Monte-Neto

    2015-02-01

    Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

  1. In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology

    Science.gov (United States)

    Fazli, Mustafa; Harrison, Joe J.; Gambino, Michela; Givskov, Michael

    2015-01-01

    Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation. PMID:25795676

  2. Novel deletion mutation of HLA-B*40:02 gene in acquired aplastic anemia.

    Science.gov (United States)

    Jeong, T-D; Mun, Y-C; Chung, H-S; Seo, D; Im, J; Huh, J

    2017-01-01

    Despite prevalence of clonal evolution in patients with aplastic anemia (AA), somatic mutation of human leukocyte antigen (HLA) gene is rarely reported. Herein, we reported a case of acquired AA (aAA) harboring a new four-base-pair deletion mutation within exon 4 of HLA-B*40:02 leading to frameshift and premature stop codon. The HLA-B*40:02 mutant allele was detected in the patient's peripheral blood sample not in patient's buccal epithelial cells. The patient received allogenic hematopoietic stem cell transplantation (HSCT) from HLA-matched sibling donor. On day 30 after HSCT, the mutant HLA allele was not detected by high-resolution sequence-based HLA typing. Serial chimerism analyses showed mixed chimeric status indicative of coexisting donor and recipient hematopoietic cells. Our data could provide additional support in view of pathophysiology of aAA that somatic mutation of HLA-B*40:02 allele is one of the possible origin of clonal escape to evade immune attack in patient with aAA. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Immunoglobulin Gene Insertions and Deletions in the Affinity Maturation of HIV-1 Broadly Reactive Neutralizing Antibodies

    Science.gov (United States)

    Kepler, Thomas B.; Liao, Hua-Xin; Alam, S. Munir; Bhaskarabhatla, Rekha; Zhang, Ruijun; Stewart, Shelley; Anasti, Kara; Kelsoe, Garnett; Parks, Robert; Lloyd, Krissey E.; Stolarchuk, Christina; Pritchett, Jamie; Solomon, Erika; Friberg, Emma; Morris, Lynn; Karim, Salim S. Abdool; Cohen, Myron S.; Walter, Emmanuel; Moody, M. Anthony; Wu, Xueling; Altae-Tran, Han R.; Georgiev, Ivelin S.; Kwong, Peter D.; Boyd, Scott D.; Fire, Andrew Z.; Mascola, John R.; Haynes, Barton F.

    2014-01-01

    Summary Induction of HIV-1 broad neutralizing antibodies (bnAbs) is a goal of HIV-1 vaccine development but has remained challenging partially due to unusual traits of bnAbs, including high somatic hypermutation (SHM) frequencies and in-frame insertions and deletions (indels). Here we examined the propensity and functional requirement for indels within HIV-1 bnAbs. High-throughput sequencing of the immunoglobulin (Ig) VHDJH genes in HIV-1 infected and uninfected individuals revealed that the indel frequency was elevated among HIV-1-infected subjects, with no unique properties attributable to bnAb-producing individuals. This increased indel occurrence depended only on the frequency of SHM point-mutations. Indel-encoded regions were generally proximal to antigen binding sites. Additionally, reconstruction of a HIV-1 CD4-binding site bnAb clonal lineage revealed that a large compound VHDJH indel was required for bnAb activity. Thus, vaccine development should focus on designing regimens targeted at sustained activation of bnAb lineages to achieve the required SHM and indel events. PMID:25211073

  4. Angiotensin-converting enzyme gene (ACE) insertion/deletion polymorphism in Mexican populations.

    Science.gov (United States)

    Vargas-Alarcón, Gilberto; Hernández-Pacheco, Guadalupe; Rodríguez-Pérez, José Manuel; Pérez-Hernández, Nonanzit; Pavón, Zinnia; Fragoso, José Manuel; Juarez-Cedillo, Teresa; Villarreal-Garza, Cynthia; Granados, Julio

    2003-12-01

    The angiotensin-converting enzyme gene (ACE) insertion/deletion polymorphism was determined in 211 Mexican healthy individuals belonging to different Mexican ethnic groups (98 Mestizos, 64 Teenek, and 49 Nahuas). ACE polymorphism differed among Mexicans with a high frequency of the D allele and the D/D genotype in Mexican Mestizos. The D/D genotype was absent in Teenek and present in only one Nahua individual (2.0%). When comparisons were made, we observed that Caucasian, African, and Asian populations presented the highest frequencies of the D allele, whereas Amerindian (Teenek and Pima) and Australian Aboriginals showed the highest frequencies of the I allele. The distribution of I/D genotype was heterogeneous in all populations: Australian Aboriginals presented the lowest frequency (4.9%), whereas Nahuas presented the highest (73.4%). The present study shows the frequencies of a polymorphism not analyzed previously in Mexican populations and establishes that this polymorphism distinguishes the Amerindian populations of other groups. On the other hand, since ACE alleles have been associated with genetic susceptibility to developing cardiovascular diseases and hypertension, knowledge of the distribution of these alleles could help to define the true significance of ACE polymorphism as a genetic susceptibility marker in the Amerindian populations.

  5. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor

    Science.gov (United States)

    Eberhart, Lauren J.; Ohlert, Janet M.; Knutson, Carolann M.; Plunkett, Mary H.

    2015-01-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  6. A de-novo large deletion of 2.8 kb produced in the ABCD1 gene causing adrenoleukodystrophy disease.

    Science.gov (United States)

    Kallabi, Fakhri; Ben Salah, Ghada; Ben Chehida, Amel; Tabebi, Mouna; Felhi, Rahma; Ben Turkia, Hadhami; Tebib, Neji; Keskes, Leila; Kamoun, Hassen

    2016-06-01

    X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disorder caused by mutations in the ABCD1 gene, which encodes an ATP-binding cassette transporter protein, ALDP. The disease is characterized by increased concentrations of very long chain fatty acids (VLCFAs) in plasma, adrenal, testicular, and nerve tissues. For this study, our objective was to conduct clinical, molecular, and genetic studies of a Tunisian patient with X-ALD. The diagnosis was based on clinical indications, biochemical analyses, typical brain-scan patterns, and molecular biology; the molecular analyses were based on PCR, long-range PCR, and sequencing. The molecular analysis by long-range PCR and direct sequencing of the ABCD1 gene showed the presence of a de-novo 2794 bp deletion covering the whole of exon 2. Using bioinformatics tools, we demonstrate that the large deletion is located in a region rich with Alu sequences. Furthermore, we suggest that the AluJb sequence could be the cause of the large deletion of intron 1, exon 2, and intron 2, and the creation of a premature stop codon within exon 3. This report is the first report in which we demonstrate the breakpoints and the size of a large deletion in a Tunisian with X-ALD.

  7. Angelman Syndrome due to a Maternally Inherited Intragenic Deletion Encompassing Exons 7 and 8 of the UBE3A Gene.

    Science.gov (United States)

    Ververi, Athina; Islam, Lily; Bewes, Beverley; Busby, Louise; Sullivan, Caroline; Canham, Natalie

    2017-01-01

    Angelman syndrome (AS) is characterised by developmental delay, lack of speech, seizures, a characteristic behavioural profile with a happy demeanour, microcephaly, and ataxia. More than two-thirds of cases are due to an approximately 5-Mb interstitial deletion of the imprinted region 15q11.2q13, which is usually de novo. The rest are associated with point mutations in the UBE3A gene, imprinting defects, and paternal uniparental disomy. Small intragenic UBE3A deletions have rarely been described. They are usually maternally inherited, increasing the recurrence risk to 50%, and may be missed by conventional testing (methylation studies and UBE3A gene sequencing). We describe a boy with AS due to an 11.7-kb intragenic deletion. The deletion was identified by array-CGH and was subsequently detected in his affected first cousin and unaffected maternal grandfather, mother, and aunt, confirming the silencing of the paternal allele. The patient had developmental delay, speech impairment, a happy demeanour, microcephaly, and an abnormal EEG, but no seizures by the age of 4 years. Delineation of the underlying genetic mechanism is of utmost importance for reasons of genetic counselling, as well as appropriate management and prognosis. Alternative techniques, such as array-CGH and MLPA, are necessary when conventional testing for AS has failed to identify the underlying genetic mechanism. © 2017 S. Karger AG, Basel.

  8. Leukoencephalopathy associated with 11q24 deletion involving the gene encoding hepatic and glial cell adhesion molecule in two patients.

    Science.gov (United States)

    Yamamoto, Toshiyuki; Shimada, Shino; Shimojima, Keiko; Sangu, Noriko; Ninomiya, Shinsuke; Kubota, Masaya

    2015-09-01

    Leukoencephalopathies are heterogeneous entities with white matter abnormalities. Mutations of the gene encoding hepatic and glial cell adhesion molecule (HEPACAM) located on 11q24 are related to one of the leukoencephalopathies: megalencephalic leukoencephalopathy with subcortical cysts type 2 (MLC2). Genomic copy number aberrations were analyzed by microarray comparative hybridization for two patients. One patient who presented with abnormal intensity of the white matter had been previously been diagnosed with the typical genotype and phenotype of Jacobsen syndrome due to an 11q subtelomere deletion, which was further characterized here. In a second patient who exhibited the characteristic finding of leukoencephalopathy, an interstitial deletion of 11q24 was also identified. HEPACAM was involved in both deletions. We therefore suggest that haploinsufficiency of HEPACAM, a gene previously associated with the features of MLC2 and located on the overlapping deletion region between the two patients, might be related to the observed white matter abnormalities. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Characterization of a de novo 43-bp deletion of the Gs[alpha] gene (GNAS1) in Albright hereditary osteodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Luttikhuis, M.E.M.O.; Trembath, R.C. (Univ. of Leicester (United Kingdom)); Wilson, L.C. (Univ. of Leicester (United Kingdom) Institute of Child Health, London (United Kingdom)); Leonard, J.V. (Institute of Child Health, London (United Kingdom))

    1994-05-15

    Albright hereditary osteodystrophy (AHO) is an autosomal dominant disorder characterized by short stature, obesity, mental retardation, subcutaneous calcification, and brachy-metaphalangia. Two distinct forms of AHO exist; pseudohypoparathyroidism type I (PHPI) and pseudopseudohypoparathyrodism (PPHP). The classification is dependent upon the presence or absence, respectively, of resistance to parathyroid and other hormones that bind to Gs-protein-coupled membrane receptors stimulating adenylyl cyclase. Gs is a heterotrimeric protein comprising [alpha], [beta], and [gamma]-subunits encoded by separate genes. Genomic DNA was isolated from peripheral leukocytes from 13 unrelated AHO patients. Exon 4 and flanking intronic sequence of GNAS1 were PCR amplified. A single PCR product corresponding to the expected 159-bp fragment was identified in 12 affected individuals with either PHPIa or PPHP. In patient 10285 an additional smaller fragment was detected but was not present in either of the unaffected parents. These two fragments were isolated from a 2% agarose gel. Direct sequencing of the smaller fragment revealed a 43-bp deletion comprising at least 35 hp of the 3[prime] end of exon 4 and the donor splice site of intron 4 and extending into the following intro. The 43-bp deletion would lead to a premature stop codon, 62 codons downstream of the deletion. The de novo mutation reported here is the largest deletion in the Gs[alpha] gene described so far for AHO patients.

  10. Molecular characterization of an 11q interstitial deletion in a patient with the clinical features of Jacobsen syndrome.

    Science.gov (United States)

    Wenger, Sharon L; Grossfeld, Paul D; Siu, Benjamin L; Coad, James E; Keller, Frank G; Hummel, Marybeth

    2006-04-01

    The 11q terminal deletion disorder or Jacobsen syndrome is a contiguous gene disorder. It is characterized by psychomotor retardation, cardiac defects, blood dyscrasias (Paris-Trousseau syndrome) and craniofacial anomalies. We report on a female patient with an approximately 10 Mb interstitial deletion with many of the features of Jacobsen syndrome: A congenital heart defect, dysmorphic features, developmental delay, and Paris-Trousseau syndrome. The karyotype of the patient is 46,XX,del(11)(q24.1q24.3). The interstitial deletion was confirmed using FISH probes for distal 11q, and the breakpoints were characterized by microarray analysis. This is the first molecularly characterized interstitial deletion in a patient with the clinical features of Jacobsen syndrome. The deletion includes FLI-1, but not JAM-3, which will help to determine the critical genes involved in this syndrome. Copyright 2006 Wiley-Liss, Inc.

  11. Screening the dystrophin gene suggests a high rate of polymorphism in general but no exonic deletions in schizophrenics

    Energy Technology Data Exchange (ETDEWEB)

    Lindor, N.M.; Sobell, J.L.; Thibodeau, S.N. [Mayo Clinic/Foundation, Rochester, MN (United States)] [and others

    1994-03-15

    The dystrophin gene, located at chromosome Xp21, was evaluated as a candidate gene in chronic schizophrenia in response to the report of a large family in which schizophrenia cosegregated with Becker muscular dystrophy. Genomic DNA from 94 men with chronic schizophrenia was evaluated by Southern blot analysis using cDNA probes that span exons 1-59. No exonic deletions were identified. An unexpectedly high rate of polymorphism was calculated in this study and two novel polymorphisms were found, demonstrating the usefulness of the candidate gene approach even when results of the original study are negative. 41 refs., 1 fig., 4 tabs.

  12. Deletion of the MBII-85 snoRNA gene cluster in mice results in postnatal growth retardation.

    Directory of Open Access Journals (Sweden)

    Boris V Skryabin

    2007-12-01

    Full Text Available Prader-Willi syndrome (PWS [MIM 176270] is a neurogenetic disorder characterized by decreased fetal activity, muscular hypotonia, failure to thrive, short stature, obesity, mental retardation, and hypogonadotropic hypogonadism. It is caused by the loss of function of one or more imprinted, paternally expressed genes on the proximal long arm of chromosome 15. Several potential PWS mouse models involving the orthologous region on chromosome 7C exist. Based on the analysis of deletions in the mouse and gene expression in PWS patients with chromosomal translocations, a critical region (PWScr for neonatal lethality, failure to thrive, and growth retardation was narrowed to the locus containing a cluster of neuronally expressed MBII-85 small nucleolar RNA (snoRNA genes. Here, we report the deletion of PWScr. Mice carrying the maternally inherited allele (PWScr(m-/p+ are indistinguishable from wild-type littermates. All those with the paternally inherited allele (PWScr(m+/p- consistently display postnatal growth retardation, with about 15% postnatal lethality in C57BL/6, but not FVB/N crosses. This is the first example in a multicellular organism of genetic deletion of a C/D box snoRNA gene resulting in a pronounced phenotype.

  13. Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

    Directory of Open Access Journals (Sweden)

    Kozmin Stanislav G

    2005-06-01

    Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

  14. Acetylcholinesterase (AChE) gene modification in transgenic animals: functional consequences of selected exon and regulatory region deletion.

    Science.gov (United States)

    Camp, Shelley; Zhang, Limin; Marquez, Michael; de la Torre, Brian; Long, Jeffery M; Bucht, Goran; Taylor, Palmer

    2005-12-15

    AChE is an alternatively spliced gene. Exons 2, 3 and 4 are invariantly spliced, and this sequence is responsible for catalytic function. The 3' alternatively spliced exons, 5 and 6, are responsible for AChE disposition in tissue [J. Massoulie, The origin of the molecular diversity and functional anchoring of cholinesterases. Neurosignals 11 (3) (2002) 130-143; Y. Li, S. Camp, P. Taylor, Tissue-specific expression and alternative mRNA processing of the mammalian acetylcholinesterase gene. J. Biol. Chem. 268 (8) (1993) 5790-5797]. The splice to exon 5 produces the GPI anchored form of AChE found in the hematopoietic system, whereas the splice to exon 6 produces a sequence that binds to the structural subunits PRiMA and ColQ, producing AChE expression in brain and muscle. A third alternative RNA species is present that is not spliced at the 3' end; the intron 3' of exon 4 is used as coding sequence and produces the read-through, unanchored form of AChE. In order to further understand the role of alternative splicing in the expression of the AChE gene, we have used homologous recombination in stem cells to produce gene specific deletions in mice. Alternatively and together exon 5 and exon 6 were deleted. A cassette containing the neomycin gene flanked by loxP sites was used to replace the exon(s) of interest. Tissue analysis of mice with exon 5 deleted and the neomycin cassette retained showed very low levels of AChE expression, far less than would have been anticipated. Only the read-through species of the enzyme was produced; clearly the inclusion of the selection cassette disrupted splicing of exon 4 to exon 6. The selection cassette was then deleted in exon 5, exon 6 and exons 5 + 6 deleted mice by breeding to Ella-cre transgenic mice. AChE expression in serum, brain and muscle has been analyzed. Another AChE gene targeted mouse strain involving a region in the first intron, found to be critical for AChE expression in muscle cells [S. Camp, L. Zhang, M. Marquez, B

  15. A highly selective G-quadruplex-based luminescent switch-on probe for the detection of gene deletion.

    Science.gov (United States)

    He, Hong-Zhang; Chan, Daniel Shiu-Hin; Leung, Chung-Hang; Ma, Dik-Lung

    2012-10-04

    A G-quadruplex-based switch-on luminescence assay has been developed for the detection of gene deletion using a cyclometallated iridium(III) complex as a G-quadruplex-selective probe. Upon hybridization with the target DNA, the two split G-quadruplex-forming sequences assemble into a split G-quadruplex, which greatly enhances the luminescence emission of the iridium(III) probe. The assay is simple and highly selective.

  16. Rhomboids of Mycobacteria: Characterization Using an aarA Mutant of Providencia stuartii and Gene Deletion in Mycobacterium smegmatis

    OpenAIRE

    David Patrick Kateete; Fred Ashaba Katabazi; Alfred Okeng; Moses Okee; Conrad Musinguzi; Benon Byamugisha Asiimwe; Samuel Kyobe; Jeniffer Asiimwe; W Henry Boom; Moses Lutaakome Joloba

    2012-01-01

    BACKGROUND: Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. METHODOLOGY/PRINCIPAL FINDINGS: Using in silico analysis we identified in M. tuberculosis genome the ge...

  17. Variable penetrance of hypogonadism in a sibship with Kallmann syndrome due to a deletion of the KAL gene

    Energy Technology Data Exchange (ETDEWEB)

    Parenti, G.; Rizzolo, M.G.; Ghezzi, M. [Federico II University, Naples (Italy)] [and others

    1995-07-03

    We report on the clinical and molecular characterization of 3 sibs with X-linked ichthyosis and variable expression of Kallmann syndrome. One of the affected brothers had mild hyposmia and showed normal pubertal progression. However, we demonstrated the same partial deletion of the X-linked Kallmann gene, sparing the first exon in the mildly affected patient as well as in one of his severely affected brothers. 13 refs., 1 fig., 1 tab.

  18. Heritable Genomic Fragment Deletions and Small Indels in the Putative ENGase Gene Induced by CRISPR/Cas9 in Barley

    Directory of Open Access Journals (Sweden)

    Eva Stoger

    2017-04-01

    Full Text Available Targeted genome editing with the CRISPR/Cas9 system has been used extensively for the selective mutation of plant genes. Here we used CRISPR/Cas9 to disrupt the putative barley (Hordeum vulgare cv. “Golden Promise” endo-N-acetyl-β-D-glucosaminidase (ENGase gene. Five single guide RNAs (sgRNAs were designed for different target sites in the upstream part of the ENGase coding region. Targeted fragment deletions were induced by co-bombarding selected combinations of sgRNA with wild-type cas9 using separate plasmids, or by co-infection with separate Agrobacterium tumefaciens cultures. Genotype screening was carried out in the primary transformants (T0 and their T1 progeny to confirm the presence of site-specific small insertions and deletions (indels and genomic fragment deletions between pairs of targets. Cas9-induced mutations were observed in 78% of the plants, a higher efficiency than previously reported in barley. Notably, there were differences in performance among the five sgRNAs. The induced indels and fragment deletions were transmitted to the T1 generation, and transgene free (sgRNA:cas9 negative genome-edited homozygous ENGase knock outs were identified among the T1 progeny. We have therefore demonstrated that mutant barley lines with a disrupted endogenous ENGase and defined fragment deletions can be produced efficiently using the CRISPR/Cas9 system even when this requires co-transformation with multiple plasmids by bombardment or Agrobacterium-mediated transformation. We confirm the specificity and heritability of the mutations and the ability to efficiently generate homozygous mutant T1 plants.

  19. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene.

    Science.gov (United States)

    Bhagavath, Bala; Layman, Lawrence C; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G; Kim, Hyung-Goo; Carr, Bruce R

    2014-08-05

    46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Directory of Open Access Journals (Sweden)

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  1. Targeted Gene Deletion and In Vivo Analysis of Putative Virulence Gene Function in the Pathogenic Dermatophyte Arthroderma benhamiae▿

    Science.gov (United States)

    Grumbt, Maria; Defaweux, Valérie; Mignon, Bernard; Monod, Michel; Burmester, Anke; Wöstemeyer, Johannes; Staib, Peter

    2011-01-01

    Dermatophytes cause the majority of superficial mycoses in humans and animals. However, little is known about the pathogenicity of this specialized group of filamentous fungi, for which molecular research has been limited thus far. During experimental infection of guinea pigs by the human pathogenic dermatophyte Arthroderma benhamiae, we recently detected the activation of the fungal gene encoding malate synthase AcuE, a key enzyme of the glyoxylate cycle. By the establishment of the first genetic system for A. benhamiae, specific ΔacuE mutants were constructed in a wild-type strain and, in addition, in a derivative in which we inactivated the nonhomologous end-joining pathway by deletion of the A. benhamiae KU70 gene. The absence of AbenKU70 resulted in an increased frequency of the targeted insertion of linear DNA by homologous recombination, without notably altering the monitored in vitro growth abilities of the fungus or its virulence in a guinea pig infection model. Phenotypic analyses of ΔacuE mutants and complemented strains depicted that malate synthase is required for the growth of A. benhamiae on lipids, major constituents of the skin. However, mutant analysis did not reveal a pathogenic role of the A. benhamiae enzyme in guinea pig dermatophytosis or during epidermal invasion of the fungus in an in vitro model of reconstituted human epidermis. The presented efficient system for targeted genetic manipulation in A. benhamiae, paired with the analyzed infection models, will advance the functional characterization of putative virulence determinants in medically important dermatophytes. PMID:21478433

  2. Gene expression profiling of a nisin-sensitive Listeria monocytogenes Scott A ctsR deletion mutant.

    Science.gov (United States)

    Liu, Yanhong; Morgan, Shannon; Ream, Amy; Huang, Lihan

    2013-05-01

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. Nisin is the only bacteriocin that can be used as a food preservative. Due to its antimicrobial activity, it can be used to control L. monocytogenes in food; however, the antimicrobial mechanism of nisin activity against L. monocytogenes is not fully understood. The CtsR (class III stress gene repressor) protein negatively regulates the expression of class III heat shock genes. A spontaneous pressure-tolerant ctsR deletion mutant that showed increased sensitivity to nisin has been identified. Microarray technology was used to monitor the gene expression profiles of the ctsR mutant under treatments with nisin. Compared to the nisin-treated wild type, 113 genes were up-regulated (>2-fold increase) in the ctsR deletion mutant whereas four genes were down-regulated (nisin sensitivity compared to the wild-type strain. This study enhances our understanding of how nisin interacts with the ctsR gene product in L. monocytogenes and may contribute to the understanding of the antibacterial mechanisms of nisin.

  3. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

    Science.gov (United States)

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

    2013-01-01

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

  4. AVAQ 594-597 deletion of the TfR2 gene in a Japanese family with hemochromatosis.

    Science.gov (United States)

    Hattori, Ai; Wakusawa, Shinnya; Hayashi, Hisao; Harashima, Ai; Sanae, Fujiko; Kawanaka, Miwa; Yamada, Gohtaro; Yano, Motoyashi; Yoshioka, Kenntaro

    2003-06-01

    The majority of Caucasian patients with hemochromatosis are homozygous for C282Y mutation of the HFE gene. In contrast to its high prevalence in Caucasians, hemochromatosis is a rare disorder in Japan. This may be due to the low prevalence of the C282Y mutation of the HFE gene in Japanese. Recent reports suggest that the mutations of transferrin receptor 2 (TfR2) gene may be involved in non-HFE hemochromatosis. Therefore, we investigated the TfR2 gene of 6 sporadic and 5 familiar cases of Japanese hemochromatosis. Three siblings in one family were found to be homozygous for an AVAQ 594-597 deletion. All three had severe iron deposits in the hepatocytes and bile ducts, but none was affected by diabetes mellitus. This mutation was not detected in 100 control individuals. Further study was undertaken to investigate whether the large deletion of the TfR2 gene is the mutation responsible for some of the Japanese hemochromatosis cases.

  5. Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

    Science.gov (United States)

    Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

    2017-08-01

    White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

  6. Intragenic deletions affecting two alternative transcripts of the IMMP2L gene in patients with Tourette syndrome

    Science.gov (United States)

    Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars R; Groth, Camilla; Glenthøj, Birte; Rizzo, Renata; Debes, Nanette Mol; Skov, Liselotte; Brøndum-Nielsen, Karen; Paschou, Peristera; Silahtaroglu, Asli; Tümer, Zeynep

    2014-01-01

    Tourette syndrome is a neurodevelopmental disorder characterized by multiple motor and vocal tics, and the disorder is often accompanied by comorbidities such as attention-deficit hyperactivity-disorder and obsessive compulsive disorder. Tourette syndrome has a complex etiology, but the underlying environmental and genetic factors are largely unknown. IMMP2L (inner mitochondrial membrane peptidase, subunit 2) located on chromosome 7q31 is one of the genes suggested as a susceptibility factor in disease pathogenesis. Through screening of a Danish cohort comprising 188 unrelated Tourette syndrome patients for copy number variations, we identified seven patients with intragenic IMMP2L deletions (3.7%), and this frequency was significantly higher (P=0.0447) compared with a Danish control cohort (0.9%). Four of the seven deletions identified did not include any known exons of IMMP2L, but were within intron 3. These deletions were found to affect a shorter IMMP2L mRNA species with two alternative 5′-exons (one including the ATG start codon). We showed that both transcripts (long and short) were expressed in several brain regions, with a particularly high expression in cerebellum and hippocampus. The current findings give further evidence for the role of IMMP2L as a susceptibility factor in Tourette syndrome and suggest that intronic changes in disease susceptibility genes should be investigated further for presence of alternatively spliced exons. PMID:24549057

  7. Inefficient viral replication of bovine leukemia virus induced by spontaneous deletion mutation in the G4 gene.

    Science.gov (United States)

    Murakami, Hironobu; Uchiyama, Jumpei; Nikaido, Sae; Sato, Reiichiro; Sakaguchi, Masahiro; Tsukamoto, Kenji

    2016-10-01

    Enzootic bovine leucosis is caused by bovine leukemia virus (BLV) infection, which is highly prevalent in several regions of the world and significantly impacts the livestock industry. In BLV infection, the proviral load in the blood reflects disease progression. Although the BLV genome is highly conserved among retroviruses, genetic variation has been reported. However, the relationship between proviral load and genetic variation is poorly understood. In this study, we investigated the changes in proviral load in BLV-infected cattle in Japan and then identified and analysed a BLV strain pvAF967 that had a static proviral load. First, examining the proviral load in the aleukaemic cattle in 2014 and 2015, cow AF967 showed a static proviral load, while the other cows showed significant increases in proviral load. Sequencing the provirus in cow AF967 showed a deletion of 12 nt located in the G4 gene. An in vitro assay system using BLV molecular clone was set up to evaluate viral replication and production. In this in vitro assay, the deletion mutation in the G4 gene resulted in a significant decrease in viral replication and production. In addition, we showed that the deletion mutation did not affect the viral transcriptional activity of Tax protein, which is also important for virus replication. The emergence of strain pvAF967 that showed a static proviral load, combined with other retrovirus evolutionary traits, suggests that some BLV strains may have evolved to be symbiotic with cattle.

  8. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Science.gov (United States)

    Baranowska, Izabella; Jäderlund, Karin Hultin; Nennesmo, Inger; Holmqvist, Erik; Heidrich, Nadja; Larsson, Nils-Göran; Andersson, Göran; Wagner, E Gerhart H; Hedhammar, Ake; Wibom, Rolf; Andersson, Leif

    2009-05-01

    Sensory ataxic neuropathy (SAN) is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr) gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt) sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr) had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr) gene is the causative mutation for SAN.

  9. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Directory of Open Access Journals (Sweden)

    Izabella Baranowska

    2009-05-01

    Full Text Available Sensory ataxic neuropathy (SAN is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr gene is the causative mutation for SAN.

  10. Restriction fragment length polymorphism caused by a deletion involving Alu sequences within the human. alpha. sub 2 -plasmin inhibitor gene

    Energy Technology Data Exchange (ETDEWEB)

    Miura, Osamu; Sugahara, Yuichi; Nakamura, Yuichi; Hirosawa, Shinsaku; Aoki, Nobuo (Tokyo Medical and Dental Univ. (Japan))

    1989-06-13

    A restriction fragment length polymorphism within the human {alpha}{sub 2}-plasmin inhibitor gene has been detected by Southern blot hybridization using an {alpha}{sub 2}-plasmin inhibitor cDNA probe. This restriction fragment length polymorphism can be attributed to the presence of two alleles, A and B, that are distributed in Hardy-Weinberg equilibrium with frequencies of 73.5% and 2.65%, respectively, in 66 unrelated Caucasian individuals or with frequencies of 51.0% and 49.0%, respectively, in 50 unrelated Japanese individuals. The minor allele, B, is due to a deletion of about 720 base pairs in intron 8 of the {alpha}{sub 2}-plasmin inhibitor gene. Sequence analysis of the deletion junction in allele B and the corresponding regions of allele A demonstrated the presence of oppositely oriented Alu sequences at the 5{prime} and 3{prime} deletion boundaries. These data suggest that this restriction fragment length polymorphism was caused by intrastrand recombination between Alu sequences.

  11. Effect of deletion and overexpression of tryptophan metabolism genes on growth and fermentation capacity at low temperature in wine yeast.

    Science.gov (United States)

    López-Malo, María; García-Rios, Estefani; Chiva, Rosana; Guillamon, José Manuel; Martí-Raga, María

    2014-01-01

    Low-temperature fermentations produce wines with greater aromatic complexity, but the success of these fermentations greatly depends on the adaptation of yeast cells to cold. Tryptophan has been previously reported to be a limiting amino acid during Saccharomyces cerevisiae growth at low temperature. The objective of this study was to determine the influence of the tryptophan metabolism on growth and fermentation performance during low-temperature wine fermentation. To this end, we constructed the deletion mutants of the TRP1 and TAT2 genes in a derivative haploid of a commercial wine strain, and the TAT2 gene was overexpressed in the prototroph and auxotroph (Δtrp1) backgrounds. Then we characterized growth and fermentation activity during wine fermentation at low and optimum temperatures. Our results partially support the role of this amino acid in cold yeast growth. Although deletion of TRP1 impaired amino acid uptake and the growth rate at low temperature in synthetic must, this growth impairment did not affect the fermentation rate. Deletion of TAT2 endorsed this strain with the highest nitrogen consumption capacity and the greatest fermentation activity at low temperature. Our results also evidenced reduced ammonium consumption in all the strains at low temperature. © 2014 American Institute of Chemical Engineers.

  12. Identification of novel genes involved in DNA damage response by screening a genome-wide Schizosaccharomyces pombe deletion library

    Directory of Open Access Journals (Sweden)

    Pan Xian

    2012-11-01

    Full Text Available Abstract Background DNA damage response (DDR plays pivotal roles in maintaining genome integrity and stability. An effective DDR requires the involvement of hundreds of genes that compose a complicated network. Because DDR is highly conserved in evolution, studies in lower eukaryotes can provide valuable information to elucidate the mechanism in higher organisms. Fission yeast (Schizosaccharomyces pombe has emerged as an excellent model for DDR research in recent years. To identify novel genes involved in DDR, we screened a genome-wide S. pombe haploid deletion library against six different DNA damage reagents. The library covered 90.5% of the nonessential genes of S. pombe. Results We have identified 52 genes that were actively involved in DDR. Among the 52 genes, 20 genes were linked to DDR for the first time. Flow cytometry analysis of the repair defective mutants revealed that most of them exhibited a defect in cell cycle progression, and some caused genome instability. Microarray analysis and genetic complementation assays were carried out to characterize 6 of the novel DDR genes in more detail. Data suggested that SPBC2A9.02 and SPAC27D7.08c were required for efficient DNA replication initiation because they interacted genetically with DNA replication initiation proteins Abp1 and Abp2. In addition, deletion of sgf73+, meu29+, sec65+ or pab1+ caused improper cytokinesis and DNA re-replication, which contributed to the diploidization in the mutants. Conclusions A genome-wide screen of genes involved in DDR emphasized the key role of cell cycle control in the DDR network. Characterization of novel genes identified in the screen helps to elucidate the mechanism of the DDR network and provides valuable clues for understanding genome stability in higher eukaryotes.

  13. Fragile X phenotype in a patient with a large de novo deletion in Xq27-q28

    Energy Technology Data Exchange (ETDEWEB)

    Albright, S.G.; Rao, K.W.; Tennison, M.B.; Aylsworth, A.S. [Univ. of North Carolina, Chapel Hill, NC (United States); Lachiewicz, A.M. [Duke Univ. Medical Center, Durham, NC (United States); Tarleton, J.C.; Schwartz, C.E.; Richie, R. [Greenwood Genetic Center, SC (United States)

    1994-07-15

    A 2-year-old boy with manifestations of the fragile X syndrome was found to have a cytogenetically visible deletion of Xq27-q28 including deletion of FMR-1. Molecular analysis of the patient was recently described in Tarleton et al. and the deletion was estimated to be at least 3 megabases (Mb). His mother had 2 FMR-1 alleles with normal numbers of CGG repeats, 20 and 32, respectively. Thus, the deletion occurred as a de novo event. The patient does not appear to have clinical or laboratory findings other than those typically associated with fragile X syndrome, suggesting that the deletion does not remove other contiguous genes. This report describes the phenotype of the patient, including psychological studies. 23 refs., 3 figs.

  14. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  15. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    Science.gov (United States)

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  16. Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes.

    Science.gov (United States)

    Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M

    2006-07-01

    Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.

  17. Systematic deletion analyses of the fla genes in the flagella operon identify several genes essential for proper assembly and function of flagella in the archaeon, Methanococcus maripaludis.

    Science.gov (United States)

    Chaban, Bonnie; Ng, Sandy Y M; Kanbe, Masaomi; Saltzman, Ilana; Nimmo, Graeme; Aizawa, Shin-Ichi; Jarrell, Ken F

    2007-11-01

    The archaeal flagellum is a unique motility apparatus in the prokaryotic domain, distinct from the bacterial flagellum. Most of the currently recognized archaeal flagella-associated genes fall into a single fla operon that contains the genes for the flagellin proteins (two or more genes designated as flaA or flaB), some variation of a set of conserved proteins of unknown function (flaC, flaD, flaE, flaF, flaG and flaH), an ATPase (flaI) and a membrane protein (flaJ). In addition, the flaD gene has been demonstrated to encode two proteins: a full-length gene product and a truncated product derived from an alternate, internal start site. A systematic deletion approach was taken using the methanogen Methanococcus maripaludis to investigate the requirement and a possible role for these proposed flagella-associated genes. Markerless in-frame deletion strains were created for most of the genes in the M. maripaludis fla operon. In addition, a strain lacking the truncated FlaD protein [FlaD M(191)I] was also created. DNA sequencing and Southern blot analysis confirmed each mutant strain, and the integrity of the remaining operon was confirmed by immunoblot. With the exception of the DeltaFlaB3 and FlaD M(191)I strains, all mutants were non-motile by light microscopy and non-flagellated by electron microscopy. A detailed examination of the DeltaFlaB3 mutant flagella revealed that these structures had no hook region, while the FlaD M(191)I strain appeared identical to wild type. Each deletion strain was complemented, and motility and flagellation was restored. Collectively, these results demonstrate for first time that these fla operon genes are directly involved and critically required for proper archaeal flagella assembly and function.

  18. Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

    Science.gov (United States)

    Negi, Vir S; Devaraju, Panneer; Gulati, Reena

    2015-09-01

    SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian

  19. Genes involved in degradation of para-nitrophenol are differentially arranged in form of non-contiguous gene clusters in Burkholderia sp. strain SJ98.

    Directory of Open Access Journals (Sweden)

    Surendra Vikram

    Full Text Available Biodegradation of para-Nitrophenol (PNP proceeds via two distinct pathways, having 1,2,3-benzenetriol (BT and hydroquinone (HQ as their respective terminal aromatic intermediates. Genes involved in these pathways have already been studied in different PNP degrading bacteria. Burkholderia sp. strain SJ98 degrades PNP via both the pathways. Earlier, we have sequenced and analyzed a ~41 kb fragment from the genomic library of strain SJ98. This DNA fragment was found to harbor all the lower pathway genes; however, genes responsible for the initial transformation of PNP could not be identified within this fragment. Now, we have sequenced and annotated the whole genome of strain SJ98 and found two ORFs (viz., pnpA and pnpB showing maximum identity at amino acid level with p-nitrophenol 4-monooxygenase (PnpM and p-benzoquinone reductase (BqR. Unlike the other PNP gene clusters reported earlier in different bacteria, these two ORFs in SJ98 genome are physically separated from the other genes of PNP degradation pathway. In order to ascertain the identity of ORFs pnpA and pnpB, we have performed in-vitro assays using recombinant proteins heterologously expressed and purified to homogeneity. Purified PnpA was found to be a functional PnpM and transformed PNP into benzoquinone (BQ, while PnpB was found to be a functional BqR which catalyzed the transformation of BQ into hydroquinone (HQ. Noticeably, PnpM from strain SJ98 could also transform a number of PNP analogues. Based on the above observations, we propose that the genes for PNP degradation in strain SJ98 are arranged differentially in form of non-contiguous gene clusters. This is the first report for such arrangement for gene clusters involved in PNP degradation. Therefore, we propose that PNP degradation in strain SJ98 could be an important model system for further studies on differential evolution of PNP degradation functions.

  20. Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene.

    Science.gov (United States)

    Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng

    2015-01-01

    In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. © 2015 by the Association of Clinical Scientists, Inc.

  1. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    Science.gov (United States)

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2. © 2015 International Society for Neurochemistry.

  2. A new insertion/deletion fragment polymorphism of inhibin-α gene associated with follicular cysts in Large White sows.

    Science.gov (United States)

    Li, Wanhong; Chen, Shuxiong; Li, Hongjiao; Liu, Zhuo; Zhao, Yun; Chen, Lu; Zhou, Xu; Li, Chunjing

    2016-05-18

    Ovarian follicular cysts are anovulatory follicular structures that lead to infertility. Hormones play key roles in the formation and persistence of cysts. Inhibins are heterodimeric gonadal glycoprotein hormones that belong to the transforming growth factor-β superfamily. These hormones suppress the secretion of follicle-stimulating hormone. In this report, partial fragment of inhibin-α (INHA) subunit gene of Large White pig was detected from the genomic DNA by polymerase chain reaction. The sequence showed a 283 bp fragment insertion/deletion (I/D) polymorphism in INHA subunit gene. A total of 49 Large White sows with cystic follicles and 152 normal sows were screened for this polymorphism. The relationship of INHA I/D polymorphisms with follicular cysts was investigated. The distribution of I/D was significantly different between cystic and normal sows, thereby suggesting that the INHA subunit gene might be a potential biological marker for breeding programs in pig.

  3. 19-base pair deletion polymorphism of the dihydrofolate reductase (DHFR gene: maternal risk of Down syndrome and folate metabolism

    Directory of Open Access Journals (Sweden)

    Cristiani Cortez Mendes

    Full Text Available CONTEXT AND OBJECTIVE: Polymorphisms in genes involved in folate metabolism may modulate the maternal risk of Down syndrome (DS. This study evaluated the influence of a 19-base pair (bp deletion polymorphism in intron-1 of the dihydrofolate reductase (DHFR gene on the maternal risk of DS, and investigated the association between this polymorphism and variations in the concentrations of serum folate and plasma homocysteine (Hcy and plasma methylmalonic acid (MMA. DESIGN AND SETTING: Analytical cross-sectional study carried out at Faculdade de Medicina de São José do Rio Preto (Famerp. METHODS: 105 mothers of individuals with free trisomy of chromosome 21, and 184 control mothers were evaluated. Molecular analysis on the polymorphism was performed using the polymerase chain reaction (PCR through differences in the sizes of fragments. Folate was quantified by means of chemiluminescence, and Hcy and MMA by means of liquid chromatography and sequential mass spectrometry. RESULTS: There was no difference between the groups in relation to allele and genotype frequencies (P = 0.44; P = 0.69, respectively. The folate, Hcy and MMA concentrations did not differ significantly between the groups, in relation to genotypes (P > 0.05. CONCLUSIONS: The 19-bp deletion polymorphism of DHFR gene was not a maternal risk factor for DS and was not related to variations in the concentrations of serum folate and plasma Hcy and MMA in the study population.

  4. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  5. Effect of deletion of 2,3-butanediol dehydrogenase gene (bdhA) on acetoin production of Bacillus subtilis.

    Science.gov (United States)

    Zhang, Junjiao; Zhao, Xiangying; Zhang, Jiaxiang; Zhao, Chen; Liu, Jianjun; Tian, Yanjun; Yang, Liping

    2017-09-14

    The present work aims to block 2,3-butanediol synthesis in acetoin fermentation of Bacillus subtilis. First, we constructed a recombinant strain BS168D by deleting the 2,3-butanediol dehydrogenase gene bdhA of the B. subtilis168, and there was almost no 2,3-butanediol production in 20 g/L of glucose media. The acetoin yield of BS168D reached 6.61 g/L, which was about 1.5 times higher than that of the control B. subtilis168 (4.47 g/L). Then, when the glucose concentration was increased to 100 g/L, the acetoin yield reached 24.6 g/L, but 2.4 g/L of 2,3-butanediol was detected at the end of fermentation. The analysis of 2,3-butanediol chiral structure indicated that the main 2,3-butanediol production of BS168D was meso-2,3-butanediol, and the bdhA gene was only responsible for (2R,3R)-2,3-butanediol synthesis. Therefore, we speculated that there may exit another pathway relating to the meso-2,3-butanediol synthesis in the B. subtilis. In addition, the results of low oxygen condition fermentation showed that deletion of bdhA gene successfully blocked the reversible transformation between acetoin and 2,3-butanediol and eliminated the effect of dissolved oxygen on the transformation.

  6. Conditional beta1-integrin gene deletion in neural crest cells causes severe developmental alterations of the peripheral nervous system

    DEFF Research Database (Denmark)

    Pietri, Thomas; Eder, Olivier; Breau, Marie Anne

    2004-01-01

    Integrins are transmembrane receptors that are known to interact with the extracellular matrix and to be required for migration, proliferation, differentiation and apoptosis. We have generated mice with a neural crest cell-specific deletion of the beta1-integrin gene to analyse the role of beta1-....... There was an almost complete absence of Schwann cells and sensory axon segregation and defective maturation in neuromuscular synaptogenesis. Thus, beta1-integrins are important for the control of embryonic and postnatal peripheral nervous system development....

  7. Deletion mutation in Drosophila ma-l homologous, putative molybdopterin cofactor sulfurase gene is associated with bovine xanthinuria type II.

    Science.gov (United States)

    Watanabe, T; Ihara, N; Itoh, T; Fujita, T; Sugimoto, Y

    2000-07-21

    Defective xanthine dehydrogenase (XDH) activity in humans results in xanthinuria and xanthine calculus accumulation in kidneys. Bovine xanthinuria was demonstrated in a local herd and characterized as xanthinuria type II, similar to the Drosophila ma-l mutations, which lose activities of molybdoenzymes, XDH, and aldehyde oxidase, although sulfite oxidase activity is preserved. Linkage analysis located the disease locus at the centromeric region of bovine chromosome 24, where a ma-l homologous, putative molybdopterin cofactor sulfurase gene (MCSU) has been physically mapped. We found that a deletion mutation at tyrosine 257 in MCSU is tightly associated with bovine xanthinuria type II.

  8. Large novel deletions detected in Chinese families with aniridia: correlation between genotype and phenotype.

    Science.gov (United States)

    Zhang, Xiaohui; Zhang, Qingsheng; Tong, Yi; Dai, Hanjun; Zhao, Xin; Bai, Fengge; Xu, Liang; Li, Yang

    2011-02-19

    To describe the clinical and genetic findings in two Chinese families with aniridia and other ocular abnormalities. Two unrelated families were examined clinically. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. Mutation screening of all exons of the PAX6 (paired box gene 6) gene was performed by direct sequencing of PCR-amplified DNA fragments. Multiplex ligation-dependent probe amplification (MLPA) was performed to detect large deletions. Linkage analysis was used to validate the large deletions revealed by MLPA in all available family members. Clinical examination and pedigree analysis revealed one four-generation family (85) and one three- generation family (86) with total aniridia, congenital cataracts, foveal hypoplasia, and glaucoma. No mutation in PAX6 was identified after PCR-sequencing. Through MLPA analysis, a large deletion including the whole PAX6 gene, DKFZp686k1684 (hypothetical LOC440034), and the RCN1 (reticulocalbin 1) gene was detected in family 85; a 3' deletion to the PAX6 gene including the ELP4 (elongator complex protein 4) and the DCDC1 (doublecortin domain containing 1) gene was identified in family 86.The two large deletions were confirmed with linkage analysis and the "loss of heterozygous" in the different PAX6 regions were co-segregated with the phenotype of the two families, respectively. Patients with the PAX6 contiguous gene deletion, including the RCN1 gene, presented more severe vision impairments than those carrying the PAX6 3' deletion. Large deletions may account for several Chinese families and sporadic cases with aniridia and screening for these kinds of alterations should be included in aniridia patients' analyses.

  9. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector

    Directory of Open Access Journals (Sweden)

    Giridhar Murlidharan

    2016-01-01

    Full Text Available Gene therapy using recombinant adeno-associated viral (AAV vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9, which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137 in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities.

  10. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector.

    Science.gov (United States)

    Murlidharan, Giridhar; Sakamoto, Kensuke; Rao, Lavanya; Corriher, Travis; Wang, Dan; Gao, Guangping; Sullivan, Patrick; Asokan, Aravind

    2016-07-19

    Gene therapy using recombinant adeno-associated viral (AAV) vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9), which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137) in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities.

  11. Novel intragenic deletions within the UBE3A gene in two unrelated patients with Angelman syndrome: case report and review of the literature.

    Science.gov (United States)

    Aguilera, Cinthia; Viñas-Jornet, Marina; Baena, Neus; Gabau, Elisabeth; Fernández, Concepción; Capdevila, Nuria; Cirkovic, Sanja; Sarajlija, Adrijan; Miskovic, Marijana; Radivojevic, Danijela; Ruiz, Anna; Guitart, Miriam

    2017-11-21

    Patients with Angelman syndrome (AS) are affected by severe intellectual disability with absence of speech, distinctive dysmorphic craniofacial features, ataxia and a characteristic behavioral phenotype. AS is caused by the lack of expression in neurons of the UBE3A gene, which is located in the 15q11.2-q13 imprinted region. Functional loss of UBE3A is due to 15q11.2-q13 deletion, mutations in the UBE3A gene, paternal uniparental disomy and genomic imprinting defects. We report here two patients with clinical features of AS referred to our hospital for clinical follow-up and genetic diagnosis. Methylation Specific-Multiplex Ligation-Dependent Probe Amplification (MS-MLPA) of the 15q11.2-q13 region was carried out in our laboratory as the first diagnostic tool detecting two novel UBE3A intragenic deletions. Subsequently, the MLPA P336-A2 kit was used to confirm and determine the size of the UBE3A deletion in the two patients. A review of the clinical features of previously reported patients with whole UBE3A gene or partial intragenic deletions is presented here together with these two new patients. Although rare, UBE3A intragenic deletions may represent a small fraction of AS patients without a genetic diagnosis. Testing for UBE3A intragenic exonic deletions should be performed in those AS patients with a normal methylation pattern and no mutations in the UBE3A gene.

  12. Temporal control of gene deletion in sensory ganglia using a tamoxifen-inducible Advillin-Cre-ERT2 recombinase mouse

    Directory of Open Access Journals (Sweden)

    Lau Joanne

    2011-12-01

    Full Text Available Abstract Background Tissue-specific gene deletion has proved informative in the analysis of pain pathways. Advillin has been shown to be a pan-neuronal marker of spinal and cranial sensory ganglia. We generated BAC transgenic mice using the Advillin promoter to drive a tamoxifen-inducible CreERT2 recombinase construct in order to be able to delete genes in adult animals. We used a floxed stop ROSA26LacZ reporter mouse to examine functional Cre expression, and analysed the behaviour of mice expressing Cre recombinase. Results We used recombineering to introduce a CreERT2 cassette in place of exon 2 of the Advillin gene into a BAC clone (RPCI23-424F19 containing the 5' region of the Advillin gene. Transgenic mice were generated using pronuclear injection. The resulting AvCreERT2 transgenic mice showed a highly specific expression pattern of Cre activity after tamoxifen induction. Recombinase activity was confined to sensory neurons and no expression was found in other organs. Less than 1% of neurons showed Cre expression in the absence of tamoxifen treatment. Five-day intraperitoneal treatment with tamoxifen (2 mg per day induced Cre recombination events in ≈90% of neurons in dorsal root and cranial ganglia. Cell counts of dorsal root ganglia (DRG from transgenic animals with or without tamoxifen treatment showed no neuronal cell loss. Sensory neurons in culture showed ≈70% induction after 3 days treatment with tamoxifen. Behavioural tests showed no differences between wildtype, AvCreERT2 and tamoxifen-treated animals in terms of motor function, responses to light touch and noxious pressure, thermal thresholds as well as responses to inflammatory agents. Conclusions Our results suggest that the inducible pan-DRG AvCreERT2 deleter mouse strain is a useful tool for studying the role of individual genes in adult sensory neuron function. The pain phenotype of the Cre-induced animal is normal; therefore any alterations in pain processing can be

  13. A de novo deletion in X 27-28 spans at least 3 megabases and results in fragile X syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Lachiewicz, A.; Rao, K.; Aylsworth, A.; Richie, R.; Schwartz, C.; Tarleton, J. [Duke Univ. Medical Center, Durham, NC (United States)]|[Univ. of North Carolina, Chapel Hill, NC (United States)]|[Greenwood Genetic Center, NC (United States)

    1994-07-15

    A 2-year-old boy with Martin-Bell syndrome was referred for molecular testing and found to have a large deletion of FMRI. His mother was found to have two FMR-1 alleles in the normal range for CGG repeats. DNA probes located both proximal and distal to FRAXA were used to delineate the approximation location of the deletion endpoints. Proximal to the fragile site, DXS312 (pX135) was absent but DXS98 (4D8) was present. Distal to the fragile site, DXS296 (VK21) was absent but DXS304 (U6.2) was present. Our patient does not appear to have clinical findings other than those typically associated with fragile X syndrome suggesting that the deletion does not remove other contiguous genes, e.g., IDS. The deletion in this patient is larger than the patient reported by Gedeon et al., in whom approximately 2.5 megabases were estimated to be deleted. Using the physical map of Schlessinger et al., the physical extent of the deletion can be estimated to be at least 3 megabases. This patient may be useful in physical mapping of the chromosomal region near FMR-1. Continued long-term evaluation of this patient may uncover clinical findings suggestive that the deletion removes other genes near to FMR-1 or, alternatively, no findings atypical of the fragile X syndrome suggesting that no other genes lie in the deletion interval.

  14. The analysis of mutations and exon deletions at TSC2 gene in angiomyolipomas associated with tuberous sclerosis complex.

    Science.gov (United States)

    Yang, Heung-Mo; Choi, Hye-Jung; Hong, Doo-Pyo; Joo, Sung-Yeon; Lee, Na-Eun; Song, Ji-Young; Choi, Yoon-La; Lee, Jeeyun; Choi, Dongil; Kim, BoKyung; Park, Hyo-Jun; Park, Jae-Berm; Kim, Sung Joo

    2014-12-01

    Angiomyolipomas (AMLs) are relatively rare hamartomatous or benign tumors that occasionally occur as part of tuberous sclerosis complex (TSC). Mutations in either of the two genes, TSC1 and TSC2, have been attributed to the development of TSC. Between 1994 and January 2009, 83 patients were diagnosed with AML at the Samsung Medical Center. In that group of patients, 5 (6%) had AML with TSC (AML-TSC). Mutational analysis of the TSC2 gene was performed using 7 samples from the 5 AML-TSC patients and 14 samples from 14 patients with sporadic AML without TSC (AML-non-TSC). From this analysis, mutations in TSC genes were identified in 5 samples from the AML-TSC patients (mutation detection rate=71%) and 3 samples from AML-non-TSC patients (mutation detection rate=21%). In the case of AML-TSC, 6 mutations were found including 3 recurrent mutations and 3 novel mutations, while in the case of AML-non-TSC, 4 mutations were identified once, including 1 novel mutation. Also MLPA analysis of the TSC2 gene showed that TSC2 exon deletion is more frequently observed in AML-TSC patients than in AML-non-TSC patients. This is the first mutation and multiplex ligation-dependent probe amplification (MLPA) analyses of TSC2 in Korean AMLs that focus on TSC. This study provides data that are representative of the distribution of mutations and exon deletions at TSC genes in clinically diagnosed AML-TSC cases of the Korean population. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. The effect of deletion of the orphan G – protein coupled receptor (GPCR gene MrgE on pain-like behaviours in mice

    Directory of Open Access Journals (Sweden)

    Qin Wenning

    2008-01-01

    Full Text Available Abstract Background The orphan GPCR MrgE is one of an extended family of GPCRs that are expressed in dorsal root ganglia (DRG. Based on these expression patterns it has been suggested that GPCRs like MrgE may play a role in nociception however, to date, no direct supporting evidence has emerged. We generated mutant mice lacking MrgE and examined the effects of deletion of this gene in three pain behavioural models. The effect of MrgE gene deletion on expression of Mrgs and genes involved in sensory neurone function was also investigated. Results The absence of MrgE had no effect on the development of pain responses to a noxious chemical stimulus or an acute thermal stimulus. However, in contrast, the development but not the maintenance of neuropathic pain was affected by deletion of MrgE. The expression of Mrg genes was not significantly affected in the MrgE knockout (KO mice with the sole exception of MrgF. In addition, the expression of 77 of 84 genes involved in sensory neuron development and function was also unaffected by deletion of MrgE. Of the 7 genes affected by MrgE deletion, 4 have previously been implicated in nociception. Conclusion The data suggests that MrgE may play a role in selective pain behavioural responses in mice.

  16. Screening Duchenne and Becker muscular dystrophy patients for deletions in 30 exons of the dystrophin gene by three-multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Risch, N. (Yale Univ., New Haven, CT (United States))

    1992-09-01

    Deletion mutations of the dystrophin gene may cause either the severe Duchenne muscular dystrophy (DMD) or the milder, allelic Becker muscular dystrophy (BMD) and are clustered in two high-frequency-deletion regions (HFDRs) located, respectively, 500 kb and 1,200 kb downstream from the 5[prime] end of the gene. Three PCR reactions described allowed the analysis of a total of 30 exons and led, to the identification of three additional deletions involving the following exons: (a) 42 only, (b) 28-42, and (c) 16 only, none of which were detected with the two original multiplex reactions. Therefore, the three modified multiplexes detected 95 of the 96 deletions identified among the 152 patients studied so far by using Southern analysis and cDNA probes. The only deletion that remained undetected with this system involves exons 22-25 and generates the junction fragment described elsewhere. The percentage of deletion mutations among DMS/BMD patients amounts to 63%, which is in agreement with similar estimates from other laboratories. When field-inversion gel electrophoresis is coupled to Southern analysis, the detection rate of deletion and duplication mutations reaches 65%.

  17. The PML gene is linked to a megabase-scale insertion/deletion restriction fragment length polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Goy, A.; Xiao, Y.H.; Passalaris, T. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1995-03-20

    The PML gene located on chromosome band 15q22 is involved with the RAR{alpha} locus (17q21) in a balanced reciprocal translocation uniquely observed in acute promyelocytic leukemia. Physical mapping studies by pulsed-field gel electrophoresis revealed that the PML gene is flanked by two CpG islands that are separated by a variable distance in normal individuals. Several lines of evidence demonstrate that this is the consequence of a large insertion/deletion polymorphism linked to the PML locus: (1) overlapping fragments obtained with a variety of rare-cutting restriction enzymes demonstrated the same variability in distance between the flanking CpG islands; (2) mapping with restriction enzymes insensitive to CpG methylation confirmed that the findings were not a consequence of variable methylation of CpG dinucleotides; (3) the polymorphism followed a Mendelian inheritance pattern. This polymorphism is localized 3{prime} to the PML locus. There are five common alleles, described on the basis of BssHII fragments, ranging from 220 to 350 kb with increments of approximately 30 kb between alleles. Both heterozygous (61%) and homozygous (391%) patterns were observed in normal individuals. Mega-base-scale insertion/deletion restriction fragment length polymorphisms are very rare and have been described initially in the context of multigene families. Such structures have been also reported as likely regions of genetic instability. High-resolution restriction mapping of this particular structure linked to the PML locus is underway. 47 refs., 4 figs., 1 tab.

  18. Deletion of ldhA and aldH genes in Klebsiella pneumoniae to enhance 1,3-propanediol production.

    Science.gov (United States)

    Chen, Lifei; Ma, Chunling; Wang, Ruiming; Yang, Jianlou; Zheng, Haijie

    2016-10-01

    To improve 1,3-propanediol (1,3-PD) production and reduce byproduct concentration during the fermentation of Klebsiella pneumonia. Klebsiella. pneumonia 2-1ΔldhA, K. pneumonia 2-1ΔaldH and K. pneumonia 2-1ΔldhAΔaldH mutant strains were obtained through deletion of the ldhA gene encoding lactate dehydrogenase required for lactate synthesis and the aldH gene encoding acetaldehyde dehydrogenase involved in the synthesis of ethanol. After fed-batch fermentation, the production of 1,3-PD from glycerol was enhanced and the concentrations of byproducts were reduced compared with the original strain K. pneumonia 2-1. The maximum yields of 1,3-PD were 85.7, 82.5 and 87.5 g/l in the respective mutant strains. Deletion of either aldH or ldhA promoted 1,3-PD production in K. pneumonia.

  19. Copy-number variation genotyping of GSTT1 and GSTM1 gene deletions by real-time PCR.

    Science.gov (United States)

    Rose-Zerilli, Matthew J; Barton, Sheila J; Henderson, A John; Shaheen, Seif O; Holloway, John W

    2009-09-01

    Structural variation in the human genome is increasingly recognized as being highly prevalent and having relevance to common human diseases. Array-based comparative genome-hybridization technology can be used to determine copy-number variation (CNV) across entire genomes, and quantitative PCR (qPCR) can be used to validate de novo variation or assays of common CNV in disease-association studies. Analysis of large qPCR data sets can be complicated and time-consuming, however. We describe qPCR assays for GSTM1 (glutathione S-transferase mu 1) and GSTT1 (glutathione S-transferase theta 1) gene deletions that can genotype up to 192 samples in duplicate 5-microL reaction volumes in macro-driven Microsoft Excel(R) spreadsheet. As proof of principle, we used our software to analyze CNV data for 1478 DNA samples from a family-based cohort. With only 8 ng of DNA template, we assigned CNV genotypes (i.e., 2, 1, or 0 copies) to either 96% (GSTM1) or 91% (GSTT1) of all DNA samples in a single round of PCR amplification. Genotyping accuracy, as ascertained by familial inheritance, was >99.5%, and independent genotype assignments with replicate real-time PCR runs were 100% concordant. The genotyping assay for GSTM1 and GSTT1 gene deletion is suitable for large genetic epidemiologic studies and is a highly effective analysis system that is readily adaptable to analysis of other CNVs. .

  20. Emergence of Multiple Human Cytomegalovirus Ganciclovir-Resistant Mutants with Deletions and Substitutions within the UL97 Gene in a Patient with Severe Combined Immunodeficiency

    Science.gov (United States)

    Wolf, Dana G.; Yaniv, Isaac; Ashkenazi, Shai; Honigman, Alik

    2001-01-01

    Infection with multiple ganciclovir-resistant human cytomegalovirus mutants, containing different substitutions and deletions in the UL97 gene, was found in a patient with severe combined immunodeficiency (SCID) within 3 weeks of ganciclovir therapy. A novel 11-codon deletion at positions 590 to 600 was identified. These unique findings may be related to the nature of the immunodeficiency in the SCID patient. PMID:11158760

  1. Analysis of mice with targeted deletion of AQP9 gene provides conclusive evidence for expression of AQP9 in neurons

    DEFF Research Database (Denmark)

    Mylonakou, Maria N; Petersen, Petur H; Rinvik, Eric

    2009-01-01

    and mouse liver, the organ with the highest level of AQP9. By blue native gel analysis it could be demonstrated that the brain contains tetrameric AQP9, corresponding to the functional form of AQP9. The band corresponding to the AQP9 tetramer was absent in AQP9 knockout brain and liver. Immunocytochemistry...... gene expression in brain, based on a quantitative and multipronged approach that includes the use of animals with targeted deletion of the AQP9 gene. We show by real-time PCR that AQP9 mRNA concentration in rat and mouse brain is approximately 3% and approximately 0.5%, respectively, of that in rat....... The present data provide conclusive evidence for the presence of tetrameric AQP9 in brain and for the expression of AQP9 in neurons....

  2. Frequent intragenic deletion of the P gene in Tanzanian patients with Type II oculocutaneous albinism (OCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.; Fukai, K.; Holmes, S.A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-06-01

    Type II oculocutaneous albinism (OCA2) is an autosomal recessive disorder in which the biosynthesis of melanin pigment is reduced in the skin, hair, and eyes. OCA2, which results from mutations of the P gene, is the most frequent type of albinism in African and African-American patients. OCA2 is especially frequent in Tanzania, where it occurs with an incidence of {approximately}1/1,400. We have identified abnormalities of the P gene in each of 13 unrelated patients with OCA2 from Tanzania. One of these, a deletion of exon 7, is strongly predominant, accounting for {approximately}77% of mutant alleles in this group of patients. 20 refs., 2 figs.

  3. A novel and de novo deletion in the OCRL1 gene associated with a severe form of Lowe syndrome.

    Science.gov (United States)

    Peces, Ramón; Peces, Carlos; de Sousa, Erika; Vega, Cristina; Selgas, Rafael; Nevado, Julián

    2013-12-01

    The oculocerebrorenal syndrome of Lowe (OCRL) is an X-linked disorder. The mutation of the gene OCRL1 localized at Xq26.1, coding for the enzyme phosphatidylinositol (4,5) bisphosphate (PIP2P) 5-phosphatase, is responsible for the phenotypic characteristics of the disease. We report a 22-year-old male with a severe form of OCRL syndrome, diagnosed on the basis of congenital cataracts, severe psychomotor and cognitive deficits, and renal tubular dysfunction without Fanconi syndrome. The patient presented low molecular weight proteinuria, nephrocalcinosis, nephrolithiasis, rickets, and growth retardation and developed progressive renal failure. Genetic analysis showed a novel and de novo deletion of exons 10-13 in the OCRL1 gene.

  4. Characterization of Escherichia coli strains with gapA and gapB genes deleted.

    Science.gov (United States)

    Seta, F D; Boschi-Muller, S; Vignais, M L; Branlant, G

    1997-08-01

    We obtained a series of Escherichia coli strains in which gapA, gapB, or both had been deleted. Delta gapA strains do not revert on glucose, while delta gapB strains grow on glycerol or glucose. We showed that gapB-encoded protein is expressed but at a very low level. Together, these results confirm the essential role for gapA in glycolysis and show that gapB is dispensable for both glycolysis and the pyridoxal biosynthesis pathway.

  5. Characterization of Escherichia coli strains with gapA and gapB genes deleted.

    OpenAIRE

    Seta, F D; Boschi-Muller, S; Vignais, M L; Branlant, G

    1997-01-01

    We obtained a series of Escherichia coli strains in which gapA, gapB, or both had been deleted. Delta gapA strains do not revert on glucose, while delta gapB strains grow on glycerol or glucose. We showed that gapB-encoded protein is expressed but at a very low level. Together, these results confirm the essential role for gapA in glycolysis and show that gapB is dispensable for both glycolysis and the pyridoxal biosynthesis pathway.

  6. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice.

    Directory of Open Access Journals (Sweden)

    Carlos A Santiviago

    2009-07-01

    Full Text Available Pools of mutants of minimal complexity but maximal coverage of genes of interest facilitate screening for genes under selection in a particular environment. We constructed individual deletion mutants in 1,023 Salmonella enterica serovar Typhimurium genes, including almost all genes found in Salmonella but not in related genera. All mutations were confirmed simultaneously using a novel amplification strategy to produce labeled RNA from a T7 RNA polymerase promoter, introduced during the construction of each mutant, followed by hybridization of this labeled RNA to a Typhimurium genome tiling array. To demonstrate the ability to identify fitness phenotypes using our pool of mutants, the pool was subjected to selection by intraperitoneal injection into BALB/c mice and subsequent recovery from spleens. Changes in the representation of each mutant were monitored using T7 transcripts hybridized to a novel inexpensive minimal microarray. Among the top 120 statistically significant spleen colonization phenotypes, more than 40 were mutations in genes with no previously known role in this model. Fifteen phenotypes were tested using individual mutants in competitive assays of intraperitoneal infection in mice and eleven were confirmed, including the first two examples of attenuation for sRNA mutants in Salmonella. We refer to the method as Array-based analysis of cistrons under selection (ABACUS.

  7. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.

    Science.gov (United States)

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc

    2015-01-01

    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Analysis of the STS gene in 40 patients with recessive X-linked ichthyosis: a high frequency of partial deletions in a Spanish population.

    Science.gov (United States)

    Cañueto, J; Ciria, S; Hernández-Martín, A; Unamuno, P; González-Sarmiento, R

    2010-10-01

    Recessive X-linked ichthyosis (RXLI) (OMIM 308100) is a genodermatosis characterized by polygonal, dark, adherent and mild-to-moderate scales that normally improve during summer. RXLI is caused by a deficiency in steroid sulphatase (STS), whose gene has been located on the X chromosome (locus Xp22.3). Up to 90% of the mutations described in this gene are complete deletions. Previous reports of partial deletion of STS gene in cases of RXLI prompted us to determine the incidence of these abnormalities in a Spanish population. We have studied exons 1, 5 and 10 of the STS gene by polymerase chain reaction in 40 patients with clinical features of RXLI. Our results revealed that 30 patients presented complete deletions (75%) while 10 patients had partial deletions (25%) a rate higher than that reported in the previous studies. Amplification of exons 1, 5 and 10 is reliable in screening RXLI in the population studied here. No correlation was found between phenotype and the extent of the deletions.

  9. Unmarked gene deletion and host-vector system for the hyperthermophilic crenarchaeon Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Deng, Ling; Zhu, Haojun; Chen, Zhengjun

    2009-01-01

    , and unmarked lacS mutants were obtained by each method. A new alternative recombination mechanism, i.e., marker circularization and integration, was shown to operate in the latter method, which did not yield the designed deletion mutation. Subsequently, Sulfolobus-E. coli plasmid shuttle vectors were...... constructed, which genetically complemented DeltapyrEFDeltalacS mutation after transformation. Thus, a complete set of genetic tools was established for S. islandicus with pyrEF and lacS as genetic markers.......Sulfolobus islandicus is being used as a model for studying archaeal biology, geo-biology and evolution. However, no genetic system is available for this organism. To produce an S. islandicus mutant suitable for genetic analyses, we screened for colonies with a spontaneous pyrEF mutation. One...

  10. Identification of the first deletion-insertion involving the complete structure of GAA gene and part of CCDC40 gene mediated by an Alu element.

    Science.gov (United States)

    Amiñoso, Cinthia; Vallespin, Elena; Fernández, Luís; Arrabal, Luisa F; Desviat, Lourdes R; Pérez, Belen; Santos, Fernando; Solera, Jesús

    2013-04-25

    Pompe disease is an uncommon autosomal recessive glycogen storage disorder caused by deficiency of acid α-glucosidase. Classic infantile form triggers severe cardiomyopathy, hypotonia, and respiratory failure, leading to death within the first two years of life. The majority of patients with Pompe disease have been reported to have point mutations in the GAA gene. We report the first complex deletion-insertion encompassing the complete structure of GAA gene and a large fragment of the gene CCDC40 in a patient with very severe form of Pompe disease. Sequencing analysis of breakpoints allowed us to determine the potential implication of an Alu repeat in the pathogenic mechanism. We suggest that molecular strategy of Pompe disease should include systematic analysis of large rearrangements. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Deletion of the Telomerase Reverse Transcriptase Gene and Haploinsufficiency of Telomere Maintenance in Cri du Chat Syndrome

    Science.gov (United States)

    Zhang, Anju; Zheng, Chengyun; Hou, Mi; Lindvall, Charlotta; Li, Ke-Jun; Erlandsson, Fredrik; Björkholm, Magnus; Gruber, Astrid; Blennow, Elisabeth; Xu, Dawei

    2003-01-01

    Cri du chat syndrome (CdCS) results from loss of the distal portion of chromosome 5p, where the telomerase reverse transcriptase (hTERT) gene is localized (5p15.33). hTERT is the rate-limiting component for telomerase activity that is essential for telomere-length maintenance and sustained cell proliferation. Here, we show that a concomitant deletion of the hTERT allele occurs in all 10 patients with CdCS whom we examined. Induction of hTERT mRNA in proliferating lymphocytes derived from five of seven patients was lower than that in unaffected control individuals (P<.05). The patient lymphocytes exhibited shorter telomeres than age-matched unaffected individuals (P<.0001). A reduction in replicative life span and a high rate of chromosome fusions were observed in cultured patient fibroblasts. Reconstitution of telomerase activity by ectopic expression of hTERT extended the telomere length, increased the population doublings, and prevented the end-to-end fusion of chromosomes. We conclude that hTERT is limiting and haploinsufficient for telomere maintenance in humans in vivo. Accordingly, the hTERT deletion may be one genetic element contributing to the phenotypic changes in CdCS. PMID:12629597

  12. A new deletion in 5'-end of dystrophin gene removing M and P promoters and dystrophin muscle enhancers.

    Science.gov (United States)

    Cau, Milena; Boccone, Loredana; Mateddu, Anna; Addis, Maria; Serrenti, Marianna; Chessa, Roberta; Marrosu, Gianni; Loudianos, Georgios; Melis, Maria Antonietta

    2012-12-15

    We describe a 3-year-old boy who, at age of 8 months, during investigations for upper respiratory tract infection was found to have an incidental grossly elevated CK of 20,000 UI/l. Investigations showed only mild calf hypertrophy and absent Gower's sign, normal cognitive function. Electromyography (EMG) showed myopathic features. Electrocardiography and echocardiography were normal. His muscle biopsy revealed myopathic features indicating Duchenne-type dystrophy. Immunohistochemistry for dystrophin N-terminal, C-terminal and mid-rod antibodies analysis showed the complete absence of dystrophin in the muscle fibers. Genetic studies showed a 141.1 Kb deletion removing muscle promoter, muscle exon 1, Purkinje promoter, Purkinje exon 1, dystrophin muscle enhancers similar to one previously reported in a DMD patient who exhibited some residual expression of dystrophin. The difference in dystrophin expression between these two patients might be due to the extension of deletions. The precise delimitation of the macrodeletion here described provides a better understanding of functional organization of the 5' end of the DMD gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Lack of association between intact/deletion polymorphisms of the APOBEC3B gene and HIV-1 risk.

    Directory of Open Access Journals (Sweden)

    Mayumi Imahashi

    Full Text Available The human APOBEC3 family of proteins potently restricts HIV-1 replication APOBEC3B, one of the family genes, is frequently deleted in human populations. Two previous studies reached inconsistent conclusions regarding the effects of APOBEC3B loss on HIV-1 acquisition and pathogenesis. Therefore, it was necessary to verify the effects of APOBEC3B on HIV-1 infection in vivo.Intact (I and deletion (D polymorphisms of APOBEC3B were analyzed using PCR. The syphilis, HBV and HCV infection rates, as well as CD4(+ T cell counts and viral loads were compared among three APOBEC3B genotype groups (I/I, D/I, and D/D. HIV-1 replication kinetics was assayed in vitro using primary cells derived from PBMCs.A total of 248 HIV-1-infected Japanese men who have sex with men (MSM patients and 207 uninfected Japanese MSM were enrolled in this study. The genotype analysis revealed no significant differences between the APOBEC3B genotype ratios of the infected and the uninfected cohorts (p = 0.66. In addition, HIV-1 disease progression parameters were not associated with the APOBEC3B genotype. Furthermore, the PBMCs from D/D and I/I subjects exhibited comparable HIV-1 susceptibility.Our analysis of a population-based matched cohort suggests that the antiviral mechanism of APOBEC3B plays only a negligible role in eliminating HIV-1 in vivo.

  14. Macrophage inhibitory cytokine-1 (MIC-1/GDF15 gene deletion promotes cancer growth in TRAMP prostate cancer prone mice.

    Directory of Open Access Journals (Sweden)

    Yasmin Husaini

    Full Text Available The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15, is overexpressed by most cancers, including prostate cancer (PCa. Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-. On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+. Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1 had metastases than TRAMPMIC+/+ mice (p<0.0001. We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread.

  15. The effect of waaL genes deletion from Yersinia enterocolitica O:3 genome on bacteria LPS’ phenotype

    Directory of Open Access Journals (Sweden)

    Shevchenko J. I.

    2014-11-01

    Full Text Available Aim. To estimate WaaL ligase contribution in the lipopolysaccharide (LPS phenotype profile formation of Y. enterocolitica O:3 (YeO3 bacteria. Methods. The waaL-knock-out mutants were created by an allelic exchange strategy. The LPS phenotypes of created mutants were visualized by silver-stained DOC-PAGE and immunoblotting with specific outer core (core oligosaccharide, hexasaccharide, OC and O-polysaccharide (OPS or O-Ag monoclonal antibodies. Results. Deletion of waaLOS gene from YeO3 genome has a marked effect on OC ligation in either single or double mutants. The waaLPS deletion has an opposite effect on the OPS ligation – barely detected increasing of OPS bands. Conclusions. The LPS ligases of YeO3 exhibit relaxed donor substrate specificity. Under given conditions the effect of WaaLOS ligase is more significant for OC and OPS ligation onto lipid A than that of WaaLPS.

  16. Identification of sites of STAT3 action in the female reproductive tract through conditional gene deletion.

    Directory of Open Access Journals (Sweden)

    Rebecca L Robker

    Full Text Available The STAT3 transcription factor is a pleiotropic transducer of signalling by hormones, growth factors and cytokines that has been identified in the female reproductive tract from oocytes and granulosa cells of the ovary to uterine epithelial and stromal cells. In the present study we used transgenic models to investigate the importance of STAT3 for reproductive performance in these different tissues. The Cre-LoxP system was used to delete STAT3 in oocytes by crossing Stat3fl/fl with Zp3-cre+ mice, or in ovarian granulosa cells and uterine stroma by crossing with Amhr2-Cre+ mice. Surprisingly, deletion of STAT3 in oocytes had no effect on fertility indicating that the abundance of STAT3 protein in maturing oocytes and fertilized zygotes is not essential to these developmental stages. In Stat3fl/fl;Amhr2-cre+ females impaired fertility was observed through significantly fewer litters and smaller litter size. Ovulation rate, oocyte fertilization and development to blastocyst were unaffected in this line; however, poor recombination efficiency in granulosa cells had yielded no net change in STAT3 protein abundance. In contrast, uteri from these mice showed STAT3 protein depletion selectively from the stomal compartment. A significant reduction in number of viable fetuses on gestational day 18, increased fetal resorptions and disrupted placental morphology were evident causes of the reduced fertility. In conclusion, this study defines an important role for STAT3 in uterine stromal cells during embryo implantation and the development of a functional placenta.

  17. High association of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism with recurrent aphthous stomatitis.

    Science.gov (United States)

    Karakus, Nevin; Yigit, Serbulent; Kalkan, Goknur; Sezer, Saime

    2013-08-01

    Recurrent aphthous stomatitis (RAS) is a common ulcerative disease of the oral mucosa. Oral ulcers are also the most common feature of Behçet's disease (BD). Association of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism with BD has been reported in Turkish population. The aim of the present study was to investigate the possible association between ACE gene I/D polymorphism and RAS, and evaluate if there was an association with clinical features in a relatively large cohort of Turkish patients. The study included 198 patients affected by RAS and 214 healthy controls. ACE gene I/D polymorphism genotypes were determined using polymerase chain reaction with I and D allele-specific primers. The genotype and allele frequencies of I/D polymorphism showed statistically significant differences between RAS patients and controls (p < 0.0001 and p < 0.0001, respectively). After stratifying RAS patients according to clinical and demographical characteristics, no significant association was observed. In conclusion, the results of this study suggest that I/D polymorphism of the ACE gene was positively associated with predisposition to develop RAS in Turkish population. Further studies with larger populations are recommended.

  18. Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo.

    Directory of Open Access Journals (Sweden)

    Raymond L Fields

    Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.

  19. Homologous expression of aspartokinase (ask) gene in Streptomyces clavuligerus and its hom-deleted mutant: effects on cephamycin C production.

    Science.gov (United States)

    Özcengiz, Gülay; Okay, Sezer; Ünsaldı, Eser; Taşkın, Bilgin; Liras, Paloma; Piret, Jacqueline

    2010-01-01

    In this study, the effect of homologous multiple copies of the ask gene, which encodes aspartokinase catalyzing the first step of the aspartate pathway, on cephamycin C biosynthesis in S. clavuligerus NRRL 3585 and its hom mutant was investigated. The intracellular pool levels of aspartate pathway amino acids accorded well with the Ask activity levels in TB3585 and AK39. When compared with the control strain carrying vector alone without any gene insert, amplification of the ask gene in the wild strain resulted in a maximum of 3.1- and 3.3-fold increase in specific, 1.7- and 1.9-fold increase in volumetric cephamycin C production when grown in trypticase soy broth (TSB) and a modified chemically defined medium (mCDM), respectively. However, expression of multicopy ask gene in a hom-deleted background significantly decreased cephamycin C yields when the cells were grown in either TSB or mCDM, most probably due to physiological disturbance resulting from enzyme overexpression and high copy number plasmid burden in an auxotrophic host, respectively. © 2010 Landes Bioscience

  20. Complementary Information Derived from CRISPR Cas9 Mediated Gene Deletion and Suppression. | Office of Cancer Genomics

    Science.gov (United States)

    CRISPR-Cas9 provides the means to perform genome editing and facilitates loss-of-function screens. However, we and others demonstrated that expression of the Cas9 endonuclease induces a gene-independent response that correlates with the number of target sequences in the genome. An alternative approach to suppressing gene expression is to block transcription using a catalytically inactive Cas9 (dCas9). Here we directly compare genome editing by CRISPR-Cas9 (cutting, CRISPRc) and gene suppression using KRAB-dCas9 (CRISPRi) in loss-of-function screens to identify cell essential genes.

  1. Association between the SMN2 gene copy number and clinical characteristics of patients with spinal muscular atrophy with homozygous deletion of exon 7 of the SMN1 gene

    Directory of Open Access Journals (Sweden)

    Žarkov Marija

    2015-01-01

    Full Text Available Background/Aim. Spinal muscular atrophy (SMA is an autosomal recessive disease characterized by degeneration of alpha motor neurons in the spinal cord and the medulla oblongata, causing progressive muscle weakness and atrophy. The aim of this study was to determine association between the SMN2 gene copy number and disease phenotype in Serbian patients with SMA with homozygous deletion of exon 7 of the SMN1 gene. Methods. The patients were identified using regional Serbian hospital databases. Investigated clinical characteristics of the disease were: patients’ gender, age at disease onset, achieved and current developmental milestones, disease duration, current age, and the presence of the spinal deformities and joint contractures. The number of SMN1 and SMN2 gene copies was determined using real-time polymerase chain reaction (PCR. Results. Among 43 identified patients, 37 (86.0% showed homozygous deletion of SMN1 exon 7. One (2.7% of 37 patients had SMA type I with 3 SMN2 copies, 11 (29.7% patients had SMA type II with 3.1 ± 0.7 copies, 17 (45.9% patients had SMA type III with 3.7 ± 0.9 copies, while 8 (21.6% patients had SMA type IV with 4.2 ± 0.9 copies. There was a progressive increase in the SMN2 gene copy number from type II towards type IV (p < 0.05. A higher SMN2 gene copy number was associated with better current motor performance (p < 0.05. Conclusion. In the Serbian patients with SMA, a higher SMN2 gene copy number correlated with less severe disease phenotype. A possible effect of other phenotype modifiers should not be neglected.

  2. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    type strains by culturing on different complex media to provoke induction of the secondary metabolism; ii) over expression of transcription factors encoding genes that are present in PKS gene clusters; iii) modification of chromatin structure regulation by knock out of histone H3 lysine methylation; iv...

  3. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

  4. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    Science.gov (United States)

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  5. Deletion of exon 26 of the dystrophin gene is associated with a mild Becker muscular dystrophy phenotype

    DEFF Research Database (Denmark)

    Witting, Nanna; Duno, Morten; Vissing, John

    2011-01-01

    With the possible introduction of exon skipping therapy in Duchenne muscular dystrophy, it has become increasingly important to know the role of each exon of the dystrophin gene to protein expression, and thus the phenotype. In this report, we present two related men with an unusually mild BMD...... associated with an exon 26 deletion. The proband, a 23-year-old man, had slightly delayed motor milestones, walking 1 1/2 years old. He had no complaints of muscle weakness, but had muscle pain. Clinical examination revealed no muscle wasting or loss of power, but his CK was 1500-7000 U/l. Muscle biopsy...... skipping therapy for Duchenne muscular dystrophy. This report also shows that BMD may present with a normal CK....

  6. Extensive nucleotide changes and deletions within the envelope glycoprotein gene of Euro-African West Nile viruses.

    Science.gov (United States)

    Berthet, F X; Zeller, H G; Drouet, M T; Rauzier, J; Digoutte, J P; Deubel, V

    1997-09-01

    We compared the sequence of an envelope protein gene fragment from 21 temporally distinct West Nile (WN) virus strains, isolated in nine African countries and in France. Alignment of nucleotide sequences defined two groups of viruses which diverged by up to 29%. The first group of subtypes is composed of nine WN strains from France and Africa. The Austral-Asian Kunjin virus was classified as a WN subtype in this first group. The second group includes 12 WN strains from Africa and Madagascar. Four strains harboured a 12 nucleotide in-frame deletion. The loss of the corresponding four amino acids resulted in the loss of the potential glycosylation site present in several WN strains. The distribution of virus subtypes into two lineages did not correlate with host preference or geographical origin. The isolation of closely related subtypes in distant countries is consistent with WN viruses being disseminated by migrating birds.

  7. Expansion of the clinical ocular spectrum of Wolfram Syndrome in a family carrying a novel WFS1 gene deletion.

    Science.gov (United States)

    Chacón-Camacho, Oscar; Arce-Gonzalez, Rocio; Granillo-Alvarez, Mariella; Flores-Limas, Sanjuanita; Ramírez, Magdalena; Zenteno, Juan C

    2013-12-01

    To present the results of the clinical and molecular analyses of a familial case of Wolfram Syndrome (WFS) associated with a novel ocular anomaly. Full ophthalmologic examination was performed in two WFS siblings. Visante OCT imaging was used for assessing anterior segment anomalies. Genetic analysis included PCR amplification and exon-by-exon nucleotide sequencing of the WFS1 gene. Ocular anomalies in both affected siblings included congenital cataract, glaucoma, and optic atrophy. Interestingly, microspherophakia, a feature that has not been previously associated with WFS, was observed in both siblings. Genetic analysis disclosed a novel c.1525_1539 homozygous deletion in exon 8 of WFS1 in DNA from both affected patients. The recognition of microspherophakia in two siblings carrying a novel WFS1 mutation expands the clinical and molecular spectrum of Wolfram syndrome.

  8. Deletion of exon 26 of the dystrophin gene is associated with a mild Becker muscular dystrophy phenotype

    DEFF Research Database (Denmark)

    Witting, Nanna; Duno, Morten; Vissing, John

    2011-01-01

    calf hypertrophy was noted. Creatine kinase was normal or raised maximally to 500 U/l. The muscle biopsy was myopathic with increased fiber size variation and many internal nuclei, but no dystrophy. No comorbidity was found. In both cases, western blot showed a reduced dystrophin band. Genetic......With the possible introduction of exon skipping therapy in Duchenne muscular dystrophy, it has become increasingly important to know the role of each exon of the dystrophin gene to protein expression, and thus the phenotype. In this report, we present two related men with an unusually mild BMD...... associated with an exon 26 deletion. The proband, a 23-year-old man, had slightly delayed motor milestones, walking 1 1/2 years old. He had no complaints of muscle weakness, but had muscle pain. Clinical examination revealed no muscle wasting or loss of power, but his CK was 1500-7000 U/l. Muscle biopsy...

  9. A New Standard for Crustacean Genomes: The Highly Contiguous, Annotated Genome Assembly of the Clam Shrimp Eulimnadia texana Reveals HOX Gene Order and Identifies the Sex Chromosome

    Science.gov (United States)

    Weeks, Stephen C; Long, Anthony D

    2018-01-01

    Abstract Vernal pool clam shrimp (Eulimnadia texana) are a promising model system due to their ease of lab culture, short generation time, modest sized genome, a somewhat rare stable androdioecious sex determination system, and a requirement to reproduce via desiccated diapaused eggs. We generated a highly contiguous genome assembly using 46× of PacBio long read data and 216× of Illumina short reads, and annotated using Illumina RNAseq obtained from adult males or hermaphrodites. Of the 120 Mb genome 85% is contained in the largest eight contigs, the smallest of which is 4.6 Mb. The assembly contains 98% of transcripts predicted via RNAseq. This assembly is qualitatively different from scaffolded Illumina assemblies: It is produced from long reads that contain sequence data along their entire length, and is thus gap free. The contiguity of the assembly allows us to order the HOX genes within the genome, identifying two loci that contain HOX gene orthologs, and which approximately maintain the order observed in other arthropods. We identified a partial duplication of the Antennapedia complex adjacent to the few genes homologous to the Bithorax locus. Because the sex chromosome of an androdioecious species is of special interest, we used existing allozyme and microsatellite markers to identify the E. texana sex chromosome, and find that it comprises nearly half of the genome of this species. Linkage patterns indicate that recombination is extremely rare and perhaps absent in hermaphrodites, and as a result the location of the sex determining locus will be difficult to refine using recombination mapping. PMID:29294012

  10. Deletion of Genes Encoding Arginase Improves Use of "Heavy" Isotope-Labeled Arginine for Mass Spectrometry in Fission Yeast.

    Directory of Open Access Journals (Sweden)

    Weronika E Borek

    Full Text Available The use of "heavy" isotope-labeled arginine for stable isotope labeling by amino acids in cell culture (SILAC mass spectrometry in the fission yeast Schizosaccharomyces pombe is hindered by the fact that under normal conditions, arginine is extensively catabolized in vivo, resulting in the appearance of "heavy"-isotope label in several other amino acids, most notably proline, but also glutamate, glutamine and lysine. This "arginine conversion problem" significantly impairs quantification of mass spectra. Previously, we developed a method to prevent arginine conversion in fission yeast SILAC, based on deletion of genes involved in arginine catabolism. Here we show that although this method is indeed successful when (13C6-arginine (Arg-6 is used for labeling, it is less successful when (13C6(15N4-arginine (Arg-10, a theoretically preferable label, is used. In particular, we find that with this method, "heavy"-isotope label derived from Arg-10 is observed in amino acids other than arginine, indicating metabolic conversion of Arg-10. Arg-10 conversion, which severely complicates both MS and MS/MS analysis, is further confirmed by the presence of (13C5(15N2-arginine (Arg-7 in arginine-containing peptides from Arg-10-labeled cells. We describe how all of the problems associated with the use of Arg-10 can be overcome by a simple modification of our original method. We show that simultaneous deletion of the fission yeast arginase genes car1+ and aru1+ prevents virtually all of the arginine conversion that would otherwise result from the use of Arg-10. This solution should enable a wider use of heavy isotope-labeled amino acids in fission yeast SILAC.

  11. Single nucleotide deletion of cqm1 gene results in the development of resistance to Bacillus sphaericus in Culex quinquefasciatus.

    Science.gov (United States)

    Guo, Qing-yun; Cai, Quan-xin; Yan, Jian-ping; Hu, Xiao-min; Zheng, Da-sheng; Yuan, Zhi-ming

    2013-09-01

    The entomopathogen Bacillus sphaericus is one of the most effective biolarvicides used to control the Culex species of mosquito. The appearance of resistance in mosquitoes to this bacterium, however, remains a threat to its continuous use in integrated mosquito control programs. Previous work showed that the resistance to B. sphaericus in Culex colonies was associated with the absence of the 60-kDa binary toxin receptor (Cpm1/Cqm1), an alpha-glucosidase present in the larval midgut microvilli. In this work, we studied the molecular basis of the resistance developed by Culex quinquefasciatus to B. sphaericus C3-41. The cqm1 genes were cloned from susceptible (CqSL) and resistant (CqRL/C3-41) colonies, respectively. The sequence of the cDNA and genomic DNA derived from CqRL/C3-41 colony differed from that of CqSL one by a one-nucleotide deletion which resulted in a premature stop codon, leading to production of a truncated protein. Recombinant Cqm1S from the CqSL colony expressed in Escherichia coli specifically bound to the Bin toxin and had α-glucosidase activity, whereas the Cqm1R from the CqRL/C3-41 colony, with a deletion of three quarters of the receptor's C-terminal lost its α-glucosidase activity and could not bind to the binary toxin. Immunoblotting experiments showed that Cqm1 was undetectable in CqRL/C3-41 larvae, although the gene was correctly transcribed. Thus, the cqm1R represents a new allele in C. quinquefasciatus that confers resistance to B. sphaericus. Copyright © 2013. Published by Elsevier Ltd.

  12. Cutis Aplasia as a clinical hallmark for the syndrome associated with 19q13.11 deletion: the possible role for UBA2 gene.

    Science.gov (United States)

    Melo, Joana B; Estevinho, Alexandra; Saraiva, Jorge; Ramos, Lina; Carreira, Isabel M

    2015-01-01

    Wide genome screening through array comparative genomic hybridization made possible the recognition of the novel 19q13.11 deletion syndrome. There are very few cases reported with this deletion, but clinically this condition seems to be recognizable by pre and postnatal growth retardation, microcephaly, developmental delay/intellectual disabilities, speech disturbance, hypospadias (in males) and signs of ectodermal dysplasia and cutis aplasia over the posterior occiput. Using oligoarray CGH, a 4.6 Mb deletion in 19q13.11q13.12 was detected in a 23 year old female patient that presented clinical features previously associated with 19q13.11 deletion. Our work reinforces the idea that a region encompassing four zinc finger genes is likely to be responsible for the syndrome, and that the difference in minor clinical manifestation depends on the genes present outside the minimal overlapping region proposed for this syndrome. We also review all cases described in the literature and discuss the correlation between haploinsufficiency of UBA2 gene and cutis aplasia present in the majority of the patients reported, and its importance as a clinical hallmark of 19q13.11 deletion syndrome, when associated with more common features like developmental delay, microcephaly, speech disturbance and hypospadias in males.

  13. The gene for replication factor C subunit 2 (RFC2) is within the 7q11.23 Williams syndrome deletion

    Energy Technology Data Exchange (ETDEWEB)

    Peoples, R.; Perez-Jurado, L.; Francke, U.; Yu-Ker Wang [Stanford Univ. Medical Center, CA (United States); Kaplan, P. [Children`s Hospital of Philadelphia, PA (United States)

    1996-06-01

    Williams syndrome (WS) is a developmental disorder with multiple system manifestations, including supraval var aortic stenosis (SVAS), peripheral pulmonic stenosis, connective tissue abnormalities, short stature, characteristic personality profile and cognitive deficits, and variable hypercalcemia in infancy. It is caused by heterozygosity for a chromosomal deletion of part of band 7q11.23 including the elastin locus (ELN). Since disruption of the ELN gene causes autosomal dominant SVAS, it is assumed that ELN haploinsufficiency is responsible for the cardiovascular features of WS. The deletion that extends from the ELN locus in both directions is {ge}200 kb in size, although estimates of {ge}2 Mb are suggested by high-resolution chromosome banding and physical mapping studies. We have searched for additional dosage-sensitive genes within the deletion that may be responsible for the noncardiovascular features. We report here that the gene for replication factor C subunit 2 (RFC2) maps within the WS deletion region and was found to be deleted in all of 18 WS patients studied. The protein product of RFC2 is part of a multimeric complex involved in DNA elongation during replication. 14 refs., 3 figs.

  14. Upon Accounting for the Impact of Isoenzyme Loss, Gene Deletion Costs Anticorrelate with Their Evolutionary Rates.

    Directory of Open Access Journals (Sweden)

    Christopher Jacobs

    Full Text Available System-level metabolic network models enable the computation of growth and metabolic phenotypes from an organism's genome. In particular, flux balance approaches have been used to estimate the contribution of individual metabolic genes to organismal fitness, offering the opportunity to test whether such contributions carry information about the evolutionary pressure on the corresponding genes. Previous failure to identify the expected negative correlation between such computed gene-loss cost and sequence-derived evolutionary rates in Saccharomyces cerevisiae has been ascribed to a real biological gap between a gene's fitness contribution to an organism "here and now" and the same gene's historical importance as evidenced by its accumulated mutations over millions of years of evolution. Here we show that this negative correlation does exist, and can be exposed by revisiting a broadly employed assumption of flux balance models. In particular, we introduce a new metric that we call "function-loss cost", which estimates the cost of a gene loss event as the total potential functional impairment caused by that loss. This new metric displays significant negative correlation with evolutionary rate, across several thousand minimal environments. We demonstrate that the improvement gained using function-loss cost over gene-loss cost is explained by replacing the base assumption that isoenzymes provide unlimited capacity for backup with the assumption that isoenzymes are completely non-redundant. We further show that this change of the assumption regarding isoenzymes increases the recall of epistatic interactions predicted by the flux balance model at the cost of a reduction in the precision of the predictions. In addition to suggesting that the gene-to-reaction mapping in genome-scale flux balance models should be used with caution, our analysis provides new evidence that evolutionary gene importance captures much more than strict essentiality.

  15. DELETIONS OF THE SURVIVAL MOTOR-NEURON GENE IN UNAFFECTED SIBLINGS OF PATIENTS WITH SPINAL MUSCULAR-ATROPHY

    NARCIS (Netherlands)

    COBBEN, JM; VANDERSTEEGE, G; GROOTSCHOLTEN, P; DEVISSER, M; SCHEFFER, H; BUYS, CHCM

    1995-01-01

    DNA studies in 103 spinal muscular atrophy (SMA) patients from The Netherlands revealed homozygosity for a survival motor neuron (SMN) deletion in 96 (93%) of 103. Neuronal apoptosis inhibitory protein deletions were found in 38 (37%) of 103 and occurred most frequently in SMA type I. SMN deletions

  16. A four base pair deletion 5' to the A gamma T gene is associated not only with decreased expression of the A gamma T-globin gene, but also of the G gamma-globin gene in cis.

    Science.gov (United States)

    Coleman, M B; Adams, J G; Steinberg, M H; Winter, W P

    1994-12-01

    A four base pair deletion 5' to A gamma T-globin gene at positions -222 to -225 has been reported to reduce the expression of this gene. To evaluate the prevalence and effect of this deletion, PCR-based methods were employed. The deletion had a gene frequency of 0.06 in a sample of African-American individuals with sickle cell trait, 0.18 in adult African-Americans with normal Hb AA, and 0.36 in caucasians. Seventy cord blood samples from African-American newborns with Hb AA were evaluated by both HPLC and PCR. The frequency of the A gamma T allele was 0.13. The A gamma T-globin chain was always present in a lower proportion than the A gamma I allele (70% of A gamma I), but the percentage of A gamma-globin was the same whether or not A gamma T was present. The total percentage of Hb F, however, was significantly lower in the group with the A gamma T allele (77.1% vs. 87.4%, P < 0.01). These results indicate that the four base pair deletion is not only associated with reduced expression of the A gamma T allele, but also of the G gamma allele in cis, further suggesting a possible role of this region in the modulation of the expression of the linked gamma-globin genes.

  17. Deletion of a Stay-Green Gene Associates with Adaptive Selection in Brassica napus

    National Research Council Canada - National Science Library

    Lunwen Qian Kai Voss-Fels Yixin Cui Habib U. Jan Birgit Samans Christian Obermeier Wei Qian Rod J. Snowdon

    2016-01-01

    .... The stay-green gene NON-YELLOWING 1 (NYE1) is believed to regu-late chlorophyll degradation during senescence, concomitantly affecting the disassembly of the light- harvesting complex and hence indirectly influencing photosynthesis...

  18. Systematic screening for PRKAR1A gene rearrangement in Carney complex: identification and functional characterization of a new in-frame deletion.

    Science.gov (United States)

    Bataille, M Guillaud; Rhayem, Y; Sousa, S B; Libé, R; Dambrun, M; Chevalier, C; Nigou, M; Auzan, C; North, M O; Sa, J; Gomes, L; Salpea, P; Horvath, A; Stratakis, C A; Hamzaoui, N; Bertherat, J; Clauser, E

    2014-01-01

    Point mutations of the PRKAR1A gene are a genetic cause of Carney complex (CNC) and primary pigmented nodular adrenocortical disease (PPNAD), but in 30% of the patients no mutation is detected. Set up a routine-based technique for systematic detection of large deletions or duplications of this gene and functionally characterize these mutations. Multiplex ligation-dependent probe amplification (MLPA) of the 12 exons of the PRKAR1A gene was validated and used to detect large rearrangements in 13 typical CNC and 39 confirmed or putative PPNAD without any mutations of the gene. An in-frame deletion was characterized by western blot and bioluminescence resonant energy transfer technique for its interaction with the catalytic subunit. MLPA allowed identification of exons 3-6 deletion in three patients of a family with typical CNC. The truncated protein is expressed, but rapidly degraded, and does not interact with the protein kinase A catalytic subunit. MLPA is a powerful technique that may be used following the lack of mutations detected by direct sequencing in patients with bona fide CNC or PPNAD. We report here one such new deletion, as an example. However, these gene defects are not a frequent cause of CNC or PPNAD.

  19. Otitis Media in a New Mouse Model for CHARGE Syndrome with a Deletion in the Chd7 Gene

    Science.gov (United States)

    Tian, Cong; Yu, Heping; Yang, Bin; Han, Fengchan; Zheng, Ye; Bartels, Cynthia F.; Schelling, Deborah; Arnold, James E.; Scacheri, Peter C.; Zheng, Qing Yin

    2012-01-01

    Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome. PMID:22539951

  20. Deletion of genes involved in glutamate metabolism to improve poly-gamma-glutamic acid production in B. amyloliquefaciens LL3.

    Science.gov (United States)

    Zhang, Wei; He, Yulian; Gao, Weixia; Feng, Jun; Cao, Mingfeng; Yang, Chao; Song, Cunjiang; Wang, Shufang

    2015-02-01

    Here, we attempted to elevate poly-gamma-glutamic acid (γ-PGA) production by modifying genes involved in glutamate metabolism in Bacillus amyloliquefaciens LL3. Products of rocR, rocG and gudB facilitate the conversion from glutamate to 2-oxoglutarate in Bacillus subtillis. The gene odhA is responsible for the synthesis of a component of the 2-oxoglutarate dehydrogenase complex that catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl coenzyme A. In-frame deletions of these four genes were performed. In shake flask experiments the gudB/rocG double mutant presented enhanced production of γ-PGA, a 38 % increase compared with wild type. When fermented in a 5-L fermenter with pH control, the γ-PGA yield of the rocR mutant was increased to 5.83 g/L from 4.55 g/L for shake flask experiments. The gudB/rocG double mutant produced 5.68 g/L γ-PGA compared with that of 4.03 g/L for the wild type, a 40 % increase. Those results indicated the possibility of improving γ-PGA production by modifying glutamate metabolism, and identified potential genetic targets to improve γ-PGA production.

  1. Association between migraine and ACE gene (insertion/deletion) polymorphism: the BioBIM study.

    Science.gov (United States)

    Palmirotta, Raffaele; Barbanti, Piero; Ludovici, Giorgia; De Marchis, Maria Laura; Ialongo, Cristiano; Egeo, Gabriella; Aurilia, Cinzia; Fofi, Luisa; Abete, Pasquale; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

    2014-02-01

    In the present case-control study, we investigated the correlation between the common ACE insertion/deletion (I/D) polymorphism and migraine. Genotyping of the ACE I/D variant was performed in 502 Caucasian patients with migraine and 323 age-, sex- and race/ethnicity-matched healthy controls. We investigated associations between ACE genetic variants and sociodemographic and/or clinical features of migraineurs. We found a significant association between ACE insertion/insertion (I/I) polymorphism and lower use of pharmacological prophylaxis in migraine patients with aura and in those with chronic migraine. Moreover, ACE I/I polymorphism was significantly more common in migraine patients with aura who had a negative family history of migraine. Our data suggest that although the ACE I/D polymorphism is not a direct risk factor for migraine, the ACE I/I genotype may influence the clinical feature of this disease being associated with reduced use of prophylactic agents in patients with migraine with aura and in those with chronic migraine.

  2. Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients

    Directory of Open Access Journals (Sweden)

    White Linda R

    2008-03-01

    Full Text Available Abstract Background The main objective of this study was to investigate the angiotensin converting enzyme (ACE genotype as a possible risk factor for migraine (both with and without aura compared to controls. We also wanted to examine whether a clinical response to an ACE inhibitor, lisinopril, or an angiotensin II receptor blocker, candesartan, in migraine prophylaxis was related to ACE genotype. Methods 347 migraine patients aged 18–68 (155 migraine without aura (MoA, 187 migraine with aura (MwA and 5 missing aura subgroup data and 403 healthy non-migrainous controls > 40 years of age were included in the study. A polymerase chain reaction (PCR was performed on the genomic DNA samples to obtain the ACE insertion (I/deletion(D polymorphisms. Results No significant differences between migraine patients and controls were found with regard to ACE genotype and allele distributions. Furthermore, there was no significant difference between the controls and the MwA or MoA subgroups. Conclusion In our sample there is no association between ACE genotype or allele frequency and migraine. In addition, ACE genotype in our experience did not predict the clinical response to lisinopril or candesartan used as migraine prophylactics.

  3. Histidine-rich protein 2 (pfhrp2 and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

    Directory of Open Access Journals (Sweden)

    Giselle Maria Rachid Viana

    Full Text Available More than 80% of available malaria rapid diagnostic tests (RDTs are based on the detection of histidine-rich protein-2 (PfHRP2 for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3, are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2% of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients. In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples to 50.9% (30 out of 59 samples. In Bolivia, only one of 25 samples (4% tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

  4. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

    Science.gov (United States)

    Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

    2017-01-01

    More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

  5. Delimitation of the Earliness per se D1 (Eps-D1) flowering gene to a subtelomeric chromosomal deletion in bread wheat (Triticum aestivum).

    Science.gov (United States)

    Zikhali, Meluleki; Wingen, Luzie U; Griffiths, Simon

    2016-01-01

    Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A (m) 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A (m) 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. Generation of induced pluripotent stem cell (iPSC) line from a patient with triple negative breast cancer with hereditary exon 17 deletion of BRCA1 gene.

    Science.gov (United States)

    Griscelli, Frank; Oudrhiri, Noufissa; Feraud, Olivier; Divers, Dominique; Portier, Lucie; Turhan, Ali G; Bennaceur Griscelli, Annelise

    2017-10-01

    BRCA1 germline mutation confers hereditary predisposition for breast and ovarian cancer. To understand the physiopathology of mammary and ovarian epithelial cancer transformation, and to identify early driver molecular events, we have generated an iPSC line from a patient carrying a germline exon 17 deletion in BRCA1 gene (BRAC1Ex17 iPSC) in a high-risk family context. Blood cells were reprogrammed used non-integrative virus of Sendaï. The BRCA1-deleted iPSC had normal karyotype, harboured a deletion in the exon 17 of the BRCA1 gene, expressed pluripotent hallmarks and had the differentiation capacity into the three germ layers. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Generation of induced pluripotent stem cell (iPSC line from a patient with triple negative breast cancer with hereditary exon 17 deletion of BRCA1 gene

    Directory of Open Access Journals (Sweden)

    Frank Griscelli

    2017-10-01

    Full Text Available BRCA1 germline mutation confers hereditary predisposition for breast and ovarian cancer. To understand the physiopathology of mammary and ovarian epithelial cancer transformation, and to identify early driver molecular events, we have generated an iPSC line from a patient carrying a germline exon 17 deletion in BRCA1 gene (BRAC1Ex17 iPSC in a high-risk family context. Blood cells were reprogrammed used non-integrative virus of Sendaï. The BRCA1-deleted iPSC had normal karyotype, harboured a deletion in the exon 17 of the BRCA1 gene, expressed pluripotent hallmarks and had the differentiation capacity into the three germ layers.

  8. Unmarked gene deletion mutagenesis of gtfB and gtfC in Streptococcus mutans using a targeted hit-and-run strategy with a thermosensitive plasmid.

    Science.gov (United States)

    Atlagic, D; Kiliç, A O; Tao, L

    2006-04-01

    Unmarked gene deletion of the Streptococcus mutans gtfB-gtfC locus was achieved using a thermosensitive plasmid. DNA fragments flanking the locus were amplified by polymerase chain reaction and jointly ligated into pG+host5, which was transformed into S. mutans at 37 degrees C to facilitate integration. A transformant was then grown at 28 degrees C for 60 generations without antibiotics to facilitate excision. Antibiotic sensitive clones appeared at a frequency of about 99% and were analyzed for deletions of gtfB, gtfC and a part of mbrA by the lack of insoluble glucan synthesis, sensitivity to bacitracin, and polymerase chain reaction. Targeted gene deletions occurred at a frequency of 2.5%.

  9. Genomic Deletions Correlate with Underexpression of Novel Candidate Genes at Six Loci in Pediatric Pilocytic Astrocytoma

    Directory of Open Access Journals (Sweden)

    Nicola Potter

    2008-08-01

    Full Text Available The molecular pathogenesis of pediatric pilocytic astrocytoma (PA is not well defined. Previous cytogenetic and molecular studies have not identified nonrandom genetic aberrations. To correlate differential gene expression and genomic copy number aberrations (CNAs in PA, we have used Affymetrix GeneChip HG_U133A to generate gene expression profiles of 19 pediatric patients and the SpectralChip 2600 to investigate CNAs in 11 of these tumors. Hierarchical clustering according to expression profile similarity grouped tumors and controls separately. We identified 1844 genes that showed significant differential expression between tumor and normal controls, with a large number clearly influencing phosphatidylinositol and mitogen-activated protein kinase signaling in PA. Most CNAs identified in this study were single-clone alterations. However, a small region of loss involving up to seven adjacent clones at 7q11.23 was observed in seven tumors and correlated with the underexpression of BCL7B. Loss of four individual clones was also associated with reduced gene expression including SH3GL2 at 9p21.2-p23, BCL7A (which shares 90% sequence homology with BCL7B at 12q24.33, DRD1IP at 10q26.3, and TUBG2 and CNTNAP1 at 17q21.31. Moreover, the down-regulation of FOXG1B at 14q12 correlated with loss within the gene promoter region in most tumors. This is the first study to correlate differential gene expression with CNAs in PA.

  10. Proteomics and bioinformatics analysis of mouse hypothalamic neurogenesis with or without EPHX2 gene deletion

    Science.gov (United States)

    Zhong, Lijun; Zhou, Juntuo; Wang, Dawei; Zou, Xiajuan; Lou, Yaxin; Liu, Dan; Yang, Bin; Zhu, Yi; Li, Xiaoxia

    2015-01-01

    The aim of this study was to identify differently expressed proteins in the presence and absence of EPHX2 gene in mouse hypothalamus using proteomics profiling and bioinformatics analysis. This study was performed on 3 wild type (WT) and 3 EPHX2 gene global knockout (KO) mice (EPHX2 -/-). Using the nano- electrospray ionization (ESI)-LC-MS/MS detector, we identified 31 over-expressed proteins in WT mouse hypothalamus compared to the KO counterparts. Gene Ontology (GO) annotation in terms of the protein-protein interaction network indicated that cellular metabolic process, protein metabolic process, signaling transduction and protein post-translation biological processes involved in EPHX2 -/- regulatory network. In addition, signaling pathway enrichment analysis also highlighted chronic neurodegenerative diseases and some other signaling pathways, such as TGF-beta signaling pathway, T cell receptor signaling pathway, ErbB signaling pathway, Neurotrophin signaling pathway and MAPK signaling pathway, were strongly coupled with EPHX2 gene knockout. Further studies into the molecular functions of EPHX2 gene in hypothalamus will help to provide new perspective in neurogenesis. PMID:26722453

  11. Conditional gene deletion reveals functional redundancy of GABAB receptors in peripheral nociceptors in vivo

    Directory of Open Access Journals (Sweden)

    Bettler Bernhard

    2009-11-01

    changed upon a specific deletion of GABAB receptors from peripheral nociceptive neurons in vivo. This lets us conclude that GABAB receptors in the peripheral nervous system play a less important role than those in the central nervous system in the regulation of pain.

  12. Self-excising Cre/mutant lox marker recycling system for multiple gene integrations and consecutive gene deletions in Aspergillus oryzae.

    Science.gov (United States)

    Zhang, Silai; Ban, Akihiko; Ebara, Naoki; Mizutani, Osamu; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2017-04-01

    In this study, we developed a self-excising Cre/loxP-mediated marker recycling system with mutated lox sequences to introduce a number of biosynthetic genes into Aspergillus oryzae. To construct the self-excising marker cassette, both the selectable marker, the Aspergillus nidulans adeA gene, and the Cre recombinase gene (cre), conditionally expressed by the xylanase-encoding gene promoter, were designed to be located between the mutant lox sequences, lox66 and lox71. However, construction of the plasmid failed, possibly owing to a slight expression of cre downstream of the fungal gene promoter in Escherichia coli. Hence, to avoid the excision of the cassette in E. coli, a 71-bp intron of the A. oryzae xynG2 gene was inserted into the cre gene. The A. oryzae adeA deletion mutant was transformed with the resulting plasmid in the presence of glucose, and the transformants were cultured in medium containing xylose as the sole carbon source. PCR analysis of genomic DNA from resultant colonies revealed the excision of both the marker and Cre expression construct, indicating that the self-excising marker cassette was efficient at removing the selectable marker. Using the marker recycling system, hyperproduction of kojic acid could be achieved in A. oryzae by the introduction of two genes that encode oxidoreductase and transporter. Furthermore, we also constructed an alternative marker recycling cassette bearing the A. nidulans pyrithiamine resistant gene (ptrA) as a dominant selectable marker. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  13. Intragenic deletions and duplications of the LIS1 and DCX genes: a major disease-causing mechanism in lissencephaly and subcortical band heterotopia.

    Science.gov (United States)

    Haverfield, Eden V; Whited, Amanda J; Petras, Kristin S; Dobyns, William B; Das, Soma

    2009-07-01

    Classical lissencephaly, or isolated lissencephaly sequence (ILS), and subcortical band heterotopia (SBH) are neuronal migration disorders associated with severe mental retardation and epilepsy. Abnormalities of the LIS1 and DCX genes are implicated in the majority of patients with these disorders and account for approximately 75% of patients with ILS, whereas mutations of DCX account for 85% of patients with SBH. The molecular basis of disease in patients with ILS and SBH, in whom no abnormalities have been identified, has been questioned. We studied a series of 83 patients with ILS, SBH or pachygyria, in whom no abnormalities of the LIS1 or DCX genes had been identified, for intragenic deletions and duplications by multiplex ligation-dependent probe amplification (MLPA). In 52 patients with ILS, we identified 12 deletions and 6 duplications involving the LIS1 gene (35%), with the majority resulting in grade 3 lissencephaly. Three deletions of the DCX gene were identified in the group of nine female patients with SBH (out of 31 patients with DCX-suggestive brain anomalies), ie 33%. We estimate an overall mutation detection rate of approximately 85% by LIS1 and DCX sequencing and MLPA in ILS, and 90% by DCX sequencing and MLPA in SBH. Our results show that intragenic deletions and duplications of the LIS1 and DCX genes account for a significant number of patients with ILS and SBH, where no molecular defect had previously been identified. Incorporation of deletion/duplication analysis of the LIS1 and DCX genes will be important for the molecular diagnosis of patients with ILS and SBH.

  14. Effect of pyruvate kinase gene deletion on the physiology of Corynebacterium glutamicum ATCC13032 under biotin-sufficient non-glutamate-producing conditions: Enhanced biomass production

    Directory of Open Access Journals (Sweden)

    Kazunori Sawada

    2015-12-01

    Full Text Available The effect of pyruvate kinase gene (pyk deletion on the physiology of Corynebacterium glutamicum ATCC13032 was investigated under biotin-sufficient, non-glutamate-producing conditions. In a complex medium containing 100 g/L glucose, a defined pyk deletion mutant, strain D1, exhibited 35% enhancement in glucose consumption rate, 37% increased growth and a 57% reduction in respiration rate compared to the wild-type parent. Significant upregulation of phosphoenolpyruvate (PEP carboxylase and downregulation of PEP carboxykinase activities were observed in the D1 mutant, which may have prevented over-accumulation of PEP caused by the pyk deletion. Moreover, we found a dramatic 63% reduction in the activity of malate:quinone oxidoreductase (MQO in the D1 mutant. MQO, a TCA cycle enzyme that converts malate to oxaloacetate (OAA, constitutes a major primary gate to the respiratory chain in C. glutamicum, thus explaining the reduced respiration rate in the mutant. Additionally, pyruvate carboxylase gene expression was downregulated in the mutant. These changes seemed to prevent OAA over-accumulation caused by the activity changes of PEP carboxylase/PEP carboxykinase. Intrinsically the same alterations were observed in the cultures conducted in a minimal medium containing 20 g/L glucose. Despite these responses in the mutant, metabolic distortion caused by pyk deletion under non-glutamate-producing conditions required amelioration by increased biomass production, as metabolome analysis revealed increased intracellular concentrations of several precursor metabolites for building block formation associated with pyk deletion. These fermentation profiles and metabolic alterations observed in the mutant reverted completely to the wild-type phenotypes in the pyk-complemented strain, suggesting the observed metabolic changes were caused by the pyk deletion. These results demonstrated multilateral strategies to overcome metabolic disturbance caused by pyk

  15. Lack of relationship between an insertion/deletion polymorphism in the angiotensin I-converting enzyme gene and diabetic nephropathy and proliferative retinopathy in IDDM patients

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1995-01-01

    Genotypic abnormalities of the renin-angiotensin system have been suggested as a risk factor for the development of diabetic nephropathy and proliferative retinopathy. We studied the relationship between an insertion(I)/deletion (D) polymorphism in the angiotensin-converting enzyme (ACE) gene in ...

  16. What is the relevance of Ikaros gene deletions as a prognostic marker in pediatric Philadelphia-negative B-cell precursor acute lymphoblastic leukemia?

    National Research Council Canada - National Science Library

    Chiara Palmi; Maria Grazia Valsecchi; Giulia Longinotti; Daniela Silvestri; Valentina Carrino; Valentino Conter; Giuseppe Basso; Andrea Biondi; Geertruy Te Kronnie; Giovanni Cazzaniga

    2013-01-01

    .... We focused our analysis on Ikaros (IKZF1) gene deletions in a homogeneous cohort of 410 pediatric patients with Philadelphia chromosome-negative, B-cell precursor acute lymphoblastic leukemia enrolled in Italy into the AIEOP-BFM ALL2000 study...

  17. Distribution and characterization of a Sandhoff disease-associated 50-kb deletion in the gene encoding the human beta-hexosaminidase beta-chain

    NARCIS (Netherlands)

    Bikker, H.; van den Berg, F. M.; Wolterman, R. A.; Kleijer, W. J.; de Vijlder, J. J.; Bolhuis, P. A.

    1990-01-01

    A 50-kb deletion was demonstrated in the gene encoding for the beta-subunit of human hexosaminidase (HEXB), using field inversion gel electrophoresis (FIGE) of SfiI-digested chromosomal DNA from patients with Sandhoff disease. We investigated 14 patients from different parts of Europe and found no

  18. Research Note A novel deletion mutation of the SOX2 gene in a ...

    Indian Academy of Sciences (India)

    Administrator

    congenital bilateral anophthalmia and sensorineural hearing loss. Yan Zhang 1, Xibo Zhang 1, Ran .... Mutations in the SOX2 gene found in patients with congenital microphthalmia and anophthalmia include ... researches have reported other anomalies including brain malformations (Zenteno JC et al. 2005), esophageal ...

  19. X-chromosome terminal deletion in a female with premature ovarian failure: Haploinsufficiency of X-linked genes as a possible explanation

    Directory of Open Access Journals (Sweden)

    Melo Joana B

    2010-07-01

    Full Text Available Abstract Background Premature ovarian failure (POF has repeatedly been associated to X-chromosome deletions. FMR1 gene premutation allele's carrier women have an increased risk for POF. We intent to determine the cause of POF in a 29 year old female, evaluating both of these situations. Methods Concomitant analysis of FMR1 gene CGG repeat number and karyotype revealed an X-chromosome terminal deletion. Fluorescence in situ further characterized the breakpoint. A methylation assay for FMR1 gene allowed to determine its methylation status, and hence, the methylation status of the normal X-chromosome. Results We report a POF patient with a 46,X,del(X(q26 karyotype and with skewed X-chromosome inactivation of the structural abnormal X-chromosome. Conclusions Despite the hemizygosity of FMR1 gene, the patient does not present Fragile X syndrome features, since the normal X-chromosome is not subject to methylation. The described deletion supports the hypothesis that haploinsufficiency of X-linked genes can be on the basis of POF, and special attention should be paid to X-linked genes in region Xq28 since they escape inactivation and might have a role in this disorder. A full clinical and cytogenetic characterization of all POF cases is important to highlight a pattern and help to understand which genes are crucial for normal ovarian development.

  20. X-chromosome terminal deletion in a female with premature ovarian failure: Haploinsufficiency of X-linked genes as a possible explanation.

    Science.gov (United States)

    Ferreira, Susana I; Matoso, Eunice; Pinto, Marta; Almeida, Joana; Liehr, Thomas; Melo, Joana B; Carreira, Isabel M

    2010-07-20

    Premature ovarian failure (POF) has repeatedly been associated to X-chromosome deletions. FMR1 gene premutation allele's carrier women have an increased risk for POF. We intent to determine the cause of POF in a 29 year old female, evaluating both of these situations. Concomitant analysis of FMR1 gene CGG repeat number and karyotype revealed an X-chromosome terminal deletion. Fluorescence in situ further characterized the breakpoint. A methylation assay for FMR1 gene allowed to determine its methylation status, and hence, the methylation status of the normal X-chromosome. We report a POF patient with a 46,X,del(X)(q26) karyotype and with skewed X-chromosome inactivation of the structural abnormal X-chromosome. Despite the hemizygosity of FMR1 gene, the patient does not present Fragile X syndrome features, since the normal X-chromosome is not subject to methylation. The described deletion supports the hypothesis that haploinsufficiency of X-linked genes can be on the basis of POF, and special attention should be paid to X-linked genes in region Xq28 since they escape inactivation and might have a role in this disorder. A full clinical and cytogenetic characterization of all POF cases is important to highlight a pattern and help to understand which genes are crucial for normal ovarian development.

  1. A Single-Nucleotide Deletion in the Transcription Factor Gene bcsmr1 Causes Sclerotial-Melanogenesis Deficiency in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Yingjun Zhou

    2017-12-01

    Full Text Available Botrytis cinerea is an important plant pathogenic fungus with a wide range of host. It usually produces black-colored sclerotia (BS due to deposition of 1,8-dihydroxynaphthalene melanin in sclerotial melanogenesis. Our previous study (Zhou et al., 2018 reported six B. cinerea isolates producing orange-colored sclerotia (OS with deficiency in sclerotial melanogenesis. Comparison of ecological fitness (conidia, mycelia, sclerotia, natural distribution, and melanogenesis of selected BS and OS isolates suggests that sclerotia play an important role in the disease cycle caused by B. cinerea. However, the molecular mechanism for formation of the OS B. cinerea remains unknown. This study was done to unravel the molecular mechanism for the sclerotial melanogenesis deficiency in the OS isolates. We found that all the five sclerotial melanogenesis genes (bcpks12, bcygh1, bcbrn1/2, bcscd1 were down-regulated in OS isolates, compared to the genes in the BS isolates. However, the sclerotial melanogenesis-regulatory gene bcsmr1 had similar expression in both types of sclerotia, suggesting the sclerotial melanogenesis deficiency is due to loss-of-function of bcsmr1, rather than lack of expression of bcsmr1. Therefore, we cloned bcsmr1 from OS (bcsmr1OS and BS (bcsmr1BS isolates, and found a single-nucleotide deletion in bcsmr1OS. The single-nucleotide deletion caused formation of a premature stop codon in the open reading frame of bcsmr1OS, resulting in production of a 465-aa truncated protein. The transcription activity of the truncated protein was greatly reduced, compared to that of the 935-aa full-length protein encoded by bcsmr1BS in the BS isolates. The function of bcsmr1OS was partially complemented by bcsmr1BS. This study not only elucidated the molecular mechanism for formation of orange-colored sclerotia by the spontaneous mutant XN-1 of B. cinerea, but also confirmed the regulatory function of bcsmr1 in sclerotial melanogenesis of B. cinerea.

  2. Improving the MVA vaccine potential by deleting the viral gene coding for the IL-18 binding protein.

    Directory of Open Access Journals (Sweden)

    Juliana Falivene

    Full Text Available BACKGROUND: Modified Vaccinia Ankara (MVA is an attenuated strain of Vaccinia virus (VACV currently employed in many clinical trials against HIV/AIDS and other diseases. MVA still retains genes involved in host immune response evasion, enabling its optimization by removing some of them. The aim of this study was to evaluate cellular immune responses (CIR induced by an IL-18 binding protein gene (C12L deleted vector (MVAΔC12L. METHODOLOGY/PRINCIPAL FINDINGS: BALB/c and C57BL/6 mice were immunized with different doses of MVAΔC12L or MVA wild type (MVAwt, then CIR to VACV epitopes in immunogenic proteins were evaluated in spleen and draining lymph nodes at acute and memory phases (7 and 40 days post-immunization respectively. Compared with parental MVAwt, MVAΔC12L immunization induced a significant increase of two to three-fold in CD8(+ and CD4(+ T-cell responses to different VACV epitopes, with increased percentage of anti-VACV cytotoxic CD8(+ T-cells (CD107a/b(+ during the acute phase of the response. Importantly, the immunogenicity enhancement was also observed after MVAΔC12L inoculation with different viral doses and by distinct routes (systemic and mucosal. Potentiation of MVA's CIR was also observed during the memory phase, in correlation with a higher protection against an intranasal challenge with VACV WR. Of note, we could also show a significant increase in the CIR against HIV antigens such as Env, Gag, Pol and Nef from different subtypes expressed from two recombinants of MVAΔC12L during heterologous DNA prime/MVA boost vaccination regimens. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the relevance of IL-18 bp contribution in the immune response evasion during MVA infection. Our findings clearly show that the deletion of the viral IL-18 bp gene is an effective approach to increase MVA vaccine efficacy, as immunogenicity improvements were observed against vector antigens and more importantly to HIV antigens.

  3. Effects of deletion of different PP2C protein phosphatase genes on stress responses in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sharmin, Dilruba; Sasano, Yu; Sugiyama, Minetaka; Harashima, Satoshi

    2014-10-01

    A key mechanism of signal transduction in eukaryotes is reversible protein phosphorylation, mediated through protein kinases and protein phosphatases (PPases). Modulation of signal transduction by this means regulates many biological processes. Saccharomyces cerevisiae has 40 PPases, including seven protein phosphatase 2C (PP2C PPase) genes (PTC1-PTC7). However, their precise functions remain poorly understood. To elucidate their cellular functions and to identify those that are redundant, we constructed 127 strains with deletions of all possible combinations of the seven PP2C PPase genes. All 127 disruptants were viable under nutrient-rich conditions, demonstrating that none of the combinations induced synthetic lethality under these conditions. However, several combinations exhibited novel phenotypes, e.g. the Δptc5Δptc7 double disruptant and the Δptc2Δptc3Δptc5Δptc7 quadruple disruptant exhibited low (13°C) and high (37°C) temperature-sensitive growth, respectively. Interestingly, the septuple disruptant Δptc1Δptc2Δptc3Δptc4Δptc5Δptc6Δptc7 showed an essentially normal growth phenotype at 37°C. The Δptc2Δptc3Δptc5Δptc7 quadruple disruptant was sensitive to LiCl (0.4 m). Two double disruptants, Δptc1Δptc2 and Δptc1Δptc4, displayed slow growth and Δptc1Δptc2Δptc4 could not grow on medium containing 1.5 m NaCl. The Δptc1Δptc6 double disruptant showed increased sensitivity to caffeine, congo red and calcofluor white compared to each single deletion. Our observations indicate that S. cerevisiae PP2C PPases have a shared and important role in responses to environmental stresses. These disruptants also provide a means for exploring the molecular mechanisms of redundant PTC gene functions under defined conditions. Copyright © 2014 John Wiley & Sons, Ltd.

  4. New intragenic deletions in the Phex gene clarify X-linked hypophosphatemia-related abnormalities in mice

    Science.gov (United States)

    Lorenz-Depiereux, Bettina; Guido, Victoria E.; Johnson, Kenneth R.; Zheng, Qing Yin; Gagnon, Leona H.; Bauschatz, Joiel D.; Davisson, Muriel T.; Washburn, Linda L.; Donahue, Leah Rae; Strom, Tim M.; Eicher, Eva M.

    2010-01-01

    X-linked hypophosphatemic rickets (XLH) in humans is caused by mutations in the PHEX gene. Previously, three mutations in the mouse Phex gene have been reported: PhexHyp, Gy, and PhexSka1. Here we report analysis of two new spontaneous mutations in the mouse Phex gene, PhexHyp-2J and PhexHyp-Duk. PhexHyp-2J and PhexHyp-Duk involve intragenic deletions of at least 7.3 kb containing exon 15, and 30 kb containing exons 13 and 14, respectively. Both mutations cause similar phenotypes in males, including shortened hind legs and tail, a shortened square trunk, hypophosphatemia, hypocalcemia, and rachitic bone disease. In addition, mice carrying the PhexHyp-Duk mutation exhibit background-dependent variable expression of deafness, circling behavior, and cranial dysmorphology, demonstrating the influence of modifying genes on Phex-related phenotypes. Cochlear cross-sections from PhexHyp-2J/Y and PhexHyp-Duk/Y males reveal a thickening of the temporal bone surrounding the cochlea with the presence of a precipitate in the scala tympani. Evidence of the degeneration of the organ of Corti and spiral ganglion also are present in the hearing-impaired PhexHyp-Duk/Y mice, but not in the normal-hearing PhexHyp-2J/Y mice. Analysis of the phenotypes noted in PhexHyp-Duk/Y an PhexHyp-2J/Y males, together with those noted in PhexSka1/Y and PhexHyp/Y males, now allow XLH-related phenotypes to be separated from non-XLH-related phenotypes, such as those noted in Gy/Y males. Also, identification of the genetic modifiers of hearing and craniofacial dysmorphology in PhexHyp-Duk/Y mice could provide insight into the phenotypic variation of XLH in humans. PMID:15029877

  5. Maintaining Arrays of Contiguous Objects

    Science.gov (United States)

    Bender, Michael A.; Fekete, Sándor P.; Kamphans, Tom; Schweer, Nils

    In this paper we consider methods for dynamically storing a set of different objects (“modules”) in a physical array. Each module requires one free contiguous subinterval in order to be placed. Items are inserted or removed, resulting in a fragmented layout that makes it harder to insert further modules. It is possible to relocate modules, one at a time, to another free subinterval that is contiguous and does not overlap with the current location of the module. These constraints clearly distinguish our problem from classical memory allocation. We present a number of algorithmic results, including a bound of {Θ}(n^2) on physical sorting if there is a sufficiently large free space and sum up NP-hardness results for arbitrary initial layouts. For online scenarios in which modules arrive one at a time, we present a method that requires O(1) moves per insertion or deletion and amortized cost O(m_i lg hat{m}) per insertion or deletion, where m i is the module’s size, hat{m} is the size of the largest module and costs for moves are linear in the size of a module.

  6. Improved detection of deletions and duplications in the DMD gene using the multiplex ligation-dependent probe amplification (MLPA) method.

    Science.gov (United States)

    Sansović, Ivona; Barišić, Ingeborg; Dumić, Katja

    2013-04-01

    The multiplex ligation-dependent probe amplification (MLPA) assay is the most powerful tool in screening for deletions and duplications in the dystrophin gene in patients with Duchenne and Becker muscular dystrophy (DMD/BMD). The efficacy of the assay was validated by testing 20 unrelated male patients with DMD/BMD who had already been screened by multiplex PCR (mPCR). We detected two duplications that had been missed by mPCR. In one DMD patient showing an ambiguous MLPA result, a novel mutation (c.3808_3809insG) was identified. MLPA improved the mutation detection rate of mPCR by 15 %. The results of our study (1) confirmed MLPA to be the method of choice for detecting DMD gene rearrangements in DMD/BMD patients, (2) showed that ambiguous MLPA amplification products should be verified by other methods, and (3) indicated that the MLPA method could be used in screening even for small mutations located in the probe-binding regions.

  7. Atypical X-linked ichthyosis in a patient with a large deletion involving the steroid sulfatase (STS) gene.

    Science.gov (United States)

    Gonzalez-Huerta, Luz; Mendiola-Jimenez, Jaime; Del Moral-Stevenel, Maria; Rivera-Vega, Maria; Cuevas-Covarrubias, Sergio

    2009-02-01

    A 70-year-old male presented with very large, thick, tightly adherent, dark-brown scales on the front of his lower extremities. His face, neck, back, abdomen, upper extremities, flexural areas, palms and soles as well as hair and nails were not involved. Family history was negative for similar lesions. Otherwise, the patient had a normal development. Onset of symptoms occurred during childhood with scales on lower extremities with no more additional features. Treatment included emollients exclusively with partial and temporary remission of cutaneous lesions. Recently, the patient had not received topical or systemic medical treatment. Laboratory investigations were within normal limits. The patient had undetectable levels of STS activity when compared with normal control (0.00 pmol mg(-1) protein h(-1)) which confirmed the diagnosis of X-linked ichthyosis (XLI) . PCR analysis showed deletion of the STS gene, markers DXS1139 and DXF22S1and the 5' end of the VCX3A gene. The patient had scales present on lower extremities only with no medical treatment that corresponded to an unusual clinical manifestation of XLI. Clinical manifestations of XLI are due to a great variety of environmental, genetic and individual factors that should be considered in XLI diagnosis.

  8. Traditional risk factors and angiotensin-converting enzyme insertion/deletion gene polymorphism in coronary artery disease.

    Science.gov (United States)

    Sahin, S; Ceyhan, K; Benli, I; Ozyurt, H; Naseri, E; Tumuklu, M M; Aydogan, L; Elalmis, A O; Ozugurlu, A F; Onalan, O

    2015-03-20

    We investigated whether the insertion/deletion (I/D) polymorphism in the angiotensin-converting enzyme (ACE) gene and serum ACE levels are associated with traditional risk factors of coronary artery disease (CAD). We enrolled 250 individuals without CAD and 750 individuals suffering from CAD who were angiographically diagnosed. Biochemical risk factors, the ACE (I/D) gene polymorphism, and ACE serum levels were compared. ACE genotypes were determined using real-time polymerase chain reaction. ACE serum levels were determined using an enzyme-linked immunosorbent assay. Lipid parameters were determined spectrophotometrically using an autoanalyzer. Compared to the control group, the CAD group showed significantly higher serum ACE levels (P < 0.001). The highest ACE levels were found in those with the DD genotype. Other genotypes also presented statistically significant differences. We observed a significant difference between the control and coronary patient groups regarding the levels of total cholesterol, triglyceride, high-density lipoprotein-cholesterol, and low-density lipoprotein-cholesterol (P < 0.05). ACE (I/D) genotypes and serum ACE levels may be associated with risk factors and the development of CAD.

  9. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    OpenAIRE

    Effat, Laila K.; El-Harouni, Ashraf A.; Khalda S. Amr; El-Minisi, Tarik I.; Nagwa Abdel Meguid; Mostafa El-Awady

    2000-01-01

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK) levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers wer...

  10. Precise Null Deletion Mutations of the Mycothiol Synthesis Genes Reveal Their Role in Isoniazid and Ethionamide Resistance in Mycobacterium smegmatis ▿

    Science.gov (United States)

    Xu, Xia; Vilchèze, Catherine; Av-Gay, Yossef; Gómez-Velasco, Anaximandro; Jacobs, William R.

    2011-01-01

    Mycothiol (MSH; AcCys-GlcN-Ins) is the glutathione analogue for mycobacteria. Mutations in MSH biosynthetic genes have been associated with resistance to isoniazid (INH) and ethionamide (ETH) in mycobacteria, but rigorous genetic studies are lacking, and those that have been conducted have yielded different results. In this study, we constructed independent null deletion mutants for all four genes involved in the MSH biosynthesis pathway (mshA, mshB, mshC, and mshD) in Mycobacterium smegmatis and made complementing constructs in integrating plasmids. The resulting set of strains was analyzed for levels of MSH, INH resistance, and ETH resistance. The mshA and mshC single deletion mutants were devoid of MSH production and resistant to INH, whereas the mshB deletion mutant produced decreased levels of MSH yet was sensitive to INH, suggesting that MSH biosynthesis is essential for INH susceptibility in M. smegmatis. Further evidence supporting this conclusion was generated by deleting the gene encoding the MSH S-conjugate amidase (mca) from the ΔmshB null mutant. This double mutant, ΔmshB Δmca, completely abolished MSH production and was resistant to INH. The mshA, mshC, and mshB single deletion mutants were also resistant to ETH, indicating that ETH resistance is modulated by the level of MSH in M. smegmatis. Surprisingly, the mshD deletion mutant lacked MSH production but was sensitive to both INH and ETH. The drug sensitivity was likely mediated by the compensated synthesis of N-formyl-Cys-GlcN-Ins, previously demonstrated to substitute for MSH in an mshD mutant of M. smegmatis. We conclude that MSH or N-formyl-Cys-GlcN-Ins is required for susceptibility to INH or ETH in M. smegmatis. PMID:21502624

  11. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  12. Cloning of a cDNA for steroid sulfatase: frequent occurrence of gene deletions in patients with recessive X chromosome-linked ichthyosis

    Energy Technology Data Exchange (ETDEWEB)

    Bonifas, J.M.; Morley, B.J.; Oakey, R.E.; Kan, Y.W.; Epstein, E.J. Jr.

    1987-12-01

    A human steroid sulfatase cDNA 2.4 kilobases long was isolated from a human placental lambda gt11 cDNA expression library. The library was screened with monospecific rabbit antibodies elicited by injection of steroid sulfatase protein purified from human placentas. Hybridization of the cDNA with EcoRI-digested genomic DNA indicated that patients from 14 of 15 apparently unrelated families have gross deletions of the gene for steroid sulfatase. One patient had genomic DNA fragments that were identical to those from normal individuals, indicating the absence of any major deletions as the cause of his lack of steroid sulfatase enzyme activity.

  13. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  14. Identification of the crp gene in avian Pasteurella multocida and evaluation of the effects of crp deletion on its phenotype, virulence and immunogenicity.

    Science.gov (United States)

    Zhao, Xinxin; Liu, Qing; Xiao, Kangpeng; Hu, Yunlong; Liu, Xueyan; Li, Yanyan; Kong, Qingke

    2016-06-24

    Pasteurella multocida (P. multocida) is an important veterinary pathogen that can cause severe diseases in a wide range of mammals and birds. The global regulator crp gene has been found to regulate the virulence of some bacteria, and crp mutants have been demonstrated to be effective attenuated vaccines against Salmonella enterica and Yersinia enterocolitica. Here, we first characterized the crp gene in P. multocida, and we report the effects of a crp deletion. The P. multocida crp mutant exhibited a similar lipopolysaccharide and outer membrane protein profile but displayed defective growth and serum complement resistance in vitro compared with the parent strain. Furthermore, crp deletion decreased virulence but did not result in full attenuation. The 50 % lethal dose (LD50) of the Δcrp mutant was 85-fold higher than that of the parent strain for intranasal infection. Transcriptome sequencing analysis showed that 92 genes were up-regulated and 94 genes were down-regulated in the absence of the crp gene. Finally, we found that intranasal immunization with the Δcrp mutant triggered both systematic and mucosal antibody responses and conferred 60 % protection against virulent P. multocida challenge in ducks. The deletion of the crp gene has an inhibitory effect on bacterial growth and bacterial resistance to serum complement in vitro. The P. multocida crp mutant was attenuated and conferred moderate protection in ducks. This work affords a platform for analyzing the function of crp and aiding the formulation of a novel vaccine against P. multocida.

  15. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela

    2013-01-01

    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  16. Construction of a Recyclable Genetic Marker and Serial Gene Deletions in the Human Pathogenic Mucorales Mucor circinelloides

    Directory of Open Access Journals (Sweden)

    Alexis Garcia

    2017-07-01

    Full Text Available Mucor circinelloides is a human pathogen, biofuel producer, and model system that belongs to a basal fungal lineage; however, the genetics of this fungus are limited. In contrast to ascomycetes and basidiomycetes, basal fungal lineages have been understudied. This may be caused by a lack of attention given to these fungi, as well as limited tools for genetic analysis. Nonetheless, the importance of these fungi as pathogens and model systems has increased. M. circinelloides is one of a few genetically tractable organisms in the basal fungi, but it is far from a robust genetic system when compared to model fungi in the subkingdom Dikarya. One problem is the organism is resistant to drugs utilized to select for dominant markers in other fungal transformation systems. Thus, we developed a blaster recyclable marker system by using the pyrG gene (encoding an orotidine-5′-phosphate decarboxylase, ortholog of URA3 in Saccharomyces cerevisiae. A 237-bp fragment downstream of the pyrG gene was tandemly incorporated into the upstream region of the gene, resulting in construction of a pyrG-dpl237 marker. To test the functionality of the pyrG-dpl237 marker, we disrupted the carRP gene that is involved in carotenoid synthesis in pyrG− mutant background. The resulting carRP::pyrG-dpl237 mutants exhibit a white colony phenotype due to lack of carotene, whereas wild type displays yellowish colonies. The pyrG marker was then successfully excised, generating carRP-dpl237 on 5-FOA medium. The mutants became auxotrophic and required uridine for growth. We then disrupted the calcineurin B regulatory subunit cnbR gene in the carRP::dpl237 strain, generating mutants with the alleles carRP::dpl237 and cnbR::pyrG. These results demonstrate that the recyclable marker system is fully functional, and therefore the pyrG-dpl237 marker can be used for sequential gene deletions in M. circinelloides.

  17. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-04

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  18. A deletion in the VLDLR gene in Eurasier dogs with cerebellar hypoplasia resembling a Dandy-Walker-like malformation (DWLM.

    Directory of Open Access Journals (Sweden)

    Martina Gerber

    Full Text Available Dandy-Walker-like malformation (DWLM is the result of aberrant brain development and mainly characterized by cerebellar hypoplasia. DWLM affected dogs display a non-progressive cerebellar ataxia. Several DWLM cases were recently observed in the Eurasier dog breed, which strongly suggested a monogenic autosomal recessive inheritance in this breed. We performed a genome-wide association study (GWAS with 9 cases and 11 controls and found the best association of DWLM with markers on chromosome 1. Subsequent homozygosity mapping confirmed that all 9 cases were homozygous for a shared haplotype in this region, which delineated a critical interval of 3.35 Mb. We sequenced the genome of an affected Eurasier and compared it with the Boxer reference genome and 47 control genomes of dogs from other breeds. This analysis revealed 4 private non-synonymous variants in the critical interval of the affected Eurasier. We genotyped these variants in additional dogs and found perfect association for only one of these variants, a single base deletion in the VLDLR gene encoding the very low density lipoprotein receptor. This variant, VLDLR:c.1713delC is predicted to cause a frameshift and premature stop codon (p.W572Gfs*10. Variants in the VLDLR gene have been shown to cause congenital cerebellar ataxia and mental retardation in human patients and Vldlr knockout mice also display an ataxia phenotype. Our combined genetic data together with the functional knowledge on the VLDLR gene from other species thus strongly suggest that VLDLR:c.1713delC is indeed causing DWLM in Eurasier dogs.

  19. A deletion in the VLDLR gene in Eurasier dogs with cerebellar hypoplasia resembling a Dandy-Walker-like malformation (DWLM).

    Science.gov (United States)

    Gerber, Martina; Fischer, Andrea; Jagannathan, Vidhya; Drögemüller, Michaela; Drögemüller, Cord; Schmidt, Martin J; Bernardino, Filipa; Manz, Eberhard; Matiasek, Kaspar; Rentmeister, Kai; Leeb, Tosso

    2015-01-01

    Dandy-Walker-like malformation (DWLM) is the result of aberrant brain development and mainly characterized by cerebellar hypoplasia. DWLM affected dogs display a non-progressive cerebellar ataxia. Several DWLM cases were recently observed in the Eurasier dog breed, which strongly suggested a monogenic autosomal recessive inheritance in this breed. We performed a genome-wide association study (GWAS) with 9 cases and 11 controls and found the best association of DWLM with markers on chromosome 1. Subsequent homozygosity mapping confirmed that all 9 cases were homozygous for a shared haplotype in this region, which delineated a critical interval of 3.35 Mb. We sequenced the genome of an affected Eurasier and compared it with the Boxer reference genome and 47 control genomes of dogs from other breeds. This analysis revealed 4 private non-synonymous variants in the critical interval of the affected Eurasier. We genotyped these variants in additional dogs and found perfect association for only one of these variants, a single base deletion in the VLDLR gene encoding the very low density lipoprotein receptor. This variant, VLDLR:c.1713delC is predicted to cause a frameshift and premature stop codon (p.W572Gfs*10). Variants in the VLDLR gene have been shown to cause congenital cerebellar ataxia and mental retardation in human patients and Vldlr knockout mice also display an ataxia phenotype. Our combined genetic data together with the functional knowledge on the VLDLR gene from other species thus strongly suggest that VLDLR:c.1713delC is indeed causing DWLM in Eurasier dogs.

  20. Intragenic deletion in the Desmoglein 4 gene underlies the skin phenotype in the Iffa Credo "hairless" rat.

    Science.gov (United States)

    Bazzi, Hisham; Kljuic, Ana; Christiano, Angela M; Christiano, Angela M; Panteleyev, Andrey A

    2004-10-01

    The Iffa Credo (IC) "hairless" rat is an autosomal recessive hypotrichotic animal model actively used in pharmacological and dermatological studies. Although the molecular basis of the IC rat phenotype was never defined, the designation "hr/hr" (hairless) has been used for this rat mutation. Despite the observation that IC rats share many phenotypic similarities with Charles River (CR) 'hairless rats', crossbreeding between CR and IC rats indicated that these mutations are not allelic, and moreover, genetic analysis of both CR and IC hairless mutant rats showed no mutations in the hr gene. Here, we present a detailed analysis of the skin phenotype in the IC rat. While the initial stages of hair follicle (HF) morphogenesis reveal no significant abnormalities, the subsequent processes of inner root sheath and hair shaft formation are severely disturbed due to impaired proliferation in the hair matrix and abnormal differentiation in the precortex zone. This results in significant reduction of hair bulb volume, and the formation of dysmorphic "blebbed" hair shafts lacking medullar structure and resembling "lanceolate" hairs. Based on the presence of lance-head hairs typical of rodent lanceolate mutants, we performed molecular analysis of the desmoglein 4 gene and found a large intragenic deletion encompassing nine exons of the gene. This finding, together with specific morphological features of skin and hairs, confirms that the IC rat is allelic with the lanceolate hair (lah) mutations in mice and rats. Our results elucidate the genetic and morphological basis of the IC rat mutation, thus providing a new model to study molecular mechanisms of hair growth control.

  1. Deletion of the Men1 Gene Prevents Streptozotocin-Induced Hyperglycemia in Mice

    Directory of Open Access Journals (Sweden)

    Yuqing Yang

    2010-01-01

    Full Text Available Diabetes ultimately results from an inadequate number of functional beta cells in the islets of Langerhans. Enhancing proliferation of functional endogenous beta cells to treat diabetes remains underexplored. Here, we report that excision of the Men1 gene, whose loss-of-function mutation leads to inherited multiple endocrine neoplasia type 1 (MEN1, rendered resistant to streptozotocin-induced hyperglycemia in a tamoxifen-inducible and temporally controlled Men1 excision mouse model as well as in a tissue-specific Men1 excision mouse model. Men1 excision prevented mice from streptozotocin-induced hyperglycemia mainly through increasing the number of functional beta cells. BrdU incorporation by beta cells, islet size, and circulating insulin levels were significantly increased in Men1-excised mice. Membrane localization of glucose transporter 2 was largely preserved in Men1-excised beta cells, but not in Men1-expressing beta cells. Our findings suggest that repression of menin, a protein encoded by the Men1 gene, might be a valuable means to maintain or increase the number of functional endogenous beta cells to prevent or ameliorate diabetes.

  2. Elevation of serum creatine kinase as the only manifestation of an intragenic deletion of the dystrophin gene in three unrelated families.

    Science.gov (United States)

    Melis, M A; Cau, M; Muntoni, F; Mateddu, A; Galanello, R; Boccone, L; Deidda, F; Loi, D; Cao, A

    1998-01-01

    This study reports three children from three unrelated families, aged from 9 to 12 years, who were investigated because of the incidental finding of elevated serum creatine kinase (CK) levels and were found to have a dystrophinopathy. The molecular defect consisted of a deletion of variable extent within the central rod domain of the dystrophin gene, involving either exons 32-44 or 48-51 or 48-53. In each family we found the same deletion in at least one adult male relative aged from 40 to 77 years, who was either completely asymptomatic or had very mild muscle involvement (thin muscles and/or mild scoliosis), with normal or borderline CK levels. This study suggests once again that deletions of the central rod domain of dystrophin may be associated with elevation of serum CK as the only manifestation and that prediction of the clinical severity based solely on the molecular findings should be interpreted with caution.

  3. Adult-onset deletion of the Prader-Willi syndrome susceptibility gene Snord116 in mice results in reduced feeding and increased fat mass.

    Science.gov (United States)

    Purtell, Louise; Qi, Yue; Campbell, Lesley; Sainsbury, Amanda; Herzog, Herbert

    2017-04-01

    The imprinted small nucleolar RNA (snoRNA) Snord116 is implicated in the aetiology of Prader-Willi syndrome (PWS), a disease associated with hyperphagia and obesity. Germline deletion of Snord116 in mice has been found to lead to increased food intake but not to the development of obesity. To determine the role of Snord116 independent of potential compensatory developmental factors, we investigated the effects of conditional adult-onset deletion of Snord116 in mice. Deletion of Snord116 was induced at 8 weeks of age by oral administration of tamoxifen to male Snordlox/lox; ROSAcre/+ mice, with vehicle-treated mice used as controls. Body weight (BW) was monitored weekly and body composition was measured by dual-energy X-ray absorptiometry and tissue dissection. Non-fasted and fasting-induced food intake was determined, and glucose and insulin tolerance tests were performed. Twenty-four-hour energy expenditure and physical activity were assessed by indirect calorimetry. Adult-onset deletion of Snord116 led to reduced food intake and increased adiposity, albeit with no concomitant change in BW or lean mass compared to controls. Adult onset Snord116 deletion was also associated with worsened glucose tolerance and insulin sensitivity. This study identified a key role for Snord116 in feeding behaviour and growth. Further, it is likely that the effects of this gene are modulated by developmental stage, as mice with adult-onset deletion showed an opposite phenotype, with respect to food intake and body composition, to previously published data on mice with germline deletion.

  4. Splice site and deletion mutations in keratin (KRT1 and KRT10) genes: unusual phenotypic alterations in Scandinavian patients with epidermolytic hyperkeratosis.

    Science.gov (United States)

    Virtanen, Marie; Smith, S Kaye; Gedde-Dahl, Tobias; Vahlquist, Anders; Bowden, Paul E

    2003-11-01

    Epidermolytic hyperkeratosis is a rare autosomal dominant inherited skin disorder caused by keratin 1 or keratin 10 mutations. Keratins are major structural proteins of the epidermis, and in keratinocytes committed to terminal differentiation the intermediate filaments are composed of keratin 1 and keratin 10 heterodimers. The majority of reported mutations (86.6%) are heterozygous single point mutations and most of these are located in the 1A and 2B regions of the highly conserved keratin alpha-helical rod domain. We have studied eight Scandinavian families with epidermolytic hyperkeratosis and identified three point mutations, two codon deletions, two splice site mutations, and a complex deletion/insertion. Two of the point mutations were in the KRT1 gene (F191C and K177N) and the other was in KRT10 (L453P). All three patients had associated palmoplantar keratoderma. The splice site mutations in KRT1 both caused a large deletion removing 22 codons (delta176-197) from the 1A helical domain. Codon deletions were found in KRT1 (delta170-173) and in KRT10 (delta161-162) in two patients with a severe phenotype. A final patient had a more complex mutation with a large deletion (442 bp) together with a large insertion (214 bp) of unknown origin that caused deletion of exon 6 in KRT1. In conclusion, we have found eight novel keratin mutations that cause epidermolytic hyperkeratosis with differing phenotypes. Even when a large part of keratin 1 (46 amino acids) is deleted, surprisingly mild phenotypes can result, suggesting that genotype-phenotype relationships in epidermolytic hyperkeratosis are complex and do not solely depend on the type of mutation but also depend on interactions between the behavior of the mutant protein and the cellular environment.

  5. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  6. Two rare deletions upstream of the NRXN1 gene (2p16.3) affecting the non-coding mRNA AK127244 segregate with diverse psychopathological phenotypes in a family

    DEFF Research Database (Denmark)

    Duong, L. T. T.; Hoeffding, L. K.; Petersen, K. B.

    2015-01-01

    susceptibility. In this study, we describe a family affected by a wide range of psychiatric disorders including early onset schizophrenia, schizophreniform disorder, and affective disorders. Microarray analysis identified two rare deletions immediately upstream of the NRXN1 gene affecting the non-coding mRNA AK......127244 in addition to the pathogenic 15q11.2 deletion in distinct family members. The two deletions upstream of the NRXN1 gene were found to segregate with psychiatric disorders in the family and further similar deletions have been observed in patients diagnosed with autism spectrum disorder. Thus, we...

  7. Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity

    DEFF Research Database (Denmark)

    Iba, K; Durkin, M E; Johnsen, L

    2001-01-01

    and muscle. To test the functional role of tetranectin directly, we have generated mice with a targeted disruption of the gene. We report that the tetranectin-deficient mice exhibit kyphosis, a type of spinal deformity characterized by an increased curvature of the thoracic spine. The kyphotic angles were...... in the morphology of the vertebrae. Histological analysis of the spines of these mice revealed an apparently asymmetric development of the growth plate and of the intervertebral disks of the vertebrae. In the most advanced cases, the growth plates appeared disorganized and irregular, with the disk material...... protruding through the growth plate. Tetranectin-null mice had a normal peak bone mass density and were not more susceptible to ovariectomy-induced osteoporosis than were their littermates as determined by dual-emission X-ray absorptiometry scanning. These results demonstrate that tetranectin plays a role...

  8. IFN-beta gene deletion leads to augmented and chronic demyelinating experimental autoimmune encephalomyelitis

    DEFF Research Database (Denmark)

    Teige, Ingrid; Treschow, Alexandra; Teige, Anna

    2003-01-01

    Since the basic mechanisms behind the beneficial effects of IFN-beta in multiple sclerosis (MS) patients are still obscure, here we have investigated the effects of IFN-beta gene disruption on the commonly used animal model for MS, experimental autoimmune encephalomyelitis (EAE). We show that IFN......-beta knockout (KO) mice are more susceptible to EAE than their wild-type (wt) littermates; they develop more severe and chronic neurological symptoms with more extensive CNS inflammation and demyelination. However, there was no discrepancy observed between wt and KO mice regarding the capacity of T cells...... to proliferate or produce IFN-gamma in response to recall Ag. Consequently, we addressed the effect of IFN-beta on encephalitogenic T cell development and the disease initiation phase by passive transfer of autoreactive T cells from KO or wt littermates to both groups of mice. Interestingly, IFN-beta KO mice...

  9. Diminished thrombogenic responses by deletion of the Podocalyxin Gene in mouse megakaryocytes.

    Directory of Open Access Journals (Sweden)

    Miguel Pericacho

    Full Text Available Podocalyxin (Podxl is a type I membrane sialoprotein of the CD34 family, originally described in the epithelial glomerular cells of the kidney (podocytes in which it plays an important function. Podxl can also be found in megakaryocytes and platelets among other extrarenal places. The surface exposure of Podxl upon platelet activation suggested it could play some physiological role. To elucidate the function of Podxl in platelets, we generated mice with restricted ablation of the podxl gene in megakaryocytes using the Cre-LoxP gene targeting methodology. Mice with Podxl-null megakaryocytes did not show any apparent phenotypical change and their rates of growth, life span and fertility did not differ from the floxed controls. However, Podxl-null mice showed prolonged bleeding time and decreased platelet aggregation in response to physiological agonists. The number, size-distribution and polyploidy of Podxl-null megakaryocytes were similar to the floxed controls. Podxl-null platelets showed normal content of surface receptors and normal activation by agonists. However, the mice bearing Podxl-null platelets showed a significant retardation in the ferric chloride-induced occlusion of the carotid artery. Moreover, acute thrombosis induced by the i.v. injection of sublethal doses of collagen and phenylephrine produced a smaller fall in the number of circulating platelets in Podxl-null mice than in control mice. In addition, perfusion of uncoagulated blood from Podxl-null mice in parallel flow chamber showed reduced adhesion of platelets and formation of aggregates under high shear stress. It is concluded that platelet Podxl is involved in the control of hemostasis acting as a platelet co-stimulator, likely due to its pro-adhesive properties.

  10. A deletion in the Hermansky-Pudlak syndrome 4 (Hps4) gene appears to be responsible for albinism in channel catfish.

    Science.gov (United States)

    Li, Yueru; Geng, Xin; Bao, Lisui; Elaswad, Ahmed; Huggins, Kevin W; Dunham, Rex; Liu, Zhanjiang

    2017-06-01

    Albinism is caused by a series of genetic abnormalities leading to reduction of melanin production. Albinism is quite frequent in catfish, but the causative gene and the molecular basis were unknown. In this study, we conducted a genome-wide association study (GWAS) using the 250 K SNP array. The GWAS analysis allowed mapping of the albino phenotype in the Hermansky-Pudlak syndrome 4 (Hps4) gene, which is known to be involved in melanosome biosynthesis. Sequencing analysis revealed that a 99-bp deletion was present in all analyzed albino catfish at the intron 2 and exon 3 junction. This deletion led to the skipping of the entire exon 3 which was confirmed by RT-PCR. Therefore, Hps4 was determined to be the candidate gene of the catfish albinism.

  11. Deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene presents an asymptomatic phenotype, indicating a target region for multiexon skipping therapy.

    Science.gov (United States)

    Nakamura, Akinori; Fueki, Noboru; Shiba, Naoko; Motoki, Hirohiko; Miyazaki, Daigo; Nishizawa, Hitomi; Echigoya, Yusuke; Yokota, Toshifumi; Aoki, Yoshitsugu; Takeda, Shin'ichi

    2016-07-01

    Few cases of dystrophinopathy show an asymptomatic phenotype with mutations in the 5' (exons 3-7) hot spot in the Duchenne muscular dystrophy (DMD) gene. Our patient showed increased serum creatine kinase levels at 12 years of age. A muscle biopsy at 15 years of age led to a diagnosis of Becker muscular dystrophy. The patient showed a slight decrease in cardiac function at the age of 21 years and was administered a β-blocker, but there was no muscle involvement even at the age of 27 years. A deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene was detected, and dystrophin protein expression was ∼15% that of control level. We propose that in-frame deletion of exons 3-9 may produce a functional protein, and that multiexon skipping therapy targeting these exons may be feasible for severe dystrophic patients with a mutation in the 5' hot spot of the DMD gene.

  12. Deletion of JAM-C, a candidate gene for heart defects in Jacobsen syndrome, results in a normal cardiac phenotype in mice.

    Science.gov (United States)

    Ye, Maoqing; Hamzeh, Rabih; Geddis, Amy; Varki, Nissi; Perryman, M Benjamin; Grossfeld, Paul

    2009-07-01

    The 11q terminal deletion disorder (11q-) is a rare chromosomal disorder caused by a deletion in distal 11q. Fifty-six percent of patients have clinically significant congenital heart defects. A cardiac "critical region" has been identified in distal 11q that contains over 40 annotated genes. In this study, we identify the distal breakpoint of a patient with a paracentric inversion in distal 11q who had hypoplastic left heart and congenital thrombocytopenia. The distal breakpoint mapped to JAM-3, a gene previously identified as a candidate gene for causing HLHS in 11q-. To determine the role of JAM-3 in cardiac development, we performed a comprehensive cardiac phenotypic assessment in which the mouse homolog for JAM-3, JAM-C, has been deleted. These mice have normal cardiac structure and function, indicating that haplo-insufficiency of JAM-3 is unlikely to cause the congenital heart defects that occur in 11q- patients. Notably, we identified a previously undescribed phenotype, jitteriness, in most of the sick or dying adult JAM-C knockout mice. These data provide further insights into the identification of the putative disease-causing cardiac gene(s) in distal 11q, as well as the functions of JAM-C in normal organ development.

  13. Lethality of mice bearing a knockout of the Ngly1-gene is partially rescued by the additional deletion of the Engase gene.

    Directory of Open Access Journals (Sweden)

    Haruhiko Fujihira

    2017-04-01

    Full Text Available The cytoplasmic peptide:N-glycanase (Ngly1 in mammals is a de-N-glycosylating enzyme that is highly conserved among eukaryotes. It was recently reported that subjects harboring mutations in the NGLY1 gene exhibited severe systemic symptoms (NGLY1-deficiency. While the enzyme obviously has a critical role in mammals, its precise function remains unclear. In this study, we analyzed Ngly1-deficient mice and found that they are embryonic lethal in C57BL/6 background. Surprisingly, the additional deletion of the gene encoding endo-β-N-acetylglucosaminidase (Engase, which is another de-N-glycosylating enzyme but leaves a single GlcNAc at glycosylated Asn residues, resulted in the partial rescue of the lethality of the Ngly1-deficient mice. Additionally, we also found that a change in the genetic background of C57BL/6 mice, produced by crossing the mice with an outbred mouse strain (ICR could partially rescue the embryonic lethality of Ngly1-deficient mice. Viable Ngly1-deficient mice in a C57BL/6 and ICR mixed background, however, showed a very severe phenotype reminiscent of the symptoms of NGLY1-deficiency subjects. Again, many of those defects were strongly suppressed by the additional deletion of Engase in the C57BL/6 and ICR mixed background. The defects observed in Ngly1/Engase-deficient mice (C57BL/6 background and Ngly1-deficient mice (C57BL/6 and ICR mixed background closely resembled some of the symptoms of patients with an NGLY1-deficiency. These observations strongly suggest that the Ngly1- or Ngly1/Engase-deficient mice could serve as a valuable animal model for studies related to the pathogenesis of the NGLY1-deficiency, and that cytoplasmic ENGase represents one of the potential therapeutic targets for this genetic disorder.

  14. Analysis of the VCX3A, VCX2 and VCX3B genes shows that VCX3A gene deletion is not sufficient to result in mental retardation in X-linked ichthyosis.

    Science.gov (United States)

    Cuevas-Covarrubias, S A; González-Huerta, L M

    2008-03-01

    X-linked ichthyosis (XLI), an inborn error of metabolism, is due to steroid sulphatase (STS) deficiency. Most patients with XLI harbour complete deletion of the STS gene and flanking sequences. The presence of low copy number repeats on either side of the STS gene seems to have a major role in the high frequency of these deletions. Some patients with XLI with terminal deletions of Xp22.3 involving marker DXS1139 and the STS gene show mental retardation (MR); VCX3A is the only gene located on this critical region. To analyse the VCX3A, VCX, VCX2 and VCX3B genes in 80 unrelated Mexican patients with XLI with normal intelligence. STS activity was measured in the leucocytes using 7-[3H]-dehydroepiandrosterone sulphate as a substrate. Amplification of the regions from telomeric DXS89 to centromeric DXS1134 including both extremes of the STS and the VCX3A, VCX, VCX2 and VCX3B genes was performed using polymerase chain reaction. No STS activity was detected in the patients with XLI (0.00 pmol mg(-1) protein h(-1)). We observed two different deletion patterns: the first group included 62 patients with deletion of VCX3A and VCX genes. The second group included 18 patients with breakpoints at several regions on either side of the STS gene not including the VCX3A gene. These data indicate that more complex mechanisms, apart from possible VCX3A gene participation, are occurring in the genesis of MR in XLI, at least in the sample of Mexican patients analysed.

  15. The ACE Gene Insertion/Deletion Polymorphism and Cerebrovascular Diseases in Uzbek Patients with Arterial Hypertension

    Directory of Open Access Journals (Sweden)

    Nargiza U. Makhkamova

    2016-09-01

    Full Text Available The aim of the present study was to investigate the association between the ACE gene I/D polymorphism and the development of hypertensive encephalopathy (HE in Uzbek patients with hypertension (HT. Materials and methods: The study included 91 male patients aged from 32 to 74 years (mean age 52.5±9.2 with HT Grade 1, 2 and 3 (ESH/ESC, 2013 [4] and presence of HE. All patients were checked on office BP using Korotkov’s method and ambulatory blood pressure monitoring (ABPM. Intima-media thickness (IMT of the carotid artery was measured by a 7.5MHz high-resolution ultrasound. Genomic DNA was isolated from peripheral blood using the DiatomTM DNA Prep 200 Kit according to the manufacturer's protocol. ACE gene I/D polymorphism genotypes were determined by PCR. Results: Among HT patients with HE, we have identified a statistically significant predominance of ID genotype carriers (65.9% against carriers of the II genotype (18.75 and DD genotype (15.4% (P=0.000; the frequency of I and D alleles was 51.6% and 48.4%, respectively (P>0.05. Comparative analysis showed a possible association between the ID genotype/D allele and HE development in HT patients, according to the general model (OR = 6.36; 95% CI 3.04 -13.31; p=0.000 and multiplicative model (OR = 2.02; 95% CI 1.25 -3.27; p=0.004 of inheritance. High grades of HT were predominant in carriers of the DD genotype. IMT was significantly higher in carriers of the DD genotype than in carriers of the II and ID genotypes. The carriage of D allele was associated with the highest levels of TC, TG, and VLDL-C. Carriers of the DD genotype were characterized by higher values of daytime SBP, nighttime SBP variability and nighttime SBP load.

  16. Deletion of admB gene encoding a fungal ADAM affects cell wall construction in Aspergillus oryzae.

    Science.gov (United States)

    Kobayashi, Takuji; Maeda, Hiroshi; Takeuchi, Michio; Yamagata, Youhei

    2017-05-01

    Mammals possess a unique signaling system based on the proteolytic mechanism of a disintegrin and metalloproteinases (ADAMs) on the cell surface. We found two genes encoding ADAMs in Aspergillus oryzae and named them admA and admB. We produced admA and admB deletion strains to elucidate their biological function and clarify whether fungal ADAMs play a similar role as in mammals. The ∆admA∆admB and ∆admB strains were sensitive to cell wall-perturbing agents, congo red, and calcofluor white. Moreover, the two strains showed significantly increased weights of total alkali-soluble fractions from the mycelial cell wall compared to the control strain. Furthermore, ∆admB showed MpkA phosphorylation at lower concentration of congo red stimulation than the control strain. However, the MpkA phosphorylation level was not different between ∆admB and the control strain without the stimulation. The results indicated that A. oryzae AdmB involved in the cell wall integrity without going through the MpkA pathway.

  17. EAAC1 Gene Deletion Increases Neuronal Death and Blood Brain Barrier Disruption after Transient Cerebral Ischemia in Female Mice

    Directory of Open Access Journals (Sweden)

    Bo Young Choi

    2014-10-01

    Full Text Available EAAC1 is important in modulating brain ischemic tolerance. Mice lacking EAAC1 exhibit increased susceptibility to neuronal oxidative stress in mice after transient cerebral ischemia. EAAC1 was first described as a glutamate transporter but later recognized to also function as a cysteine transporter in neurons. EAAC1-mediated transport of cysteine into neurons contributes to neuronal antioxidant function by providing cysteine substrates for glutathione synthesis. Here we evaluated the effects of EAAC1 gene deletion on hippocampal blood vessel disorganization after transient cerebral ischemia. EAAC1−/− female mice subjected to transient cerebral ischemia by common carotid artery occlusion for 30 min exhibited twice as much hippocampal neuronal death compared to wild-type female mice as well as increased reduction of neuronal glutathione, blood–brain barrier (BBB disruption and vessel disorganization. Pre-treatment of N-acetyl cysteine, a membrane-permeant cysteine prodrug, increased basal glutathione levels in the EAAC1−/− female mice and reduced ischemic neuronal death, BBB disruption and vessel disorganization. These findings suggest that cysteine uptake by EAAC1 is important for neuronal antioxidant function under ischemic conditions.

  18. Safety and serological response to a matrix gene-deleted rabies virus-based vaccine vector in dogs.

    Science.gov (United States)

    McGettigan, James P; David, Frederic; Figueiredo, Monica Dias; Minke, Jules; Mebatsion, Teshome; Schnell, Matthias J

    2014-03-26

    Dogs account for the majority of human exposures and deaths due to rabies virus (RABV) worldwide. In this report, we show that a replication-deficient RABV-based vaccine in which the matrix gene is deleted (RABV-ΔM) is safe and induces rapid and potent VNA titers after a single inoculation in dogs. Average VNA titers peaked at 3.02 or 5.11 international units (IU/ml) by 14 days post-immunization with a single dose of 10(6) or 10(7) focus forming units (ffu), respectively, of RABV-ΔM. By day 70 post immunization, all dogs immunized with either dose of vaccine showed VNA titers >0.5IU/ml, the level indicative of a satisfactory immunization. Importantly, no systemic or local reactions were noted in any dog immunized with RABV-ΔM. The elimination of dog rabies through mass vaccination is hindered by limited resources, requirement for repeat vaccinations often for the life of a dog, and in some parts of the world, inferior vaccine quality. Our preliminary safety and immunogenicity data in dogs suggest that RABV-ΔM might complement currently used inactivated RABV-based vaccines in vaccination campaigns by helping to obtain 100% response in vaccinated dogs, thereby increasing overall vaccination coverage. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs.

    Science.gov (United States)

    Avishek, Kumar; Kaushal, Himanshu; Gannavaram, Sreenivas; Dey, Ranadhir; Selvapandiyan, Angamuthu; Ramesh, V; Negi, Narender Singh; Dubey, Uma S; Nakhasi, Hira L; Salotra, Poonam

    2016-09-14

    Currently no effective vaccine is available for human visceral leishmaniasis(VL) caused by Leishmania donovani. Previously, we showed that centrin1 and p27gene deleted live attenuated Leishmania parasites (LdCen1(-/-) and Ldp27(-/-)) are safe, immunogenic and protective in animal models. Here, to assess the correlates of protection, we evaluated immune responses induced by LdCen1(-/-) and Ldp27(-/-) in human blood samples obtained from healthy, healed VL (HVL), post kala-azar dermal leishmaniasis(PKDL) and VL subjects. Both parasites infected human macrophages, as effectively as the wild type parasites. Further, LdCen1(-/-) and Ldp27(-/-) strongly stimulated production of pro-inflammatory cytokines including, IL-12, IFN-γ, TNF-α, IL-2, IL-6 and IL-17 in the PBMCs obtained from individuals with a prior exposure to Leishmania (HVL and PKDL). There was no significant stimulation of anti-inflammatory cytokines (IL-4 and IL-10). Induction of Th1 biased immune responses was supported by a remarkable increase in IFN-γ secreting CD4(+) and CD8(+) T cells and IL-17 secreting CD4(+) cells in PBMCs from HVL cases with no increase in IL-10 secreting T cells. Hence, LdCen1(-/-) and Ldp27(-/-) are promising as live vaccine candidates against VL since they elicit strong protective immune response in human PBMCs from HVL, similar to the wild type parasite infection, mimicking a naturally acquired protection following cure.

  20. The effect of homozygous deletion of the BBOX1 and Fibin genes on carnitine level and acyl carnitine profile.

    Science.gov (United States)

    Rashidi-Nezhad, Ali; Talebi, Saeed; Saebnouri, Homeira; Akrami, Seyed Mohammad; Reymond, Alexandre

    2014-07-01

    Carnitine is a key molecule in energy metabolism that helps transport activated fatty acids into the mitochondria. Its homeostasis is achieved through oral intake, renal reabsorption and de novo biosynthesis. Unlike dietary intake and renal reabsorption, the importance of de novo biosynthesis pathway in carnitine homeostasis remains unclear, due to lack of animal models and description of a single patient defective in this pathway. We identified by array comparative genomic hybridization a 42 months-old girl homozygote for a 221 Kb interstitial deletions at 11p14.2, that overlaps the genes encoding Fibin and butyrobetaine-gamma 2-oxoglutarate dioxygenase 1 (BBOX1), an enzyme essential for the biosynthesis of carnitine de novo. She presented microcephaly, speech delay, growth retardation and minor facial anomalies. The levels of almost all evaluated metabolites were normal. Her serum level of free carnitine was at the lower limit of the reference range, while her acylcarnitine to free carnitine ratio was normal. We present an individual with a completely defective carnitine de novo biosynthesis. This condition results in mildly decreased free carnitine level, but not in clinical manifestations characteristic of carnitine deficiency disorders, suggesting that dietary carnitine intake and renal reabsorption are sufficient to carnitine homeostasis. Our results also demonstrate that haploinsufficiency of BBOX1 and/or Fibin is not associated with Primrose syndrome as previously suggested.

  1. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.

    Science.gov (United States)

    Denora, Paola S; Schlesinger, David; Casali, Carlo; Kok, Fernando; Tessa, Alessandra; Boukhris, Amir; Azzedine, Hamid; Dotti, Maria Teresa; Bruno, Claudio; Truchetto, Jeremy; Biancheri, Roberta; Fedirko, Estelle; Di Rocco, Maja; Bueno, Clarissa; Malandrini, Alessandro; Battini, Roberta; Sickl, Elisabeth; de Leva, Maria Fulvia; Boespflug-Tanguy, Odile; Silvestri, Gabriella; Simonati, Alessandro; Said, Edith; Ferbert, Andreas; Criscuolo, Chiara; Heinimann, Karl; Modoni, Anna; Weber, Peter; Palmeri, Silvia; Plasilova, Martina; Pauri, Flavia; Cassandrini, Denise; Battisti, Carla; Pini, Antonella; Tosetti, Michela; Hauser, Erwin; Masciullo, Marcella; Di Fabio, Roberto; Piccolo, Francesca; Denis, Elodie; Cioni, Giovanni; Massa, Roberto; Della Giustina, Elvio; Calabrese, Olga; Melone, Marina A B; De Michele, Giuseppe; Federico, Antonio; Bertini, Enrico; Durr, Alexandra; Brockmann, Knut; van der Knaap, Marjo S; Zatz, Mayana; Filla, Alessandro; Brice, Alexis; Stevanin, Giovanni; Santorelli, Filippo M

    2009-03-01

    Autosomal recessive spastic paraplegia with thinning of corpus callosum (ARHSP-TCC) is a complex form of HSP initially described in Japan but subsequently reported to have a worldwide distribution with a particular high frequency in multiple families from the Mediterranean basin. We recently showed that ARHSP-TCC is commonly associated with mutations in SPG11/KIAA1840 on chromosome 15q. We have now screened a collection of new patients mainly originating from Italy and Brazil, in order to further ascertain the spectrum of mutations in SPG11, enlarge the ethnic origin of SPG11 patients, determine the relative frequency at the level of single Countries (i.e., Italy), and establish whether there is one or more common mutation. In 25 index cases we identified 32 mutations; 22 are novel, including 9 nonsense, 3 small deletions, 4 insertions, 1 in/del, 1 small duplication, 1 missense, 2 splice-site, and for the first time a large genomic rearrangement. This brings the total number of SPG11 mutated patients in the SPATAX collection to 111 cases in 44 families and in 17 isolated cases, from 16 Countries, all assessed using homogeneous clinical criteria. While expanding the spectrum of mutations in SPG11, this larger series also corroborated the notion that even within apparently homogeneous population a molecular diagnosis cannot be achieved without full gene sequencing. 2008 Wiley-Liss, Inc.

  2. Effects of deletion of the prolactin receptor on ovarian gene expression

    Directory of Open Access Journals (Sweden)

    Kelly Paul A

    2003-02-01

    Full Text Available Abstract Prolactin (PRL exerts pleiotropic physiological effects in various cells and tissues, and is mainly considered as a regulator of reproduction and cell growth. Null mutation of the PRL receptor (R gene leads to female sterility due to a complete failure of embryo implantation. Pre-implantatory egg development, implantation and decidualization in the mouse appear to be dependent on ovarian rather than uterine PRLR expression, since progesterone replacement permits the rescue of normal implantation and early pregnancy. To better understand PRL receptor deficiency, we analyzed in detail ovarian and corpora lutea development of PRLR-/- females. The present study demonstrates that the ovulation rate is not different between PRLR+/+ and PRLR-/- mice. The corpus luteum is formed but an elevated level of apoptosis and extensive inhibition of angiogenesis occur during the luteal transition in the absence of prolactin signaling. These modifications lead to the decrease of LH receptor expression and consequently to a loss of the enzymatic cascades necessary to produce adequate levels of progesterone which are required for the maintenance of pregnancy.

  3. Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids

    Directory of Open Access Journals (Sweden)

    Barker James

    2010-04-01

    Full Text Available Abstract Background and objective With prolonged use of anabolic androgenic steroids (AAS, occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17 gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be

  4. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  5. An unusual insertion/deletion in the gene encoding the. beta. -subunit of propionyl-CoA carboxylase is a frequent mutation in Caucasian propionic acidemia

    Energy Technology Data Exchange (ETDEWEB)

    Tahara, T.; Kraus, J.P.; Rosenberg, L.E. (Yale Univ. School of Medicine, New Haven, CT (USA))

    1990-02-01

    Propionic acidemia is an inherited disorder of organic acid metabolism that is caused by deficiency of propionly-CoA carboxylase. Affected patients fall into two complementation groups, pccA and pccBC (subgroups B, C, and BC), resulting from deficiency of the nonidentical {alpha} and {beta} subunits of PCC, respectively. The authors have detected an unusual insertion/deletion in the DNA of patients from the pccBC and pccC subgroups that replaces 14 nucleotides in the coding sequence of the {beta} subunit with 12 nucleotides unrelated to this region of the gene. Among 14 unrelated Caucasian patients in the pccBc complementation group, this unique mutation was found in 8 of 28 mutant alleles examined. Mutant allele-specific oligonucleotide hybridization to amplified genomic DNAs revealed that the inserted 12 nucleotides do not originate in an {approx}1000-bp region around the mutation. In the course of the investigation, they identified another mutation in the same exon: a 3-bp in-frame deletion that eliminates one of two isoleucine codons immediately preceding the Msp I site. Two unrelated patients were compound heterozygotes for this single-codon deletion and for the insertion/deletion described above. They conclude that either there is a propensity for the PCC {beta}-subunit gene to undergo mutations of this sort at this position or, more likely, the mutations in all of the involved Caucasian patients have a common origin in preceding generations.

  6. EGFR exon 19 in-frame deletion and polymorphisms of DNA repair genes in never-smoking female lung adenocarcinoma patients.

    Science.gov (United States)

    Yang, Shi-Yi; Yang, Tsung-Ying; Li, Yao-Jen; Chen, Kun-Chieh; Liao, Kuo-Meng; Hsu, Kuo-Hsuan; Tsai, Chi-Ren; Chen, Chih-Yi; Hsu, Chung-Ping; Hsia, Jiun-Yi; Chuang, Cheng-Yen; Tsai, Ying-Huang; Chen, Kuan-Yu; Huang, Ming-Shyan; Su, Wu-Chou; Chen, Yuh-Min; Hsiung, Chao A; Shen, Chen-Yang; Chang, Gee-Chen; Yang, Pan-Chyr; Chen, Chien-Jen

    2013-01-15

    We explored potential associations between genetic polymorphisms in genes related to DNA repair and detoxification metabolism and epidermal growth factor receptor (EGFR) mutations in a cohort of 410 never-smoking patients with lung adenocarcinoma. Multivariate-adjusted odds ratios (aORs) and corresponding 95% confidence intervals (CI) of EGFR mutation status in association with the genotypes of DNA repair and detoxification metabolism genes were evaluated using logistic regression analysis. We found an association between in-frame deletion in EGFR exon 19 and a single nucleotide polymorphism (SNP) rs1800566C/T located in NQO1 (aOR, 2.2 with 95% CI, 1.0-4.8) in female never-smokers. The SNP rs744154C/G in ERCC4 was also associated with the EGFR exon 19 in-frame deletion both in never-smokers (aOR, 1.7 with 95% CI, 1.0-3.0) and female never-smokers (aOR, 1.9 with 95% CI, 1.0-3.6). Although the association was marginally significant in multivariate logistic regression analysis, the A/A genotype of rs1047840 in EXO1 was associated with a 7.6-fold increase in the occurrence of the EGFR exon 19 in-frame deletion in female never-smokers. Moreover, risk alleles in NQO1, ERCC4 and EXO1 were associated with an increasing aOR of the EGFR exon 19 in-frame deletion both in never-smokers (p = 0.007 for trend) and female never-smokers (p = 0.002 for trend). Our findings suggest that the in-frame deletion in EGFR exon 19 is associated with polymorphisms in DNA repair and detoxification metabolism genes in never-smoking lung adenocarcinoma patients, especially in females. Copyright © 2012 UICC.

  7. Characterization of a genetically engineered mouse model of hemophilia A with complete deletion of the F8 gene.

    Science.gov (United States)

    Chao, B N; Baldwin, W H; Healey, J F; Parker, E T; Shafer-Weaver, K; Cox, C; Jiang, P; Kanellopoulou, C; Lollar, P; Meeks, S L; Lenardo, M J

    2016-02-01

    ESSENTIALS: Anti-factor VIII (FVIII) inhibitory antibody formation is a severe complication in hemophilia A therapy. We genetically engineered and characterized a mouse model with complete deletion of the F8 coding region. F8(TKO) mice exhibit severe hemophilia, express no detectable F8 mRNA, and produce FVIII inhibitors. The defined background and lack of FVIII in F8(TKO) mice will aid in studying FVIII inhibitor formation. The most important complication in hemophilia A treatment is the development of inhibitory anti-Factor VIII (FVIII) antibodies in patients after FVIII therapy. Patients with severe hemophilia who express no endogenous FVIII (i.e. cross-reacting material, CRM) have the greatest incidence of inhibitor formation. However, current mouse models of severe hemophilia A produce low levels of truncated FVIII. The lack of a corresponding mouse model hampers the study of inhibitor formation in the complete absence of FVIII protein. We aimed to generate and characterize a novel mouse model of severe hemophilia A (designated the F8(TKO) strain) lacking the complete coding sequence of F8 and any FVIII CRM. Mice were created on a C57BL/6 background using Cre-Lox recombination and characterized using in vivo bleeding assays, measurement of FVIII activity by coagulation and chromogenic assays, and anti-FVIII antibody production using ELISA. All F8 exonic coding regions were deleted from the genome and no F8 mRNA was detected in F8(TKO) mice. The bleeding phenotype of F8(TKO) mice was comparable to E16 mice by measurements of factor activity and tail snip assay. Similar levels of anti-FVIII antibody titers after recombinant FVIII injections were observed between F8(TKO) and E16 mice. We describe a new C57BL/6 mouse model for severe hemophilia A patients lacking CRM. These mice can be directly bred to the many C57BL/6 strains of genetically engineered mice, which is valuable for studying the impact of a wide variety of genes on FVIII inhibitor formation on a

  8. Deletion of the Braun lipoprotein-encoding gene and altering the function of lipopolysaccharide attenuate the plague bacterium.

    Science.gov (United States)

    Sha, Jian; Kirtley, Michelle L; van Lier, Christina J; Wang, Shaofei; Erova, Tatiana E; Kozlova, Elena V; Cao, Anthony; Cong, Yingzi; Fitts, Eric C; Rosenzweig, Jason A; Chopra, Ashok K

    2013-03-01

    Braun (murein) lipoprotein (Lpp) and lipopolysaccharide (LPS) are major components of the outer membranes of Enterobacteriaceae family members that are capable of triggering inflammatory immune responses by activating Toll-like receptors 2 and 4, respectively. Expanding on earlier studies that demonstrated a role played by Lpp in Yersinia pestis virulence in mouse models of bubonic and pneumonic plague, we characterized an msbB in-frame deletion mutant incapable of producing an acyltransferase that is responsible for the addition of lauric acid to the lipid A moiety of LPS, as well as a Δlpp ΔmsbB double mutant of the highly virulent Y. pestis CO92 strain. Although the ΔmsbB single mutant was minimally attenuated, the Δlpp single mutant and the Δlpp ΔmsbB double mutant were significantly more attenuated than the isogenic wild-type (WT) bacterium in bubonic and pneumonic animal models (mouse and rat) of plague. These data correlated with greatly reduced survivability of the aforementioned mutants in murine macrophages. Furthermore, the Δlpp ΔmsbB double mutant was grossly compromised in its ability to disseminate to distal organs in mice and in evoking cytokines/chemokines in infected animal tissues. Importantly, mice that survived challenge with the Δlpp ΔmsbB double mutant, but not the Δlpp or ΔmsbB single mutant, in a pneumonic plague model were significantly protected against a subsequent lethal WT CO92 rechallenge. These data were substantiated by the fact that the Δlpp ΔmsbB double mutant maintained an immunogenicity comparable to that of the WT strain and induced long-lasting T-cell responses against heat-killed WT CO92 antigens. Taken together, the data indicate that deletion of the msbB gene augmented the attenuation of the Δlpp mutant by crippling the spread of the double mutant to the peripheral organs of animals and by inducing cytokine/chemokine responses. Thus, the Δlpp ΔmsbB double mutant could provide a new live-attenuated background

  9. A novel single gene deletion (-αMAL3.5 giving rise to silent α thalassemia carrier removing the entire HBA2 gene observed in two Chinese patients with Hb H disease: case report of two probands

    Directory of Open Access Journals (Sweden)

    Faidatul Syazlin Abdul Hamid

    2015-07-01

    Full Text Available We report a novel deletion at the HBA2 presented with Hb H disease in two Malaysian- Chinese patients. The two unrelated probands were diagnosed with Hb H disease in a primary hematological screening for thalassemia. Results from routine molecular analysis with gap-polymerase chain reaction (PCR method revealed a genotype asynchrony with the observed clinical presentation. Subsequent DNA analysis using a battery of molecular methods such as gap-PCR, multiplex ligation dependent probe amplification, DNA sequencing, confirmed the presence of a novel deletion in both the index cases removing the entire α2 globin gene. We have designated the deletion as (‒αMAL3.5. Hematological indices and clinical findings suggest that the deletion has an α+ phenotype. The molecular process of this deletion is the result from misalignment and unequal crossover event between the duplicated homologous Y-boxes within the α globin gene cluster. Uncharacterized deletions, single nucleotide polymorphism and other nucleotide indels at the primer binding sites may impede the optimum condition for its annealing and extension and therefore may invalidate the gap-PCR obscuring the real genotype.

  10. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  11. Deletion of the small RNA chaperone protein Hfq down regulates genes related to virulence and confers protection against wild-type Brucella challenge in mice

    Directory of Open Access Journals (Sweden)

    Shuangshuang eLei

    2016-01-01

    Full Text Available Brucellosis is one of the most common zoonotic epidemics worldwide. Brucella, the etiological pathogen of brucellosis, has unique virulence characteristics, including the ability to survive within the host cell. Hfq is a bacterial chaperone protein that is involved in the survival of the pathogen under stress conditions. Moreover, hfq affects the expression of a large number of target genes. In the present study, we characterized the expression and regulatory patterns of the target genes of Hfq during brucellosis. The results revealed that hfq expression is highly induced in macrophages at the early infection stage and at the late stage of mouse infection. Several genes related to virulence, including omp25, omp31, vjbR, htrA, gntR, and dnaK, were found to be regulated by hfq during infection in BALB/c mice. Gene expression and cytokine secretion analysis revealed that an hfq-deletion mutant induced different cytokine profiles compared with that induced by 16M. Infection with the hfq-deletion mutant induced protective immune responses against 16M challenge. Together, these results suggest that hfq is induced during infection and its deletion results in significant attenuation which affects the host immune response caused by Brucella infection. By regulating genes related to virulence, hfq promotes the virulence of Brucella. The unique characteristics of the hfq-deletion mutant, including its decreased virulence and the ability to induce protective immune response upon infection, suggest that it represents an attractive candidate for the design of a live attenuated vaccine against Brucella.

  12. [THE EFFECT OF waaL LIGASE GENES DELETION ON MOTILITY AND STRESS ADAPTATION REACTIONS OF YERSINIA ENTEROCOLITICA 6471/76].

    Science.gov (United States)

    Shevchenko, J I; Shilina, J V; Pozur, V K; Skurnik, M

    2015-01-01

    The aim of current study was to estimate the influence of waaL(OS) and waaL(PS) genes deletion on lipopolysaccharide (LPS) synthesis, bacterial motility and stress resistance of bacteria Yersinia enterocolitica 6471/76. Single and double waaL mutants were created by replacing the wild-type alleles in bacterial chromosome for mutant ones. The phenotypes of mutants were visualized by DOC-PAGE gels stained with silver and immunoblot with specific to O-polysaccharide and outer core monoclonal antibodies. Bacterial motility was evaluated by the diameter of the migration zone. Wild type bacteria and mutants were analyzed by bacterial growth curves in a hypertonic medium. Participation of WaaL ligases in resistance to osmotic pressure was found only in case of both ligese genes deletion. Also the YeO3_os_ps mutants showed motility decreasing, which recovered after adding a functionally active gene. Thus, deletion of both waaL ligase genes lead to a drastic reduction in bacterial motility and increase their sensitivity to hypertonic medium that can indirectly characterize biological role of WaaL ligases.

  13. Zebrafish homologs of genes within 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes.

    Science.gov (United States)

    Blaker-Lee, Alicia; Gupta, Sunny; McCammon, Jasmine M; De Rienzo, Gianluca; Sive, Hazel

    2012-11-01

    Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs), intellectual disability disorder (IDD) and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV). The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed 'dosage sensors'), which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development - impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa) and kinesin family member 22 (kif22) genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least) two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.

  14. The deletion of bacterial dynamin and flotillin genes results in pleiotrophic effects on cell division, cell growth and in cell shape maintenance

    Directory of Open Access Journals (Sweden)

    Dempwolff Felix

    2012-12-01

    Full Text Available Abstract Background In eukaryotic cells, dynamin and flotillin are involved in processes such as endocytosis and lipid raft formation, respectively. Dynamin is a GTPase that exerts motor-like activity during the pinching off of vesicles, while flotillins are coiled coil rich membrane proteins with no known enzymatic activity. Bacteria also possess orthologs of both classes of proteins, but their function has been unclear. Results We show that deletion of the single dynA or floT genes lead to no phenotype or a mild defect in septum formation in the case of the dynA gene, while dynA floT double mutant cells were highly elongated and irregularly shaped, although the MreB cytoskeleton appeared to be normal. DynA colocalizes with FtsZ, and the dynA deletion strain shows aberrant FtsZ rings in a subpopulation of cells. The mild division defect of the dynA deletion is exacerbated by an additional deletion in ezrA, which affects FtsZ ring formation, and also by the deletion of a late division gene (divIB, indicating that DynA affects several steps in cell division. DynA and mreB deletions generated a synthetic defect in cell shape maintenance, showing that MreB and DynA play non-epistatic functions in cell shape maintenance. TIRF microscopy revealed that FloT forms many dynamic membrane assemblies that frequently colocalize with the division septum. The deletion of dynA did not change the pattern of localization of FloT, and vice versa, showing that the two proteins play non redundant roles in a variety of cellular processes. Expression of dynamin or flotillin T in eukaryotic S2 cells revealed that both proteins assemble at the cell membrane. While FloT formed patch structures, DynA built up tubulated structures extending away from the cells. Conclusions Bacillus subtilis dynamin ortholog DynA plays a role during cell division and in cell shape maintenance. It shows a genetic link with flotillin T, with both proteins playing non-redundant functions at

  15. Organization and Evolution of a Gene-Rich Region of the Mouse Genome: A 12.7-Mb Region Deleted in the Del(13)Svea36H Mouse

    Science.gov (United States)

    Mallon, Ann-Marie; Wilming, Laurens; Weekes, Joseph; Gilbert, James G.R.; Ashurst, Jennifer; Peyrefitte, Sandrine; Matthews, Lucy; Cadman, Matthew; McKeone, Richard; Sellick, Chris A.; Arkell, Ruth; Botcherby, Marc R.M.; Strivens, Mark A.; Campbell, R. Duncan; Gregory, Simon; Denny, Paul; Hancock, John M.; Rogers, Jane; Brown, Steve D.M.

    2004-01-01

    Del(13)Svea36H (Del36H) is a deletion of ∼20% of mouse chromosome 13 showing conserved synteny with human chromosome 6p22.1-6p22.3/6p25. The human region is lost in some deletion syndromes and is the site of several disease loci. Heterozygous Del36H mice show numerous phenotypes and may model aspects of human genetic disease. We describe 12.7 Mb of finished, annotated sequence from Del36H. Del36H has a higher gene density than the draft mouse genome, reflecting high local densities of three gene families (vomeronasal receptors, serpins, and prolactins) which are greatly expanded relative to human. Transposable elements are concentrated near these gene families. We therefore suggest that their neighborhoods are gene factories, regions of frequent recombination in which gene duplication is more frequent. The gene families show different proportions of pseudogenes, likely reflecting different strengths of purifying selection and/or gene conversion. They are also associated with relatively low simple sequence concentrations, which vary across the region with a periodicity of ∼5 Mb. Del36H contains numerous evolutionarily conserved regions (ECRs). Many lie in noncoding regions, are detectable in species as distant as Ciona intestinalis, and therefore are candidate regulatory sequences. This analysis will facilitate functional genomic analysis of Del36H and provides insights into mouse genome evolution. PMID:15364904

  16. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  17. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Science.gov (United States)

    Atanassov, Ivan I; Atanassov, Ilian I; Etchells, J Peter; Turner, Simon R

    2009-01-01

    Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data. PMID:19863796

  18. Genome and gene alterations by insertions and deletions in the evolution of human and chimpanzee chromosome 22

    Directory of Open Access Journals (Sweden)

    Volfovsky Natalia

    2009-01-01

    Full Text Available Abstract Background Understanding structure and function of human genome requires knowledge of genomes of our closest living relatives, the primates. Nucleotide insertions and deletions (indels play a significant role in differentiation that underlies phenotypic differences between humans and chimpanzees. In this study, we evaluated distribution, evolutionary history, and function of indels found by comparing syntenic regions of the human and chimpanzee genomes. Results Specifically, we identified 6,279 indels of 10 bp or greater in a ~33 Mb alignment between human and chimpanzee chromosome 22. After the exclusion of those in repetitive DNA, 1,429 or 23% of indels still remained. This group was characterized according to the local or genome-wide repetitive nature, size, location relative to genes, and other genomic features. We defined three major classes of these indels, using local structure analysis: (i those indels found uniquely without additional copies of indel sequence in the surrounding (10 Kb region, (ii those with at least one exact copy found nearby, and (iii those with similar but not identical copies found locally. Among these classes, we encountered a high number of exactly repeated indel sequences, most likely due to recent duplications. Many of these indels (683 of 1,429 were in proximity of known human genes. Coding sequences and splice sites contained significantly fewer of these indels than expected from random expectations, suggesting that selection is a factor in limiting their persistence. A subset of indels from coding regions was experimentally validated and their impacts were predicted based on direct sequencing in several human populations as well as chimpanzees, bonobos, gorillas, and two subspecies of orangutans. Conclusion Our analysis demonstrates that while indels are distributed essentially randomly in intergenic and intronic genomic regions, they are significantly under-represented in coding sequences. There are

  19. Androgen Insensitivity Syndrome in a Family of Warmblood Horses Caused by a 25-bp Deletion of the DNA-Binding Domain of the Androgen Receptor Gene

    DEFF Research Database (Denmark)

    Eastman Welsford, G.; Munk, Rikke; Villagómez, Daniel A.F.

    2017-01-01

    Testicular feminization, an earlier term coined for describing a syndrome resulting from failure of masculinization of target organs by androgen secretions during embryo development, has been well documented not only in humans but also in the domestic horse. The pathology, actually referred to as...... pedigree segregating AIS, where the molecular analyses of the androgen receptor gene in the family provided evidences that a 25-bp deletion of the DNA-binding domain is causative of this equine syndrome....

  20. A 556 kb deletion in the downstream region of the PAX6 gene causes familial aniridia and other eye anomalies in a Chinese family.

    Science.gov (United States)

    Cheng, Fang; Song, Wulian; Kang, Yang; Yu, Shihui; Yuan, Huiping

    2011-02-10

    The paired box gene 6 (PAX6) on human chromosome 11p13 is an essential transcription factor for eye formation in animals. Mutations in PAX6 can lead to varieties of autosomal-dominant ocular malformations with aniridia as the major clinical signs. Known genetic alterations causing haplo-insufficiency of PAX6 include nonsense mutations, frame-shift mutations, splicing errors, or genomic deletions. The purpose of this study was to identify genetic defects as the underlying cause of familial aniridia in a large Chinese family. All exons of PAX6 in the proband were sequenced by the Sanger sequencing technique. The genome of the proband was evaluated by a microarray-based comparative genomic hybridization (aCGH). Quantitative real-time PCR was applied to verify the abnormal aCGH findings in the proband and to test five other family members. There were no detectable pathogenic mutations in the exons of PAX6 in the proband. The aCGH analysis showed two copies of PAX6 but revealed a 566 kb hemizygous deletion of chromosome 11p13, including four annotated genes doublecortin domain containing 1 (DCDC1), DnaJ homolog subfamily C member 24 (DNAJC24), IMP1 inner mitochondrial membrane(IMMP1L), andelongation factor protein 4 (ELP4) downstream of PAX6. Quantitative real-time PCR verified the deletion in the proband and further identified the deletion in a blind fashion in four affected family members but not in the one with a normal phenotype. The 566 kb hemizygous deletion of chromosome 11p13 downstream of PAX6 should be the cause of the familial aniridia in this Chinese family, although two copies of PAX6 are intact. aCGH evaluation should be applied if there is a negative result for the mutation detection of PAX6 in patients with aniridia.

  1. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  2. Simultaneous Deletion of the 9GL and UK Genes from the African Swine Fever Virus Georgia 2007 Isolate Offers Increased Safety and Protection against Homologous Challenge.

    Science.gov (United States)

    O'Donnell, Vivian; Risatti, Guillermo R; Holinka, Lauren G; Krug, Peter W; Carlson, Jolene; Velazquez-Salinas, Lauro; Azzinaro, Paul A; Gladue, Douglas P; Borca, Manuel V

    2017-01-01

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Successful experimental vaccines have been derived from naturally occurring, cell culture-adapted, or genetically modified live attenuated ASFV. Recombinant viruses harboring engineered deletions of specific virulence-associated genes induce solid protection against challenge with parental viruses. Deletion of the 9GL (B119L) gene in the highly virulent ASFV isolates Malawi Lil-20/1 (Mal) and Pretoriuskop/96/4 (Δ9GL viruses) resulted in complete protection when challenged with parental isolates. When similar deletions were created within the ASFV Georgia 2007 (ASFV-G) genome, attenuation was achieved but the protective and lethal doses were too similar. To enhance attenuation of ASFV-G, we deleted another gene, UK (DP96R), which was previously shown to be involved in attenuation of the ASFV E70 isolate. Here, we report the construction of a double-gene-deletion recombinant virus, ASFV-G-Δ9GL/ΔUK. When administered intramuscularly (i.m.) to swine, there was no induction of disease, even at high doses (10 6 HAD 50 ). Importantly, animals infected with 10 4 50% hemadsorbing doses (HAD 50 ) of ASFV-G-Δ9GL/ΔUK were protected as early as 14 days postinoculation when challenged with ASFV-G. The presence of protection correlates with the appearance of serum anti-ASFV antibodies, but not with virus-specific circulating ASFV-specific gamma interferon (IFN-γ)-producing cells. ASFV-G-Δ9GL/ΔUK is the first rationally designed experimental ASFV vaccine that protects against the highly virulent ASFV Georgia 2007 isolate as early as 2 weeks postvaccination. Currently, there is no commercially available vaccine against African swine fever. Outbreaks of the disease are devastating to the swine

  3. Heterozygosity for a deletion in the CKR-5 gene leads to prolonged AIDS-free survival and slower CD4 T-cell decline in a cohort of HIV-seropositive individuals

    DEFF Research Database (Denmark)

    Eugen-Olsen, J; Iversen, Anton; Garred, P

    1997-01-01

    Recently, it has been shown that a homozygous 32 base-pair deletion in the gene encoding CKR-5, a major coreceptor for HIV-1, leads to resistance to infection with HIV-1. We have investigated whether HIV-seropositive individuals who were heterozygous for the CKR-5 deletion had a different course...

  4. Unmarked gene deletion mutagenesis of kstD, encoding 3-ketosteroid Delta1-dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker.

    Science.gov (United States)

    van der Geize, R; Hessels, G I; van Gerwen, R; van der Meijden, P; Dijkhuizen, L

    2001-12-18

    This paper reports the first method for the construction of unmarked gene deletion mutants in the genus Rhodococcus. Unmarked deletion of the kstD gene, encoding 3-ketosteroid Delta1-dehydrogenase (KSTD1) in Rhodococcus erythropolis SQ1, was achieved using the sacB counter-selection system. Conjugative mobilization of the mutagenic plasmid from Escherichia coli S17-1 to R. erythropolis strain SQ1 was used to avoid its random genomic integration. The kstD gene deletion mutant, designated strain RG1, still possessed about 10% of the KSTD enzyme activity of wild-type and was not affected in its ability to grow on the steroid substrates 4-androstene-3,17-dione (AD) and 9alpha-hydroxy-4-androstene-3,17-dione (9OHAD). Biochemical evidence subsequently was obtained for the presence of a second KSTD enzyme (KSTD2) in R. erythropolis SQ1. UV mutants of strain RG1 unable to grow on AD were isolated. One of these mutants, strain RG1-UV29, had lost all KSTD enzyme activity and was also unable to grow on 9OHAD. It stoichiometrically converted AD into 9OHAD in concentrations as high as 20 g x l(-1). The two KSTD enzymes apparently both function in AD and 9OHAD catabolism. These isoenzymes have been inactivated in strain RG1 (KSTD1 negative) and strain RG1-UV29 (KSTD1 and KSTD2 negative), respectively.

  5. Deleting exon 55 from the nebulin gene induces severe muscle weakness in a mouse model for nemaline myopathy.

    Science.gov (United States)

    Ottenheijm, Coen A C; Buck, Danielle; de Winter, Josine M; Ferrara, Claudia; Piroddi, Nicoletta; Tesi, Chiara; Jasper, Jeffrey R; Malik, Fady I; Meng, Hui; Stienen, Ger J M; Beggs, Alan H; Labeit, Siegfried; Poggesi, Corrado; Lawlor, Michael W; Granzier, Henk

    2013-06-01

    Nebulin--a giant sarcomeric protein--plays a pivotal role in skeletal muscle contractility by specifying thin filament length and function. Although mutations in the gene encoding nebulin (NEB) are a frequent cause of nemaline myopathy, the most common non-dystrophic congenital myopathy, the mechanisms by which mutations in NEB cause muscle weakness remain largely unknown. To better understand these mechanisms, we have generated a mouse model in which Neb exon 55 is deleted (Neb(ΔExon55)) to replicate a founder mutation seen frequently in patients with nemaline myopathy with Ashkenazi Jewish heritage. Neb(ΔExon55) mice are born close to Mendelian ratios, but show growth retardation after birth. Electron microscopy studies show nemaline bodies--a hallmark feature of nemaline myopathy--in muscle fibres from Neb(ΔExon55) mice. Western blotting studies with nebulin-specific antibodies reveal reduced nebulin levels in muscle from Neb(ΔExon55) mice, and immunofluorescence confocal microscopy studies with tropomodulin antibodies and phalloidin reveal that thin filament length is significantly reduced. In line with reduced thin filament length, the maximal force generating capacity of permeabilized muscle fibres and single myofibrils is reduced in Neb(ΔExon55) mice with a more pronounced reduction at longer sarcomere lengths. Finally, in Neb(ΔExon55) mice the regulation of contraction is impaired, as evidenced by marked changes in crossbridge cycling kinetics and by a reduction of the calcium sensitivity of force generation. A novel drug that facilitates calcium binding to the thin filament significantly augmented the calcium sensitivity of submaximal force to levels that exceed those observed in untreated control muscle. In conclusion, we have characterized the first nebulin-based nemaline myopathy model, which recapitulates important features of the phenotype observed in patients harbouring this particular mutation, and which has severe muscle weakness caused by

  6. Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism and Small Vessel Cerebral Stroke in Indian Population

    Directory of Open Access Journals (Sweden)

    Puttachandra Prabhakar

    2014-01-01

    Full Text Available Background. Hypertension is an established risk factor for small-vessel cerebral stroke and the renin-angiotensin system plays an important role in the maintenance of blood pressure. We aimed at evaluating the contribution of the angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism to the risk of small-vessel stroke in south Indian population. Materials and Methods. We investigated 128 patients diagnosed with small-vessel stroke and 236 age, and gender-matched healthy controls. ACE I/D polymorphism was detected by polymerase chain reaction. Results. Hypertension was significantly more prevalent in the patient group and was associated with 6-fold increase in risk for stroke. ACE genotypes were in Hardy-Weinberg equilibrium in both patients and controls. Prevalence of DD, ID, and II genotypes in cases (34.4%, 43.7%, and 28% did not differ significantly from controls (31.8%, 43.2%, and 25%. The polymorphism was not associated with small-vessel stroke (OR: 1.34; 95% CI: 0.52–1.55. However, diastolic blood pressure was associated with the ACE I/D genotypes in the patients. (DD; 90.2±14.2> ID; 86.2±11.9> II; 82.3±7.8 mm Hg,  P=0.047. Conclusion. Our study showed that hypertension, but not ACE I/D polymorphism, increased the risk of small-vessel stroke.

  7. Modulation of learning and memory by the targeted deletion of the circadian clock gene Bmal1 in forebrain circuits.

    Science.gov (United States)

    Snider, Kaitlin H; Dziema, Heather; Aten, Sydney; Loeser, Jacob; Norona, Frances E; Hoyt, Kari; Obrietan, Karl

    2016-07-15

    A large body of literature has shown that the disruption of circadian clock timing has profound effects on mood, memory and complex thinking. Central to this time keeping process is the master circadian pacemaker located within the suprachiasmatic nucleus (SCN). Of note, within the central nervous system, clock timing is not exclusive to the SCN, but rather, ancillary oscillatory capacity has been detected in a wide range of cell types and brain regions, including forebrain circuits that underlie complex cognitive processes. These observations raise questions about the hierarchical and functional relationship between the SCN and forebrain oscillators, and, relatedly, about the underlying clock-gated synaptic circuitry that modulates cognition. Here, we utilized a clock knockout strategy in which the essential circadian timing gene Bmal1 was selectively deleted from excitatory forebrain neurons, whilst the SCN clock remained intact, to test the role of forebrain clock timing in learning, memory, anxiety, and behavioral despair. With this model system, we observed numerous effects on hippocampus-dependent measures of cognition. Mice lacking forebrain Bmal1 exhibited deficits in both acquisition and recall on the Barnes maze. Notably, loss of forebrain Bmal1 abrogated time-of-day dependent novel object location memory. However, the loss of Bmal1 did not alter performance on the elevated plus maze, open field assay, and tail suspension test, indicating that this phenotype specifically impairs cognition but not affect. Together, these data suggest that forebrain clock timing plays a critical role in shaping the efficiency of learning and memory retrieval over the circadian day. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Deletions in chromosome 4 differentially associated with the development of cervical cancer: evidence of slit2 as a candidate tumor suppressor gene.

    Science.gov (United States)

    Singh, Ratnesh Kumar; Indra, Dipanjana; Mitra, Sraboni; Mondal, Ranajit Kumar; Basu, Partha Sarathi; Roy, Anup; Roychowdhury, Susanta; Panda, Chinmay Kumar

    2007-08-01

    The aim of this study was to locate the candidate tumor suppressor genes (TSGs) loci in the chromosomal 4p15-16, 4q22-23 and 4q34-35 regions associated with the development of uterine cervical carcinoma (CA-CX). Deletion mapping of the regions by microsatellite markers identified six discrete areas with high frequency of deletions, viz. 4p16.2 (D1: 40%), 4p15.31 (D2: 35-38%), 4p15.2 (D3: 37-40%), 4q22.2 (D4: 34%), 4q34.2-34.3 (D5: 37-59%) and 4q35.1 (D6: 40-50%). Significant correlation was noted among the deleted regions D1, D2 and D3. The deletions in D1, D2, D5 and D6 regions are suggested to be associated with the cervical intraepithelial neoplasia (CIN), and deletions in the D2, D3, D5 and D6 regions seems to be associated with progression of CA-CX. The deletions in the D2 and D6 regions showed significant prognostic implications (P = 0.001; 0.02). The expression of the candidate TSG SLIT2 mapped to D2 region gradually reduced from normal cervix uteri -->CIN --> CA-CX. SLIT2 promoter hypermethylation was seen in 28% CIN samples and significantly increased with tumor progression (P = 0.04). Significant correlation was seen between SLIT2 deletion and its promoter methylation (P = 0.001), indicating that both these phenomena could occur simultaneously to inactivate this gene. Immunohistochemical analysis showed reduced expression of SLIT2 in cervical lesions and CA-CX cell lines. Although no mutation was detected in the SLIT2 promoter region (-432 to + 55 bp), CC and AA haplotypes were seen in -227 and -195 positions, respectively. Thus, it indicates that inactivation of SLIT2-ROBO1 signaling pathway may have an important role in CA-CX development.

  9. Prenatal Diagnosis of a 2.5 Mb De Novo 17q24.1q24.2 Deletion Encompassing KPNA2 and PSMD12 Genes in a Fetus with Craniofacial Dysmorphism, Equinovarus Feet, and Syndactyly

    Directory of Open Access Journals (Sweden)

    Marie-Emmanuelle Naud

    2017-01-01

    Full Text Available Interstitial 17q24.1 or 17q24.2 deletions were reported after conventional cytogenetic analysis or chromosomal microarray analysis in patients presenting intellectual disability, facial dysmorphism, and/or malformations. We report on a fetus with craniofacial dysmorphism, talipes equinovarus, and syndactyly associated with a de novo 2.5 Mb 17q24.1q24.2 deletion. Among the deleted genes, KPNA2 and PSMD12 are discussed for the correlation with the fetal phenotype. This is the first case of prenatal diagnosis of 17q24.1q24.2 deletion.

  10. Detection of large deletion in human BRCA1 gene in human breast carcinoma MCF-7 cells by using DNA-Silver Nanoclusters

    Science.gov (United States)

    Borghei, Yasaman-Sadat; Hosseini, Morteza; Ganjali, Mohammad Reza

    2018-01-01

    Here we describe a label-free detection strategy for large deletion mutation in breast cancer (BC) related gene BRCA1 based on a DNA-silver nanocluster (NC) fluorescence upon recognition-induced hybridization. The specific hybridization of DNA templated silver NCs fluorescent probe to target DNAs can act as effective templates for enhancement of AgNCs fluorescence, which can be used to distinguish the deletion of BRCA1 due to different fluorescence intensities. Under the optimal conditions, the fluorescence intensity of the DNA-AgNCs at emission peaks around 440 nm (upon excitation at 350 nm) increased with the increasing deletion type within a dynamic range from 1.0 × 10‑10 to 2.4 × 10‑6 M with a detection limit (LOD) of 6.4 × 10‑11 M. In this sensing system, the normal type shows no significant fluorescence; on the other hand, the deletion type emits higher fluorescence than normal type. Using this nanobiosensor, we successfully determined mutation using the non-amplified genomic DNAs that were isolated from the BC cell line.

  11. Pregnancy after preimplantation diagnosis for a deletion in the dystrophin gene by polymerase chain reaction in embryos obtained after intracytoplasmic sperm injection

    Energy Technology Data Exchange (ETDEWEB)

    Lissens, W.; Liu, J.; Van Broeckhoven, C. [University Hospital, Brussels (Belgium)] [and others

    1994-09-01

    Duchenne muscular dystrophy (DMD) is one of the most common X-linked recessive diseases. In order to be able to perform a DMD-specific preimplantation diagnosis (PID) in a female carrier of a deletion of exons 3 to 18 in the dystrophin gene, we have developed a PCR assay to detect the deletion based on sequences of exon 17. The efficiency of this PCR was evaluated on 50 single blastomeres from 12 normal control embryos and on 41 blastomeres for 9 male and 3 female embryos from the female DMD carrier, obtained after a first preimplantation diagnosis by sexing. The exon 17 region was amplified with 100% efficiency, except in all 21 blastomeres from 6 male embryos from the carrier where no PCR signals were observed. The negative results in these blastomeres were interpreted as being found only in male embryos carrying the deletion. Intracytoplasmic sperm injection was carried out on the carrier`s metaphase II oocytes retrieved after ovarian stimulation. Embryos were analyzed for the presence of exon 17 and 2 male embryos were found to be deleted, while 4 embryos showed normal amplification signals. Three of the latter embryos were replaced, resulting in a singleton pregnancy. Amniotic cell analysis showed a normal female karyotype and DNA analysis indicated a non-carrier.

  12. Renal angiomyolipoma bleeding in a patient with TSC2/PKD1 contiguous gene syndrome after 17 years of renal replacement therapy

    Directory of Open Access Journals (Sweden)

    Mónica Furlano

    2017-01-01

    Full Text Available We report the case of a 32-year-old male diagnosed with TSC2/PKD1 contiguous gene syndrome, presenting with tuberous sclerosis complex (TSC and autosomal dominant polycystic kidney disease simultaneously. He progressed to end-stage renal disease and received a kidney transplant at the age of 12. The native kidneys presented angiomyolipomas (AML, which are common benign tumours in patients with TSC. Seventeen years after transplantation, he presented with abdominal pain, anaemia and a retroperitoneal haematoma, the latter caused by renal AML bleeding. Selective embolisation was performed. Our patient could have benefited from the administration of mTOR inhibitors at transplant. This therapy is immunosuppressive and reduces the size of benign tumours in TSC as well as the risk of rupture and bleeding. This patient did not receive mTOR inhibitors at the time of the transplant because the relationship between mTOR inhibitors and TSC was unknown at that time. This case confirms the persistent risk of renal AML bleeding for both transplanted patients and patients on dialysis. As a result, we would recommend routine check-ups of native kidneys and nephrectomy assessment.

  13. Renal angiomyolipoma bleeding in a patient with TSC2/PKD1 contiguous gene syndrome after 17 years of renal replacement therapy.

    Science.gov (United States)

    Furlano, Mónica; Barreiro, Yaima; Martí, Teresa; Facundo, Carme; Ruiz-García, César; DaSilva, Iara; Ayasreh, Nadia; Cabrera-López, Cristina; Ballarín, José; Ars, Elisabet; Torra, Roser

    We report the case of a 32-year-old male diagnosed with TSC2/PKD1 contiguous gene syndrome, presenting with tuberous sclerosis (TS) and autosomal dominant polycystic kidney disease simultaneously. He progressed to end-stage renal disease and received a kidney transplant at the age of 12. The native kidneys presented angiomyolipomas (AML), which are common benign tumours in patients with TS. Seventeen years after transplantation, he presented with abdominal pain, anaemia and a retroperitoneal haematoma, the latter caused by renal AML bleeding. Selective embolisation was performed. Our patient could have benefited from the administration of mTOR inhibitors at transplant. This therapy is immunosuppressive and reduces the size of benign tumours in TS as well as the risk of rupture and bleeding. This patient did not receive mTOR inhibitors at the time of the transplant because the relationship between mTOR inhibitors and TS was unknown at that time. This case confirms the persistent risk of renal AML bleeding for both transplanted patients and patients on dialysis. As a result, we would recommend routine check-ups of native kidneys and nephrectomy assessment. Copyright © 2017 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  14. Altered ultrasonic vocalization and impaired learning and memory in Angelman syndrome mouse model with a large maternal deletion from Ube3a to Gabrb3.

    Directory of Open Access Journals (Sweden)

    Yong-Hui Jiang

    2010-08-01

    communication behaviors in human AS patients. Thus, mutant mice with a maternal deletion from Ube3a to Gabrb3 provide an AS mouse model that is molecularly more similar to the contiguous gene deletion form of AS in humans than mice with Ube3a mutation alone. These mice will be valuable for future comparative studies to mice with maternal deficiency of Ube3a alone.

  15. Altered Ultrasonic Vocalization and Impaired Learning and Memory in Angelman Syndrome Mouse Model with a Large Maternal Deletion from Ube3a to Gabrb3

    Science.gov (United States)

    Jiang, Yong-hui; Pan, Yanzhen; Zhu, Li; Landa, Luis; Yoo, Jong; Spencer, Corinne; Lorenzo, Isabel; Brilliant, Murray; Noebels, Jeffrey; Beaudet, Arthur L.

    2010-01-01

    communication behaviors in human AS patients. Thus, mutant mice with a maternal deletion from Ube3a to Gabrb3 provide an AS mouse model that is molecularly more similar to the contiguous gene deletion form of AS in humans than mice with Ube3a mutation alone. These mice will be valuable for future comparative studies to mice with maternal deficiency of Ube3a alone. PMID:20808828

  16. Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice.

    Science.gov (United States)

    Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D Woodrow; Ivy, Dunbar; Perryman, M B; Garrett-Sinha, Lee Ann; Grossfeld, Paul

    2010-02-15

    Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an approximately 7 Mb 'cardiac critical region' in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease.

  17. Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

    Science.gov (United States)

    Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

    2010-01-01

    Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

  18. Prenatal Diagnosis of Cystic Hygroma related to a Deletion of 16q24.1 with Haploinsufficiency of FOXF1 and FOXC2 Genes

    Directory of Open Access Journals (Sweden)

    Matthew J. Garabedian

    2012-01-01

    Full Text Available We report the prenatal diagnosis of cystic hygroma that was subsequently identified to have haploinsufficiency of the FOXF1 and FOXC2 genes via array comparative genomic hybridization (aCGH. Deletion o f these genes has previously neither been associated with cystic hygroma nor prenatally diagnosed. The FOX gene cluster is involved in cardiopulmonary development. This case expands the phenotypic spectrum o f abnormalities of the FOXF1 and FOXC2 genes, as it seems within the spectrum of function that disruption of the FOX gene cluster would lead to include abnormalities of prenatal onset. Identification of this association would not be possible with conventional karyotype or targeted aCGH. This case highlights the power of whole genomic aCGH to further delineate the etiology of birth defects.

  19. Nephrogenic diabetes insipidus in a patient with L1 syndrome : A new report of a contiguous gene deletion syndrome including L1CAM and AVPR2

    NARCIS (Netherlands)

    Knops, Noel B. B.; Bos, Krista K.; Kerstjens, Mieke; van Dael, Karin; Vos, Yvonne J.

    2008-01-01

    We report on.in infant boy \\vitli congenital hydrocephatLis CILle to 1.1 syndrorne and p0lyUria dne to diabetes itisipidtis. We initially believed Ins excessive Lirine loss was froin central diabetes insipidLIS and diat the cerebral inalforniation caused a secondary insufficient pitnitary

  20. Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

    Science.gov (United States)

    Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

    2014-06-01

    pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  1. Impact of the growth hormone receptor exon 3 deletion gene polymorphism on glucose metabolism, lipids, and insulin-like growth factor-I levels during puberty

    DEFF Research Database (Denmark)

    Sørensen, Kaspar; Aksglaede, Lise; Munch-Andersen, Thor

    2009-01-01

    CONTEXT: The GH/IGF-I axis has major impact on insulin sensitivity and insulin secretion. Recently a polymorphism in the GH receptor gene (GHR), a genomic deletion of exon 3 (GHRd3), has been linked to increased responsiveness to GH. OBJECTIVE: The objective of the present study was to evaluate...... the impact of the GHRd3 gene polymorphism on insulin sensitivity, insulin secretion, lipids, and IGF-I levels in healthy children and adolescents. DESIGN: This was cross-sectional and was part of the COPENHAGEN puberty study. SETTING: The study was conducted at a tertiary center for pediatric endocrinology...

  2. A novel 3-base deletion (IVS3+2_4delTGG of the hydroxymethylbilane synthase gene in a Brazilian patient with acute intermittent porphyria

    Directory of Open Access Journals (Sweden)

    Georgina Severo Ribeiro

    2007-01-01

    Full Text Available Acute intermittent porphyria (AIP, OMIM 176000 is an autosomal dominant metabolic disease caused by mutations in the gene encoding hydroxymethylbilane synthase (HMBS; EC 4.3.1.8; formely named porphobilinogen deaminase, PBGD, mapped to chromosome 11q23.3. We describe a novel mutation of the HMBS gene, a de novo 3-base deletion in the splicing donor site of intron 3 (IVS3+2_4delTGG in a woman affected by AIP. RT-PCR analysis revealed an abnormal HMBS mRNA, compatible with exon 3 skipping.

  3. Transcriptome Analysis of a Ustilago maydis ust1 Deletion Mutant Uncovers Involvement of Laccase and Polyketide Synthase Genes in Spore Development.

    Science.gov (United States)

    Islamovic, Emir; García-Pedrajas, María D; Chacko, Nadia; Andrews, David L; Covert, Sarah F; Gold, Scott E

    2015-01-01

    Ustilago maydis, causal agent of corn smut disease, is a dimorphic fungus alternating between a saprobic budding haploid and an obligate pathogenic filamentous dikaryon. Maize responds to U. maydis colonization by producing tumorous structures, and only within these does the fungus sporulate, producing melanized sexual teliospores. Previously we identified Ust1, an APSES (Asm1p, Phd1p, Sok2p, Efg1p, and StuAp) transcription factor, whose deletion led to filamentous haploid growth and the production of highly pigmented teliospore-like structures in culture. In this study, we analyzed the transcriptome of a ust1 deletion mutant and functionally characterized two highly upregulated genes with potential roles in melanin biosynthesis: um05361, encoding a putative laccase (lac1), and um06414, encoding a polyketide synthase (pks1). The Δlac1 mutant strains showed dramatically reduced virulence on maize seedlings and fewer, less-pigmented teliospores in adult plants. The Δpks1 mutant was unaffected in seedling virulence but adult plant tumors generated hyaline, nonmelanized teliospores. Thus, whereas pks1 appeared to be restricted to the synthesis of melanin, lac1 showed a broader role in virulence. In conclusion, the ust1 deletion mutant provided an in vitro model for sporulation in U. maydis, and functional analysis supports the efficacy of this in vitro mutant analysis for identification of genes involved in in planta teliosporogenesis.

  4. A deleted portion of one of the two xanthine dehydrogenase genes causes translucent larval skin in the oq mutant of the silkworm (Bombyx mori).

    Science.gov (United States)

    Kômoto, Natuo

    2002-06-01

    A silkworm mutant, oq, has translucent larval skin because it is deficient in xanthine dehydrogenase (XDH) activity and is unable to synthesize uric acid, which is normally accumulated in the larval epidermis and makes the skin white and opaque. Two XDH bands were found in zymograms of the silkworm fat body: an intense band (XDHalpha) and a faint one (XDHbeta). The oq mutant lacks only XDHalpha, which seemed to be the major source of XDH activity in the fat body. An 8-bp deletion found in BmXDH1, a silkworm XDH gene, generates a premature stop codon. The resulting truncated BmXDH1 protein lacks three molybdenum cofactor-binding domains necessary for enzyme activity. BmXDH2, the other XDH gene, does not show any apparent deficiencies. BmXDH1 expressed in yeast cells yielded an activity band with the same mobility as that of XDHalpha in zymograms. BmXDH1 of the oq mutant did not yield active XDH in yeast, while the activity was restored by filling in the deleted sequence. These results showed that BmXDH1 deletion in the oq mutant is responsible for the absence of significant XDH activity, resulting in the translucent larval skin of the mutant phenotype.

  5. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  6. Deletion hotspots in AMACR promoter CpG island are cis-regulatory elements controlling the gene expression in the colon.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2009-01-01

    Full Text Available Alpha-methylacyl-coenzyme A racemase (AMACR regulates peroxisomal beta-oxidation of phytol-derived, branched-chain fatty acids from red meat and dairy products -- suspected risk factors for colon carcinoma (CCa. AMACR was first found overexpressed in prostate cancer but not in benign glands and is now an established diagnostic marker for prostate cancer. Aberrant expression of AMACR was recently reported in Cca; however, little is known about how this gene is abnormally activated in cancer. By using a panel of immunostained-laser-capture-microdissected clinical samples comprising the entire colon adenoma-carcinoma sequence, we show that deregulation of AMACR during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island within the core promoter of AMACR. The double-deletion at CG3 and CG10 was found to be a somatic lesion. It existed in histologically normal colonic glands and tubular adenomas with low AMACR expression and was absent in villous adenomas and all CCas expressing variable levels of AMACR. In contrast, deletion of CG12-16 was shown to be a constitutional allele with a frequency of 43% in a general population. Its prevalence reached 89% in moderately differentiated CCas strongly expressing AMACR but only existed at 14% in poorly differentiated CCas expressing little or no AMACR. The DNA sequences housing these deletions were found to be putative cis-regulatory elements for Sp1 at CG3 and CG10, and ZNF202 at CG12-16. Chromatin immunoprecipitation, siRNA knockdown, gel shift assay, ectopic expression, and promoter analyses supported the regulation by Sp1 and ZNF202 of AMACR gene expression in an opposite manner. Our findings identified key in vivo events and novel transcription factors responsible for AMACR regulation in CCas and suggested these AMACR deletions may have diagnostic/prognostic value for

  7. CCR2 gene deletion and pharmacologic blockade ameliorate a severe murine experimental autoimmune neuritis model of Guillain-Barre syndrome.

    Directory of Open Access Journals (Sweden)

    Furong Yuan

    Full Text Available The molecular determinants and signaling pathways responsible for hematogenous leukocyte trafficking during peripheral neuroinflammation are incompletely elucidated. Chemokine ligand/receptor pair CCL2/CCR2 has been pathogenically implicated in the acute inflammatory demyelinating polyradiculoneuropathy variant of Guillain-Barré syndrome (GBS. We evaluated the role of CCR2 in peripheral neuroinflammation utilizing a severe murine experimental autoimmune neuritis (sm-EAN model. Sm-EAN was induced in 8-12 week old female SJL CCR2 knockout (CCR2KO, heterozygote (CCR2HT and wild type (CCR2WT mice, and daily neuromuscular severity scores and weights recorded. In vitro and in vivo splenocyte proliferation and cytokine expression assays, and sciatic nerve Toll-like receptor (TLR 2, TLR4 and CCL2 expression assays were performed to evaluate systemic and local innate immune activation at disease onset. Motor nerve electrophysiology and sciatic nerve histology were also performed to characterize the inflammatory neuropathy at expected peak severity. To further determine the functional relevance of CCR2 in sm-EAN, 20 mg/kg CCR2 antagonist, RS 102895 was administered daily for 5 days to a cohort of CCR2WT mice following sm-EAN disease onset, with efficacy compared to 400 mg/kg human intravenous immunoglobulin (IVIg. CCR2KO mice were relatively resistant to sm-EAN compared to CCR2WT and CCR2HT mice, associated with attenuated peripheral nerve demyelinating neuritis. Partial CCR2 gene deletion did not confer any protection against sm-EAN. CCR2KO mice demonstrated similar splenocyte activation or proliferation profiles, as well as TLR2, TLR4 and CCL2 expression to CCR2WT or CCR2HT mice, implying a direct role for CCR2 in sm-EAN pathogenesis. CCR2 signaling blockade resulted in rapid, near complete recovery from sm-EAN following disease onset. RS 102895 was significantly more efficacious than IVIg. CCR2 mediates pathogenic hematogenous monocyte trafficking

  8. Familial isolated primary hyperparathyroidism/hyperparathyroidism-jaw tumour syndrome caused by germline gross deletion or point mutations of CDC73 gene in Chinese.

    Science.gov (United States)

    Kong, Jing; Wang, Ou; Nie, Min; Shi, Jie; Hu, Yingying; Jiang, Yan; Li, Mei; Xia, Weibo; Meng, Xunwu; Xing, Xiaoping

    2014-08-01

    Hyperparathyroidism-jaw tumour syndrome (HPT-JT) and familial isolated primary hyperparathyroidism (FIHP) are two subtypes of familial primary hyperparathyroidism, which are rarely reported in Chinese population. Here, we reported three FIHP families and one HPT-JT family with long-term follow-up and genetic analysis. A total of 22 patients, from four FIHP/HPT-JT families of Chinese descent, were recruited and genomic DNA was extracted from their peripheral blood lymphocytes. Direct sequencing for MEN1, CDC73, CASR gene was conducted. Reverse transcription PCR (RT-PCR) and quantitative real-time PCR (qRT-PCR) were used to study the effect of splice site mutations and gross deletion mutations. Immunohistochemistry was performed to analyse parafibromin expression in parathyroid tumours. Genotype-phenotype correlations were assessed through clinical characteristics and long-term follow-up data. Genetic analysis revealed four CDC73 germline mutations that were responsible for the four kindreds, including two novel point mutation (c.157 G>T and IVS3+1 G>A), one recurrent point mutation (c.664 C>T) and one deletion mutation (c.307+?_513-?del exons 4, 5, 6). RT-PCR confirmed that IVS3+1 G>A generated an aberrant transcript with exon3 deletion. Immunohistochemical analysis demonstrated reduced nuclear parafibromin expression in tumours supporting the pathogenic effects of these mutations. This study supplies information on mutations and phenotypes of HPT-JT/FIHP syndrome in Chinese. Screening for gross deletion and point mutations of the CDC73 gene is necessary in susceptible subjects. © 2014 John Wiley & Sons Ltd.

  9. Unusual accelerated rate of deletions and insertions in toxin genes in the venom glands of the pygmy copperhead (Austrelaps labialis) from Kangaroo island.

    Science.gov (United States)

    Doley, Robin; Tram, Nguyen Ngoc Bao; Reza, Md Abu; Kini, R Manjunatha

    2008-02-28

    Toxin profiling helps in cataloguing the toxin present in the venom as well as in searching for novel toxins. The former helps in understanding potential pharmacological profile of the venom and evolution of toxins, while the latter contributes to understanding of novel mechanisms of toxicity and provide new research tools or prototypes of therapeutic agents. The pygmy copperhead (Austrelaps labialis) is one of the less studied species. In this present study, an attempt has been made to describe the toxin profile of A. labialis from Kangaroo Island using the cDNA library of its venom glands. We sequenced 658 clones which represent the common families of toxin genes present in snake venom. They include (a) putative long-chain and short-chain neurotoxins, (b) phospholipase A2, (c) Kunitz-type protease inhibitor, (d) CRISPs, (e) C-type lectins and (f) Metalloproteases. In addition, we have also identified a novel protein with two Kunitz-type domains in tandem similar to bikunin. Interestingly, the cDNA library reveals that most of the toxin families (17 out of 43 toxin genes; approximately 40%) have truncated transcripts due to insertion or deletion of nucleotides. These truncated products might not be functionally active proteins. However, cellular transcripts from the same venom glands are not affected. This unusual higher rate of deletion and insertion of nucleotide in toxin genes may be responsible for the lower toxicity of A. labialis venom of Kangroo Island and have significant effect on evolution of toxin genes.

  10. Identification of a deletion in the mismatch repair gene, MSH2, using mouse-human cell hybrids monosomal for chromosome 2.

    Science.gov (United States)

    Pyatt, R E; Nakagawa, H; Hampel, H; Sedra, M; Fuchik, M B; Comeras, I; de la Chapelle, A; Prior, T W

    2003-03-01

    Hereditary non-polyposis colorectal cancer is characterized by mutations in one of the DNA mismatch repair genes, primarily MLH1, MSH2, or MSH6. We report here the identification of a genomic deletion of approximately 11.4 kb encompassing the first two exons of the MSH2 gene in two generations of an Ohio family. By Southern blot analysis, using a cDNA probe spanning the first seven exons of MSH2, an alteration in each of three different enzyme digests (including a unique 13-kb band on HindIII digests) was observed, which suggested the presence of a large alteration in the 5' region of this gene. Mouse-human cell hybrids from a mutation carrier were then generated which contained a single copy each of human chromosome 2 on which the MSH2 gene resides. Southern blots on DNA from the cell hybrids demonstrated the same, unique 13-kb band from one MSH2 allele, as seen in the diploid DNA. DNA from this same monosomal cell hybrid failed to amplify in polymerase chain reactions (PCRs) using primers to exons 1 and 2, demonstrating the deletion of these sequences in one MSH2 allele, and the breakpoints involving Alu repeats were identified by PCR amplification and sequence analysis. Copyright Blackwell Munksgaard, 2003

  11. Analyses of numerical aberrations of chromosome 17 and tp53 gene deletion/amplification in human oral squamous cell carcinoma using dual-color fluorescence in situ hybridization

    Directory of Open Access Journals (Sweden)

    Noemi MESZAROS

    2010-05-01

    Full Text Available In Romania, oral and facial cancers represent approximately 5% of all cancers. Deactivation and unregulated expression of oncogenes and tumor suppressor genes may be involved in the pathogenesis of oral squamous cell carcinoma. The genomic change results in numerical and structural chromosomal alterations, particularly in chromosomes 3, 9, 11 and 17. The aim of our study was to identify numerical aberrations of chromosome 17, deletion or amplification of p53 gene and to reveal correlations between abnormalities of chromosome 17and of p53 gene with TNM status and grading in 15 subjects with oral squamous cell carcinoma. 80 % of cases presented chromosome 17 polysomy and only 20% of cases had chromosome 17 monosomy. 46.6 % of samples revealed p53 gene amplification and 33.3 % of them p53 deletion. Polysomy of chromosome 17 was also detected in tumor-adjacent epithelia. The degree of the cytogenetic abnormality did not correlate with the stage of the disease, the histological differentiation of oral squamous cell carcinoma and lymph node metastasis. Molecular cytogenetic techniques, using fluorescence in situ hybridization with chromosome-specific DNA probes, facilitate the confirmation of presumed chromosomal aberrations with high sensitivity and specificity.

  12. Effect of the deletion of qmoABC and the promoter distal gene encoding a hypothetical protein on sulfate-reduction in Desulfovibrio vulgaris Hildenborough

    Energy Technology Data Exchange (ETDEWEB)

    Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.

    2010-03-18

    The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.

  13. Deletion of aprA and nprA genes for alkaline protease A and neutral protease A from bacillus thuringiensis: effect on insecticidal crystal proteins.

    Science.gov (United States)

    Tan, Y; Donovan, W P

    2001-11-17

    The aprA gene encoding alkaline protease A (AprA) was cloned from Bacillus thuringiensis subsp. kurstaki, and the cloned gene was used to construct aprA-deleted (aprA1) strains of B. thuringiensis. An aprA1 strain of B. thuringiensis that contained the wild-type gene for neutral protease A (nprA(+)) displayed levels of extracellular proteolytic activity that were similar to those of an aprA(+)nprA(+) strain. However, when EDTA was included in the protease assay to inhibit NprA activity the aprA1nprA(+) strain displayed only 2% of the extracellular proteolytic activity of the aprA(+)nprA(+) strain. A strain that was deleted for both aprA and nprA (aprA1nprA3 strain) failed to produce detectable levels of proteolytic activity either in the presence or absence of EDTA in the assay. Compared with the aprA(+)nprA(+) strain the aprA1nprA(+) strain yielded 10% more full-length Cry1Bb crystal protein and the aprA1nprA3 strain yielded 25% more full-length Cry1Bb protein. No significant differences were seen in the 50% lethal dose of Cry1Bb protein from aprA(+)nprA(+) and aprA1nprA3 strains against three species of lepidopteran insects. These results suggest that enhanced yield of certain crystal proteins can be obtained by deletion of the genes aprA and nprA which are the major extracellular proteases of B. thuringiensis.

  14. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Evidence for a distinct region causing a cat-like cry in patients with 5p deletions

    Energy Technology Data Exchange (ETDEWEB)

    Gersh, M.; Goodart, S.A.; Overhauser, J. [Thomas Jefferson Univ., Philadelphia, PA (United States)] [and others

    1995-06-01

    The cri-du-chat syndrome is a contiguous gene syndrome that results from a deletion of the short arm of chromosome 5 (5p). Patients present with a cat-like cry at birth, which is usually considered diagnostic of this syndrome. Additional features of the syndrome include failure to thrive, microcephaly, hypertelorism, epicanthal folds, hypotonia, and severe mental retardation. We report on four families in which patients with 5p deletions have only the characteristic cat-like cry, with normal to mildly delayed development. The precise locations of the deletions in each family were determined by FISH using lambda phage and cosmic clones. All of the deletion breakpoints map distal to a chromosomal region that is implicated with the facial features and severe mental and developmental delay in the cri-du-chat syndrome. DNA clones mapping in the chromosomal region associated with the cat-like cry feature will be useful diagnostic tools. They will allow for the distinction between 5p deletions that will result in the severe delay observed in most cri-du-chat syndrome patients and those deletions that result in the isolated cat-like cry feature, which is associated with a better prognosis. 19 refs., 5 figs., 1 tab.

  16. Evidence for autism spectrum disorder in Jacobsen syndrome: identification of a candidate gene in distal 11q.

    Science.gov (United States)

    Akshoomoff, Natacha; Mattson, Sarah N; Grossfeld, Paul D

    2015-02-01

    Jacobsen syndrome, also called the 11q terminal deletion disorder, is a contiguous gene disorder caused by the deletion of the end of the long arm of chromosome 11. Intellectual skills range from low average to severe/profound intellectual disability and usually correlate with deletion size. Comprehensive genotype/phenotype evaluations are limited, and little is known about specific behavioral characteristics associated with 11q terminal deletion disorder. In this prospective study, 17 patients with 11q terminal deletion disorder underwent cognitive and behavioral assessments. Deletion sizes were determined by array comparative genomic hybridization. Deletion sizes ranged from 8.7 to 14.5 Mb across the patients. We found that 8 of 17 patients (47%) exhibited behavioral characteristics consistent with an autism spectrum disorder diagnosis. There was no correlation between deletion size and the presence of autism spectrum disorder, implicating at least one predisposing gene in the distal 8.7 Mb of 11q. The findings from three additional patients with autistic features and "atypical" distal 11q deletions led to the identification of an autism "critical region" in distal 11q containing four annotated genes including ARHGAP32 (also known as RICS), a gene encoding rho GTPase activating protein. Results from this study support early autism spectrum disorder screening for patients with 11q terminal deletion disorder and provide further molecular insights into the pathogenesis of autism spectrum disorder.

  17. Deletion/insertion polymorphism of the angiotensin-converting enzyme gene and white matter hyperintensities in dementia: A pilot study.

    NARCIS (Netherlands)

    Purandare, N.; Oude Voshaar, R.C.; Davidson, Y.; Gibbons, L.; Hardicre, J.; Byrne, J.; McCollum, C.N.; Jackson, A.; Burns, A.; Mann, D.M.

    2006-01-01

    OBJECTIVES: To examine the association between the angiotensin-converting enzyme (ACE) deletion/insertion (D/I) polymorphism and white matter hyperintensities (WMHs) in patients with dementia. DESIGN: Observational pilot study with adjustment for potential confounders using analysis of covariance.

  18. Impact of the 7-bp deletion in HvGA20ox2 gene on agronomic important traits in barley (Hordeum vulgare L.).

    Science.gov (United States)

    Teplyakova, Serafima; Lebedeva, Marina; Ivanova, Nadezhda; Horeva, Valentina; Voytsutskaya, Nina; Kovaleva, Olga; Potokina, Elena

    2017-11-14

    Alike to Reduced height-1 (Rht-1) genes in wheat and the semi dwarfing (sd-1) gene in rice, the sdw1/denso locus involved in the metabolism of the GA, was designated as the 'Green Revolution' gene in barley. The recent molecular characterization of the candidate gene HvGA20ox2 for sdw1/denso locus allows to estimate the impact of the functional polymorphism of this gene on the variation of agronomically important traits in barley. We investigated the effect of the 7-bp deletion in exon 1 of HvGA20ox2 gene (sdw1.d mutation) on the variation of yield-related and malting quality traits in the population of DHLs derived from cross of medium tall barley Morex and semi-dwarf barley Barke. Segregation of plant height, flowering time, thousand grain weight, grain protein content and grain starch was evaluated in two diverse environments separated from one another by 15° of latitude. The 7-bp deletion in HvGA20ox2 gene reduced plant height by approximately 13 cm and delayed flowering time by 3-5 days in the barley segregating DHLs population independently on environmental cue. On other hand, the sdw1.d mutation did not affect significantly either grain quality traits (protein and starch content) or thousand grain weight. The beneficial effect of the sdw1.d allele could be associated in barley with lodging resistance and extended period of vegetative growth allowing to accumulate additional biomass that supports higher yield in certain environments. However, no direct effect of the sdw1.d mutation on thousand grain weight or grain quality traits in barley was detected.

  19. Identification of the Avian Pasteurella multocida phoP Gene and Evaluation of the Effects of phoP Deletion on Virulence and Immunogenicity

    Directory of Open Access Journals (Sweden)

    Kangpeng Xiao

    2015-12-01

    Full Text Available Pasteurella multocida (P. multocida is an animal pathogen of worldwide economic significance that causes fowl cholera in poultry and wild birds. Global gene regulators, including PhoP are important in regulating bacterial virulence and are good targets for developing attenuated vaccines against many pathogenic bacteria. However, the biological significance of phoP gene has not been identified in P. multocida. Here, we identified the phoP gene in P. multocida, and we evaluated the roles of phoP in P. multocida by deleting the phoP gene. The P. multocida phoP mutant exhibited similar growth curves and lipopolysaccharide and outer membrane protein profiles but displayed defective polymyxin resistance in vitro compared with the parent strain. Additionally, the phoP deletion resulted in decreased virulence. The LD50 of the ΔphoP mutant was 32- and 154-fold higher than the parent strain via the oral and intranasal routes, respectively. Transcriptome sequencing analysis showed that 161 genes were up-regulated and 173 genes were down-regulated in the absence of the phoP gene. Finally, the immunogenicity and protective efficacy of the ΔphoP mutant were evaluated. Immunized ducks produced significantly higher levels of serum IgY and bile IgA compared to the control ducks, and immunization with the ΔphoP mutant conferred 54.5% protection efficiency against challenge with the virulent P. multocida. This work provides a platform to dissect the function of phoP and develop a new vaccine against P. multocida.

  20. Identification of the Avian Pasteurella multocida phoP Gene and Evaluation of the Effects of phoP Deletion on Virulence and Immunogenicity.

    Science.gov (United States)

    Xiao, Kangpeng; Liu, Qing; Liu, Xueyan; Hu, Yunlong; Zhao, Xinxin; Kong, Qingke

    2015-12-23

    Pasteurella multocida (P. multocida) is an animal pathogen of worldwide economic significance that causes fowl cholera in poultry and wild birds. Global gene regulators, including PhoP are important in regulating bacterial virulence and are good targets for developing attenuated vaccines against many pathogenic bacteria. However, the biological significance of phoP gene has not been identified in P. multocida. Here, we identified the phoP gene in P. multocida, and we evaluated the roles of phoP in P. multocida by deleting the phoP gene. The P. multocida phoP mutant exhibited similar growth curves and lipopolysaccharide and outer membrane protein profiles but displayed defective polymyxin resistance in vitro compared with the parent strain. Additionally, the phoP deletion resulted in decreased virulence. The LD50 of the ΔphoP mutant was 32- and 154-fold higher than the parent strain via the oral and intranasal routes, respectively. Transcriptome sequencing analysis showed that 161 genes were up-regulated and 173 genes were down-regulated in the absence of the phoP gene. Finally, the immunogenicity and protective efficacy of the ΔphoP mutant were evaluated. Immunized ducks produced significantly higher levels of serum IgY and bile IgA compared to the control ducks, and immunization with the ΔphoP mutant conferred 54.5% protection efficiency against challenge with the virulent P. multocida. This work provides a platform to dissect the function of phoP and develop a new vaccine against P. multocida.

  1. Cryptic 7q21 and 9p23 deletions in a patient with apparently balanced de novo reciprocal translocation t(7;9)(q21;p23) associated with a dystonia-plus syndrome: paternal deletion of the epsilon-sarcoglycan (SGCE) gene.

    Science.gov (United States)

    Bonnet, C; Grégoire, M-J; Vibert, M; Raffo, E; Leheup, B; Jonveaux, P

    2008-01-01

    We report on a boy with myoclonus-dystonia (M-D), language delay, and malformative anomalies. Genetic investigations allowed the identification of an apparently balanced de novo reciprocal translocation, t(7;9)(q21;p23). Breakpoint-region mapping using fluorescent in situ hybridization (FISH) analysis of bacterial artificial chromosome (BAC) clone probes identified microdeletions of 3.7 and 5.2 Mb within 7q21 and 9p23 breakpoint regions, respectively. Genotyping with microsatellite markers showed that deletions originated from paternal alleles. The deleted region on chromosome 7q21 includes a large imprinted gene cluster. SGCE and PEG10 are two maternally imprinted genes. SGCE mutations are implicated in M-D. In our case, M-D is due to deletion of the paternal allele of the SGCE gene. PEG10 is strongly expressed in the placenta and is essential for embryo development. Prenatal growth retardation identified in the patient may be due to deletion of the paternal allele of the PEG10 gene. Other genes in the deleted region on chromosome 7 are not imprinted. Nevertheless, a phenotype can be due to haploinsufficiency of these genes. KRIT1 is implicated in familial forms of cerebral cavernous malformations, and COL1A2 may be implicated in very mild forms of osteogenesis imperfecta. The deleted region on chromosome 9 overlaps with the candidate region for monosomy 9p syndrome. The proband shows dysmorphic features compatible with monosomy 9p syndrome, without mental impairment. These results emphasize that the phenotypic abnormalities of apparently balanced de novo translocations can be due to cryptic deletions and that the precise mapping of these aneusomies may improve clinical management.

  2. Targeted next-generation sequencing detects point mutations, insertions, deletions and balanced chromosomal rearrangements as well as identifies novel leukemia-specific fusion genes in a single procedure.

    Science.gov (United States)

    Grossmann, V; Kohlmann, A; Klein, H-U; Schindela, S; Schnittger, S; Dicker, F; Dugas, M; Kern, W; Haferlach, T; Haferlach, C

    2011-04-01

    DNA sequence enrichment from complex genomic samples using microarrays enables targeted next-generation sequencing (NGS). In this study, we combined 454 shotgun pyrosequencing with long oligonucleotide sequence capture arrays. We demonstrate the detection of mutations including point mutations, deletions and insertions in a cohort of 22 patients presenting with acute leukemias and myeloid neoplasms. Importantly, this one-step methodological procedure also allowed the detection of balanced chromosomal aberrations, including translocations and inversions. Moreover, the genomic representation of only one of the partner genes of a chimeric fusion on the capture platform also permitted identification of the novel fusion partner genes. Using acute myeloid leukemias harboring RUNX1 abnormalities as a model system, three novel chromosomal fusion sequences and KCNMA1 as a novel RUNX1 fusion partner gene were detected. This assay has the strong potential to become an important method for the comprehensive genetic characterization of particular leukemias and other malignancies harboring complex genomes.

  3. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  4. Targeted deletion of multiple CTCF-binding elements in the human C-MYC gene reveals a requirement for CTCF in C-MYC expression.

    Directory of Open Access Journals (Sweden)

    Wendy M Gombert

    Full Text Available BACKGROUND: Insulators and domain boundaries both shield genes from adjacent enhancers and inhibit intrusion of heterochromatin into transgenes. Previous studies examined the functional mechanism of the MYC insulator element MINE and its CTCF binding sites in the context of transgenes that were randomly inserted into the genome by transfection. However, the contribution of CTCF binding sites to both gene regulation and maintenance of chromatin has not been tested at the endogenous MYC gene. METHODOLOGY/PRINCIPAL FINDINGS: To determine the impact of CTCF binding on MYC expression, a series of mutant human chromosomal alleles was prepared in homologous recombination-efficient DT40 cells and individually transferred by microcell fusion into murine cells. Functional tests reported here reveal that deletion of CTCF binding elements within the MINE does not impact the capacity of this locus to correctly organize an 'accessible' open chromatin domain, suggesting that these sites are not essential for the formation of a competent, transcriptionally active locus. Moreover, deletion of the CTCF site at the MYC P2 promoter reduces transcription but does not affect promoter acetylation or serum-inducible transcription. Importantly, removal of either CTCF site leads to DNA methylation of flanking sequences, thereby contributing to progressive loss of transcriptional activity. CONCLUSIONS: These findings collectively demonstrate that CTCF-binding at the human MYC locus does not repress transcriptional activity but is required for protection from DNA methylation.

  5. Angiotensin-converting enzyme insertion/deletion gene polymorphism in Egyptian children with systemic lupus erythematosus: a possible relation to proliferative nephritis.

    Science.gov (United States)

    Hammad, A; Yahia, S; Laimon, W; Hamed, S M; Shouma, A; Shalaby, N M; Abdel-Hady, D; Ghanem, R; El-Farahaty, R M; El-Bassiony, S R; Hammad, E M

    2017-06-01

    Introduction Angiotensin-converting enzyme (ACE) is crucial in the pathogenesis of systemic lupus erythematosus through angiotensin II which regulates vascular tone and endothelial functions. Objectives To study the frequency of ACE insertion/deletion (I/D) gene polymorphism in Egyptian children with systemic lupus erythematosus and its possible relation to the renal pathology in cases with lupus nephritis. Subjects and methods The frequency of ACE gene insertion/deletion polymorphism genotypes was determined in 78 Egyptian children with systemic lupus erythematosus and compared to a matched group of 140 healthy controls using polymerase chain reaction. Results The DD genotype of the ACE gene was higher in systemic lupus erythematosus patients when compared to controls ( Plupus erythematosus patients in comparison to controls ( P lupus nephritis group, the DD genotype was significantly higher in those with proliferative lupus nephritis when compared to those with non-proliferative lupus nephritis ( P = 0.02; OR = 1.45; 95% CI = 1.4-1.6). Also, patients with proliferative lupus nephritis showed a higher frequency of the D allele ( P lupus erythematosus and occurrence of proliferative nephritis in Egyptian children.

  6. Insertion/deletion polymorphism in the angiotensin-I-converting enzyme gene is associated with coronary heart disease in IDDM patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1995-01-01

    Insulin-dependent diabetic (IDDM) patients with diabetic nephropathy have a highly increased morbidity and mortality from coronary heart disease. An insertion (I) /deletion (D) polymorphism in the angiotensin-I-converting enzyme (ACE) gene has been shown to be associated with coronary heart disease...... regression analysis of the risk factors associated with coronary heart disease in univariate analysis revealed that the II genotype acts as an independent protective factor against coronary heart disease, odds ratio II/DD + ID 0.27 (95% confidence interval 0.07-0.97, p

  7. A Mutant with Expression Deletion of Gene Sec-1 in a 1RS.1BL Line and Its Effect on Production Quality of Wheat.

    Directory of Open Access Journals (Sweden)

    Zhi Li

    Full Text Available The chromosome arm 1RS of rye (Secale cereal L. has been used worldwide as a source of genes for agronomic and resistant improvement. However, the 1RS arm in wheat has end-use quality defects that are partially attributable to the presence of ω-secalins, which are encoded by genes at the Sec-1 locus. Various attempts in removing the Sec-1 genes from the 1RS.1BL translocation chromosome have been made. In the present study, two new primary 1RS.1BL translocation lines, T917-26 and T917-15, were developed from a cross between wheat variety "A42912" and Chinese local rye "Weining." The lines T917-15 and T917-26 carried a pair of intact and homogeneous 1RS.1BL chromosomes. The line T917-26 also harbored an expression deletion of some genes at the Sec-1 locus, which originated from a mutation that occurred simultaneously with wheat-rye chromosome translocations. These results suggest that the accompanying mutations of the evolutionarily significant translocations are remarkable resources for plant improvement. Comparison of translocation lines with its wheat parent showed improvements in the end-use quality parameters, which included protein content (PC, water absorption (WA, sodium dodecyl sulfate sedimentation (SDSS, wet gluten (WG, dry gluten (DG and dough stickiness (DS, whereas significant reduction in gluten index (GI and stability time (ST were observed. These findings indicate that 1RS in wheat has produced a higher amount of protein, although these comprised worse compositions. However, in the T917-26 line that harbored an expression deletion mutation in the Sec-1 genes, the quality parameters were markedly improved relative to its sister line, T917-15, especially for GI and DS (P < 0.05. These results indicated that expression deletion of Sec-1 genes significantly improves the end-use quality of wheat cultivars harboring the 1RS.1BL translocation. Strategies to remove the Sec-1 genes from the 1RS.1BL translocation in wheat improvement are

  8. Zebrafish homologs of genes within 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes

    Directory of Open Access Journals (Sweden)

    Alicia Blaker-Lee

    2012-11-01

    Deletion or duplication of one copy of the human 16p11.2 interval is tightly associated with impaired brain function, including autism spectrum disorders (ASDs, intellectual disability disorder (IDD and other phenotypes, indicating the importance of gene dosage in this copy number variant region (CNV. The core of this CNV includes 25 genes; however, the number of genes that contribute to these phenotypes is not known. Furthermore, genes whose functional levels change with deletion or duplication (termed ‘dosage sensors’, which can associate the CNV with pathologies, have not been identified in this region. Using the zebrafish as a tool, a set of 16p11.2 homologs was identified, primarily on chromosomes 3 and 12. Use of 11 phenotypic assays, spanning the first 5 days of development, demonstrated that this set of genes is highly active, such that 21 out of the 22 homologs tested showed loss-of-function phenotypes. Most genes in this region were required for nervous system development – impacting brain morphology, eye development, axonal density or organization, and motor response. In general, human genes were able to substitute for the fish homolog, demonstrating orthology and suggesting conserved molecular pathways. In a screen for 16p11.2 genes whose function is sensitive to hemizygosity, the aldolase a (aldoaa and kinesin family member 22 (kif22 genes were identified as giving clear phenotypes when RNA levels were reduced by ∼50%, suggesting that these genes are deletion dosage sensors. This study leads to two major findings. The first is that the 16p11.2 region comprises a highly active set of genes, which could present a large genetic target and might explain why multiple brain function, and other, phenotypes are associated with this interval. The second major finding is that there are (at least two genes with deletion dosage sensor properties among the 16p11.2 set, and these could link this CNV to brain disorders such as ASD and IDD.

  9. Scarless deletion of up to seven methyl-accepting chemotaxis genes with an optimized method highlights key function of CheM in Salmonella Typhimurium.

    Directory of Open Access Journals (Sweden)

    Stefanie Hoffmann

    Full Text Available Site-directed scarless mutagenesis is an essential tool of modern pathogenesis research. We describe an optimized two-step protocol for genome editing in Salmonella enterica serovar Typhimurium to enable multiple sequential mutagenesis steps in a single strain. The system is based on the λ Red recombinase-catalyzed integration of a selectable antibiotics resistance marker followed by replacement of this cassette. Markerless mutants are selected by expressing the meganuclease I-SceI which induces double-strand breaks in bacteria still harboring the resistance locus. Our new dual-functional plasmid pWRG730 allows for heat-inducible expression of the λ Red recombinase and tet-inducible production of I-SceI. Methyl-accepting chemotaxis proteins (MCP are transmembrane chemoreceptors for a vast set of environmental signals including amino acids, sugars, ions and oxygen. Based on the sensory input of MCPs, chemotaxis is a key component for Salmonella virulence. To determine the contribution of individual MCPs we sequentially deleted seven MCP genes. The individual mutations were validated by PCR and genetic integrity of the final seven MCP mutant WRG279 was confirmed by whole genome sequencing. The successive MCP mutants were functionally tested in a HeLa cell infection model which revealed increased invasion rates for non-chemotactic mutants and strains lacking the MCP CheM (Tar. The phenotype of WRG279 was reversed with plasmid-based expression of CheM. The complemented WRG279 mutant showed also partially restored chemotaxis in swarming assays on semi-solid agar. Our optimized scarless deletion protocol enables efficient and precise manipulation of the Salmonella genome. As demonstrated with whole genome sequencing, multiple subsequent mutagenesis steps can be realized without the introduction of unwanted mutations. The sequential deletion of seven MCP genes revealed a significant role of CheM for the interaction of S. Typhimurium with host cells

  10. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  11. Whole-Genome Microarray and Gene Deletion Studies Reveal Regulation of the Polyhydroxyalkanoate Production Cycle by the Stringent Response in Ralstonia eutropha H16

    Energy Technology Data Exchange (ETDEWEB)

    Brigham, CJ; Speth, DR; Rha, C; Sinskey, AJ

    2012-10-22

    Poly(3-hydroxybutyrate) (PHB) production and mobilization in Ralstonia eutropha are well studied, but in only a few instances has PHB production been explored in relation to other cellular processes. We examined the global gene expression of wild-type R. eutropha throughout the PHB cycle: growth on fructose, PHB production using fructose following ammonium depletion, and PHB utilization in the absence of exogenous carbon after ammonium was resupplied. Our results confirm or lend support to previously reported results regarding the expression of PHB-related genes and enzymes. Additionally, genes for many different cellular processes, such as DNA replication, cell division, and translation, are selectively repressed during PHB production. In contrast, the expression levels of genes under the control of the alternative sigma factor sigma(54) increase sharply during PHB production and are repressed again during PHB utilization. Global gene regulation during PHB production is strongly reminiscent of the gene expression pattern observed during the stringent response in other species. Furthermore, a ppGpp synthase deletion mutant did not show an accumulation of PHB, and the chemical induction of the stringent response with DL-norvaline caused an increased accumulation of PHB in the presence of ammonium. These results indicate that the stringent response is required for PHB accumulation in R. eutropha, helping to elucidate a thus-far-unknown physiological basis for this process.

  12. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  13. Deletion of 16q24.1 supports a role for the ATP2C2 gene in specific language impairment.

    Science.gov (United States)

    Smith, Amena W; Holden, Kenton R; Dwivedi, Alka; Dupont, Barbara R; Lyons, Michael J

    2015-03-01

    A 10-year-old boy presented with a history of significant delay in language acquisition as well as receptive and expressive language impairment that persisted into elementary school. In school, he exhibited difficulty with reading comprehension, telling and understanding narratives, and making inferences. Other aspects of his neurodevelopment were normal, with no history of significant medical concerns. He did not have hearing impairment, oromotor dysfunction, or specific neurologic abnormalities. He did not meet testing criteria for autism. Chromosomal microarray analysis and quantitative polymerase chain reaction determined that he had a de novo 159-kilobase deletion of chromosome 16q24.1 that included the ATP2C2 gene. ATP2C2 is a known candidate gene for specific language impairment and is postulated to have neurobiological significance in memory-related circuits. Our patient's language deficits were consistent with a global type of specific language impairment impacting language comprehension, formulation, semantics, syntax, and phonology attributed to his de novo chromosome deletion. © The Author(s) 2014.

  14. Tumor Protein 53 Gene Mutations Without 17p13 Deletion Have No Significant Clinical Implications in Chronic Lymphocytic Leukemia. Detection of a New Mutation.

    Science.gov (United States)

    Diamantopoulos, Panagiotis T; Samara, Stavroula; Kollia, Panagoula; Giannakopoulou, Nefeli; Sofotasiou, Maria; Kalala, Fani; Kodandreopoulou, Elina; Zervakis, Panagiotis; Vassilakopoulos, Theodoros; Siakantaris, Marina; Mantzourani, Marina; Angelopoulou, Maria; Kyrtshonis, Marie-Christine; Korkolopoulou, Penelope; Patsouris, Efstathios; Viniou, Nora-Athina

    2017-05-01

    The tumor protein p53 (TP53) gene may be inactivated through 17p13 deletion, somatic mutations, or both. In chronic lymphocytic leukemia (CLL) although 17p13 deletion is correlated with poor prognosis, the role of sole TP53 mutations remains controversial. We carried out a mutation analysis of TP53 gene in 72 patients with CLL. Seventy-one (98.6%) patients carried the polymorphic site c.215C>G, p.Pro72Arg, but its presence was not correlated with overall survival (OS). Moreover, 19 (26.4%) patients carried a mutation of TP53. Among the eight detected mutations, to our knowledge, one (c.587G>A) has never been reported in the past. There was a correlation of the mutation burden with the stage of the disease (p=0.022), but not with OS. None of the detected mutations was individually correlated with OS. The clinical significance of TP53 mutations is still a matter of debate and larger studies and meta-analyses are required to reach an unequivocal conclusion. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  15. Enhanced genome editing tools for multi-gene deletion knock-out approaches using paired CRISPR sgRNAs in CHO cells

    DEFF Research Database (Denmark)

    Schmieder, Valerie; Bydlinski, Nina; Strasser, Richard

    2017-01-01

    Since the establishment of clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9, powerful strategies for engineering of CHO cell lines have emerged. Nevertheless, there is still room to expand the scope of the CRISPR tool box for further applications to improve CHO cell factories....... Here, we demonstrate activity of the alternative CRISPR endonuclease Cpf1 in CHO-K1 for the first time and that it can be used in parallel to CRISPR/Cas9 without any interference. Both, Cas9 and Cpf1, can be effectively used for multi-gene engineering with a strategy based on paired single guide RNAs...... of application of CRISPR for novel gene editing approaches in CHO cells and also enable the efficient realization of a genome-wide deletion library....

  16. Single gene deletions of orexin, leptin, neuropeptide Y, and ghrelin do not appreciably alter food anticipatory activity in mice.

    Directory of Open Access Journals (Sweden)

    Keith M Gunapala

    Full Text Available Timing activity to match resource availability is a widely conserved ability in nature. Scheduled feeding of a limited amount of food induces increased activity prior to feeding time in animals as diverse as fish and rodents. Typically, food anticipatory activity (FAA involves temporally restricting unlimited food access (RF to several hours in the middle of the light cycle, which is a time of day when rodents are not normally active. We compared this model to calorie restriction (CR, giving the mice 60% of their normal daily calorie intake at the same time each day. Measurement of body temperature and home cage behaviors suggests that the RF and CR models are very similar but CR has the advantage of a clearly defined food intake and more stable mean body temperature. Using the CR model, we then attempted to verify the published result that orexin deletion diminishes food anticipatory activity (FAA but observed little to no diminution in the response to CR and, surprisingly, that orexin KO mice are refractory to body weight loss on a CR diet. Next we tested the orexigenic neuropeptide Y (NPY and ghrelin and the anorexigenic hormone, leptin, using mouse mutants. NPY deletion did not alter the behavior or physiological response to CR. Leptin deletion impaired FAA in terms of some activity measures, such as walking and rearing, but did not substantially diminish hanging behavior preceding feeding time, suggesting that leptin knockout mice do anticipate daily meal time but do not manifest the full spectrum of activities that typify FAA. Ghrelin knockout mice do not have impaired FAA on a CR diet. Collectively, these results suggest that the individual hormones and neuropepetides tested do not regulate FAA by acting individually but this does not rule out the possibility of their concerted action in mediating FAA.

  17. Unusual accelerated rate of deletions and insertions in toxin genes in the venom glands of the pygmy copperhead (Austrelaps labialis from kangaroo island

    Directory of Open Access Journals (Sweden)

    Kini R Manjunatha

    2008-02-01

    Full Text Available Abstract Background Toxin profiling helps in cataloguing the toxin present in the venom as well as in searching for novel toxins. The former helps in understanding potential pharmacological profile of the venom and evolution of toxins, while the latter contributes to understanding of novel mechanisms of toxicity and provide new research tools or prototypes of therapeutic agents. Results The pygmy copperhead (Austrelaps labialis is one of the less studied species. In this present study, an attempt has been made to describe the toxin profile of A. labialis from Kangaroo Island using the cDNA library of its venom glands. We sequenced 658 clones which represent the common families of toxin genes present in snake venom. They include (a putative long-chain and short-chain neurotoxins, (b phospholipase A2, (c Kunitz-type protease inhibitor, (d CRISPs, (e C-type lectins and (f Metalloproteases. In addition, we have also identified a novel protein with two Kunitz-type domains in tandem similar to bikunin. Conclusion Interestingly, the cDNA library reveals that most of the toxin families (17 out of 43 toxin genes; ~40% have truncated transcripts due to insertion or deletion of nucleotides. These truncated products might not be functionally active proteins. However, cellular trancripts from the same venom glands are not affected. This unusual higher rate of deletion and insertion of nucleotide in toxin genes may be responsible for the lower toxicity of A. labialis venom of Kangroo Island and have significant effect on evolution of toxin genes.

  18. Truncated Photosystem Chlorophyll Antenna Size in the Green Microalga Chlamydomonas reinhardtii upon Deletion of the TLA3-CpSRP43 Gene1[C][W][OA

    Science.gov (United States)

    Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios

    2012-01-01

    The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions. PMID:23043081

  19. Truncated photosystem chlorophyll antenna size in the green microalga Chlamydomonas reinhardtii upon deletion of the TLA3-CpSRP43 gene.

    Science.gov (United States)

    Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios

    2012-12-01

    The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions.

  20. A de novo whole gene deletion of XIAP detected by exome sequencing analysis in very early onset inflammatory bowel disease: a case report.

    Science.gov (United States)

    Kelsen, Judith R; Dawany, Noor; Martinez, Alejandro; Martinez, Alejuandro; Grochowski, Christopher M; Maurer, Kelly; Rappaport, Eric; Piccoli, David A; Baldassano, Robert N; Mamula, Petar; Sullivan, Kathleen E; Devoto, Marcella

    2015-11-18

    Children with very early-onset inflammatory bowel disease (VEO-IBD), those diagnosed at less than 5 years of age, are a unique population. A subset of these patients present with a distinct phenotype and more severe disease than older children and adults. Host genetics is thought to play a more prominent role in this young population, and monogenic defects in genes related to primary immunodeficiencies are responsible for the disease in a small subset of patients with VEO-IBD. We report a child who presented at 3 weeks of life with very early-onset inflammatory bowel disease (VEO-IBD). He had a complicated disease course and remained unresponsive to medical and surgical therapy. The refractory nature of his disease, together with his young age of presentation, prompted utilization of whole exome sequencing (WES) to detect an underlying monogenic primary immunodeficiency and potentially target therapy to the identified defect. Copy number variation analysis (CNV) was performed using the eXome-Hidden Markov Model. Whole exome sequencing revealed 1,380 nonsense and missense variants in the patient. Plausible candidate variants were not detected following analysis of filtered variants, therefore, we performed CNV analysis of the WES data, which led us to identify a de novo whole gene deletion in XIAP. This is the first reported whole gene deletion in XIAP, the causal gene responsible for XLP2 (X-linked lymphoproliferative Disease 2). XLP2 is a syndrome resulting in VEO-IBD and can increase susceptibility to hemophagocytic lymphohistocytosis (HLH). This identification allowed the patient to be referred for bone marrow transplantation, potentially curative for his disease and critical to prevent the catastrophic sequela of HLH. This illustrates the unique etiology of VEO-IBD, and the subsequent effects on therapeutic options. This cohort requires careful and thorough evaluation for monogenic defects and primary immunodeficiencies.

  1. Highly efficient gene targeting in Aspergillus oryzae industrial strains under ligD mutation introduced by genome editing: Strain-specific differences in the effects of deleting EcdR, the negative regulator of sclerotia formation.

    Science.gov (United States)

    Nakamura, Hidetoshi; Katayama, Takuya; Okabe, Tomoya; Iwashita, Kazuhiro; Fujii, Wataru; Kitamoto, Katsuhiko; Maruyama, Jun-Ichi

    2017-07-11

    Numerous strains of Aspergillus oryzae are industrially used for Japanese traditional fermentation and for the production of enzymes and heterologous proteins. In A. oryzae, deletion of the ku70 or ligD genes involved in non-homologous end joining (NHEJ) has allowed high gene targeting efficiency. However, this strategy has been mainly applied under the genetic background of the A. oryzae wild strain RIB40, and it would be laborious to delete the NHEJ genes in many A. oryzae industrial strains, probably due to their low gene targeting efficiency. In the present study, we generated ligD mutants from the A. oryzae industrial strains by employing the CRISPR/Cas9 system, which we previously developed as a genome editing method. Uridine/uracil auxotrophic strains were generated by deletion of the pyrG gene, which was subsequently used as a selective marker. We examined the gene targeting efficiency with the ecdR gene, of which deletion was reported to induce sclerotia formation under the genetic background of the strain RIB40. As expected, the deletion efficiencies were high, around 60~80%, in the ligD mutants of industrial strains. Intriguingly, the effects of the ecdR deletion on sclerotia formation varied depending on the strains, and we found sclerotia-like structures under the background of the industrial strains, which have never been reported to form sclerotia. The present study demonstrates that introducing ligD mutation by genome editing is an effective method allowing high gene targeting efficiency in A. oryzae industrial strains.

  2. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    Directory of Open Access Journals (Sweden)

    Gregory N. Thyssen

    2016-06-01

    Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  3. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    Science.gov (United States)

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-06-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. Copyright © 2016 Thyssen et al.

  4. Deletion of p66Shc longevity gene protects against experimental diabetic glomerulopathy by preventing diabetes-induced oxidative stress.

    Science.gov (United States)

    Menini, Stefano; Amadio, Lorena; Oddi, Giovanna; Ricci, Carlo; Pesce, Carlo; Pugliese, Francesco; Giorgio, Marco; Migliaccio, Enrica; Pelicci, PierGiuseppe; Iacobini, Carla; Pugliese, Giuseppe

    2006-06-01

    p66(Shc) regulates both steady-state and environmental stress-dependent reactive oxygen species (ROS) generation. Its deletion was shown to confer resistance to oxidative stress and protect mice from aging-associated vascular disease. This study was aimed at verifying the hypothesis that p66(Shc) deletion also protects from diabetic glomerulopathy by reducing oxidative stress. Streptozotocin-induced diabetic p66(Shc) knockout (KO) mice showed less marked changes in renal function and structure, as indicated by the significantly lower levels of proteinuria, albuminuria, glomerular sclerosis index, and glomerular and mesangial areas. Glomerular content of fibronectin and collagen IV was also lower in diabetic KO versus wild-type mice, whereas apoptosis was detected only in diabetic wild-type mice. Serum and renal tissue advanced glycation end products and plasma isoprostane 8-epi-prostaglandin F2alpha levels and activation of nuclear factor kappaB (NF-kappaB) were also lower in diabetic KO than in wild-type mice. Mesangial cells from KO mice grown under high-glucose conditions showed lower cell death rate, matrix production, ROS levels, and activation of NF-kappaB than those from wild-type mice. These data support a role for oxidative stress in the pathogenesis of diabetic glomerulopathy and indicate that p66(Shc) is involved in the molecular mechanism(s) underlying diabetes-induced oxidative stress and oxidant-dependent renal injury.

  5. Deletion of A44L, A46R and C12L Vaccinia Virus Genes from the MVA Genome Improved the Vector Immunogenicity by Modifying the Innate Immune Response Generating Enhanced and Optimized Specific T-Cell Responses

    Directory of Open Access Journals (Sweden)

    María Pía Holgado

    2016-05-01

    Full Text Available MVA is an attenuated vector that still retains immunomodulatory genes. We have previously reported its optimization after deleting the C12L gene, coding for the IL-18 binding-protein. Here, we analyzed the immunogenicity of MVA vectors harboring the simultaneous deletion of A44L, related to steroid synthesis and A46R, a TLR-signaling inhibitor (MVAΔA44L-A46R; or also including a deletion of C12L (MVAΔC12L/ΔA44L-A46R. The absence of biological activities of the deleted genes in the MVA vectors was demonstrated. Adaptive T-cell responses against VACV epitopes, evaluated in spleen and draining lymph-nodes of C57Bl/6 mice at acute/memory phases, were of higher magnitude in those animals that received deleted MVAs compared to MVAwt. MVAΔC12L/ΔA44L-A46R generated cellular specific memory responses of higher quality characterized by bifunctionality (CD107a/b+/IFN-γ+ and proliferation capacity. Deletion of selected genes from MVA generated innate immune responses with higher levels of determining cytokines related to T-cell response generation, such as IL-12, IFN-γ, as well as IL-1β and IFN-β. This study describes for the first time that simultaneous deletion of the A44L, A46R and C12L genes from MVA improved its immunogenicity by enhancing the host adaptive and innate immune responses, suggesting that this approach comprises an appropriate strategy to increase the MVA vaccine potential.

  6. An analysis of possible off target effects following CAS9/CRISPR targeted deletions of neuropeptide gene enhancers from the mouse genome.

    Science.gov (United States)

    Hay, Elizabeth Anne; Khalaf, Abdulla Razak; Marini, Pietro; Brown, Andrew; Heath, Karyn; Sheppard, Darrin; MacKenzie, Alasdair

    2017-08-01

    We have successfully used comparative genomics to identify putative regulatory elements within the human genome that contribute to the tissue specific expression of neuropeptides such as galanin and receptors such as CB1. However, a previous inability to rapidly delete these elements from the mouse genome has prevented optimal assessment of their function in-vivo. This has been solved using CAS9/CRISPR genome editing technology which uses a bacterial endonuclease called CAS9 that, in combination with specifically designed guide RNA (gRNA) molecules, cuts specific regions of the mouse genome. However, reports of "off target" effects, whereby the CAS9 endonuclease is able to cut sites other than those targeted, limits the appeal of this technology. We used cytoplasmic microinjection of gRNA and CAS9 mRNA into 1-cell mouse embryos to rapidly generate enhancer knockout mouse lines. The current study describes our analysis of the genomes of these enhancer knockout lines to detect possible off-target effects. Bioinformatic analysis was used to identify the most likely putative off-target sites and to design PCR primers that would amplify these sequences from genomic DNA of founder enhancer deletion mouse lines. Amplified DNA was then sequenced and blasted against the mouse genome sequence to detect off-target effects. Using this approach we were unable to detect any evidence of off-target effects in the genomes of three founder lines using any of the four gRNAs used in the analysis. This study suggests that the problem of off-target effects in transgenic mice have been exaggerated and that CAS9/CRISPR represents a highly effective and accurate method of deleting putative neuropeptide gene enhancer sequences from the mouse genome. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Hereditary spherocytic anemia with deletion of the short arm of chromosome 8

    Energy Technology Data Exchange (ETDEWEB)

    Okamoto, Nobuhiko; Wada, Yoshinao; Nakamura, Yoich [Osaka Medical Center and Research Inst. for Maternal and Child Health, Tokyo (Japan)] [and others

    1995-09-11

    We describe a 30-month-old boy with multiple anomalies and mental retardation with hereditary spherocytic anemia. His karyotype was 46,XYdel(8)(p11.23p21.1). Genes for ankyrin and glutathione reductase (GSR) were localized to chromosome areas 8p11.2 and 8p21.1, respectively. Six patients with spherocytic anemia and interstitial deletion of 8p- have been reported. In these patients, severe mental retardation and multiple anomalies are common findings. This is a new contiguous gene syndrome. Lux established that ankyrin deficiency and associated deficiencies of spectrin and protein 4.2 were responsible for spherocytosis in this syndrome. We reviewed the manifestations of this syndrome. Patients with spherocytic anemia and multiple congenital anomalies should be investigated by high-resolution chromosomal means to differentiate this syndrome. 14 refs., 3 figs., 2 tabs.

  8. Isolation and Functional Validation of Salinity and Osmotic Stress Inducible Promoter from the Maize Type-II H+-Pyrophosphatase Gene by Deletion Analysis in Transgenic Tobacco Plants.

    Directory of Open Access Journals (Sweden)

    Jiajia Hou

    Full Text Available Salinity and drought severely affect both plant growth and productivity, making the isolation and characterization of salinity- or drought-inducible promoters suitable for genetic improvement of crop resistance highly desirable. In this study, a 1468-bp sequence upstream of the translation initiation codon ATG of the promoter for ZmGAPP (maize Type-II H+-pyrophosphatase gene was cloned. Nine 5´ deletion fragments (D1-D9 of different lengths of the ZmGAPP promoter were fused with the GUS reporter and translocated into tobacco. The deletion analysis showed that fragments D1-D8 responded well to NaCl and PEG stresses, whereas fragment D9 and CaMV 35S did not. The D8 segment (219 bp; -219 to -1 bp exhibited the highest promoter activity of all tissues, with the exception of petals among the D1-D9 transgenic tobacco, which corresponds to about 10% and 25% of CaMV 35S under normal and NaCl or PEG stress conditions, respectively. As such, the D8 segment may confer strong gene expression in a salinity and osmotic stress inducible manner. A 71-bp segment (-219 to -148 bp was considered as the key region regulating ZmGAPP response to NaCl or PEG stress, as transient transformation assays demonstrated that the 71-bp sequence was sufficient for the salinity or osmotic stress response. These results enhance our understanding of the molecular mechanisms regulating ZmGAPP expression, and that the D8 promoter would be an ideal candidate for moderating expression of drought and salinity response genes in transgenic plants.

  9. Combinational deletion of three membrane protein-encoding genes highly attenuates yersinia pestis while retaining immunogenicity in a mouse model of pneumonic plague.

    Science.gov (United States)

    Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K

    2015-04-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a

  10. Combinational Deletion of Three Membrane Protein-Encoding Genes Highly Attenuates Yersinia pestis while Retaining Immunogenicity in a Mouse Model of Pneumonic Plague

    Science.gov (United States)

    Tiner, Bethany L.; Kirtley, Michelle L.; Erova, Tatiana E.; Popov, Vsevolod L.; Baze, Wallace B.; van Lier, Christina J.; Ponnusamy, Duraisamy; Andersson, Jourdan A.; Motin, Vladimir L.; Chauhan, Sadhana

    2015-01-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a

  11. The Dominant white, Dun and Smoky Color Variants in Chicken Are Associated With Insertion/Deletion Polymorphisms in the PMEL17 Gene

    Science.gov (United States)

    Kerje, Susanne; Sharma, Preety; Gunnarsson, Ulrika; Kim, Hyun; Bagchi, Sonchita; Fredriksson, Robert; Schütz, Karin; Jensen, Per; von Heijne, Gunnar; Okimoto, Ron; Andersson, Leif

    2004-01-01

    Dominant white, Dun, and Smoky are alleles at the Dominant white locus, which is one of the major loci affecting plumage color in the domestic chicken. Both Dominant white and Dun inhibit the expression of black eumelanin. Smoky arose in a White Leghorn homozygous for Dominant white and partially restores pigmentation. PMEL17 encodes a melanocyte-specific protein and was identified as a positional candidate gene due to its role in the development of eumelanosomes. Linkage analysis of PMEL17 and Dominant white using a red jungle fowl/White Leghorn intercross revealed no recombination between these loci. Sequence analysis showed that the Dominant white allele was exclusively associated with a 9-bp insertion in exon 10, leading to an insertion of three amino acids in the PMEL17 transmembrane region. Similarly, a deletion of five amino acids in the transmembrane region occurs in the protein encoded by Dun. The Smoky allele shared the 9-bp insertion in exon 10 with Dominant white, as expected from its origin, but also had a deletion of 12 nucleotides in exon 6, eliminating four amino acids from the mature protein. These mutations are, together with the recessive silver mutation in the mouse, the only PMEL17 mutations with phenotypic effects that have been described so far in any species. PMID:15579702

  12. Chemotherapy modulates intestinal immune gene expression including surfactant Protein-D and deleted in malignant brain tumors 1 in piglets

    DEFF Research Database (Denmark)

    Rathe, Mathias; Thomassen, Mads; Shen, René L.

    2016-01-01

    Background: Information about chemotherapy-induced intestinal gene expression may provide insight into the mechanisms underlying gut toxicity and help identify biomarkers and targets for intervention. Methods: We analyzed jejunal tissue from piglets subjected to two different, clinically relevant...... the upregulated genes for both treatments. Conclusion: In the developing intestine, chemotherapy increases the expression of genes related to innate immune functions involved in surveillance, protection, and homeostasis of mucosal surfaces....

  13. Association of insertion/deletion polymorphism of angiotensin-converting enzyme gene among Malay male hypertensive subjects in response to ACE inhibitors.

    Science.gov (United States)

    Heidari, Farzad; Vasudevan, Ramachandran; Mohd Ali, Siti Zubaidah; Ismail, Patimah; Etemad, Ali; Pishva, Seyyed Reza; Othman, Fauziah; Abu Bakar, Suhaili

    2015-12-01

    Several studies show that the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene has been associated with hypertension in various populations. The present study sought to determine the association of the I/D gene polymorphism among Malay male essential hypertensive subjects in response to ACE inhibitors (enalapril and lisinopril). A total of 72 patients with newly diagnosed hypertension and 72 healthy subjects were recruited in this study. Blood pressure was recorded from 0 to 24 weeks of treatment with enalapril or lisinopril. Genotyping of the I/D polymorphism was carried out using a standard PCR method. Statistically significant association of the D allele of the ACE gene was observed between the case and control subjects (p ACE gene. Patients carrying the DD genotype had higher blood pressure-lowering response when treated with ACE inhibitors enalapril or lisinopril than those carrying ID and II genotypes, suggesting that the D allele may be a possible genetic marker for essential hypertension among Malay male subjects. © The Author(s) 2014.

  14. Partial deletion of eNOS gene causes hyperinsulinemic state, unbalance of cardiac insulin signaling pathways and coronary dysfunction independently of high fat diet.

    Directory of Open Access Journals (Sweden)

    Cecilia Vecoli

    Full Text Available Abnormalities in eNOS gene, possibly interacting with high fat diet (HFD, affect peripheral vascular function and glucose metabolism. The relative role of eNOS gene, HFD and metabolic derangement on coronary function has not been fully elucidated. We test whether eNOS gene deficiency per se or in association with HFD modulates coronary function through mechanisms involving molecular pathways related to insulin signaling. Wild type (WT, eNOS-/- and eNOS+/- mice were studied. WT and eNOS+/- mice were fed with either standard or HF diet for 16 weeks and compared with standard diet fed eNOS-/-. Glucose and insulin tolerance tests were performed during the last week of diet. Coronary resistance (CR was measured at baseline and during infusions of acetylcholine (Ach or sodium-nitroprusside (SNP to evaluate endothelium-dependent or independent vasodilation, in the Langendorff isolated hearts. Cardiac expression of Akt and ERK genes as evaluation of two major insulin-regulated signaling pathways involved in the control of vascular tone were assessed by western blot. HFD-fed mice developed an overt diabetic state. Conversely, chow-fed genetically modified mice (in particular eNOS-/- showed a metabolic pattern characterized by normoglycemia and hyperinsulinemia with a limited degree of insulin resistance. CR was significantly higher in animals with eNOS gene deletions than in WT, independently of diet. Percent decrease in CR, during Ach infusion, was significantly lower in both eNOS-/- and eNOS+/- mice than in WT, independently of diet. SNP reduced CR in all groups except eNOS-/-. The cardiac ERK1-2/Akt ratio, increased in animals with eNOS gene deletions compared with WT, independently of diet. These results suggest that the eNOS genetic deficiency, associated or not with HFD, has a relevant effect on coronary vascular function, possibly mediated by increase in blood insulin levels and unbalance in insulin-dependent signaling in coronary vessels

  15. Deletion of the steroid-binding domain of the human androgen receptor gene in one family with complete androgen insensitivity syndrome: Evidence for further genetic heterogeneity in this syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, T.R.; Lubahn, D.B.; Wilson, E.M.; Joseph, D.R.; French, F.S.; Migeon, C.J. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (USA))

    1988-11-01

    The cloning of a cDNA for the human androgen receptor gene has resulted in the availability for cDNA probes that span various parts of the gene, including the entire steroid-binding domain and part of the DNA-binding domain, as well as part of the 5' region of the gene. The radiolabeled probes were used to screen for androgen receptor mutations on Southern blots prepared by restriction endonuclease digestion of genomic DNA from human subjects with complete androgen insensitivity syndrome (AIS). In this investigation, the authors considered only patients presenting complete AIS and with the androgen receptor (-) form as the most probably subjects to show a gene deletion. One subject from each of six unrelated families with the receptor (-) form of complete AIS and 10 normal subjects were studied. In the 10 normal subjects and in 5 of the 6 patients, identical DNA restriction fragment patterns were observed with EcoRI and BamHI. Analysis of other members of this family confirmed the apparent gene deletion. The data provide direct proof that complete AIS in some families can result from a deletion of the androgen receptor structural gene. However, other families do not demonstrate such a deletion, suggesting that point mutations may also result in the receptor (-) form of complete AIS, adding further to the genetic heterogeneity of this syndrome.

  16. Deletion of fucose residues in plant N-glycans by repression of the GDP-mannose 4,6-dehydratase gene using virus-induced gene silencing and RNA interference.

    Science.gov (United States)

    Matsuo, Kouki; Matsumura, Takeshi

    2011-02-01

    Production of pharmaceutical glycoproteins in plants has many advantages in terms of safety and reduced costs. However, plant-produced glycoproteins have N-glycans with plant-specific sugar residues (core β-1,2-xylose and α-1,3-fucose) and a Lewis a (Le(a) ) epitope, i.e., Galβ(1-3)[Fucα(1-4)]GlcNAc. Because these sugar residues and glycan structures seemed to be immunogenic, several attempts have been made to delete them by repressing their respective glycosyltransferase genes. However, until date, such deletions have not been successful in completely eliminating the fucose residues. In this study, we simultaneously reduced the plant-specific core α-1,3-fucose and α-1,4-fucose residues in the Le(a) epitopes by repressing the Guanosine 5'-diphosphate (GDP)-D-mannose 4,6-dehydratase (GMD) gene, which is associated with GDP-L-fucose biosynthesis, in Nicotiana benthamiana plants. Repression of GMD was achieved using virus-induced gene silencing (VIGS) and RNA interference (RNAi). The proportion of fucose-free N-glycans found in total soluble protein from GMD gene-repressed plants increased by 80% and 95% following VIGS and RNAi, respectively, compared to wild-type plants. A small amount of putative galactose substitution in N-glycans from the NbGMD gene-repressed plants was observed, similar to what has been previously reported GMD-knockout Arabidopsis mutant. On the other hand, the recombinant mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) with fucose-deleted N-glycans was successfully produced in NbGMD-RNAi transgenic N. benthamiana plants. Thus, repression of the GMD gene is thus very useful for deleting immunogenic total fucose residues and facilitating the production of pharmaceutical glycoproteins in plants. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  17. A case of autism with an interstitial deletion on 4q leading to hemizygosity for genes encoding for glutamine and glycine neurotransmitter receptor sub-units (AMPA 2, GLRA3, GLRB and neuropeptide receptors NPY1R, NPY5R

    Directory of Open Access Journals (Sweden)

    Steinberg-Epstein Robin

    2004-04-01

    Full Text Available Abstract Background Autism is a pervasive developmental disorder characterized by a triad of deficits: qualitative impairments in social interactions, communication deficits, and repetitive and stereotyped patterns of behavior. Although autism is etiologically heterogeneous, family and twin studies have established a definite genetic basis. The inheritance of idiopathic autism is presumed to be complex, with many genes involved; environmental factors are also possibly contributory. The analysis of chromosome abnormalities associated with autism contributes greatly to the identification of autism candidate genes. Case presentation We describe a child with autistic disorder and an interstitial deletion on chromosome 4q. This child first presented at 12 months of age with developmental delay and minor dysmorphic features. At 4 years of age a diagnosis of Pervasive Developmental Disorder was made. At 11 years of age he met diagnostic criteria for autism. Cytogenetic studies revealed a chromosome 4q deletion. The karyotype was 46, XY del 4 (q31.3-q33. Here we report the clinical phenotype of the child and the molecular characterization of the deletion using molecular cytogenetic techniques and analysis of polymorphic markers. These studies revealed a 19 megabase deletion spanning 4q32 to 4q34. Analysis of existing polymorphic markers and new markers developed in this study revealed that the deletion arose on a paternally derived chromosome. To date 33 genes of known or inferred function are deleted as a consequence of the deletion. Among these are the AMPA 2 gene that encodes the glutamate receptor GluR2 sub-unit, GLRA3 and GLRB genes that encode glycine receptor subunits and neuropeptide Y receptor genes NPY1R and NPY5R. Conclusions The deletion in this autistic subject serves to highlight specific autism candidate genes. He is hemizygous for AMPA 2, GLRA3, GLRB, NPY1R and NPY5R. GluR2 is the major determinant of AMPA receptor structure. Glutamate

  18. Deletion of the topoisomerase III gene in the hyperthermophilic archaeon Sulfolobus islandicus results in slow growth and defects in cell cycle control

    DEFF Research Database (Denmark)

    Li, Xiyang; Guo, Li; Deng, Ling

    2011-01-01

    Topoisomerase III (topo III), a type IA topoisomerase, is widespread in hyperthermophilic archaea. In order to interrogate the in vivo role of archaeal topo III, we constructed and characterized a topo III gene deletion mutant of Sulfolobus islandicus. The mutant was viable but grew more slowly......-growing cultures. As shown by fluorescence microscopy, a fraction of mutant cells in the cultures were drastically enlarged, and at least some of the enlarged cells were apparently capable of resuming cell division. The mutant also shows a different transcriptional profile from that of the wild-type strain. Our...... results suggest that the enzyme may serve roles in chromosomal segregation and control of the level of supercoiling in the cell....

  19. Novel single base-pair deletion in exon 1 of XK gene leading to McLeod syndrome with chorea, muscle wasting, peripheral neuropathy, acanthocytosis and haemolysis.

    Science.gov (United States)

    Wiethoff, Sarah; Xiromerisiou, Georgia; Bettencourt, Conceição; Kioumi, Anna; Tsiptsios, Iakovos; Tychalas, Athanasios; Evaggelia, Markousi; George, Kaltsounis; Makris, Vasileios; Hardy, John; Houlden, Henry

    2014-04-15

    We present a 70-year-old male patient of Greek origin with choreatic movements of the tongue and face, lower limb muscle weakness, peripheral neuropathy, elevated creatinephosphokinase (CPK), acanthocytosis and haemolysis in the absence of Kell RBC antigens with an additional Factor IX-deficiency. Genetic testing for mutations in the three exons of the XK gene revealed a previously unreported hemizygous single base-pair frameshift deletion at exon 1 (c.229delC, p.Leu80fs). In conclusion, we hereby describe a rare phenotype of a patient with McLeod syndrome which was discovered coincidentally during routine blood group testing and consecutively genetically confirmed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  20. The insertion and deletion (I28005D) polymorphism of the angiotensin I converting enzyme gene is a risk factor for osteoarthritis in an Asian Indian population.

    Science.gov (United States)

    Poornima, Subhadra; Subramanyam, Krishna; Khan, Imran Ali; Hasan, Qurratulain

    2015-12-01

    Angiotensin I converting enzyme (ACE) insertion and deletion (I/D) polymorphism has been implicated in the pathogenesis of osteoarthritis (OA). In recent years, numerous genetic factors have been identified and implicated in OA. In this Asian Indian population-based study, we aimed to evaluate the relationship between ACE (I28005D) gene polymorphism and primary OA. We performed a case-control association study to identify and explore the correlation between clinically, radiologically diagnosed individuals with primary knee OA and the ACE I/D polymorphism. Genomic DNA was isolated from 200 samples, including 100 OA cases and 100 healthy volunteers. DNA was amplified by polymerase chain reaction (PCR) using I and D allele-specific primers. PCR products were assessed via UV visualization of products electrophoresed on 2% agarose gels. The groups differed significantly in genotype distributions (p risk factor for early onset primary knee OA. © The Author(s) 2014.