Route to three-dimensional fragments using diversity-oriented synthesis.

Science.gov (United States)

Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W

2011-04-26

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.

Construction of ivermectin producer by domain swaps of avermectin polyketide synthase in Streptomyces avermitilis.

Science.gov (United States)

Zhang, Xiaolin; Chen, Zhi; Li, Meng; Wen, Ying; Song, Yuan; Li, Jilun

2006-10-01

Ivermectin, 22, 23-dihydroavermectin B1, is commercially important in human, veterinary medicine, and pesticides. It is currently synthesized by chemical reduction of the double bond between C22 and C23 of avermectins B1, which are a mixture of B1a (>80%) and B1b (produced by fermentation of Streptomyces avermitilis. The cost of ivermectin is much higher than that of avermectins B1 owing to the necessity of region-specific hydrogenation at C22-C23 of avermectins B1 with rhodium chloride as the catalyst for producing ivermectin. Here we report that ivermectin can be produced directly by fermentation of recombinant strains constructed through targeted genetic engineering of the avermectin polyketide synthase (PKS) in S. avermitilis Olm73-12, which produces only avermectins B and not avermectins A and oligomycin. The DNA region encoding the dehydratase (DH) and ketoreductase (KR) domains of module 2 from the avermectin PKS in S. avermitilis Olm73-12 was replaced by the DNA fragment encoding the DH, enoylreductase, and KR domains from module 4 of the pikromycin PKS of Streptomyces venezuelae ATCC 15439 using a gene replacement vector pXL211. Twenty-seven of mutants were found to produce a small amount of 22, 23-dihydroavermectin B1a and avermectin B1a and B2a by high performance liquid chromatography and liquid chromatography mass spectrometry analysis. This study might provide a route to the low-cost production of ivermectin by fermentation.

Complete isotopic distributions of fragments produced in transfer- and fusion-induced reactions

International Nuclear Information System (INIS)

Delaune, O.; Caamano, M.; Farget, F.; Tarasov, O. B.; Derkx, X.; Schmidt, K. H.; Audouin, L.; Amthor, A. M.; Bacri, C. O.; Barreau, G.; Bastin, B.; Bazin, D.; Benlliure, J.; Blank, B.; Caceres, L.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Grevy, S.; Jurado, B.; Kamalou, O.; Lemasson, A.; Lukyanov, S. M.; Mittig, W.; Morrissey, D. J.; Navin, A.; Pereira, J.; Perrot, L.; Rejmund, M.; Roger, T.; Saint-Laurent, M. G.; Savajols, H.; Schmitt, C.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C. C.

2013-01-01

Two fission experiments have been performed at GANIL using 238 U beams at different energies and light targets. Different fissioning systems were produced with centre of mass energies from 10 to 240 MeV and their decay by fission was investigated with GANIL spectrometers. Fission-fragment isotopic distributions have been obtained. The evolution with impinging energy of their properties, the neutron excess and the width of the neutron-number distributions, gives important insights into the dynamics of the fusion-fission mechanism. (authors)

Spin polarization of 34Al fragments produced by nucleon pickup at intermediate energies

International Nuclear Information System (INIS)

Turzo, K.; Himpe, P.; Borremans, D.; Mallion, S.; Neyens, G.; Vermeulen, N.; Yordanov, D.; Balabanski, D.L.; Belier, G.; Daugas, J.M.; Georgiev, G.; Oliveira de Santos, F.; Matea, I.; Stodel, Ch.; Penionzhkevich, Yu. E.

2006-01-01

The polarization of 34 Al fragments, produced by single neutron pickup from a 9 Be target by a 36 S projectile at 77.5 MeV/nucleon, have been observed at GANIL via the detection of resonantly destroyed β-asymmetry. The reaction-induced polarization is deduced using a tentative spin/parity assignment for the 34 Al ground state. A positive polarization was measured near the peak of the 34 Al yield curve. A kinematical model based on the spectator-participant model for projectile fragmentation reactions has been extended in order to take into account the features of pickup reactions, i.e., the picked-up nucleon having an average momentum equal to the Fermi momentum and aligned along the incident beam direction. The trend-line in the observed spin-orientation is very well reproduced by this model

An endogenously produced fragment of cardiac myosin-binding protein C is pathogenic and can lead to heart failure.

Science.gov (United States)

Razzaque, Md Abdur; Gupta, Manish; Osinska, Hanna; Gulick, James; Blaxall, Burns C; Robbins, Jeffrey

2013-08-16

A stable 40-kDa fragment is produced from cardiac myosin-binding protein C when the heart is stressed using a stimulus, such as ischemia-reperfusion injury. Elevated levels of the fragment can be detected in the diseased mouse and human heart, but its ability to interfere with normal cardiac function in the intact animal is unexplored. To understand the potential pathogenicity of the 40-kDa fragment in vivo and to investigate the molecular pathways that could be targeted for potential therapeutic intervention. We generated cardiac myocyte-specific transgenic mice using a Tet-Off inducible system to permit controlled expression of the 40-kDa fragment in cardiomyocytes. When expression of the 40-kDa protein is induced by crossing the responder animals with tetracycline transactivator mice under conditions in which substantial quantities approximating those observed in diseased hearts are reached, the double-transgenic mice subsequently experience development of sarcomere dysgenesis and altered cardiac geometry, and the heart fails between 12 and 17 weeks of age. The induced double-transgenic mice had development of cardiac hypertrophy with myofibrillar disarray and fibrosis, in addition to activation of pathogenic MEK-ERK pathways. Inhibition of MEK-ERK signaling was achieved by injection of the mitogen-activated protein kinase (MAPK)/ERK inhibitor U0126. The drug effectively improved cardiac function, normalized heart size, and increased probability of survival. These results suggest that the 40-kDa cardiac myosin-binding protein C fragment, which is produced at elevated levels during human cardiac disease, is a pathogenic fragment that is sufficient to cause hypertrophic cardiomyopathy and heart failure.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Preliminary studies on fragmentation in tissue-equivalent material produced by 55 MeV/u 40Ar17+ ion beam

International Nuclear Information System (INIS)

Dang Bingrong; Wei Zengquan; Duan Limin; Zhang Baoguo; Li Songlin; Yin Xu; Zhu Yongtai; Li Wenjian; Li Qiang; Yuan Shibin

2002-01-01

By using a 55 MeV/u 40 Ar 17+ beam produced by HIRFL, the distribution of fragments in 1.5 mm lucite on three different directions were measured at the radiobiology terminal. Feasibilities of the phoswich detector composed of fast plastic scintillator and CsI(Tl) detectors for determination of angular distribution of fragments in tissue-equivalent materials were investigated. The results obtained were satisfactory

Cytosolic expression of functional Fab fragments in Escherichia coli using a novel combination of dual SUMO expression cassette and EnBase® cultivation mode.

Science.gov (United States)

Rezaie, F; Davami, F; Mansouri, K; Agha Amiri, S; Fazel, R; Mahdian, R; Davoudi, N; Enayati, S; Azizi, M; Khalaj, V

2017-05-08

The Escherichia coli expression system is highly effective in producing recombinant proteins. However, there are some limitations in this system, especially in obtaining correctly folded forms of some complex proteins such as Fab fragments. To improve the solubility and folding quality of Fab fragments, we have examined the effect of simultaneous application of a SUMO fusion tag, EnBase ® cultivation mode and a redox mutant strain in the E. coli expression system. A bicistronic gene construct was designed to express an antivascular endothelial growth factor (VEGF) Fab fragment as a model system. The construct contained a dual SUMO fusion gene fragment to encode SUMO-tagged heavy and light chains. While the expression of the construct in batch cultures of BL21 or SHuffle ® transformants produced insoluble and unfolded products, the induction of the transformants in EnBase ® medium resulted in soluble and correctly folded Fab fragment, reaching as high as 19% of the total protein in shuffle strain. The functional assays indicated that the biological activity of the target Fab is similar to the commercial anti-VEGF, Lucentis ® . This study demonstrated that the combination of SUMO fusion technology, EnBase ® cultivation system and recruiting a redox mutant of E. coli can efficiently enhance the solubility and productivity of recombinant Fab fragments. The presented strategy provides not only a novel method to produce soluble and active form of an anti-VEGF Fab but also may use in the efficient production of other antibody fragments. © 2017 The Society for Applied Microbiology.

Coincidence measurements of intermediate mass fragments produced in /sup 32/S-induced reactions on Ag at E/A = 22.5 MeV

International Nuclear Information System (INIS)

Fields, D.J.; Lynch, W.G.; Nayak, T.K.

1986-01-01

Single- and two-particle inclusive cross sections for the production of light nuclei and intermediate mass fragments, 3< or =Z< or =24, were measured at angles well beyond the grazing angle for /sup 32/S-induced reactions on Ag at 720 MeV. Information about fragment multiplicities and reaction dynamics was extracted from measurements of light particles, intermediate mass fragments, and targetlike residues in coincidence with intermediate mass fragments. Incomplete linear momentum transfer and non-compound-particle emission are important features of collisions producing intermediate mass fragments. About half of the incident kinetic energy in these collisions is converted into internal excitation. The mean multiplicity of intermediate mass fragments is of the order of 1. Particle correlations are strongly enhanced in the plane which contains the intermediate mass fragment and the beam axis

Construction and operation of an universal stopping equipment for the fragment separator of the GSI Darmstadt

International Nuclear Information System (INIS)

Weckenmann, J.; Hanelt, E.; Schmidt, K.H.

1990-07-01

The fragment separator is a magnetic spectrometer, in which an especially-shaped layer of matter is applied as ion-optical element. The energy loss occurring there is accompanied by a series of unwanted effects like nuclear reaction, elecromagnetic dissociation, energy and angle straggling. These effects reduce on the one hand the total resolution of the separator and on the other hand the number of the fragments, which reach the exit of the separator. In the present study it was stated that the influence of these effects exhibits in most of the cases only a weak dependence on the material of the stopper. The ideal stopper material has a mass number, which corresponds nearly to the mass number of the selected fragment. If only one single stopper material will be applied, a material with low mass number seems to be the best compromise. Therefore for the universal stopper equipment of the fragment separator aluminium was selected. A further object of this study was the profile of the stopper. In a symmetrically constructed magnet spectrometer as the fragment separator the highest resolution is then reached, when the required particles are stopped in the whole width of their momentum distribution by a constant factor. This requirement leads to a curved profile of the stopper. It was stated that the profile can be approached by a linear wedge shape without a disadvantageous change of the resolution of the separator. The technical realization of the universal stopping equipment for the fragment separator consists mainly of very accurately manufactured, shiftable, and rotatable wedge-shaped layers. By means of a step-motor guiding the profiles required for the isotope separation can thus be obtained in a wide range. (orig.) [de

Study of fission fragments produced by 14N + 235U reaction

International Nuclear Information System (INIS)

Yalcinkaya, M.; Erduran, M.N.; Ganioglu, E.; Akkus, B.; Bostan, M.; Gurdal, G.; Erturk, S.; Balabanski, D.; Minkova, A.; Danchev, M.

2005-01-01

This work was performed to understand the structure of neutron rich fission fragments around ∼ 130 region. A thin metallic 235 U target was bombarded by 14 N beam with 10 MeV/A from the Separated Sector Cyclotron at the National Accelerator Centre, Cape Town, South Africa. The main goal to detect and identify fission fragments and to obtain their mass distribution was achieved by using Solar Cell detectors in the AFRODITE (African Omnipurpose Detector for Innovative Techniques and Experiments) spectrometer. The X-rays emitted from fission fragments were detected by LEP detectors and γ rays emitted from excited states of the fission fragments were detected by CLOVER detectors in the spectrometer. (author)

Commissioning the A1900 projectile fragment separator

CERN Document Server

Morrissey, D J; Steiner, M; Stolz, A; Wiedenhöver, I

2003-01-01

An important part of the recent upgrade of the NSCL facility is the replacement of the A1200 fragment separator with a new high acceptance device called the A1900. The design of the A1900 device represents a third generation projectile fragment separator (relative to the early work at LBL) as it is situated immediately after the primary accelerator, has a very large acceptance, a bending power significantly larger than that of the cyclotron and is constructed from large superconducting magnets (quadrupoles with 20 and 40 cm diameter warm bores). The A1900 can accept over 90% of a large range of projectile fragmentation products produced at the NSCL, leading to large gains in the intensity of the secondary beams. The results of initial tests of the system with a restricted momentum acceptance (+-0.5%) indicate that the A1900 is performing up to specifications. Further large gains in the intensities of primary beams, typically two or three orders of magnitude, will be possible as the many facets of high current...

An Algebra for Program Fragments

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

1985-01-01

Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

FRAGMENTATION ISSUE IN MALAYSIAN INDUSTRIALISED BUILDING SYSTEM (IBS PROJECTS

Directory of Open Access Journals (Sweden)

MOHD NASRUN MOHD NAWI

2014-02-01

Full Text Available As a developing country, Malaysian is currently driving for implementing a new or modern construction method, the Industrialised Building System (IBS, as an alternative towards enhancing construction performance. Currently, most of the IBS project developments in Malaysia are still conducted by using the traditional construction process approach. This traditional construction process has been widely criticised for its fragmented approach to project delivery and its failure to form effective teams thus created a number of issues such as reworks, time delay, rising costs, lack of communication and coordination, and wastages. This paper through literature review aims to highlight this fragmentation issue and clarify how far it affects the process of IBS implementation. Suggestions on how an integrated approach in design and construction in order to minimise the fragmentation gaps will be concluded.

A Framework for Coordination Process into Construction Projects

Directory of Open Access Journals (Sweden)

Alaloul Wesam S.

2016-01-01

Full Text Available Construction industry is recognized as high fragmentation, low efficiency, cost and time overruns in contrast with other industries. These peculiarities are the main roots of poor performance facing by the industry. Effective coordination is vital in construction projects success and mitigate the fragmentation dilemma, however it is often difficult to achieve and need iterative process. Coordination is core issue to improve performance in construction project. Relevant studies have addressed the coordination process importance and implementation, but not in a framework. This paper propose a framework for coordination process in construction projects, as well as its relationship with performance. The objective of the framework is to provide a roadmap for the construction parties to realize operational excellence so that collectively stakeholders can recognize the effect of coordination process application on the project performance. The data were obtained from literature review and structured interviews with five experts. The analysis produced the framework of coordination based on the extensively used procedures for information and data flow between stakeholders.

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

Light particles emitted with the fission fragments of thorium

Energy Technology Data Exchange (ETDEWEB)

San-Tsiang, T; Faraggi, H

1947-01-01

The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.

Total Synthesis of Zoanthamine Alkaloids, Part 2. Construction of the C1-C5, C6-C10 and C11-C24 Fragments of Zoanthamine

DEFF Research Database (Denmark)

Tanner, David Ackland; Tedenborg, Lars; Somfai, Peter

1997-01-01

This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R)-hydroxymethyl-butyrolac......This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R...

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

Protective vaccination with a recombinant fragment of Clostridium botulinum neurotoxin serotype A expressed from a synthetic gene in Escherichia coli.

OpenAIRE

Clayton, M A; Clayton, J M; Brown, D R; Middlebrook, J L

1995-01-01

A completely synthetic gene encoding fragment C, a approximately 50-kDa fragment, of botulinum neurotoxin serotype A was constructed from oligonucleotides. The gene was expressed in Escherichia coli, and full-sized product was produced as judged by Western blot (immunoblot) analysis. Crude extracts of E. coli expressing the gene were used to vaccinate mice and evaluate their survival against challenge with active toxin. Mice given three subcutaneous vaccinations were protected against an intr...

Rock fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

1976-01-01

Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

Reframing landscape fragmentation's effects on ecosystem services.

Science.gov (United States)

Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

2015-04-01

Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Characterization of a bioactive 15 kDa fragment produced by proteolytic cleavage of chicken growth hormone.

Science.gov (United States)

Arámburo, C; Carranza, M; Reyes, M; Luna, M; Martinez-Coria, H; Berúmen, L; Scanes, C G

2001-07-01

There is evidence for a cleaved form of GH in the chicken pituitary gland. A 25 kDa band of immunoreactive-(ir-)GH, as well as the 22 kDa monomeric form and some oligomeric forms were observed when purified GH or fresh pituitary extract were subjected to SDS-PAGE under nonreducing conditions. Under reducing conditions, the 25 kDa ir-GH was no longer observed, being replaced by a 15 kDa band, consistent with reduction of the disulfide bridges of the cleaved form. The type of protease involved was investigated using exogenous proteases and monomeric cGH. Cleaved forms of chicken GH were generated by thrombin or collagenase. The site of cleavage was found in position Arg133-Gly134 as revealed by sequencing the fragments produced. The NH2-terminal sequence of 40 amino acid residues in the 15 kDa form was identical to that of the rcGH and analysis of the remaining 7 kDa fragment showed an exact identity with positions 134-140 of cGH structure. The thrombin cleaved GH and the 15 kDa form showed reduced activity (0.8% and 0.5% of GH, respectively) in a radioreceptor assay employing a chicken liver membrane preparation. However, this fragment had a clear bioactivity in an angiogenic bioassay and was capable to inhibit the activity of deiodinase type III in the chicken liver.

Mini-Fragment Fixation Is Equivalent to Bicortical Screw Fixation for Horizontal Medial Malleolus Fractures.

Science.gov (United States)

Wegner, Adam M; Wolinsky, Philip R; Robbins, Michael A; Garcia, Tanya C; Amanatullah, Derek F

2018-05-01

Horizontal fractures of the medial malleolus occur through application of valgus or abduction force through the ankle that creates a tension failure of the medial malleolus. The authors hypothesize that mini-fragment T-plates may offer improved fixation, but the optimal fixation construct for these fractures remains unclear. Forty synthetic distal tibiae with identical osteotomies were randomized into 4 fixation constructs: (1) two parallel unicortical cancellous screws; (2) two parallel bicortical cortical screws; (3) a contoured mini-fragment T-plate with 2 unicortical screws in the fragment and 2 bicortical screws in the shaft; and (4) a contoured mini-fragment T-plate with 2 bicortical screws in the fragment and 2 unicortical screws in the shaft. Specimens were subjected to offset axial tension loading on a servohydraulic testing system and tracked using high-resolution video. Failure was defined as 2 mm of articular displacement. Analysis of variance followed by a Tukey-Kramer post hoc test was used to assess for differences between groups, with significance defined as Pfragment T-plate constructs (239±83 N/mm and 190±37 N/mm) and the bicortical screw construct (240±17 N/mm) were not statistically different. The mean stiffness values of both mini-fragment T-plate constructs and the bicortical screw construct were higher than that of a parallel unicortical screw construct (102±20 N/mm). Contoured T-plate constructs provide stiffer initial fixation than a unicortical cancellous screw construct. The T-plate is biomechanically equivalent to a bicortical screw construct, but may be superior in capturing small fragments of bone. [Orthopedics. 2018; 41(3):e395-e399.]. Copyright 2018, SLACK Incorporated.

Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

Science.gov (United States)

Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

2018-04-01

The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

Measurement of isotopic cross sections of the fission fragments produced in 500 AMeV 208Pb + p reaction

International Nuclear Information System (INIS)

Fernandez-Dominguez, B.

2003-03-01

The aim of this work is the study of the fission fragments produced in the spallation reaction 208 Pb + p at 500 AMeV. The fission fragments from Z=23 up to Z=59 have been detected and identified by using the inverse kinematics technique with the high-resolution spectrometer FRS. The production cross sections and the recoil velocities of 430 nuclei have been measured. The measured data have been compared with previous data. The isotopic distributions show a high precision. However, the absolute value of the fission cross section is higher than expected. From the experimental data the characteristics of the average fissioning system have been reconstructed (Z fis , A fis , E* fis ). In addition, the number of post-fission neutrons emitted from the fission fragments, v post , has been determined by using a new method. The experimental data have been compared to the two-steps models describing the spallation reaction. The impact of the model parameters on the observables has been analysed and the reasons Leading to the observed differences between the codes are also presented. This analyse shows a good agreement with the INCL4+ABLA code. (author)

Anisotropy in angular distributions of 238U fission fragments by photons, produced in high energy electron interaction with Si monocrystal

International Nuclear Information System (INIS)

Kasilov, V.I.; Lapin, N.N.

1981-01-01

An enhancement is detected under the angle of 90 deg in the fission fragment yield from 238 U nuclei produced by photons emitted by high-energy electrons passing through a silicon monocrystal. The results enable one to select the most optimal conditions to obtain maximal yields of nuclear particles [ru

Continuous fragment of the mu-calculus

NARCIS (Netherlands)

Fontaine, G.

2008-01-01

In this paper we investigate the Scott continuous fragment of the modal μ-calculus. We discuss its relation with constructivity, where we call a formula constructive if its least fixpoint is always reached in at most ω steps. Our main result is a syntactic characterization of this continuous

Emission of light charged particles from fragments produced on fission of uranium nuclei by 153 MeV protons and 1700 MeV negative pions

International Nuclear Information System (INIS)

Belovitzky, G.E.; Shteingrad, O.M.

2000-01-01

The mechanism underlying the emission of light charged particles (LCP) with Z = 1, 2 from fragments produced in fission of uranium nuclei by 153 MeV protons and 1700 MeV negative pions was studied. It was found that LCP accompanying the fission by pions are emitted from non-accelerated fragments immediately after the fission, whereas in the case of 153 MeV protons, the LCP are emitted from the accelerated heavy fragments. The number of LCP emitted in the course of pion-induced fission is 0.7 per fission event, which exceeds by a factor of 30 the corresponding number for 153 MeV protons [ru

Architectural fragments

DEFF Research Database (Denmark)

Bang, Jacob Sebastian

2018-01-01

I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

Three-body fragmentation of methane dications produced by slow A r8 + -ion impact

Science.gov (United States)

Zhang, Y.; Jiang, T.; Wei, L.; Luo, D.; Wang, X.; Yu, W.; Hutton, R.; Zou, Y.; Wei, B.

2018-02-01

The three-body fragmentation dynamics of CH4 2 + dications induced by single-electron capture of slow (3-keV/u) A r8 + ions is investigated. The experiment is performed on a newly built, highly charged ion collision platform which consists of an electron cyclotron resonance ion source and a cold target recoil ion momentum spectroscopy (COLTRIMS) setup. Using the COLTRIMS methodology, the complete kinematical information is determined for two three-body breakup channels, CH4 2 +→H++CH2 ++H and CH4 2 +→H2 ++C H++H . Then analyzing the complete kinematics with the Dalitz plot, very different fragmentation mechanisms (e.g., sequential and/or concerted pathway) are clearly identified for the two channels. To confirm the existence of some possible fragmentation pathways, we also simulate corresponding Dalitz plots employing a simple classical mechanical model. For the H++CH2 ++H channel, the dependence of the fragmentation pathway on its kinetic energy release is studied, which reflects the different nature of the corresponding states of CH4 2 + dications. Furthermore, the kinetic energy ratio of two ionic fragments is analyzed to infer the three-body fragmentation mechanism of CH4 2 + dications.

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

Evolutions in fragment-based drug design: the deconstruction–reconstruction approach

Science.gov (United States)

Chen, Haijun; Zhou, Xiaobin; Wang, Ailan; Zheng, Yunquan; Gao, Yu; Zhou, Jia

2014-01-01

Recent advances in the understanding of molecular recognition and protein–ligand interactions have facilitated rapid development of potent and selective ligands for therapeutically relevant targets. Over the past two decades, a variety of useful approaches and emerging techniques have been developed to promote the identification and optimization of leads that have high potential for generating new therapeutic agents. Intriguingly, the innovation of a fragment-based drug design (FBDD) approach has enabled rapid and efficient progress in drug discovery. In this critical review, we focus on the construction of fragment libraries and the advantages and disadvantages of various fragment-based screening (FBS) for constructing such libraries. We also highlight the deconstruction–reconstruction strategy by utilizing privileged fragments of reported ligands. PMID:25263697

Molten aluminum alloy fuel fragmentation experiments

International Nuclear Information System (INIS)

Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

1992-01-01

Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

Fragmentation properties of 6Li

International Nuclear Information System (INIS)

Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

1987-01-01

The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

Fragment Impact Toolkit (FIT)

Energy Technology Data Exchange (ETDEWEB)

Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-09-05

The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

Velocity distribution of fragments of catastrophic impacts

Science.gov (United States)

Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

1992-01-01

Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

Engineering of the Lactococcus lactis serine proteinase by construction of hybrid enzymes

NARCIS (Netherlands)

Boerrigter, Ingrid J.; Buist, Girbe; Haandrikman, Alfred J.; Nijhuis, Monique; Reuver, Marjon B. de; Siezen, Roland J.; Venema, Gerhardus; Vos, Willem M. de; Kok, Jan

Plasmids containing wild-type and hybrid proteinase genes were constructed from DNA fragments of the prtP genes of Lactococcus lactis strains Wg2 and SK11. These plasmids were introduced into the plasmid-free strain L. lactis MG1363. The serine proteinases produced by these L. lactis strains were

De novo analysis of electron impact mass spectra using fragmentation trees

International Nuclear Information System (INIS)

Hufsky, Franziska; Rempt, Martin; Rasche, Florian; Pohnert, Georg; Böcker, Sebastian

2012-01-01

Highlights: ► We present a method for de novo analysis of accurate mass EI mass spectra of small molecules. ► This method identifies the molecular ion and thus the molecular formula where the molecular ion is present in the spectrum. ► Fragmentation trees are constructed by automated signal extraction and evaluation. ► These trees explain relevant fragmentation reactions. ► This method will be very helpful in the automated analysis of unknown metabolites. - Abstract: The automated fragmentation analysis of high resolution EI mass spectra based on a fragmentation tree algorithm is introduced. Fragmentation trees are constructed from EI spectra by automated signal extraction and evaluation. These trees explain relevant fragmentation reactions and assign molecular formulas to fragments. The method enables the identification of the molecular ion and the molecular formula of a metabolite if the molecular ion is present in the spectrum. These identifications are independent of existing library knowledge and, thus, support assignment and structural elucidation of unknown compounds. The method works even if the molecular ion is of very low abundance or hidden under contaminants with higher masses. We apply the algorithm to a selection of 50 derivatized and underivatized metabolites and demonstrate that in 78% of cases the molecular ion can be correctly assigned. The automatically constructed fragmentation trees correspond very well to published mechanisms and allow the assignment of specific relevant fragments and fragmentation pathways even in the most complex EI-spectra in our dataset. This method will be very helpful in the automated analysis of metabolites that are not included in common libraries and it thus has the potential to support the explorative character of metabolomics studies.

Neighbouring charge fragmentations in low energy fission

International Nuclear Information System (INIS)

Montoya, M.

1986-10-01

Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

Biological effectiveness of high-energy protons - Target fragmentation

International Nuclear Information System (INIS)

Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.

1991-01-01

High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs

Radio Frequency Fragment Separator at NSCL

International Nuclear Information System (INIS)

Bazin, D.; Andreev, V.; Becerril, A.; Doleans, M.; Mantica, P.F.; Ottarson, J.; Schatz, H.; Stoker, J.B.; Vincent, J.

2009-01-01

A new device has been designed and built at NSCL which provides additional filtering of radioactive beams produced via projectile fragmentation. The Radio Frequency Fragment Separator (RFFS) uses the time micro structure of the beams accelerated by the cyclotrons to deflect particles according to their time-of-flight, in effect producing a phase filtering. The transverse RF (Radio Frequency) electric field of the RFFS has superior filtering performance compared to other electrostatic devices, such as Wien filters. Such filtering is critical for radioactive beams produced on the neutron-deficient side of the valley of stability, where strong contamination occurs at intermediate energies from 50 to 200 MeV/u.

Medium-scale melt-sodium fragmentation experiments

International Nuclear Information System (INIS)

Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.

1979-01-01

The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

The dynamical fate of self-gravitating disc fragments after tidal downsizing

Science.gov (United States)

Forgan, Duncan; Parker, Richard J.; Rice, Ken

2015-02-01

The gravitational instability model of planet/brown dwarf formation proposes that protostellar discs can fragment into objects with masses above a few Jupiter masses at large semimajor axis. Tidal downsizing may reduce both the object mass and semimajor axis. However, most studies of tidal downsizing end when the protostellar disc disperses, while the system is embedded in its parent star-forming region. To compare disc fragment descendants with exoplanet and brown dwarf observations, the subsequent dynamical evolution must be explored. We carry out N-body integrations of fragment-fragment scattering in multi-object star systems, and star systems embedded in substructured clusters. In both cases, we use initial conditions generated by population synthesis models of tidal downsizing. The scattering simulations produce a wide range of eccentricities. The ejection rate is around 25 per cent. The ejecta mass distribution is similar to that for all objects, with a velocity dispersion consistent with those produced by full hydrodynamic simulations. The semimajor axis distribution after scattering extends to parsec scales. In the cluster simulations, 13 per cent of the objects are ejected from their planetary system, and around 10 per cent experience significant orbit modification. A small number of objects are recaptured on high-eccentricity, high-inclination orbits. The velocity distribution of ejecta is similar to that produced by fragment-fragment scattering. If fragment-fragment scattering and cluster stripping act together, then disc fragmentation should be efficient at producing free-floating substellar objects, and hence characterizing the free-floating planet population will provide strong constraints on the frequency of disc fragmentation.

Measurement of projectile-like fragments produced by 80. 6 MeV /sup 16/O on /sup 27/Al

Energy Technology Data Exchange (ETDEWEB)

Wen-Qing, SHEN; Shu-Zhi, YIN; Zhong-Yan, GUO; Wen-Long, ZHAN; Yong-Tai, ZHU; Gen-Ming, JIN; Wei-Min, QIAO; En-Chiu, WU; Cheng-Lie, JIANG

1985-05-01

The projectile-like fragments produced by 80.6 MeV /sup 16/O on /sup 27/Al were measured using the large area position sensitive ionization chamber. The energy spectra, angular distributions, contour plots of d/sup 2/sigma/d..cap omega..dE in the E-theta plane of the reaction products from Li to Na and the Z-distribution were obtained. The cross sections of the quasi and deep inelastic scattering were introduced. A brief discussion of the experimental results is also given.

Fluctuations in the size of the largest projectile fragment produced in 1 GeV/nucleon Au + C collisions

International Nuclear Information System (INIS)

Warren, P.; Elliott, J.B.; Gilkes, M.L.; Hauger, A.; Hirsch, A.S.

1993-01-01

Large fluctuations in quantities such as density are characteristic of critical phenomena in the neighborhood of the critical point. Using the EOS apparatus at the Bevalac, we have performed an exclusive experiment in which the size of the largest projectile fragment produced in 1 GeV/nucleon Au+C collisions is studied as a function of the charged multiplicity of the event. A peak in the fluctuations is expected at the critical multiplicity. The data are compared to a percolation model and a statistical multifragmentation model

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

Aspect Ratio Dependence of Impact Fragmentation

International Nuclear Information System (INIS)

Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

1997-01-01

A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

Current fragmentation in deep inelastic scattering

International Nuclear Information System (INIS)

Hamer, C.J.

1975-04-01

It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Validation of Geant4 fragmentation for Heavy Ion Therapy

Science.gov (United States)

Bolst, David; Cirrone, Giuseppe A. P.; Cuttone, Giacomo; Folger, Gunter; Incerti, Sebastien; Ivanchenko, Vladimir; Koi, Tatsumi; Mancusi, Davide; Pandola, Luciano; Romano, Francesco; Rosenfeld, Anatoly B.; Guatelli, Susanna

2017-10-01

12C ion therapy has had growing interest in recent years for its excellent dose conformity. However at therapeutic energies, which can be as high as 400 MeV/u, carbon ions produce secondary fragments. For an incident 400 MeV/u 12C ion beam, ∼ 70 % of the beam will undergo fragmentation before the Bragg Peak. The dosimetric and radiobiological impact of these fragments must be accurately characterised, as it can result in increasing the risk of secondary cancer for the patient as well as altering the relative biological effectiveness. This work investigates the accuracy of three different nuclear fragmentation models available in the Monte Carlo Toolkit Geant4, the Binary Intranuclear Cascade (BIC), the Quantum Molecular Dynamics (QMD) and the Liege Intranuclear Cascade (INCL++). The models were benchmarked against experimental data for a pristine 400 MeV/u 12C beam incident upon a water phantom, including fragment yield, angular and energy distribution. For fragment yields the three alternative models agreed between ∼ 5 and ∼ 35 % with experimental measurements, the QMD using the "Frag" option gave the best agreement for lighter fragments but had reduced agreement for larger fragments. For angular distributions INCL++ was seen to provide the best agreement among the models for all elements with the exception of Hydrogen, while BIC and QMD was seen to produce broader distributions compared to experiment. BIC and QMD performed similar to one another for kinetic energy distributions while INCL++ suffered from producing lower energy distributions compared to the other models and experiment.

The calculated modelling of a local thinning of a pipe fragment subjected to erosive-corrosive wear to definition of a stress state of construction at the defect zone

International Nuclear Information System (INIS)

Shugajlo, O.P.; Krits'kij, V.B.; Lugovoj, P.Z.

2005-01-01

The models of a defect-thinning of pipes fragment as an ellipse, elliptic paraboloid and elliptic cone are developed in order to analyze their impact on a stress state of a construction at the defect zone

Complex fragment emission from hot compound nuclei

International Nuclear Information System (INIS)

Moretto, L.G.

1986-03-01

The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs

Total Synthesis of Zoanthamine Alkaloids, Part 2. Construction of the C1-C5, C6-C10 and C11-C24 Fragments of Zoanthamine

DEFF Research Database (Denmark)

Tanner, David Ackland; Tedenborg, Lars; Somfai, Peter

1997-01-01

This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R...

Observation for really cold fragmentation of heavy nucleus

International Nuclear Information System (INIS)

Goverdovskij, A.A.; Ketlerov, V.V.; Mitrofanov, V.F.; Ostapenko, Yu.B.; Khryachkov, V.A.

1998-01-01

The results of the detailed study on mass-energy charged correlations of the thorium-232 fission fragments, produced by the 5 MeV neutrons are presented. The event of the thorium nucleus really cold fragmentation into tellurium-134 and strontium-99 at the basic quantum states is identified. It is shown that the whole reaction energy is exhausted by the motion kinetic energy of the fragments in the mutual field

Dissociation and Memory Fragmentation in Posttraumatic Stress Disorder: An Evaluation of the Dissociative Encoding Hypothesis

Science.gov (United States)

Bedard-Gilligan, Michele; Zoellner, Lori A.

2012-01-01

Several prominent theories of posttraumatic stress disorder (PTSD) posit that peritraumatic dissociation results in insufficient encoding of the trauma memory and that persistent dissociation prevents memory elaboration, resulting in memory fragmentation and PTSD. In this review, we summarize the empirical literature on peritraumatic and trait dissociation and trauma narrative fragmentation as measured by meta-memory and rater/objective coding. Across 16 studies to date, the association between dissociation and fragmentation was most prominent when examining peritraumatic dissociation and patient's own ratings of memory fragmentation. This relationship did not hold when examining trait dissociation or rater-coded or computer-generated measures of fragmentation. Thus, initial evidence points more toward a strong self-reported association between constructs that is not supported on more objective fragmentation coding. Measurement overlap, construct ambiguity, and exclusion of potential confounds may underlie lack of a strong association between dissociation and objective-rated fragmentation. PMID:22348400

Measurement of π0 fragments from jets produced in pp collisions at the CERN ISR

International Nuclear Information System (INIS)

Kourkoumelis, C.; Resvanis, L.K.; Filippas, T.A.; Fokitis, E.; Fabjan, C.W.; Fields, T.; Lissauer, D.; Mannelli, I.; Mouzourakis, P.; Nappi, A.; Willis, W.J.; Goldberg, M.; Horwitz, N.; Moneti, G.C.

1979-01-01

The jet fragmentation function into π 0 , f(z) has been measured using the away side high psub(t) π 0 or eta mesons as a measure of the jet momentum. The fragmentation function is found to have an excess of events near z approximately 1 compared with the exponential fall-off observed at lower z values. The data behaves like 1/z 3 up to z approximately 1, but deviates sharply from it for z>=1. Possible explanations of this effect are the single particle fragmentation mode of the quark or gluon jet, or quark fusion. (Auth.)

Effective source size, radial, angular and energy spread of therapeutic 11C positron emitter beams produced by 12C fragmentation

Science.gov (United States)

Lazzeroni, Marta; Brahme, Anders

2014-02-01

The use of positron emitter light ion beams in combination with PET (Positron Emission Tomography) and PET-CT (Computed Tomography) imaging could significantly improve treatment verification and dose delivery imaging during radiation therapy. The present study is dedicated to the analysis of the beam quality in terms of the effective source size, as well as radial, angular and energy spread of the 11C ion beam produced by projectile fragmentation of a primary point monodirectional and monoenergetic 12C ion beam in a dedicated range shifter of different materials. This study was performed combining analytical methods describing the transport of particles in matter and the Monte Carlo code SHIELD-HIT+. A high brilliance and production yield of 11C fragments with a small effective source size and emittance is best achieved with a decelerator made of two media: a first liquid hydrogen section of about 20 cm followed by a hydrogen rich section of variable length. The calculated intensity of the produced 11C ion beam ranges from about 5% to 8% of the primary 12C beam intensity depending on the exit energy and the acceptance of the beam transport system. The angular spread is lower than 1 degree for all the materials studied, but the brilliance of the beam is the highest with the proposed mixed decelerator.

Zinc Mediated Tandem Fragmentation-Allylation of Methyl 5-Iodopentofuranosides

DEFF Research Database (Denmark)

Hyldtoft, Lene; Madsen, Robert

1999-01-01

In the presence of zinc and allyl bromide methyl 5-iodopentofuranosides undergo a tandem fragmentation alkylation to give functionalized dienes. These can undergo ring-closing olefin metathesis to produce cyclohexenes which on dihydroxylation give quercitols.......In the presence of zinc and allyl bromide methyl 5-iodopentofuranosides undergo a tandem fragmentation alkylation to give functionalized dienes. These can undergo ring-closing olefin metathesis to produce cyclohexenes which on dihydroxylation give quercitols....

Comparison of midvelocity fragment formation with projectilelike decay

International Nuclear Information System (INIS)

Hudan, S.; Alfaro, R.; Davin, B.; Larochelle, Y.; Xu, H.; Beaulieu, L.; Lefort, T.; Yanez, R.; Souza, R.T. de; Charity, R.J.; Sobotka, L.G.; Liu, T.X.; Liu, X.D.; Lynch, W.G.; Shomin, R.; Tan, W.P.; Tsang, M.B.; Molen, A. van der; Wagner, A.; Xi, H.F.

2005-01-01

The characteristics of intermediate mass fragments (IMFs: 3≤ Z≤ 20) produced in midperipheral and central collisions are compared. We compare IMFs detected at midvelocity with those evaporated from the excited projectilelike fragment (PLF*). On average, the IMFs produced at midvelocity are larger in atomic number, exhibit broader transverse velocity distributions, and are more neutron rich as compared to IMFs evaporated from the PLF*. These characteristics of midvelocity fragments are consistent with the low-density formation of the fragments. We present in the different kinematical regions studied, the perpendicular > for isotopically identified IMFs. For a given Z, perpendicular > is either constant or decreases slightly with increasing A, in contradiction with a mass-dependent collective expansion in which all IMFs are emitted on average at the same time. Neutron-deficient isotopes of even Z elements manifest higher kinetic energies than heavier isotopes of the same element for both PLF* and midvelocity emission. This result may be because of the charged-particle decay of long-lived excited states

Percolation versus microcanonical fragmentation - comparison of fragment size distribution: Where is the liquid-gas transition in nuclei?

International Nuclear Information System (INIS)

Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin

1990-01-01

The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)

GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

International Nuclear Information System (INIS)

Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

2008-01-01

Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

Dissociation and memory fragmentation in post-traumatic stress disorder: an evaluation of the dissociative encoding hypothesis.

Science.gov (United States)

Bedard-Gilligan, Michele; Zoellner, Lori A

2012-01-01

Several prominent theories of post-traumatic stress disorder (PTSD) posit that peritraumatic dissociation results in insufficient encoding of the trauma memory and that persistent dissociation prevents memory elaboration, resulting in memory fragmentation and PTSD. In this review we summarise the empirical literature on peritraumatic and trait dissociation and trauma narrative fragmentation as measured by meta-memory and rater/objective coding. Across 16 studies to date, the association between dissociation and fragmentation was most prominent when examining peritraumatic dissociation and patient's own ratings of memory fragmentation. This relationship did not hold when examining trait dissociation or rater-coded or computer-generated measures of fragmentation. Thus initial evidence points more towards a strong self-reported association between constructs that is not supported on more objective fragmentation coding. Measurement overlap, construct ambiguity, and exclusion of potential confounds may underlie lack of a strong association between dissociation and objective-rated fragmentation.

Fragmentation in DNA double-strand breaks

International Nuclear Information System (INIS)

Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

2005-01-01

DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

Mobile Learning Model and Process Optimization in the Era of Fragmentation

Science.gov (United States)

Zhang, Shi-Jun; Yu, Gui-Hua

2017-01-01

In the context of mobile Internet, college students' leisure time has fragmentation characteristics to improve the value of time, it is of great practical significance to make full use of fragmentation time to study effectively. This research focuses on mobile learning model and its effect, firstly, qualitative research is used to construct the…

Nuclear isomerism in fission fragments produced by the spontaneous fission of {sup 252}Cf; Isomerisme nucleaire dans les fragments de fission produits dans la fission spontanee du {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C

1997-09-01

This thesis is devoted to the study of the nuclear structure of neutron-rich nuclei, via the search of isomeric nuclear states. Neutron-rich nuclei were produced in the spontaneous fission of {sup 252}Cf. The experimental study of isomeric states in these nuclei was performed with the {gamma}-array EUROGAM II, coupled to an additional and original fission fragment detector composed by photovoltaic cells, SAPhIR. The photovoltaic cells are well adapted to detect low energy heavy ions and have good energy and time resolutions to obtain a good fission fragment detection. This experiment led to the discovery of new isomeric states in {sup 135}Xe, {sup 104}Mo, {sup 146,147,148}Ce and {sup 152,154,156}Nd, with lifetimes between 60 ns and 2 {mu}s. Level schemes of these nuclei have been completed. An interpretation of the isomeric states in the nuclei {sup 154,156}Nd and {sup 156,158}Sm was performed by Hartree-Fock-Bogolyubov calculations using the DIS Gogny force with two quasi-particles excitations. The confrontation with the experimental results led to an interpretation of these isomeric states as K-isomers. (author)

Fragmentation of Jets Produced in Proton-Antiproton Collisions at $\\sqrt{s} = 1.96$ TeV

Energy Technology Data Exchange (ETDEWEB)

Jindariani, Sergo R. [Univ. of Florida, Gainesville, FL (United States)

2007-01-01

We present the first measurement of two-particle momentum correlations in jets produced in p$\\bar{p}$ collisions at center of mass energy of 1.96 TeV. A comparison of the experimental data to theoretical predictions obtained for partons within the framework of resummed perturbative QCD (Next-to-Leading Log Approximation) shows that the predicted parton momentum correlations survive the hadronization stage of jet fragmentation and are present at the hadron level. We also present the measurement of the intrinsic transverse momenta of particles with respect to jet axis (k_T ). Experimental data is compared to the theoretical predictions obtained for partons within the framework of Modified Leading Log Approximation and Next-to-Modified Leading Log Approximation, and shows good agreement in the range of validity of the theoretical predictions. The results of both measurements indicate that the perturbative stage of the jet formation must be dominant and give further support to the hypothesis of Local Parton-Hadron Duality.

A probabilistic fragment-based protein structure prediction algorithm.

Directory of Open Access Journals (Sweden)

David Simoncini

Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].

Computational medicinal chemistry in fragment-based drug discovery: what, how and when.

Science.gov (United States)

Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen

2011-01-01

The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.

Fragment-based approaches to the discovery of kinase inhibitors.

Science.gov (United States)

Mortenson, Paul N; Berdini, Valerio; O'Reilly, Marc

2014-01-01

Protein kinases are one of the most important families of drug targets, and aberrant kinase activity has been linked to a large number of disease areas. Although eminently targetable using small molecules, kinases present a number of challenges as drug targets, not least obtaining selectivity across such a large and relatively closely related target family. Fragment-based drug discovery involves screening simple, low-molecular weight compounds to generate initial hits against a target. These hits are then optimized to more potent compounds via medicinal chemistry, usually facilitated by structural biology. Here, we will present a number of recent examples of fragment-based approaches to the discovery of kinase inhibitors, detailing the construction of fragment-screening libraries, the identification and validation of fragment hits, and their optimization into potent and selective lead compounds. The advantages of fragment-based methodologies will be discussed, along with some of the challenges associated with using this route. Finally, we will present a number of key lessons derived both from our own experience running fragment screens against kinases and from a large number of published studies.

Reconstruction of Banknote Fragments Based on Keypoint Matching Method.

Science.gov (United States)

Gwo, Chih-Ying; Wei, Chia-Hung; Li, Yue; Chiu, Nan-Hsing

2015-07-01

Banknotes may be shredded by a scrap machine, ripped up by hand, or damaged in accidents. This study proposes an image registration method for reconstruction of multiple sheets of banknotes. The proposed method first constructs different scale spaces to identify keypoints in the underlying banknote fragments. Next, the features of those keypoints are extracted to represent their local patterns around keypoints. Then, similarity is computed to find the keypoint pairs between the fragment and the reference banknote. The banknote fragments can determine the coordinate and amend the orientation. Finally, an assembly strategy is proposed to piece multiple sheets of banknote fragments together. Experimental results show that the proposed method causes, on average, a deviation of 0.12457 ± 0.12810° for each fragment while the SIFT method deviates 1.16893 ± 2.35254° on average. The proposed method not only reconstructs the banknotes but also decreases the computing cost. Furthermore, the proposed method can estimate relatively precisely the orientation of the banknote fragments to assemble. © 2015 American Academy of Forensic Sciences.

Timing characteristics of a two-dimensional multi-wire cathode strip detector for fission fragments

International Nuclear Information System (INIS)

Vind, R.P.; Joshi, B.N.; Jangale, R.V.; Inkar, A.L.; Prajapati, G.K.; John, B.V.; Biswas, D.C.

2014-01-01

In the recent past, a gas filled two-dimensional multi-wire cathode strip detector (MCSD) was developed for the detection of fission fragments (FFs). The position resolution was found to be about 1.0 and 1.5 mm in X and Y directions respectively. The detector has three electrode planes consisting of cathode strip (X-plane), anode wires and split-cathode wires (Y-plane). Each thin wire of the anode plane placed between the two cathode planes is essentially independent and behaves like a proportional counter. The construction of the detector in detail has been given in our earlier paper. The position information has been obtained by employing high impedance discrete delay line read out method for extracting position information in X and Y-directions. In this work, the timing characteristics of MCSD detector are reported to explore the possible use of this detector for the measurement of the mass of the fission fragments produced in heavy ion induced fission reactions

Process of Fragment-Based Lead Discovery—A Perspective from NMR

Directory of Open Access Journals (Sweden)

Rongsheng Ma

2016-07-01

Full Text Available Fragment-based lead discovery (FBLD has proven fruitful during the past two decades for a variety of targets, even challenging protein–protein interaction (PPI systems. Nuclear magnetic resonance (NMR spectroscopy plays a vital role, from initial fragment-based screening to lead generation, because of its power to probe the intrinsically weak interactions between targets and low-molecular-weight fragments. Here, we review the NMR FBLD process from initial library construction to lead generation. We describe technical aspects regarding fragment library design, ligand- and protein-observed screening, and protein–ligand structure model generation. For weak binders, the initial hit-to-lead evolution can be guided by structural information retrieved from NMR spectroscopy, including chemical shift perturbation, transferred pseudocontact shifts, and paramagnetic relaxation enhancement. This perspective examines structure-guided optimization from weak fragment screening hits to potent leads for challenging PPI targets.

ACFIS: a web server for fragment-based drug discovery

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-01-01

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808

Endogenous proteolytic cleavage of disease-associated prion protein to produce C2 fragments is strongly cell- and tissue-dependent.

Science.gov (United States)

Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

2010-04-02

The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.

Endogenous Proteolytic Cleavage of Disease-associated Prion Protein to Produce C2 Fragments Is Strongly Cell- and Tissue-dependent*

Science.gov (United States)

Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

2010-01-01

The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089

Photo-electron spectroscopy using synchrotron radiation of molecular radicals and fragments produced by laser photo-dissociation

International Nuclear Information System (INIS)

Nahon, Laurent

1991-01-01

This research thesis reports the combined use of a laser and of a synchrotron radiation in order to respectively photo-dissociate a molecule and to photo-ionize fragments which are analysed by photo-electron spectroscopy. This association allows, on the one hand, radical photo-ionization to be studied, and, on the other hand, polyatomic molecule photo-dissociation to be studied. The author studied the photo-excitation and/or photo-ionization in layer 4d (resp. 3d) of atomic iodine (resp. bromine) produced almost complete laser photo-dissociation of I_2 (resp. Br_2). He discuses the processes of relaxation of transitions from valence 4d to 5p (resp. 3d to 4p) which occur either by direct self-ionization or by resonant Auger effect, and reports the study of photo-dissociation of s-tetrazine (C_2N_4H_2) [fr

Test of quark fragmentation in the quark-parton model framework

International Nuclear Information System (INIS)

Derrick, M.; Barish, S.J.; Barnes, V.E.

1979-08-01

The hadronic system produced in charged-current antineutrino interactions is used to study fragmentation of the d-quark. Some problems encountered in separating the current quark-fragments are discussed. The fragmentation function for the current quark is in good agreement with the expectations of the naive quark-parton model and, in particular, there is no evidence of either a Q 2 - or x/sub BJ/-dependence. 10 references

Stochastic weighted particle methods for population balance equations with coagulation, fragmentation and spatial inhomogeneity

International Nuclear Information System (INIS)

Lee, Kok Foong; Patterson, Robert I.A.; Wagner, Wolfgang; Kraft, Markus

2015-01-01

Graphical abstract: -- Highlights: •Problems concerning multi-compartment population balance equations are studied. •A class of fragmentation weight transfer functions is presented. •Three stochastic weighted algorithms are compared against the direct simulation algorithm. •The numerical errors of the stochastic solutions are assessed as a function of fragmentation rate. •The algorithms are applied to a multi-dimensional granulation model. -- Abstract: This paper introduces stochastic weighted particle algorithms for the solution of multi-compartment population balance equations. In particular, it presents a class of fragmentation weight transfer functions which are constructed such that the number of computational particles stays constant during fragmentation events. The weight transfer functions are constructed based on systems of weighted computational particles and each of it leads to a stochastic particle algorithm for the numerical treatment of population balance equations. Besides fragmentation, the algorithms also consider physical processes such as coagulation and the exchange of mass with the surroundings. The numerical properties of the algorithms are compared to the direct simulation algorithm and an existing method for the fragmentation of weighted particles. It is found that the new algorithms show better numerical performance over the two existing methods especially for systems with significant amount of large particles and high fragmentation rates.

Stochastic weighted particle methods for population balance equations with coagulation, fragmentation and spatial inhomogeneity

Energy Technology Data Exchange (ETDEWEB)

Lee, Kok Foong [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge CB2 3RA (United Kingdom); Patterson, Robert I.A.; Wagner, Wolfgang [Weierstrass Institute for Applied Analysis and Stochastics, Mohrenstraße 39, 10117 Berlin (Germany); Kraft, Markus, E-mail: mk306@cam.ac.uk [Department of Chemical Engineering and Biotechnology, University of Cambridge, New Museums Site, Pembroke Street, Cambridge CB2 3RA (United Kingdom); School of Chemical and Biomedical Engineering, Nanyang Technological University, 62 Nanyang Drive, Singapore, 637459 (Singapore)

2015-12-15

Graphical abstract: -- Highlights: •Problems concerning multi-compartment population balance equations are studied. •A class of fragmentation weight transfer functions is presented. •Three stochastic weighted algorithms are compared against the direct simulation algorithm. •The numerical errors of the stochastic solutions are assessed as a function of fragmentation rate. •The algorithms are applied to a multi-dimensional granulation model. -- Abstract: This paper introduces stochastic weighted particle algorithms for the solution of multi-compartment population balance equations. In particular, it presents a class of fragmentation weight transfer functions which are constructed such that the number of computational particles stays constant during fragmentation events. The weight transfer functions are constructed based on systems of weighted computational particles and each of it leads to a stochastic particle algorithm for the numerical treatment of population balance equations. Besides fragmentation, the algorithms also consider physical processes such as coagulation and the exchange of mass with the surroundings. The numerical properties of the algorithms are compared to the direct simulation algorithm and an existing method for the fragmentation of weighted particles. It is found that the new algorithms show better numerical performance over the two existing methods especially for systems with significant amount of large particles and high fragmentation rates.

arXiv Generalized Fragmentation Functions for Fractal Jet Observables

CERN Document Server

Elder, Benjamin T.; Thaler, Jesse; Waalewijn, Wouter J.; Zhou, Kevin

2017-06-15

We introduce a broad class of fractal jet observables that recursively probe the collective properties of hadrons produced in jet fragmentation. To describe these collinear-unsafe observables, we generalize the formalism of fragmentation functions, which are important objects in QCD for calculating cross sections involving identified final-state hadrons. Fragmentation functions are fundamentally nonperturbative, but have a calculable renormalization group evolution. Unlike ordinary fragmentation functions, generalized fragmentation functions exhibit nonlinear evolution, since fractal observables involve correlated subsets of hadrons within a jet. Some special cases of generalized fragmentation functions are reviewed, including jet charge and track functions. We then consider fractal jet observables that are based on hierarchical clustering trees, where the nonlinear evolution equations also exhibit tree-like structure at leading order. We develop a numeric code for performing this evolution and study its phen...

Production of light fragments in hA collisions at high energies

International Nuclear Information System (INIS)

Braun, M.A.; Vechernin, V.V.

1988-12-01

Production of fast relativistic light fragments in hA collisions at high energies is considered. Direct coalescence of produced nucleons into fragments is shown to be the main mechanism for fragment production. The influence of the nuclear field is small and is not described by the well-known Butler-Pearson formulas. The coalescence coefficient strongly depends on the angle and on the behaviour of the fragment wave function at small internucleon distances. (author). 14 refs, 7 figs

Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

Science.gov (United States)

Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

2016-05-12

Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome

International Nuclear Information System (INIS)

Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie

2008-01-01

Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

ACFIS: a web server for fragment-based drug discovery.

Science.gov (United States)

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-07-08

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown 'chemical space' to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for 'chemical space', which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Primary and secondary fragmentation of crystal-bearing intermediate magma

Science.gov (United States)

Jones, Thomas J.; McNamara, Keri; Eychenne, Julia; Rust, Alison C.; Cashman, Katharine V.; Scheu, Bettina; Edwards, Robyn

2016-11-01

Crystal-rich intermediate magmas are subjected to both primary and secondary fragmentation processes, each of which may produce texturally distinct tephra. Of particular interest for volcanic hazards is the extent to which each process contributes ash to volcanic plumes. One way to address this question is by fragmenting pyroclasts under controlled conditions. We fragmented pumice samples from Soufriere Hills Volcano (SHV), Montserrat, by three methods: rapid decompression in a shock tube-like apparatus, impact by a falling piston, and milling in a ball mill. Grain size distributions of the products reveal that all three mechanisms produce fractal breakage patterns, and that the fractal dimension increases from a minimum of 2.1 for decompression fragmentation (primary fragmentation) to a maximum of 2.7 by repeated impact (secondary fragmentation). To assess the details of the fragmentation process, we quantified the shape, texture and components of constituent ash particles. Ash shape analysis shows that the axial ratio increases during milling and that particle convexity increases with repeated impacts. We also quantify the extent to which the matrix is separated from the crystals, which shows that secondary processes efficiently remove adhering matrix from crystals, particularly during milling (abrasion). Furthermore, measurements of crystal size distributions before (using x-ray computed tomography) and after (by componentry of individual grain size classes) decompression-driven fragmentation show not only that crystals influence particular size fractions across the total grain size distribution, but also that free crystals are smaller in the fragmented material than in the original pumice clast. Taken together, our results confirm previous work showing both the control of initial texture on the primary fragmentation process and the contributions of secondary processes to ash formation. Critically, however, our extension of previous analyses to characterisation

Relationship between Statistical and Dynamical properties of fragments produced at Fermi Energy in Heavy ion collisions: ng

International Nuclear Information System (INIS)

Lehaut, G.

2009-10-01

The properties of the fragments produced in heavy-ion collisions around the Fermi energy have been studied through the isospin degree of freedom. First, a theoretical approach based on a lattice gas model with two types of particles (neutron,proton) interacting by an isospin dependent and Coulomb interactions was developed. The study of the phase diagram shows that this system presents three different phases (liquid, gas, fission). In the liquid and gas phases, the energy of the system was described by a density functional, where the temperature dependence acts only on the density. The symmetry term of this functional was related to the isotopic content of the biggest fragment via an iso-scaling analysis. Secondly a systematic study of the stopping power of the nuclear matter and isospin equilibration of light particles in the most violent collisions was carried out using the experimental data taken by the INDRA multidetector at GANIL and GSI. Two stopping power regimes appear; at low energy (< 40 MeV/A) the stopping power decreases with increasing beam energy, whereas at high energy the stopping power is governed by the quantity of matter along the beam direction. An other study has been focused on the Xe+Sn reaction at 32 and 45 MeV/A with different isospin systems. The separation of three different reaction mechanisms by use of a principal component analysis allowed us to observe that the isospin content of light particles seems to be independent on the mechanism, but depends on the violence of the collision (i.e. impact parameter). (author)

Magmatic and fragmentation controls on volcanic ash surface chemistry

Science.gov (United States)

Ayris, Paul M.; Diplas, Spyros; Damby, David E.; Hornby, Adrian J.; Cimarelli, Corrado; Delmelle, Pierre; Scheu, Bettina; Dingwell, Donald B.

2016-04-01

The chemical effects of silicate ash ejected by explosive volcanic eruptions on environmental systems are fundamentally mediated by ash particle surfaces. Ash surfaces are a composite product of magmatic properties and fragmentation mechanisms, as well as in-plume and atmospheric alteration processes acting upon those surfaces during and after the eruption. Recent attention has focused on the capacity of alteration processes to shape ash surfaces; most notably, several studies have utilised X-ray photoelectron spectroscopy (XPS), a technique probing the elemental composition and coordination state of atoms within the top 10 nm of ash surfaces, to identify patterns of elemental depletions and enrichments relative to bulk ash chemical composition. Under the presumption of surface and bulk equivalence, any disparities have been previously attributed to surface alteration processes, but the ubiquity of some depletions (e.g., Ca, Fe) across multiple ash studies, irrespective of eruptive origin, could suggest these to be features of the surface produced at the instant of magma fragmentation. To investigate this possibility further, we conducted rapid decompression experiments at different pressure conditions and at ambient and magmatic temperature on porous andesitic rocks. These experiments produced fragmented ash material untouched by secondary alteration, which were compared to particles produced by crushing of large clasts from the same experiments. We investigated a restricted size fraction (63-90 μm) from both fragmented and crushed materials, determining bulk chemistry and mineralogy via XRF, SEM-BSE and EPMA, and investigated the chemical composition of the ash surface by XPS. Analyses suggest that fragmentation under experimental conditions partitioned a greater fraction of plagioclase-rich particles into the selected size fraction, relative to particles produced by crushing. Trends in surface chemical composition in fragmented and crushed particles mirror that

Does string fragmentation reveal more than longitudinal phase space?

International Nuclear Information System (INIS)

Schulze, H.J.; Aichelin, J.

1989-01-01

The fragmentation of a color string into hadrons is assumed to be a sequence of binary decays governed by Fermi's golden rule. In each decay step a hadron is produced and a string with lower energy is left. Assuming that the transition matrix element depends on p/sub T/ only the decay is completely determined by the longitudinal phase space and one parameter, the 2 > of the produced hadrons. We find an almost complete agreement with the experimental momentum (longitudinal and transversal) and multiplicity distributions and the number of produced particles. The ''seagull'' shape of 2 >(x) turns out to be completely due to the sphericity analysis. This leaves little room for extracting information of QCD from single-particle-inclusive fragmentation data

Rapid formation of rock armour for soil - rock fragment mixture during simulated rainfall

Science.gov (United States)

Poultney, E.; McGrath, G. S.; Hinz, C.

2009-04-01

Preventing erosion is an important issue in disturbed semi-arid and arid landscapes. This is in particular of highest importance for mining companies while undertaking land rehabilitation. An onsite investigation of the impact of surface rock fragments on erosion was conducted at Telfer goldmine in the Great Sandy Desert, Western Australia. The study site is a waste rock dump designed to mimic the concave slope of a natural mesa to both discourage erosion and blend in with its natural surroundings. Four treatments were used to construct the slope: two are topsoil mixed with rock fragments, and two are unmixed topsoil. A field study investigating erosion rills, particle size distribution, rock fragment coverage surface roughness and vegetation was carried out to determine changes down and across slope. The treatments constructed by mixing topsoil and rock fragments are more stable and show rock fragment distributions that more closely resemble patterns found on natural mesas surrounding Telfer. A controlled study using trays of topsoil mixed with rock fragment volumes of 50%, 60%, 70% and 80% were used to investigate how varying mixtures of rock fragments and topsoil erode using rainfall intensities between 20 and 100 mm h-1. Two runs of 25 minutes each were used to assess the temporal evolution of rock armouring. Surface coverage results converged for the 50%, 60% and 70% mixtures after the first run to coverage of about 90%, suggesting that fine sediment proportion does not affect rate and degree of rock armouring.

Fragmentation patterns of jets in pPb collisions in CMS

CERN Document Server

AUTHOR|(CDS)2089542

2016-01-01

The nuclear parton distribution function and flavor composition of hard scattering processes can be accurately studied using the jet fragmentation functions. Recent measurements of the pPb nuclear modification factor ($R_{pPb}$), with diverging values for inclusive jets and charged hadrons, have raised question on jet fragmentation properties in pPb collisions. These spectra measurements are performed with pp reference at 5.02 TeV constructed by interpolation or extrapolation from different $\\sqrt{s}$, and on steeply falling power-law spectra. As the jet fragmentation function is only evolving logarithmically with $\\sqrt{s}$, this further underscores the importance of a direct measurement. Together with the CMS results in pPb inclusive jets and charge hadron $R_{pPb}$, we introduce the new CMS measurement of fragmentation function in pPb collisions, where within our uncertainties, jets in pPb is found to have identical fragmentation property vs. pp jets. We will further discuss the consistency and tension amo...

Isomer Information from Ion Mobility Separation of High-Mannose Glycan Fragments.

Science.gov (United States)

Harvey, David J; Seabright, Gemma E; Vasiljevic, Snezana; Crispin, Max; Struwe, Weston B

2018-05-01

Extracted arrival time distributions of negative ion CID-derived fragments produced prior to traveling-wave ion mobility separation were evaluated for their ability to provide structural information on N-linked glycans. Fragmentation of high-mannose glycans released from several glycoproteins, including those from viral sources, provided over 50 fragments, many of which gave unique collisional cross-sections and provided additional information used to assign structural isomers. For example, cross-ring fragments arising from cleavage of the reducing terminal GlcNAc residue on Man 8 GlcNAc 2 isomers have unique collision cross-sections enabling isomers to be differentiated in mixtures. Specific fragment collision cross-sections enabled identification of glycans, the antennae of which terminated in the antigenic α-galactose residue, and ions defining the composition of the 6-antenna of several of the glycans were also found to have different cross-sections from isomeric ions produced in the same spectra. Potential mechanisms for the formation of the various ions are discussed and the estimated collisional cross-sections are tabulated. Graphical Abstract ᅟ.

Light nuclides observed in the fission and fragmentation of 238U

International Nuclear Information System (INIS)

Ricciardi, M.V.; Schmidt, K.H.; Benlliure, J.

2001-05-01

Light nuclides produced in collisions of 1 A.GeV 238 U with protons and titanium have been fully identified with a high-resolution forward magnetic spectrometer, the fragment separator (FRS), at GSI, and for each nuclide an extremely precise determination of the velocity has been performed. The so-obtained information on the velocity shows that the very asymmetric fission of uranium, in the 238 U + p reaction, produces neutron-rich isotopes of elements down to around charge 10. New important features of the fragmentation of 238 U, concerning the velocity and the N/Z-ratio of these light fragments, and a peculiar even-odd structure in N=Z nuclei, have also been observed. (orig.)

Neutron multiplicity of fission fragments

Energy Technology Data Exchange (ETDEWEB)

Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)

1995-10-01

The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

A 3D bioprinting system to produce human-scale tissue constructs with structural integrity.

Science.gov (United States)

Kang, Hyun-Wook; Lee, Sang Jin; Ko, In Kap; Kengla, Carlos; Yoo, James J; Atala, Anthony

2016-03-01

A challenge for tissue engineering is producing three-dimensional (3D), vascularized cellular constructs of clinically relevant size, shape and structural integrity. We present an integrated tissue-organ printer (ITOP) that can fabricate stable, human-scale tissue constructs of any shape. Mechanical stability is achieved by printing cell-laden hydrogels together with biodegradable polymers in integrated patterns and anchored on sacrificial hydrogels. The correct shape of the tissue construct is achieved by representing clinical imaging data as a computer model of the anatomical defect and translating the model into a program that controls the motions of the printer nozzles, which dispense cells to discrete locations. The incorporation of microchannels into the tissue constructs facilitates diffusion of nutrients to printed cells, thereby overcoming the diffusion limit of 100-200 μm for cell survival in engineered tissues. We demonstrate capabilities of the ITOP by fabricating mandible and calvarial bone, cartilage and skeletal muscle. Future development of the ITOP is being directed to the production of tissues for human applications and to the building of more complex tissues and solid organs.

Light fragment formation at intermediate energies

International Nuclear Information System (INIS)

Boal, D.H.

1982-03-01

This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

Radiation Simulations and Development of Concepts for High Power Beam Dumps, Catchers and Pre-separator Area Layouts for the Fragment Separators for RIA

CERN Document Server

Ronningen, Reginald; Beene, James R; Blideanu, Valetin; Boles, Jason; Bollen, Georg; Burgess, Thomas; Carter, Ken; Conner, David L; Gabriel, Tony A; Geissel, Hans; Gomes, Itacil C; Heilbronn, Lawrence; Iwase, Hiroshi; Lawton, Don; Levand, Anthony; Mansur, Louis; Momozaki, Yoichi; Morrissey, David; Nolen, Jerry; Reed, Claude; Remec, Igor; Rennich, Mark; Reyes, Susana; Sherrill, Bradley; Stein, Werner; Stoyer, Mark; Stracener, Dan; Wendel, Mark; Zeller, Al

2005-01-01

The development of high-power beam dumps and catchers, and pre-separator layouts for proposed fragment separators of the Rare-Isotope Accelerator (RIA) facility are important in realizing how to handle the 400 kW in the primary beam. We will present examples of pre-conceptual designs of beam dumps, fragment catchers, and the pre-separator layout. We will also present examples of ongoing work on radiation simulations using the heavy-ion-transport code PHITS, characterizing the secondary radiation produced by the high-power ion beams interacting with these devices. Results on radiation heating of targets, magnet coils, associated hardware and shielding, component activation, and levels of radiation dose will be presented. These initial studies will yield insight into the impact of the high-power dissipation on fragment separator design, remote handling concepts, nuclear safety and potential facility hazard classification, shielding design, civil construction design, component design, and material choices. Furth...

Measurement of isotopic cross sections of the fission fragments produced in 500 AMeV {sup 208}Pb + p reaction; Etude de la production des fragments de fission issus de la reaction {sup 208}Pb + p a 500 AMeV

Energy Technology Data Exchange (ETDEWEB)

Fernandez-Dominguez, B

2003-03-01

The aim of this work is the study of the fission fragments produced in the spallation reaction {sup 208}Pb + p at 500 AMeV. The fission fragments from Z=23 up to Z=59 have been detected and identified by using the inverse kinematics technique with the high-resolution spectrometer FRS. The production cross sections and the recoil velocities of 430 nuclei have been measured. The measured data have been compared with previous data. The isotopic distributions show a high precision. However, the absolute value of the fission cross section is higher than expected. From the experimental data the characteristics of the average fissioning system have been reconstructed (Z{sub fis}, A{sub fis}, E*{sub fis}). In addition, the number of post-fission neutrons emitted from the fission fragments, v{sub post}, has been determined by using a new method. The experimental data have been compared to the two-steps models describing the spallation reaction. The impact of the model parameters on the observables has been analysed and the reasons Leading to the observed differences between the codes are also presented. This analyse shows a good agreement with the INCL4+ABLA code. (author)

Fission fragment simulation of fusion neutron radiation effects on bulk mechanical properties

International Nuclear Information System (INIS)

Van Konynenburg, R.A.; Mitchell, J.B.; Guinan, M.W.; Stuart, R.N.; Borg, R.J.

1976-01-01

This research demonstrates the feasibility of using homogeneously-generated fission fragments to simulate high-fluence fusion neutron damage in niobium tensile specimens. This technique makes it possible to measure radiation effects on bulk mechanical properties at high damage states, using conveniently short irradiation times. The primary knock-on spectrum for a fusion reactor is very similar to that produced by fission fragments, and nearly the same ratio of gas atoms to displaced atoms is produced in niobium. The damage from fission fragments is compared to that from fusion neutrons and fission reactor neutrons in terms of experimentally measured yield strength increase, transmission electron microscopy (TEM) observations, and calculated damage energies

Dynamics of fragments and associated phenomena in heavy-ion collisions using a modified secondary algorithm

Energy Technology Data Exchange (ETDEWEB)

Kumar, Rohit [Department of Physics, Panjab University, Chandigarh-160014 (India)

2016-05-06

We discuss the stability of fragments identified by secondary algorithms used to construct fragments within quantum molecular dynamics model. For this purpose we employ three different algorithms for fragment identification. 1) The conventional minimum spanning tree (MST) method based on the spatial correlations, 2) an improved version of MST with additional binding energy constraints of cold nuclear matter, 3) and that of hot matter. We find significant role of thermal binding energies over cold matter binding energies. Significant role is observed for fragment multiplicities and stopping of fragments. Whereas insignificant effect is observed on fragment’s flow.

The Fragment Network: A Chemistry Recommendation Engine Built Using a Graph Database.

Science.gov (United States)

Hall, Richard J; Murray, Christopher W; Verdonk, Marcel L

2017-07-27

The hit validation stage of a fragment-based drug discovery campaign involves probing the SAR around one or more fragment hits. This often requires a search for similar compounds in a corporate collection or from commercial suppliers. The Fragment Network is a graph database that allows a user to efficiently search chemical space around a compound of interest. The result set is chemically intuitive, naturally grouped by substitution pattern and meaningfully sorted according to the number of observations of each transformation in medicinal chemistry databases. This paper describes the algorithms used to construct and search the Fragment Network and provides examples of how it may be used in a drug discovery context.

Fragmentation of percolation cluster perimeters

Science.gov (United States)

Debierre, Jean-Marc; Bradley, R. Mark

1996-05-01

We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

Fragmentation of 22Ne in emulsion at 4.1 A GeV/c

International Nuclear Information System (INIS)

El-Naghy, A.; Krasnov, S.A.; Tolstov, K.D.

1987-01-01

Charge distributions of projectile fragments produced in the interactions of 22 Ne beams with emulsion at 4.1 A GeV/c have been studied. Correlations between projectile and target fragments and among projectile fragments are presented. The change of charge yield distribution with the violence of the collision has been shown. The present analysis contradicts theoretical calculations describing the inclusive charge yield distribution of fragments by a single process

Construction of bifunctional molecules specific to antigen and antibody’s Fc-fragment by fusion of scFv-antibodies with staphylococcal protein A

Directory of Open Access Journals (Sweden)

Kolibo D. V.

2009-06-01

Full Text Available Aim. To develop approach for detection of scFv and their complexes with antigens. Methods. The fusion proteins, which include sequences of scFv and staphylococcal protein A, were constructed and the obtained bifunctional molecules were immunochemically analysed. Results. It was shown, that scFv fused with protein A and their complexes with antigens are effectively recognized by labelled immunoglobulins with unrestricted antigenic specificity. Conclusions. The fusion of scFv with protein A fragment is a perspective approach to increase the efficiency of application in ELISA. The obtained scFv, fused with protein A, could be used for development of test-systems for the detection of diphtheria toxin.

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Extracellular matrix fragmentation in young, healthy cartilaginous tissues.

Science.gov (United States)

Craddock, R J; Hodson, N W; Ozols, M; Shearer, T; Hoyland, J A; Sherratt, M J

2018-02-09

Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC) and the nucleus pulposus (NP) of the intervertebral disc (IVD). Whilst structural heterogeneity of intact aggrecan ( containing three globular domains) is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months), bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 %) were fragmented (lacking one or more globular domains). Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa) comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis). As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2) as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2), it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally) and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.

Method for construction of normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

Science.gov (United States)

Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

2012-01-01

The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

Construction of Biologically Functional Bacterial Plasmids In Vitro

Science.gov (United States)

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Does the range of IMF affect rise and fall trend in fragmentation?

Science.gov (United States)

Sharma, Sakshi; Kumar, Rohit; Puri, Rajeev K.

2018-05-01

We study the rise and fall behavior in the multiplicity of intermediate mass fragments produced in the asymmetric reactions of 36S+ 198Pt using isospin-dependent quantum molecular dynamics model. We use different definitions of intermediate mass fragments according to various experimental studies. We find that the use of one or the other definition of intermediate mass fragments does not alter results significantly.

Energy distribution of projectile fragment particles in heavy ion therapeutic beam

Energy Technology Data Exchange (ETDEWEB)

Matsufuji, Naruhiro; Tomura, Hiromi; Futami, Yasuyuki [National Inst. of Radiological Sciences, Chiba (Japan)] [and others

1998-03-01

Production of fragment particles in a patient`s body is one of important problems for heavy charged particle therapy. It is required to know the yield and the energy spectrum for each fragment element - so called `beam quality` to understand the effect of therapeutic beam precisely. In this study, fragment particles produced by practical therapeutic beam of HIMAC were investigated with using tissue-equivalent material and a detector complex. From the results, fragment particles were well identified by difference of their atomic numbers and the beam quality was derived. Responses of the detectors in this energy region were also researched. (author)

Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen, produced by plasmin (fragments X)

NARCIS (Netherlands)

Nieuwenhuizen, W.; Gravesen, M.

1981-01-01

Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and

Searching Fragment Spaces with feature trees.

Science.gov (United States)

Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger

2009-02-01

Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.

Improved Barriers to Turbine Engine Fragments: Interim Report II

National Research Council Canada - National Science Library

Shockey, Donald

1999-01-01

Because fragments from in-flight engine failures can damage critical aircraft components and produce catastrophic consequences, the Federal Aviation Administration is sponsoring research to mitigate...

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

Metagenome Fragment Classification Using -Mer Frequency Profiles

Directory of Open Access Journals (Sweden)

Gail Rosen

2008-01-01

Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

An experimental study of hydromagmatic fragmentation through energetic, non-explosive magma-water mixing

Science.gov (United States)

Mastin, L.G.; Spieler, O.; Downey, W.S.

2009-01-01

In this paper we report the first experimental investigation of non-explosive hydromagmatic fragmentation during energetic mixing with water. We mix magma and water by two methods: (1) pouring a basaltic melt between two converging water sprays; and (2) jetting basaltic melt at high pressure (3??MPa) through a nozzle into a tank of stagnant water. These experiments involved shear at relative velocities of ~ 5-16??m/s and vigorous mixing for less than a second, providing sufficient time for glassy rinds to grow but insufficient time for clot interiors to cool. In resulting fragments, we examined the gross morphology, which reflects fluid deformation during mixing, and surface textures, which reflect the growth and disruption of glassy rinds. We find major differences in both fragment morphology and surface texture between experiments. Water-spray experiments produced Pele's hair, thin bubble shards, melt droplets, and angular, fracture-bound droplet pieces. Melt-jet experiments produced mostly coarse (> 1??mm diameter), wavy fluidal fragments with broken ends. Fluidal surfaces of fragments produced by water-spray experiments were generally shiny under reflected light and, in microscopic examination, smooth down to micron scale, implying no disruption of glassy rinds, except for (a) rare flaking on Pele's hair that was bent prior to solidification; or (b) cracking and alligator-skin textures on segments of melt balls that had expanded before complete cooling. In contrast, textures of fluidal surfaces on fragments produced by melt-jet experiments are dull in reflected light and, in scanning electron images, exhibit ubiquitous discontinuous skins ("rinds") that are flaked, peeled, or smeared away in stripes. Adhering to these surfaces are flakes, blocks, and blobs of detached material microns to tens of microns in diameter. In the water-spray fragments, we interpret the scarcity of disrupted surface rinds to result from lack of bending after surfaces formed. In the

Diversity-Oriented Synthesis as a Strategy for Fragment Evolution against GSK3β

Science.gov (United States)

2016-01-01

Traditional fragment-based drug discovery (FBDD) relies heavily on structural analysis of the hits bound to their targets. Herein, we present a complementary approach based on diversity-oriented synthesis (DOS). A DOS-based fragment collection was able to produce initial hit compounds against the target GSK3β, allow the systematic synthesis of related fragment analogues to explore fragment-level structure–activity relationship, and finally lead to the synthesis of a more potent compound. PMID:27660690

Spontaneous formation of densely packed shear bands of rotating fragments.

Science.gov (United States)

Åström, J A; Timonen, J

2012-05-01

Appearance of self-similar space-filling ball bearings has been suggested to provide the explanation for seismic gaps, shear weakness, and lack of detectable frictional heat formation in mature tectonic faults (shear zones). As the material in a shear zone fractures and grinds, it could be thought to eventually form a conformation that allows fragments to largely roll against each other without much sliding. This type of space-filling "ball bearing" can be constructed artificially, but so far how such delicate structures may appear spontaneously has remained unexplained. It is demonstrated here that first-principles simulations of granular packing with fragmenting grains indeed display spontaneous formation of shear bands with fragment conformations very similar to those of densely packed ball bearings.

Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

Science.gov (United States)

Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

2003-05-01

Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

Optimization long hole blast fragmentation techniques and detonating circuit underground uranium mine stope

International Nuclear Information System (INIS)

Li Qin; Yang Lizhi; Song Lixia; Qin De'en; Xue Yongshe; Wang Zhipeng

2012-01-01

Aim at high rate of large blast fragmentation, a big difficulty in long hole drilling and blasting underground uranium mine stope, it is pointed out at the same time of taking integrated technical management measures, the key is to optimize the drilling and blasting parameters and insure safety the act of one that primes, adopt 'minimum burden' blasting technique, renew the stope fragmentation process, and use new process of hole bottom indirect initiation fragmentation; optimize the detonating circuit and use safe, reliable and economically rational duplex non-electric detonating circuit. The production practice shows that under the guarantee of strictly controlled construction quality, the application of optimized blast fragmentation technique has enhanced the reliability of safety detonation and preferably solved the problem of high rate of large blast fragments. (authors)

Extracellular matrix fragmentation in young, healthy cartilaginous tissues

Directory of Open Access Journals (Sweden)

RJ Craddock

2018-02-01

Full Text Available Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC and the nucleus pulposus (NP of the intervertebral disc (IVD. Whilst structural heterogeneity of intact aggrecan ( containing three globular domains is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months, bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 % were fragmented (lacking one or more globular domains. Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p < 0.0001. In contrast, fibrillar collagen appeared structurally intact and tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis. As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2 as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2, it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.

Fragmentation properties of jets produced in proton-antiproton collisions at √S = 1.8 TeV

International Nuclear Information System (INIS)

Hubbard, B.

1989-11-01

Jet fragmentation properties have been studied in collisions of protons and antiprotons at a center-of-mass energy of 1.8 TeV, using the Collider Detector at Fermilab (CDF). The fractional momentum distribution of charged particles within jets is presented and compared with Monte-Carlo predictions. With increasing di-jet invariant mass from 60 to 200 GeV/c 2 the fragmentation is observed to soften as predicted by scale breaking effects in Quantum Chromodynamics (QCD). The charged multiplicity in the jet core is observed to rise with di-jet invariant mass. 57 refs

Dual small fragment plating improves screw-to-screw load sharing for mid-diaphyseal humeral fracture fixation: a finite element study.

Science.gov (United States)

Kosmopoulos, Victor; Luedke, Colten; Nana, Arvind D

2015-01-01

A smaller humerus in some patients makes the use of a large fragment fixation plate difficult. Dual small fragment plate constructs have been suggested as an alternative. This study compares the biomechanical performance of three single and one dual plate construct for mid-diaphyseal humeral fracture fixation. Five humeral shaft finite element models (1 intact and 4 fixation) were loaded in torsion, compression, posterior-anterior (PA) bending, and lateral-medial (LM) bending. A comminuted fracture was simulated by a 1-cm gap. Fracture fixation was modelled by: (A) 4.5-mm 9-hole large fragment plate (wide), (B) 4.5-mm 9-hole large fragment plate (narrow), (C) 3.5-mm 9-hole small fragment plate, and (D) one 3.5-mm 9-hole small fragment plate and one 3.5-mm 7-hole small fragment plate. Model A showed the best outcomes in torsion and PA bending, whereas Model D outperformed the others in compression and LM bending. Stress concentrations were located near and around the unused screw holes for each of the single plate models and at the neck of the screws just below the plates for all the models studied. Other than in PA bending, Model D showed the best overall screw-to-screw load sharing characteristics. The results support using a dual small fragment locking plate construct as an alternative in cases where crutch weight-bearing (compression) tolerance may be important and where anatomy limits the size of the humerus bone segment available for large fragment plate fixation.

Element Distribution and Multiplicity of Heavy Fragments

CERN Multimedia

2002-01-01

This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...

Radioisotope thermoelectric generator/thin fragment impact test

International Nuclear Information System (INIS)

Reimus, M.A.H.; Hinckley, J.E.

1998-01-01

The General-Purpose Heat Source (GPHS) provides power for space missions by transmitting the heat of 238 Pu decay to an array of thermoelectric elements in a radioisotope thermoelectric generator (RTG). Because the potential for a launch abort or return from orbit exists for any space mission, the heat source response to credible accident scenarios is being evaluated. This test was designed to provide information on the response of a loaded RTG to impact by a fragment similar to the type of fragment produced by breakup of the spacecraft propulsion module system (PMS). The results of this test indicated that impact of the RTG by a thin aluminum fragment traveling at 306 m/s may result in significant damage to the convertor housing, failure of one fueled clad, and release of a small quantity of fuel

Divide and conquer: intermediate levels of population fragmentation maximize cultural accumulation.

Science.gov (United States)

Derex, Maxime; Perreault, Charles; Boyd, Robert

2018-04-05

Identifying the determinants of cumulative cultural evolution is a key issue in the interdisciplinary field of cultural evolution. A widely held view is that large and well-connected social networks facilitate cumulative cultural evolution because they promote the spread of useful cultural traits and prevent the loss of cultural knowledge through factors such as drift. This view stems from models that focus on the transmission of cultural information, without considering how new cultural traits actually arise. In this paper, we review the literature from various fields that suggest that, under some circumstances, increased connectedness can decrease cultural diversity and reduce innovation rates. Incorporating this idea into an agent-based model, we explore the effect of population fragmentation on cumulative culture and show that, for a given population size, there exists an intermediate level of population fragmentation that maximizes the rate of cumulative cultural evolution. This result is explained by the fact that fully connected, non-fragmented populations are able to maintain complex cultural traits but produce insufficient variation and so lack the cultural diversity required to produce highly complex cultural traits. Conversely, highly fragmented populations produce a variety of cultural traits but cannot maintain complex ones. In populations with intermediate levels of fragmentation, cultural loss and cultural diversity are balanced in a way that maximizes cultural complexity. Our results suggest that population structure needs to be taken into account when investigating the relationship between demography and cumulative culture.This article is part of the theme issue 'Bridging cultural gaps: interdisciplinary studies in human cultural evolution'. © 2018 The Author(s).

Inner-shell excitation and ionic fragmentation of molecules

International Nuclear Information System (INIS)

Hitchcock, A.P.; Tyliszczak, T.; Cavell, R.G.

1997-01-01

Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF 6 and CO 2 . Their work is illustrated using results from the carborane and PF 3 studies

Inner-shell excitation and ionic fragmentation of molecules

Energy Technology Data Exchange (ETDEWEB)

Hitchcock, A.P.; Tyliszczak, T. [McMaster Univ., Hamilton, Ontario (Canada); Cavell, R.G. [Univ. of Alberta, Edmonton (Canada)] [and others

1997-04-01

Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF{sub 6} and CO{sub 2}. Their work is illustrated using results from the carborane and PF{sub 3} studies.

Optimizing virtual fragment screening for GPCRs: Identification of novel ligands for the histamine H3 receptor using ligand- and structure-based molecular fingerprints

NARCIS (Netherlands)

Sirci, F.; Istyastono, E.P.; Vischer, H.F.; Nijmeijer, S.; Kuijer, M.; Kooistra, A.J.; Wijtmans, M.; Mannhold, R.; Leurs, R.; de Esch, I.J.P.; de Graaf, C.

2012-01-01

Virtual fragment screening (VFS) is a promising new method that uses computer models to identify small, fragment-like biologically active molecules as useful starting points for fragment-based drug discovery (FBDD). Training sets of true active and inactive fragment-like molecules to construct and

Microbial platform technology for recombinant antibody fragment production: A review.

Science.gov (United States)

Gupta, Sanjeev Kumar; Shukla, Pratyoosh

2017-02-01

Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.

Construction and expression of a functional monoclonal antibody SZ-51 specific for GMP-140 chimeric fab fragment in Escherichia coli

International Nuclear Information System (INIS)

Gu Jianming; Zhang Xiaomin; Xia Lijun; Wan Haiying; Liu Yue; Li Peixia; Ruan Changgeng

1996-04-01

The variable region cDNAs of a monoclonal antibody SZ-51 specific for α-granule membrane protein (GMP-140) on the surface of activated human platelets were spliced with the constant region cDNA of the heavy chain CH1 and light chain k of human Ig G by means of the gene recombination techniques. The above recombinant gene was amplified by the polymerase chain reaction (PCR). The expression vector of phage plasmid pHEN1 SZ-51 Fab/Hu was constructed. The pHEN1-51 Fab/Hu was introduced into non-suppressor E. coli HB2151. The amount of expression of SZ-51 chimeric Fab/Hu measured by quantitative ELISA was about 500 μg/L. Western blot demonstrated that the SZ-51 chimeric Fab fragment could specifically bind to GMP-140. (2 figs.)

Densities and temperatures at fragment formation in heavy-ion collision

Energy Technology Data Exchange (ETDEWEB)

Ohnishi, Akira [Hokkaido Univ., Sapporo (Japan)

1998-07-01

In order to clarify whether the liquid-gas phase transition is relevant to the multi-fragment formation found in intermediate energy heavy-ion collisions, we estimate the densities and temperatures at fragment formation in Au+Au collisions at incident energies of 150 MeV/A and 400 MeV/A within the Quantum Molecular Dynamics (QMD) model with and without quantum fluctuations implemented according to the Quantal Langevin (QL) model. The calculated results show that the IMFs are mainly produced inside the unstable region of nuclear matter, which supports the idea of the fragment formation from supercooled nuclear matter. (author)

Constructive modelling of structural turbulence: computational experiment

Energy Technology Data Exchange (ETDEWEB)

Belotserkovskii, O M; Oparin, A M; Troshkin, O V [Institute for Computer Aided Design, Russian Academy of Sciences, Vtoraya Brestskaya st., 19/18, Moscow, 123056 (Russian Federation); Chechetkin, V M [Keldysh Institute for Applied Mathematics, Russian Academy of Sciences, Miusskaya sq., 4, Moscow, 125047 (Russian Federation)], E-mail: o.bel@icad.org.ru, E-mail: a.oparin@icad.org.ru, E-mail: troshkin@icad.org.ru, E-mail: chech@gin@keldysh.ru

2008-12-15

Constructively, the analysis of the phenomenon of turbulence must and can be performed through direct numerical simulations of mechanics supposed to be inherent to secondary flows. This one reveals itself through such instances as large vortices, structural instabilities, vortex cascades and principal modes discussed in this paper. Like fragments of a puzzle, they speak of a motion ordered with its own nuts and bolts, however chaotic it appears at first sight. This opens an opportunity for a multi-oriented approach of which a prime ideology seems to be a rational combination of grid, spectral and statistical methods. An attempt is made to bring together the above instances and produce an alternative point of view on the phenomenon in question when based on the main laws of conservation.

Fragmentation measurement using image processing

Directory of Open Access Journals (Sweden)

Farhang Sereshki

2016-12-01

Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

Full-Scale Tests of Lightweight Fragment Barriers on Commercial Aircraft

National Research Council Canada - National Science Library

Shockey, Donald

1999-01-01

Because fragments from inflight engine failures can damage critical aircraft components and produce catastrophic consequences, the Federal Aviation Administration is sponsoring research to mitigate...

Jet mass dependence of fragmentation in positron-proton collisions

Energy Technology Data Exchange (ETDEWEB)

Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)

2017-02-15

We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)

First spatial isotopic separation of relativistic uranium projectile fragments

International Nuclear Information System (INIS)

Magel, A.; Voss, B.; Armbruster, P.; Aumann, T.; Clerc, H.G.; Czajkowski, S.; Folger, H.; Grewe, A.; Hanelt, E.; Heinz, A.; Irnich, H.; Jong, M. de; Junghans, A.; Nickel, F.; Pfuetzner, M.; Roehl, C.; Scheidenberger, C.; Schmidt, K.H.; Schwab, W.; Steinhaeuser, S.; Suemmerer, K.; Trinder, W.; Wollnik, H.

1994-07-01

Spatial isotopic separation of relativistic uranium projectile fragments has been achieved for the first time. The fragments were produced in peripheral nuclear collisions and spatially separated in-flight with the fragment separator FRS at GSI. A two-fold magnetic-rigidity analysis was applied exploiting the atomic energy loss in specially shaped matter placed in the dispersive central focal plane. Systematic investigations with relativistic projectiles ranging from oxygen up to uranium demonstrate that the FRS is a universal and powerful facility for the production and in-flight separation of monoisotopic, exotic secondary beams of all elements up to Z=92. This achievement has opened a new area in heavy-ion research and applications. (orig.)

Quantitative experimental modelling of fragmentation during explosive volcanism

Science.gov (United States)

Thordén Haug, Ø.; Galland, O.; Gisler, G.

2012-04-01

Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Experimental determination of fragment excitation energies in multifragmentation events

Energy Technology Data Exchange (ETDEWEB)

Marie, N.; Natowitz, J.B. [Texas A and M Univ., College Station, TX (United States). Cyclotron Inst.; Chbihi, A.; Le Fevre, A.; Salou, S.; Wieleczko, J.P.; Gingras, L.; Auger, G. [Grand Accelerateur National d`Ions Lourds, 14 - Caen (France); Assenard, M. [Nantes Univ., 44 (France); Bacri, Ch.O. [Centre National de la Recherche Scientifique, CNRS, 91 - Orsay (France)] [and others

1998-03-17

For 50 MeV/nucleon {sup 129}Xe + {sup nat}Sn multifragmentation events, by means of correlation techniques, the multiplicities of the hydrogen and helium isotopes which were emitted by the hot primary excited fragments produced at the stage of the disassembly of an equilibrated hot source are determined. The relative kinetic energy distributions between the primary clusters and the light charged particles that they evaporate are also derived. From the comparison between the secondary multiplicities observed experimentally and the multiplicities predicted by the GEMINI model, it is concluded that the source breaks into primary fragments which are characterized by the same N/Z ratio as the combined system. Knowing the secondary light charged particle multiplicities and kinetic energies, the average charges of the hot fragments and are reconstructed their mean excitation energies are estimated. The fragment excitation energies are equal to 3.0 MeV/nucleon for the full range of intermediate mass fragment atomic number. This global constancy indicates that, on the average, thermodynamical equilibrium was achieved at the disassembly stage of the source. (author) 25 refs.

Experimental determination of fragment excitation energies in multifragmentation events

International Nuclear Information System (INIS)

Marie, N.; Natowitz, J.B.; Assenard, M.; Bacri, Ch.O.

1998-01-01

For 50 MeV/nucleon 129 Xe + nat Sn multifragmentation events, by means of correlation techniques, the multiplicities of the hydrogen and helium isotopes which were emitted by the hot primary excited fragments produced at the stage of the disassembly of an equilibrated hot source are determined. The relative kinetic energy distributions between the primary clusters and the light charged particles that they evaporate are also derived. From the comparison between the secondary multiplicities observed experimentally and the multiplicities predicted by the GEMINI model, it is concluded that the source breaks into primary fragments which are characterized by the same N/Z ratio as the combined system. Knowing the secondary light charged particle multiplicities and kinetic energies, the average charges of the hot fragments and are reconstructed their mean excitation energies are estimated. The fragment excitation energies are equal to 3.0 MeV/nucleon for the full range of intermediate mass fragment atomic number. This global constancy indicates that, on the average, thermodynamical equilibrium was achieved at the disassembly stage of the source. (author)

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

TURBULENT DISKS ARE NEVER STABLE: FRAGMENTATION AND TURBULENCE-PROMOTED PLANET FORMATION

Energy Technology Data Exchange (ETDEWEB)

Hopkins, Philip F. [TAPIR, Mailcode 350-17, California Institute of Technology, Pasadena, CA 91125 (United States); Christiansen, Jessie L., E-mail: phopkins@caltech.edu [SETI Institute/NASA Ames Research Center, M/S 244-30, Moffett Field, CA 94035 (United States)

2013-10-10

A fundamental assumption in our understanding of disks is that when the Toomre Q >> 1, the disk is stable against fragmentation into self-gravitating objects (and so cannot form planets via direct collapse). But if disks are turbulent, this neglects a spectrum of stochastic density fluctuations that can produce rare, high-density mass concentrations. Here, we use a recently developed analytic framework to predict the statistics of these fluctuations, i.e., the rate of fragmentation and mass spectrum of fragments formed in a turbulent Keplerian disk. Turbulent disks are never completely stable: we calculate the (always finite) probability of forming self-gravitating structures via stochastic turbulent density fluctuations in such disks. Modest sub-sonic turbulence above Mach number M∼0.1 can produce a few stochastic fragmentation or 'direct collapse' events over ∼Myr timescales, even if Q >> 1 and cooling is slow (t{sub cool} >> t{sub orbit}). In transsonic turbulence this extends to Q ∼ 100. We derive the true Q-criterion needed to suppress such events, which scales exponentially with Mach number. We specify to turbulence driven by magneto-rotational instability, convection, or spiral waves and derive equivalent criteria in terms of Q and the cooling time. Cooling times ∼> 50 t{sub dyn} may be required to completely suppress fragmentation. These gravo-turbulent events produce mass spectra peaked near ∼(Q M{sub disk}/M{sub *}){sup 2} M{sub disk} (rocky-to-giant planet masses, increasing with distance from the star). We apply this to protoplanetary disk models and show that even minimum-mass solar nebulae could experience stochastic collapse events, provided a source of turbulence.

TURBULENT DISKS ARE NEVER STABLE: FRAGMENTATION AND TURBULENCE-PROMOTED PLANET FORMATION

International Nuclear Information System (INIS)

Hopkins, Philip F.; Christiansen, Jessie L.

2013-01-01

A fundamental assumption in our understanding of disks is that when the Toomre Q >> 1, the disk is stable against fragmentation into self-gravitating objects (and so cannot form planets via direct collapse). But if disks are turbulent, this neglects a spectrum of stochastic density fluctuations that can produce rare, high-density mass concentrations. Here, we use a recently developed analytic framework to predict the statistics of these fluctuations, i.e., the rate of fragmentation and mass spectrum of fragments formed in a turbulent Keplerian disk. Turbulent disks are never completely stable: we calculate the (always finite) probability of forming self-gravitating structures via stochastic turbulent density fluctuations in such disks. Modest sub-sonic turbulence above Mach number M∼0.1 can produce a few stochastic fragmentation or 'direct collapse' events over ∼Myr timescales, even if Q >> 1 and cooling is slow (t cool >> t orbit ). In transsonic turbulence this extends to Q ∼ 100. We derive the true Q-criterion needed to suppress such events, which scales exponentially with Mach number. We specify to turbulence driven by magneto-rotational instability, convection, or spiral waves and derive equivalent criteria in terms of Q and the cooling time. Cooling times ∼> 50 t dyn may be required to completely suppress fragmentation. These gravo-turbulent events produce mass spectra peaked near ∼(Q M disk /M * ) 2 M disk (rocky-to-giant planet masses, increasing with distance from the star). We apply this to protoplanetary disk models and show that even minimum-mass solar nebulae could experience stochastic collapse events, provided a source of turbulence

Coal structure construction system with construction knowledge and partial energy evaluation; Kochiku chishiki to bubunteki energy hyoka ni yoru sekitan bunshi kozo kochiku system

Energy Technology Data Exchange (ETDEWEB)

Okawa, T.; Sasai, T.; Komoda, N. [Osaka University, Osaka (Japan). Faculty of Engineering

1996-10-28

The computer aided coal structure construction system is proposed, and a computational construction example is presented. The coal structure construction engine of this system fabricates molecular structure by connecting fragments sequentially inputted through a user interface. The best structure candidate is determined using construction knowledge and partial energy evaluation every addition of one fragment, and this process is subsequently repeated. The structure evaluation engine analyzes the 3-D conformation candidate by molecular dynamics, and evaluates the conformation by determining the energy value of an optimum structure. As an example, this system was applied to construction of coal molecular structure based on the actual data of partial structure composed of 26 structures from 2l kinds of aromatic cluster structures, 27 bonds from 2 kinds of bridged bonds, and 16 groups from 2 kinds of terminal substitutional groups. As a result, this system could construct a superior structure according to expert knowledge from the viewpoint of energy. 6 refs., 5 figs., 2 tabs.

Studies of complex fragment emission in heavy ion reactions

International Nuclear Information System (INIS)

Sobotka, L.G.

1989-01-01

The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

The Kosice meteorite fall: atmospheric trajectory and fragmentation from videos and radiometers

Science.gov (United States)

Borovicka, J.

2012-01-01

On 28 February 2010, 22h24m46s UT, a huge bolide of absolute magnitude -18 appeared over eastern Slovakia. Although this country is covered by the European Fireball Network (EN) and the Slovak Video Network, bad weather prevented direct imaging of the bolide by dedicated meteor cameras. Fortunately, three surveillance video cameras in Hungary recorded, at least partly, the event. These recordings allowed us to reconstruct the trajectory of the bolide and recover the meteorites. In addition, the light curve of the bolide was recorded by several EN camera radiometers, and sonic booms were registered by seismic stations in the region. The meteorites were classified as ordinary chondrites of type H5 (see Meteoritical Bulletin 100). I developed a model of atmospheric meteoroid fragmentation to fit the observed light curve. The model is based on the fact that meteoroid fragmentation leads to a sudden increase of a bolide's brightness, because the total meteoroid surface area increases after the fragmentation. A bright flare is produced if large numbers of small fragments or dust particles are released. I tried to model the whole light curve rigorously by setting up the mass distribution of fragments and/or dust particles released at each fragmentation point. The dust particles were allowed to be released either instantaneously or gradually. The ablation and radiation of individual particles were computed independently, and the summary light curve was computed. The deceleration at the end of the trajectory was taken into account as well. Based on the approximate calibration of the light curve, the initial mass of the meteoroid was estimated to 3500 kg (corresponding to diameter of 1.2 m). The major fragmentation occurred at a height of 39 km. Only few (probably three) large compact fragments of masses 20-100 kg survived this disruption. All of them fragmented again at lower heights below 30 km, producing minor flares on the light curve. In summary, Kosice was a weak

Phenomenological formula for the inclusive fragmentation cross sections of relativistic heavy ions

International Nuclear Information System (INIS)

Masuda, N.; Inoue, K.; Ito, Y.

1981-01-01

We study phenomenologically the inclusive fragmentation cross section data of 12 C and 16 O at 2.1 GeV/nucleon, and 56 Fe at 1.88 GeV/nucleon upon collisions with a 12 C target. The main assumptions on the fragmentation mechanism are the diffractive excitation of the high energy beam nucleus into the state of virtual dissociation and its direct decay into two fragments as was previously proposed by the authors. Starting from Izosimova et al.'s formula for the same problem, we derive a phenomenological inclusive cross section formula for fragment production, which is applicable to both ordinary and very light fragments. We find that the data can be understood if we assume that the fragments are being produced not only in their ground states but also in the low lying excited states. Our formula relates the inclusive cross section of light fragment (cluster) to the effective number of the same cluster in the low lying excited states of the beam nucleus

Binary star formation: gravitational fragmentation followed by capture

Science.gov (United States)

Turner, J. A.; Chapman, S. J.; Bhattal, A. S.; Disney, M. J.; Pongracic, H.; Whitworth, A. P.

1995-11-01

We describe in detail one of a sequence of numerical simulations which realize the mechanism of binary star formation proposed by Pringle. In these simulations, collisions between stable molecular cloud clumps produce dense shocked layers, which cool radiatively and fragment gravitationally. The resulting fragments then condense to form protostellar discs, which at the same time fall together and, as a result of tidal and viscous interactions, capture one another to form binary systems. We refer to this mechanism as shock-induced gravitational fragmentation followed by capture, or SGF+C. When the initial clumps are sufficiently massive and/or the Mach number of the collision is sufficiently high, a large number (>~10) of protostellar discs is produced; under these circumstances, the layer fragments first into filaments, and then into beads along the filaments. The marriage of two protostellar discs in this way is `arranged' in the sense that the protostellar discs involved do not form independently. First, they both condense out of the same layer, and probably also out of the same filament within this layer; this significantly increases the likelihood of them interacting dynamically. Secondly, there tends to be alignment between the orbital and spin angular momenta of the interacting protostellar discs, reflecting the fact that these angular momenta derive mainly from the systematic global angular momentum of the off-axis collision which produced the layer; this alignment of the various angular momenta pre-disposes the discs to very dissipative interactions, thereby increasing the probability of producing a strongly bound, long-lasting union. It is a marriage because the binary orbit stabilizes itself rather quickly. Any subsequent orbit evolution, as the protostellar discs `mop up' the surrounding residual gas and interact tidally, tends to harden the orbit. Therefore, as long as a third body does not intervene, the union is binding. Even if a third body does

Generation of Polar Semi-Saturated Bicyclic Pyrazoles for Fragment-Based Drug Discovery Campaigns.

Science.gov (United States)

Luise, Nicola; Wyatt, Paul

2018-05-07

Synthesising polar semi-saturated bicyclic heterocycles can lead to better starting points for fragment-based drug discovery (FBDD) programs. This communication highlights the application of diverse chemistry to construct bicyclic systems from a common intermediate, where pyrazole, a privileged heteroaromatic able to bind effectively to biological targets, is fused to diverse saturated counterparts. The generated fragments can be further developed either after confirmation of their binding pose or early in the process, as their synthetic intermediates. Essential quality control (QC) for selection of small molecules to add to a fragment library is discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of clonal fragmentation on intraspecific competition of a stoloniferous floating plant.

Science.gov (United States)

Wang, P; Xu, Y-S; Dong, B-C; Xue, W; Yu, F-H

2014-11-01

Disturbance is common and can fragment clones of plants. Clonal fragmentation may affect the density and growth of ramets so that it could alter intraspecific competition. To test this hypothesis, we grew one (low density), five (medium density) or nine (high density) parent ramets of the floating invasive plant Pistia stratiotes in buckets, and newly produced offspring ramets were either severed (with fragmentation) or remained connected to parent ramets (no fragmentation). Increasing density reduced biomass of the whole clone (i.e. parent ramet plus its offspring ramets), showing intense intraspecific competition. Fragmentation decreased biomass of offspring ramets, but increased biomass of parent ramets and the whole clone, suggesting significant resource translocation from parent to offspring ramets when clones were not fragmented. There was no interaction effect of density x fragmentation on biomass of the whole clone, and fragmentation did not affect competition intensity index. We conclude that clonal fragmentation does not alter intraspecific competition between clones of P. stratiotes, but increases biomass production of the whole clone. Thus, fragmentation may contribute to its interspecific competitive ability and invasiveness, and intentional fragmentation should not be recommended as a measure to stop the rapid growth of this invasive species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Time reversal odd fragmentation functions in semi-inclusive deep inelastic lepton-hadron scattering

Energy Technology Data Exchange (ETDEWEB)

Mulders, P.J. [National Inst. for Nuclear Physics and High Energy Physics, Amsterdam (Netherlands); Levelt, J. [Univ. of Erlangen-Nuernberg (Germany)

1994-04-01

In semi-inclusive scattering of polarized leptons from unpolarized hadrons, one can measure a time reversal odd structure function. It shows up as a sin({phi}) asymmetry of the produced hadrons. This asymmetry can be expressed as the product of a twist-three {open_quotes}hadron {r_arrow} quark{close_quotes} profile function and a time reversal odd twist-two {open_quotes}quark {r_arrow} hadron{close_quotes} fragmentation function. This fragmentation function can only be measured for nonzero transverse momenta of the produced hadron. Its appearance is a consequence of final state interactions between the produced hadron and the rest of the final state.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Fragmentation of molecular ions in slow electron collisions

International Nuclear Information System (INIS)

Novotny, Steffen

2008-01-01

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD + the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2 nd order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H 2 + produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

Fragmentation of molecular ions in slow electron collisions

Energy Technology Data Exchange (ETDEWEB)

Novotny, Steffen

2008-06-25

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD{sup +} the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2{sup nd} order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H{sub 2}{sup +} produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

[Construction of a low-pH-sensing system in Streptococcus mutans].

Science.gov (United States)

Di, Kang; Yuqing, Li; Xuedong, Zhou

2017-06-01

To construct a low-pH-sensing system in Streptococcus mutans (S. mutans) and to visually detect the pH in situ. Promoter of ureaseⅠ(PureⅠ) and green fluorescence protein (gfp) DNA fragments were amplified by polymerase chain reaction (PCR) from the genome of Streptococcus salivarius 57.I and S. mutans containing the gfp fragment. The two amplified DNA fragments were ligated together and further integrated into pDL278 to construct the recombinant plasmid pDL278-pureⅠ-gfp. This recombinant plasmid was then transformed into S. mutans UA159 cells. Subsequently, the intensity of the optical density per unit area of the low-pH-sensing system was measured and compared under different pH conditions and different processing times. PureⅠ and gfp DNA fragments were amplified successfully with the correct molecule sizes (450 and 717 bp, respectively). The recombinant plasmid pDL278-pureⅠ-gfp was constructed and further verified by PCR and sequencing. The intensity of the optical density per unit area of the low-pH-sensing system increased with decreasing pH and increasing processing time. A low-pH-sensing system was constructed successfully in S. mutans. Our research verified that pureⅠ of Streptococcus salivarius can function well in S. mutans as an acid induced promoter, and provided a new method of detecting the pH of plaque biofilms in situ.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

Linear infrastructure drives habitat conversion and forest fragmentation associated with Marcellus shale gas development in a forested landscape.

Science.gov (United States)

Langlois, Lillie A; Drohan, Patrick J; Brittingham, Margaret C

2017-07-15

Large, continuous forest provides critical habitat for some species of forest dependent wildlife. The rapid expansion of shale gas development within the northern Appalachians results in direct loss of such habitat at well sites, pipelines, and access roads; however the resulting habitat fragmentation surrounding such areas may be of greater importance. Previous research has suggested that infrastructure supporting gas development is the driver for habitat loss, but knowledge of what specific infrastructure affects habitat is limited by a lack of spatial tracking of infrastructure development in different land uses. We used high-resolution aerial imagery, land cover data, and well point data to quantify shale gas development across four time periods (2010, 2012, 2014, 2016), including: the number of wells permitted, drilled, and producing gas (a measure of pipeline development); land use change; and forest fragmentation on both private and public land. As of April 2016, the majority of shale gas development was located on private land (74% of constructed well pads); however, the number of wells drilled per pad was lower on private compared to public land (3.5 and 5.4, respectively). Loss of core forest was more than double on private than public land (4.3 and 2.0%, respectively), which likely results from better management practices implemented on public land. Pipelines were by far the largest contributor to the fragmentation of core forest due to shale gas development. Forecasting future land use change resulting from gas development suggests that the greatest loss of core forest will occur with pads constructed farthest from pre-existing pipelines (new pipelines must be built to connect pads) and in areas with greater amounts of core forest. To reduce future fragmentation, our results suggest new pads should be placed near pre-existing pipelines and methods to consolidate pipelines with other infrastructure should be used. Without these mitigation practices, we

Rapid synthesis of the A-E fragment of ciguatoxin CTX3C.

Science.gov (United States)

Clark, J Stephen; Conroy, Joanne; Blake, Alexander J

2007-05-24

The A-E fragment of the marine natural product CTX3C has been prepared in an efficient manner by using a strategy in which two-directional and iterative ring-closing metathesis (RCM) reactions were employed for ring construction.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Addition of Sodium Bicarbonate to Irrigation Solution May Assist in Dissolution of Uric Acid Fragments During Ureteroscopy.

Science.gov (United States)

Paonessa, Jessica E; Williams, James C; Lingeman, James E

2018-04-01

We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine whether dissolution of UA fragments could be accomplished within 1 hour. In total 100% UA renal calculi were fragmented, filtered, and separated by size. Fragment sizes were <0.5 mm and 0.5 to 1 mm. Similar amounts of stone material were agitated in solution at room temperature. Four solutions were tested (NS, NS +1 ampule bicarb/L, NS +2, NS +3). Both groups were filtered to remove solutions after fixed periods. Filtered specimens were dried and weighed. Fragment dissolution rates were calculated as percent removed per hour. Additional testing was performed to determine whether increasing the temperature of solution affected dissolution rates. For fragments <0.5 mm, adding 2 or 3 bicarb ampules/L NS produced a dissolution rate averaging 91% ± 29% per hour. This rate averaged 226% faster than NS alone. With fragments 0.5 to 1 mm, addition of 2 or 3 bicarb ampules/L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). The addition of bicarbonate to NS more than doubles the dissolution rate of UA stone fragments and fragments less than 0.5 mm can be completely dissolved within 1 hour. Addition of bicarb to NS irrigation is a simple and inexpensive approach that may assist in the dissolution of UA fragments produced during ureteroscopic laser lithotripsy. Further studies are needed to determine whether a clinical benefit exists.

Fragmentation of suddenly heated liquids in ICF reactors. Revision 1

International Nuclear Information System (INIS)

Blink, J.A.; Hoover, W.G.

1985-01-01

Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate because increased surface area will enhance the cooling and condensation of coolant ablated by the fusion x rays. Relaxation from the suddenly (neutron) heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The resulting expansion in a diverging geometry will hydrodynamically force the liquid to fragment, with vapor then forming from the new surfaces to fill the cavities. An energy minimization model is used to determine the fragment size that produces the least amount of non-fragment-center-of-mass energy; i.e., the sum of the surface and dilational kinetic energies. This model predicts fragmentation dependence on original system size and amount of isochoric heating as well as liquid density, Grueneisen parameter, surface tension, and sound speed. A two dimensional molecular dynamics code was developed to test the model at a microscopic scale for the Lennard-Jones fluid with its two adjustable constants chosen to represent lithium

Properties of the hadronic system produced in antineutrino proton interactions

International Nuclear Information System (INIS)

Musgrave, B.

1979-01-01

The separation of the hadronic system produced in anti νp charged-current reactions into the current and target fragmentation components is discussed. The current fragments show properties in good qualitative agreement with the expectations of the naive quark-parton model. In particular, there is no evidence for either a Q 2 - or X/sub BJ/-dependence of the fragmentation functions. 7 references

Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

International Nuclear Information System (INIS)

Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

1998-01-01

Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

Jet fragmentation and predictions of the resummed perturbative QCD

Energy Technology Data Exchange (ETDEWEB)

Safonov, Alexei Nikolayevich [Univ. of Florida, Gainesville, FL (United States)

2001-01-01

This dissertation is dedicated to the experimental analysis of jet fragmentation, the process of formation of jets of particles produced in high-energy collisions, and to the comparison of the results to the predictions of resummed perturbative calculations within Quantum Chromodynamics.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Methods of producing compounds from plant materials

Science.gov (United States)

Werpy, Todd A [West Richland, WA; Schmidt, Andrew J [Richland, WA; Frye, Jr., John G.; Zacher, Alan H. , Franz; James A. , Alnajjar; Mikhail S. , Neuenschwander; Gary G. , Alderson; Eric V. , Orth; Rick J. , Abbas; Charles A. , Beery; Kyle E. , Rammelsberg; Anne M. , Kim; Catherine, J [Decatur, IL

2010-01-26

The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.

Methods of producing compounds from plant material

Energy Technology Data Exchange (ETDEWEB)

Werpy, Todd A.; Schmidt, Andrew J.; Frye, Jr., John G.; Zacher, Alan H.; Franz, James A.; Alnajjar, Mikhail S.; Neuenschwander, Gary G.; Alderson, Eric V.; Orth, Rick J.; Abbas, Charles A.; Beery, Kyle E.; Rammelsberg, Anne M.; Kim, Catherine J.

2006-01-03

The invention includes methods of processing plant material by adding water to form a mixture, heating the mixture, and separating a liquid component from a solid-comprising component. At least one of the liquid component and the solid-comprising component undergoes additional processing. Processing of the solid-comprising component produces oils, and processing of the liquid component produces one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention includes a process of forming glycerol, ethylene glycol, lactic acid and propylene glycol from plant matter by adding water, heating and filtering the plant matter. The filtrate containing starch, starch fragments, hemicellulose and fragments of hemicellulose is treated to form linear poly-alcohols which are then cleaved to produce one or more of glycerol, ethylene glycol, lactic acid and propylene glycol. The invention also includes a method of producing free and/or complexed sterols and stanols from plant material.

Nuclear fragmentation and the number of particle tracks in tissue

International Nuclear Information System (INIS)

Ponomarev, A. L.; Cucinotta, F. A.

2006-01-01

For high energy nuclei, the number of particle tracks per cell is modified by local nuclear reactions that occur, with large fluctuations expected for heavy ion tracks. Cells near the interaction site of a reaction will experience a much higher number of tracks than estimated by the average fluence. Two types of reaction products are possible and occur in coincidence; projectile fragments, which generally have smaller charge and similar velocity to that of the projectile, and target fragments, which are produced from the fragmentation of the nuclei of water atoms or other cellular constituents with low velocity. In order to understand the role of fragmentation in biological damage a new model of human tissue irradiated by heavy ions was developed. A box of the tissue is modelled with periodic boundary conditions imposed, which extrapolates the technique to macroscopic volumes of tissue. The cross sections for projectile and target fragmentation products are taken from the quantum multiple scattering fragmentation code previously developed at NASA Johnson Space Center. Statistics of fragmentation pathways occurring in a cell monolayer, as well as in a small volume of 10 x 10 x 10 cells are given. A discussion on approaches to extend the model to describe spatial distributions of inactivated or other cell damage types, as well as highly organised tissues of multiple cell types, is presented. (authors)

AlphaSpace: Fragment-Centric Topographical Mapping To Target Protein–Protein Interaction Interfaces

Science.gov (United States)

2016-01-01

Inhibition of protein–protein interactions (PPIs) is emerging as a promising therapeutic strategy despite the difficulty in targeting such interfaces with drug-like small molecules. PPIs generally feature large and flat binding surfaces as compared to typical drug targets. These features pose a challenge for structural characterization of the surface using geometry-based pocket-detection methods. An attractive mapping strategy—that builds on the principles of fragment-based drug discovery (FBDD)—is to detect the fragment-centric modularity at the protein surface and then characterize the large PPI interface as a set of localized, fragment-targetable interaction regions. Here, we introduce AlphaSpace, a computational analysis tool designed for fragment-centric topographical mapping (FCTM) of PPI interfaces. Our approach uses the alpha sphere construct, a geometric feature of a protein’s Voronoi diagram, to map out concave interaction space at the protein surface. We introduce two new features—alpha-atom and alpha-space—and the concept of the alpha-atom/alpha-space pair to rank pockets for fragment-targetability and to facilitate the evaluation of pocket/fragment complementarity. The resulting high-resolution interfacial map of targetable pocket space can be used to guide the rational design and optimization of small molecule or biomimetic PPI inhibitors. PMID:26225450

A recombinant estrogen receptor fragment-based homogeneous fluorescent assay for rapid detection of estrogens.

Science.gov (United States)

Wang, Dan; Xie, Jiangbi; Zhu, Xiaocui; Li, Jinqiu; Zhao, Dongqin; Zhao, Meiping

2014-05-15

In this work, we demonstrate a novel estrogenic receptor fragment-based homogeneous fluorescent assay which enables rapid and sensitive detection of 17β-estradiol (E2) and other highly potent estrogens. A modified human estrogenic receptor fragment (N-His × 6-hER270-595-C-Strep tag II) has been constructed that contains amino acids 270-595 of wild-type human estrogenic receptor α (hER270-595) and two specific tags (6 × His and Strep tag II) fused to the N and C terminus, respectively. The designed receptor protein fragment could be easily produced by prokaryotic expression with high yield and high purity. The obtained protein exhibits high binding affinity to E2 and the two tags greatly facilitate the application of the recombinant protein. Taking advantage of the unique spectroscopic properties of coumestrol (CS), a fluorescent phytoestrogen, a CS/hER270-595-based fluorescent assay has been developed which can sensitively respond to E2 within 1.0 min with a linear working range from 0.1 to 20 ng/mL and a limit of detection of 0.1 ng/mL. The assay was successfully applied for rapid detection of E2 in the culture medium of rat hippocampal neurons. The method also holds great potential for high-throughput monitoring the variation of estrogen levels in complex biological fluids, which is crucial for investigation of the molecular basis of various estrogen-involved processes. Copyright © 2013 Elsevier B.V. All rights reserved.

Emission of fragments in heavy ion-collisions at Fermi energy

International Nuclear Information System (INIS)

Normand, J.

2001-10-01

The study of reaction mechanisms in Fermi energy domain has shown the dominant binary character of the process. The two heavy sources produced after the first stage of the interaction (the quasi-projectile QP and the quasi-target QT) can experience various decay modes from evaporation to multifragmentation. However, the presence of light fragments at mid rapidity cannot be explained by the standard decay of the QP and the QT. To understand the mechanisms producing such a contribution, the break-up of the QP has been studied on the following systems: Xe+Sn from 25 to 50 MeV/A, Ta+Au and Ta+U at 33, 39.6 MeV/A and U+U at 24 MeV/A. The experiment has been performed at GANIL with the INDRA multidetector. The particular behaviour of the heaviest fragment and the correlation between the charge and the velocity of the fragments suggest a shape deformation followed by the rupture of a neck formed in between the two partners of the collision. The heaviest fragment could be the reminiscence of the projectile. A method based on the angular distribution of the heaviest fragment has allowed to separate the statistical break-up of the QP and the non equilibrated break-up. The statistical break-up ranges from 30 % to 75 % of the break-ups. The comparison of the statistical component with a statistical model gives information about the charge, the angular momentum and the temperature of the QP. The comparison of the non equilibrated component with dynamical models could give information about the parameters of the nuclear interaction in medium. (author)

Microbials for the production of monoclonal antibodies and antibody fragments.

Science.gov (United States)

Spadiut, Oliver; Capone, Simona; Krainer, Florian; Glieder, Anton; Herwig, Christoph

2014-01-01

Monoclonal antibodies (mAbs) and antibody fragments represent the most important biopharmaceutical products today. Because full length antibodies are glycosylated, mammalian cells, which allow human-like N-glycosylation, are currently used for their production. However, mammalian cells have several drawbacks when it comes to bioprocessing and scale-up, resulting in long processing times and elevated costs. By contrast, antibody fragments, that are not glycosylated but still exhibit antigen binding properties, can be produced in microbial organisms, which are easy to manipulate and cultivate. In this review, we summarize recent advances in the expression systems, strain engineering, and production processes for the three main microbials used in antibody and antibody fragment production, namely Saccharomyces cerevisiae, Pichia pastoris, and Escherichia coli. Copyright © 2013 Elsevier Ltd. All rights reserved.

Heavy-quark fragmentation functions at next-to-leading perturbative QCD

Energy Technology Data Exchange (ETDEWEB)

Moosavi Nejad, S.M. [Yazd University, Faculty of Physics, Yazd (Iran, Islamic Republic of); Institute for Research in Fundamental Sciences (IPM), School of Particles and Accelerators, Tehran (Iran, Islamic Republic of); Sartipi Yarahmadi, P. [Yazd University, Faculty of Physics, Yazd (Iran, Islamic Republic of)

2016-10-15

It is well known that the dominant mechanism to produce hadronic bound states with large transverse momentum is fragmentation. This mechanism is described by the fragmentation functions (FFs) which are the universal and process-independent functions. Here, we review the perturbative FFs formalism as an appropriate tool for studying these hadronization processes and detail the extension of this formalism at next-to-leading order (NLO). Using Suzuki's model, we calculate the perturbative QCD FF for a heavy quark to fragment into a S-wave heavy meson at NLO. As an example, we study the LO and NLO FFs for a charm quark to split into the S-wave D-meson and compare our analytic results both with experimental data and well-known phenomenological models. (orig.)

Ionic fragmentation following core-level photoionization of Sn(CH3)4 by soft X-rays

International Nuclear Information System (INIS)

Ueda, Kiyoshi; Shigemasa, Eiji; Sato, Yukinori; Yagishita, Akira; Hayaishi, Tatsuji

1990-01-01

Ionic fragmentation following the photoionization of Sn(CH 3 ) 4 (TMT) has been studied in the photon energy range of 60-600 eV using synchrotron radiation and time-of-flight mass spectrometry. Each of the Sn:4d, 4p, 3d and C:1s photoionization leads to a type of ionic fragmentation that is characteristic of each ionized core. The Sn:4d photoionization above 60 eV predominantly produces the doubly-charged TMT which dissociates into two singly-charged ions and some neutral fragments. The ions produced in this pathway are CH 3 + , C 2 H 3 + , C 2 H 5 + , SnCH m + and/or Sn + . The Sn:4p photoionization produces the triply-charged TMT and enhances the production of H + , CHsub(m' + ) (m' = 0-3) and Sn + significantly. The Sn:3d photoionization produces multiply-charged TMT whose charges are 3-5 and enhances the production of H + , CHsub(m' + ) (m' = 0-2) and Sn + significantly. The C:1s photoionization produces doubly-charged TMT via the KVV Auger transition and enhances the production of CH 3 + , C 2 H 3 + , SnCH m + and/or Sn + . (orig.)

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

Science.gov (United States)

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Elaboration of a fragment library hit produces potent and selective aspartate semialdehyde dehydrogenase inhibitors.

Science.gov (United States)

Thangavelu, Bharani; Bhansali, Pravin; Viola, Ronald E

2015-10-15

Aspartate-β-semialdehyde dehydrogenase (ASADH) lies at the first branch point in the aspartate metabolic pathway which leads to the biosynthesis of several essential amino acids and some important metabolites. This pathway is crucial for many metabolic processes in plants and microbes like bacteria and fungi, but is absent in mammals. Therefore, the key microbial enzymes involved in this pathway are attractive potential targets for development of new antibiotics with novel modes of action. The ASADH enzyme family shares the same substrate binding and active site catalytic groups; however, the enzymes from representative bacterial and fungal species show different inhibition patterns when previously screened against low molecular weight inhibitors identified from fragment library screening. In the present study several approaches, including fragment based drug discovery (FBDD), inhibitor docking, kinetic, and structure-activity relationship (SAR) studies have been used to guide ASADH inhibitor development. Elaboration of a core structure identified by FBDD has led to the synthesis of low micromolar inhibitors of the target enzyme, with high selectivity introduced between the Gram-negative and Gram-positive orthologs of ASADH. This new set of structures open a novel direction for the development of inhibitors against this validated drug-target enzyme. Copyright © 2015 Elsevier Ltd. All rights reserved.

Charged-particle spectroscopy in the microsecond range following projectile fragmentation

CERN Document Server

Pfützner, M; Grzywacz, R; Janas, Z; Momayezi, M; Bingham, C; Blank, B; Chartier, M; Geissel, H; Giovinazzo, J; Hellström, M; Kurcewicz, J; Lalleman, A S; Mazzocchi, C; Mukha, I; Plettner, C; Roeckl, E; Rykaczewski, K; Schmidt, K; Simon, R S; Stanoiu, M; Thomas, J C

2002-01-01

We present a new approach to charged-particle spectroscopy of short-lived nuclei produced by relativistic projectile fragmentation. The system based on digital DGF-4C CAMAC modules and newly developed fast-reset preamplifiers was tested at the Fragment Separator of GSI. We were able to detect low-energy (approx 1 MeV) decay signals occurring a few microseconds after a heavy-ion implantation accompanied by a release of approx 1 GeV energy. Applications for the study of one- and two-proton radioactivity are discussed.

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Neutronics and radiation field studies for the RIA fragmentation target area

Energy Technology Data Exchange (ETDEWEB)

Reyes, Susana [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)]. E-mail: reyes20@llnl.gov; Boles, Jason L. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Ahle, Larry E. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Stein, Werner [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)

2006-06-23

Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kw for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.

Neutronics and radiation field studies for the RIA fragmentation target area

Science.gov (United States)

Reyes, Susana; Boles, Jason L.; Ahle, Larry E.; Stein, Werner

2006-06-01

Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kW for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.

Emission of fragments in heavy ion-collisions at Fermi energy; Modes de production des fragments dans les collisions d'ions lourds aux energies intermediaires

Energy Technology Data Exchange (ETDEWEB)

Normand, J

2001-10-01

The study of reaction mechanisms in Fermi energy domain has shown the dominant binary character of the process. The two heavy sources produced after the first stage of the interaction (the quasi-projectile QP and the quasi-target QT) can experience various decay modes from evaporation to multifragmentation. However, the presence of light fragments at mid rapidity cannot be explained by the standard decay of the QP and the QT. To understand the mechanisms producing such a contribution, the break-up of the QP has been studied on the following systems: Xe+Sn from 25 to 50 MeV/A, Ta+Au and Ta+U at 33, 39.6 MeV/A and U+U at 24 MeV/A. The experiment has been performed at GANIL with the INDRA multidetector. The particular behaviour of the heaviest fragment and the correlation between the charge and the velocity of the fragments suggest a shape deformation followed by the rupture of a neck formed in between the two partners of the collision. The heaviest fragment could be the reminiscence of the projectile. A method based on the angular distribution of the heaviest fragment has allowed to separate the statistical break-up of the QP and the non equilibrated break-up. The statistical break-up ranges from 30 % to 75 % of the break-ups. The comparison of the statistical component with a statistical model gives information about the charge, the angular momentum and the temperature of the QP. The comparison of the non equilibrated component with dynamical models could give information about the parameters of the nuclear interaction in medium. (author)

Experimental and numerical studies of high-velocity impact fragmentation

Energy Technology Data Exchange (ETDEWEB)

Kipp, M.E.; Grady, D.E.; Swegle, J.W.

1993-08-01

Developments are reported in both experimental and numerical capabilities for characterizing the debris spray produced in penetration events. We have performed a series of high-velocity experiments specifically designed to examine the fragmentation of the projectile during impact. High-strength, well-characterized steel spheres (6.35 mm diameter) were launched with a two-stage light-gas gun to velocities in the range of 3 to 5 km/s. Normal impact with PMMA plates, thicknesses of 0.6 to 11 mm, applied impulsive loads of various amplitudes and durations to the steel sphere. Multiple flash radiography diagnostics and recovery techniques were used to assess size, velocity, trajectory and statistics of the impact-induced fragment debris. Damage modes to the primary target plate (plastic) and to a secondary target plate (aluminum) were also evaluated. Dynamic fragmentation theories, based on energy-balance principles, were used to evaluate local material deformation and fracture state information from CTH, a three-dimensional Eulerian solid dynamics shock wave propagation code. The local fragment characterization of the material defines a weighted fragment size distribution, and the sum of these distributions provides a composite particle size distribution for the steel sphere. The calculated axial and radial velocity changes agree well with experimental data, and the calculated fragment sizes are in qualitative agreement with the radiographic data. A secondary effort involved the experimental and computational analyses of normal and oblique copper ball impacts on steel target plates. High-resolution radiography and witness plate diagnostics provided impact motion and statistical fragment size data. CTH simulations were performed to test computational models and numerical methods.

Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III

Energy Technology Data Exchange (ETDEWEB)

Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.

1979-01-01

Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

The multiple roles of computational chemistry in fragment-based drug design

Science.gov (United States)

Law, Richard; Barker, Oliver; Barker, John J.; Hesterkamp, Thomas; Godemann, Robert; Andersen, Ole; Fryatt, Tara; Courtney, Steve; Hallett, Dave; Whittaker, Mark

2009-08-01

Fragment-based drug discovery (FBDD) represents a change in strategy from the screening of molecules with higher molecular weights and physical properties more akin to fully drug-like compounds, to the screening of smaller, less complex molecules. This is because it has been recognised that fragment hit molecules can be efficiently grown and optimised into leads, particularly after the binding mode to the target protein has been first determined by 3D structural elucidation, e.g. by NMR or X-ray crystallography. Several studies have shown that medicinal chemistry optimisation of an already drug-like hit or lead compound can result in a final compound with too high molecular weight and lipophilicity. The evolution of a lower molecular weight fragment hit therefore represents an attractive alternative approach to optimisation as it allows better control of compound properties. Computational chemistry can play an important role both prior to a fragment screen, in producing a target focussed fragment library, and post-screening in the evolution of a drug-like molecule from a fragment hit, both with and without the available fragment-target co-complex structure. We will review many of the current developments in the area and illustrate with some recent examples from successful FBDD discovery projects that we have conducted.

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Evaluation of thermobarometry for spinel lherzolite fragments in alkali basalts

Science.gov (United States)

Ozawa, Kazuhito; Youbi, Nasrrddine; Boumehdi, Moulay Ahmed; McKenzie, Dan; Nagahara, Hiroko

2017-04-01

Geothermobarometry of solid fragments in kimberlite and alkali basalts, generally called "xenoliths", provides information on thermal and chemical structure of lithospheric and asthenospheric mantle, based on which various chemical, thermal, and rheological models of lithosphere have been constructed (e.g., Griffin et al., 2003; McKenzie et al., 2005; Ave Lallemant et al., 1980). Geothermobarometry for spinel-bearing peridotite fragments, which are frequently sampled from Phanerozoic provinces in various tectonic environments (Nixon and Davies, 1987), has essential difficulties, and it is usually believed that appropriated barometers do not exist for them (O'Reilly et al., 1997; Medaris et al., 1999). Ozawa et al. (2016; EGU) proposed a method of geothermobarometry for spinel lherzolite fragments. They applied the method to mantle fragments in alkali basalts from Bou Ibalhatene maars in the Middle Atlas in Morocco (Raffone et al. 2009; El Azzouzi et al., 2010; Witting et al., 2010; El Messbahi et al., 2015). Ozawa et al. (2016) obtained 0.5GPa pressure difference (1.5-2.0GPa) for 100°C variation in temperatures (950-1050°C). However, it is imperative to verify the results on the basis of completely independent data. There are three types of independent information: (1) time scale of solid fragment extraction, which may be provided by kinetics of reactions induced by heating and/or decompression during their entrapment in the host magma and transportation to the Earth's surface (Smith, 1999), (2) depth of the host basalt formation, which may be provided by the petrological and geochemical studies of the host basalts, and (3) lithosphere-asthenosphere boundary depths, which may be estimated by geophysical observations. Among which, (3) is shown to be consistent with the result in Ozawa et al. (2016). We here present that the estimated thermal structure just before the fragment extraction is fully supported by the information of (1) and (2). Spera (1984) reviewed

Welcoming high reliability organising in construction management

NARCIS (Netherlands)

olde Scholtenhuis, Léon Luc; Doree, Andries G.; Smith, S.D.; Ahiaga-Dagbui, D.D.

2013-01-01

To achieve project objectives, construction project managers have to manoeuvre through complex coordination structures. They have to simultaneously deal with limited budgets, tight schedules, demanding stakeholders and a fragmented supply-chain. Despite their extensive coordination efforts, project

Fragment emission in reactions of 18.5-GeV 12C ions with complex nuclei

International Nuclear Information System (INIS)

Porile, N.T.; Cole, G.D.

1982-01-01

The emission of fragments ranging from 24 Na to 52 Mn in reactions of 18.5 GeV 12 C ions with Cu, Ag, Gd, Ta, Au, and U targets has been studied by means of activation techniques. The experiments involved determination of the fragment production cross sections and thick-target recoil properties. The latter were used to obtain mean fragment kinetic energies and values of β/sub parallel to/, the forward velocity component of the struck nucleus (in units of c). The results are compared with similar data for incident protons of the same total kinetic energy. The data may be used to assess the importance of central collisions in fragment production. Such collisions lead to the near total destruction of both interacting nuclei and the resulting fragments are emitted by a system of intermediate rapidity. In such a process, the factorization hypothesis, which has been shown to be valid for target and projectile fragmentation reactions, should not be obeyed. A test for factorization is performed by means of a relation which states that the ratio of the cross sections for producing fragment /sup A/Z in 12 C reactions to that for producing the same fragment in proton reactions with the same target is unity, provided both cross sections are reduced by the values of the corresponding total reaction cross sections sigma/sub R/, and evaluated for the same total kinetic energy of the projectile. The results of this comparison for the targets studied are presented and discussed

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Tube pumices as strain markers of the ductile-brittle transition during magma fragmentation

Science.gov (United States)

Martí, J.; Soriano, C.; Dingwell, D. B.

1999-12-01

Magma fragmentation-the process by which relatively slow-moving magma transforms into a violent gas flow carrying fragments of magma-is the defining feature of explosive volcanism. Yet of all the processes involved in explosively erupting systems, fragmentation is possibly the least understood. Several theoretical and laboratory studies on magma degassing and fragmentation have produced a general picture of the sequence of events leading to the fragmentation of silicic magma. But there remains a debate over whether magma fragmentation is a consequence of the textural evolution of magma to a foamed state where disintegration of walls separating bubbles becomes inevitable due to a foam-collapse criterion, or whether magma is fragmented purely by stresses that exceed its tensile strength. Here we show that tube pumice-where extreme bubble elongation is observed-is a well-preserved magmatic `strain marker' of the stress state immediately before and during fragmentation. Structural elements in the pumice record the evolution of the magma's mechanical response from viscous behaviour (foaming and foam elongation) through the plastic or viscoelastic stage, and finally to brittle behaviour. These observations directly support the hypothesis that fragmentation occurs when magma undergoes a ductile-brittle transition and stresses exceed the magma's tensile strength.

Populations of excited states and reaction mechanisms in the emission of complex fragments

International Nuclear Information System (INIS)

Gomez del Campo, J.

1990-01-01

Cross sections for emission of complex fragments (Z>2) in their ground and excited states are presented for several heavy-ion reactions at bombarding energies above 10 MeV/nucleon. Data presented are mostly on the cross sections extracted by γ-ray techniques. It is shown that a simple statistical approach to associate the ratio, of cross sections for excited states and ground states, to the temperature of the emitter fails to give the expected temperatures. However, it is shown that this is mostly due to the fact that the fragments that γ decay are secondary fragments, produced by the particle decay of the primary emitted complex fragments. A Hauser-Feshbach analysis accounts well for the cross sections and extracted temperatures. 22 refs., 6 figs

Fragmentation production of Ωccc baryons at LHC energies

International Nuclear Information System (INIS)

Saleev, V.A.

2000-01-01

Within the nonrelativistic quark-diquark model for heavy baryons, the fragmentation functions for the transitions of a c-quark and a doubly charmed vector diquark into an Ω ccc baryon are calculated in the leading order of perturbative QCD. The cross section for Ω ccc production in high-energy hadron interactions is estimated. It is assumed that Ω ccc baryons are formed via the fragmentation of a c quark or a vector (cc) diquark produced in the partonic subprocesses gg → cc-bar, qq-bar → cc-bar, gg → (cc) + c-bar + c-bar, and qq-bar → (cc) + c-bar + c-bar

Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

Science.gov (United States)

Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

2017-01-01

Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

MCNP6 fragmentation of light nuclei at intermediate energies

Energy Technology Data Exchange (ETDEWEB)

Mashnik, Stepan G., E-mail: mashnik@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Kerby, Leslie M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); University of Idaho, Moscow, ID 83844 (United States)

2014-11-11

Fragmentation reactions induced on light target nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the latest Los Alamos Monte Carlo transport code MCNP6 and with its cascade-exciton model (CEM) and Los Alamos version of the quark-gluon string model (LAQGSM) event generators, version 03.03, used as stand-alone codes. Such reactions are involved in different applications, like cosmic-ray-induced single event upsets (SEU's), radiation protection, and cancer therapy with proton and ion beams, among others; therefore, it is important that MCNP6 simulates them as well as possible. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. Both CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to {sup 4}He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

Efficacy of a potential trivalent vaccine based on Hc fragments of botulinum toxins A, B, and E produced in a cell-free expression system.

Science.gov (United States)

Zichel, R; Mimran, A; Keren, A; Barnea, A; Steinberger-Levy, I; Marcus, D; Turgeman, A; Reuveny, S

2010-05-01

Botulinum toxins produced by the anaerobic bacterium Clostridium botulinum are the most potent biological toxins in nature. Traditionally, people at risk are immunized with a formaldehyde-inactivated toxin complex. Second generation vaccines are based on the recombinant carboxy-terminal heavy-chain (Hc) fragment of the neurotoxin. However, the materialization of this approach is challenging, mainly due to the high AT content of clostridial genes. Herein, we present an alternative strategy in which the native genes encoding Hc proteins of botulinum toxins A, B, and E were used to express the recombinant Hc fragments in a cell-free expression system. We used the unique property of this open system to introduce different combinations of chaperone systems, protein disulfide isomerase (PDI), and reducing/oxidizing environments directly to the expression reaction. Optimized expression conditions led to increased production of soluble Hc protein, which was successfully scaled up using a continuous exchange (CE) cell-free system. Hc proteins were produced at a concentration of more than 1 mg/ml and purified by one-step Ni(+) affinity chromatography. Mice immunized with three injections containing 5 microg of any of the in vitro-expressed, alum-absorbed, Hc vaccines generated a serum enzyme-linked immunosorbent assay (ELISA) titer of 10(5) against the native toxin complex, which enabled protection against a high-dose toxin challenge (10(3) to 10(6) mouse 50% lethal dose [MsLD(50)]). Finally, immunization with a trivalent HcA, HcB, and HcE vaccine protected mice against the corresponding trivalent 10(5) MsLD(50) toxin challenge. Our results together with the latest developments in scalability of the in vitro protein expression systems offer alternative routes for the preparation of botulinum vaccine.

MCNP6 Simulation of Light and Medium Nuclei Fragmentation at Intermediate Energies

Energy Technology Data Exchange (ETDEWEB)

Mashnik, Stepan Georgievich [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of Idaho, Moscow, ID (United States)

2015-08-24

Fragmentation reactions induced on light and medium nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the Los Alamos transport code MCNP6 and with its CEM03.03 and LAQGSM03.03 event generators. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to sup>4He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

Properties, production and applications of camelid single-domain antibody fragments

NARCIS (Netherlands)

Harmsen, M.M.; Haard, de H.J.

2007-01-01

Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms

Coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16O on 27Al

International Nuclear Information System (INIS)

Shen Wenqing; Zhan Wenlong; Zhu Yongtai

1988-01-01

In a coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16 O on 27 Al, the contour plot of Galilean-invariant cross section of the coincidence between C-fragments and α-particles in the velocity plane, and the coincident angular correlation have been obtained. The correlated α-particles measured at positive angles (on the same side of the beam as the projectile-like fragments) were emitted mainly from the projectile-like fragments;the α-particles at large negative angles were emitted from the target-like fragments;the α-particles at small negative angles came from the fragmentation of the 16 O projectile. A possible reaction mechanism in which the residue produced in the fragmentation of the projectile continues the dissipation process during the interaction with the target has been discussed. It is also pointed out that in the large yield of C-fragments observed in the inclusive experiment, the contribution of C-fragments produced by the excited 16 O of DIC product via α-emission is quite small

A recombinant, fully human monoclonal antibody with antitumor activity constructed from phage-displayed antibody fragments

NARCIS (Netherlands)

Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T

A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell

Classical molecular dynamics simulations of fusion and fragmentation in fullerene-fullerene collisions

International Nuclear Information System (INIS)

Verkhovtsev, A.; Korol, A.V.; Solovyov, A.V.

2017-01-01

We present the results of classical molecular dynamics simulations of collision-induced fusion and fragmentation of C 60 fullerenes, performed by means of the MBN Explorer software package. The simulations provide information on structural differences of the fused compound depending on kinematics of the collision process. The analysis of fragmentation dynamics at different initial conditions shows that the size distributions of produced molecular fragments are peaked for dimers, which is in agreement with a well-established mechanism of C 60 fragmentation via preferential C 2 emission. Atomic trajectories of the colliding particles are analyzed and different fragmentation patterns are observed and discussed. On the basis of the performed simulations, characteristic time of C 2 emission is estimated as a function of collision energy. The results are compared with experimental time-of-flight distributions of molecular fragments and with earlier theoretical studies. Considering the widely explored case study of C 60 -C 60 collisions, we demonstrate broad capabilities of the MBN Explorer software, which can be utilized for studying collisions of a broad variety of nano-scale and bio-molecular systems by means of classical molecular dynamics. (authors)

Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.

1999-01-01

A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

A Measurement of $B$ Quark Fragmentation Fractions in $p\\bar{p}$ Collisions at 1.8-TeV

Energy Technology Data Exchange (ETDEWEB)

Taylor, Wendy Jane [Toronto U.

1999-01-01

Fragmentation is the process by which quarks and gluons organize themselves into hadrons. The fragmentation properties of the bottom quark cannot be predicted from fundamental principles and hence must be determined empirically. We investigate one such property, namely the avour dependence of the fragmentation process for bottom quarks produced in 1.8-TeV proton-antiproton collisions. This avour dependence is investigated by determining the B-hadron production ratios....

Direct labelling of monomeric antibody fragments Fab' with 99mTc

International Nuclear Information System (INIS)

Li Jun; Wang Shizhen; Yang Ziyi

1994-01-01

Direct labelling method and conditions of monomeric antibody Fab' with 99m Tc were investigated. Polyclonal antibody IgG was digested with ficin to produce dimeric fragments F(ab') 2 , which was subsequently reduced to monomeric fragments Fab' with 2-mercaptoethylamine. Finally, Fab' was incubated with sodium gluconate (Sn(II)) kit solution and 99m TcO 4 - eluted at room temperature to form 99m Tc-Fab'. The labelling efficiency was 85%-95%. The stability of labelled products was satisfactory and the elimination rate was faster than 99m Tc-IgG

White blood cell fragments in platelet concentrates prepared by the platelet-rich plasma or buffy-coat methods

NARCIS (Netherlands)

Dijkstra-Tiekstra, M. J.; van der Schoot, C. E.; Pietersz, R. N. I.; Reesink, H. W.

2005-01-01

BACKGROUND AND OBJECTIVES: White blood cell (WBC) fragments in platelet concentrates (PCs) may induce allo-immunization in the recipient. MATERIALS AND METHODS: As the level of WBC fragments can differ between PCs produced using different methods, we compared PCs prepared by using the buffy-coat

Comparative evaluation of low cost materials as constructed wetland filling media

Science.gov (United States)

Pinho, Henrique J. O.; Vaz, Mafalda M.; Mateus, Dina M. R.

2017-11-01

Three waste materials from civil construction activities were assessed as low cost alternative filling materials used in Constructed Wetlands (CW). CW are green processes for wastewater treatment, whose design includes an appropriate selection of vegetation and filling material. The sustainability of such processes may be incremented using recovered wastes as filling materials. The abilities of the materials to support plant growth and to contribute to pollutants removal from wastewater were assessed and compared to expanded clay, a filling usually used in CW design. Statistical analysis, using one-way ANOVA and Welch's ANOVA, demonstrate that limestone fragments are a better choice of filling material than brick fragments and basalt gravel.

Pathway Construction in Corynebacterium glutamicum and Strain Engineering To Produce Rare Sugars from Glycerol.

Science.gov (United States)

Yang, Jiangang; Zhu, Yueming; Men, Yan; Sun, Shangshang; Zeng, Yan; Zhang, Ying; Sun, Yuanxia; Ma, Yanhe

2016-12-21

Rare sugars are valuable natural products widely used in pharmaceutical and food industries. In this study, we expected to synthesize rare ketoses from abundant glycerol using dihydroxyacetone phosphate (DHAP)-dependent aldolases. First, a new glycerol assimilation pathway was constructed to synthesize DHAP. The enzymes which convert glycerol to 3-hydroxypropionaldehyde and l-glyceraldehyde were selected, and their corresponding aldehyde synthesis pathways were constructed in vivo. Four aldol pathways based on different aldolases and phosphorylase were gathered. Next, three pathways were assembled and the resulting strains synthesized 5-deoxypsicose, 5-deoxysorbose, and 5-deoxyfructose from glucose and glycerol and produce l-fructose, l-tagatose, l-sorbose, and l-psicose with glycerol as the only carbon source. To achieve higher product titer and yield, the recombinant strains were further engineered and fermentation conditions were optimized. Fed-batch culture of engineered strains obtained 38.1 g/L 5-deoxypsicose with a yield of 0.91 ± 0.04 mol product per mol of glycerol and synthesized 20.8 g/L l-fructose, 10.3 g/L l-tagatose, 1.2 g/L l-sorbose, and 0.95 g/L l-psicose.

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

Production of pions and anomalous projectile fragments in heavy ion collisions

International Nuclear Information System (INIS)

Noren, B.

1988-05-01

Results are presented from investigations of the mean free path (mfp) of multiply charged fragments, produced by 1.8 A GeV argon nuclei. The mfp's have been studied experimentally, and no dependence of the mfp on the distance from the preceeding collision is observed. In a Monte Carlo simulation, the mfp estimators are investigated for different statistics, with or without an enhanced reaction probability. Intermediate energy heavy ion collisions have been studied using the carbon beam produced at the CERN SC-accelerator. Cross-sections for pion + and pion - have been measured over a wide range of angles and targets. Also, coincidence measurements with projectile-like fragments have been performed. The pion - /pion + ratio has been studied for C+Li, C+C, C+Pb, C+ 116 Sn and C+ 124 Sn. Inconsistencies in the target mass dependence of the pion yield disappear if a correction for reabsorption in the target nucleus is included. The projectile breakup is significantly stronger for pion producing collisions than for the average collision, thus indicating a much stronger abundance of central collisions. (With 32 refs.) (author)

Construction and evaluation of an exopolysaccharide-producing engineered bacterial strain by protoplast fusion for microbial enhanced oil recovery.

Science.gov (United States)

Sun, Shanshan; Luo, Yijing; Cao, Siyuan; Li, Wenhong; Zhang, Zhongzhi; Jiang, Lingxi; Dong, Hanping; Yu, Li; Wu, Wei-Min

2013-09-01

Enterobacter cloacae strain JD, which produces water-insoluble biopolymers at optimal temperature of 30°C, and a thermophilic Geobacillus strain were used to construct an engineered strain for exopolysaccharide production at high temperatures by protoplast fusion. The obtained fusant strain ZR3 produced exopolysaccharides at up to 45°C with optimal growth temperature at 35°C. The fusant produced exopolysaccharides of approximately 7.5 g/L or more at pH between 7.0 and 9.0. The feasibility of the enhancement of crude oil recovery with the fusant was tested in a sand-packed column at 40°C. The results demonstrated that bioaugmentation of the fusant was promising approach for MEOR. Mass growth of the fusant was confirmed in fermentor tests. Copyright © 2013 Elsevier Ltd. All rights reserved.

Validating PHITS for heavy ion fragmentation reactions

International Nuclear Information System (INIS)

Ronningen, Reginald M.

2015-01-01

The performance of the Monte Carlo code system PHITS is validated for heavy-ion transport capabilities by performing simulations and comparing results against experimental data from heavy-ion reactions of benchmark quality. These data are from measurements of isotope yields produced in the fragmentation of a 140 MeV/u "4"8Ca beam on a beryllium target and on a tantalum target. The results of this study show that PHITS performs reliably. (authors)

Isotopic dependence of the fragments' internal temperatures determined from multifragment emission

Science.gov (United States)

Souza, S. R.; Donangelo, R.

2018-05-01

The internal temperatures of fragments produced by an excited nuclear source are investigated by using the microcanonical version of the statistical multifragmentation model, with discrete energy. We focus on the fragments' properties at the breakup stage, before they have time to deexcite by particle emission. Since the adopted model provides the excitation energy distribution of these primordial fragments, it allows one to calculate the temperatures of different isotope families and to make inferences about the sensitivity to their isospin composition. It is found that, due to the functional form of the nuclear density of states and the excitation energy distribution of the fragments, proton-rich isotopes are hotter than neutron-rich isotopes. This property has been taken to be an indication of earlier emission of the former from a source that cools down as it expands and emits fragments. Although this scenario is incompatible with the prompt breakup of a thermally equilibrated source, our results reveal that the latter framework also provides the same qualitative features just mentioned. Therefore they suggest that this property cannot be taken as evidence for nonequilibrium emission. We also found that this sensitivity to the isotopic composition of the fragments depends on the isospin composition of the source, and that it is weakened as the excitation energy of the source increases.

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

Reproductive success of Cabralea canjerana (Meliaceae in Atlantic forest fragments, Brazil

Directory of Open Access Journals (Sweden)

Edivani Villaron Franceschinelli

2015-06-01

Full Text Available In Brazil, the Atlantic forest remnants have high biological diversity and a high level of endemism, but very little is known about the reproductive success of native species. Cabralea canjerana is a common tree in the Montane Atlantic forest, and its reproduction is highly dependent on pollinators. In order to contribute with the particular knowledge on this species, we collected data in three fragmented and three continuous forest sites, where the effects of fragmentation on both mutualistic (pollination and antagonistic (seed predation interactions were analysed. We determined fruit production and weight of 25 trees per site. The number of seeds and the percentage of predated and aborted seeds were also accessed for seven fruits of 10 trees per site. Pollinator visitation frequencies to flowers were recorded in two forest fragments and in two sites of the continuous forest. Our data showed that plants of C. canjerana produced more fruits (z-value=-8.24; p<0.0001 and seeds per fruit (z-value=-6.58; p=0.002 in the continuous than in the fragmented sites. This was likely due to differences in pollination, because the number of pollinator visits was higher in the continuous forest than in the fragments. Seed abortion (z-value=4.08, p<0.001 and predation (z-value=3.72, p=0.0002, on the other hand, were higher in the fragmented than in the continuous sites. Then, mutualistic and antagonistic interactions were affected by fragmentation, decreasing the reproductive success of the study tree. This study was the first to show a decrease in the reproductive output in forest fragments in an Atlantic forest tree species. This decrease may threaten the population structure and viability of C. canjerana in forest fragments. Rev. Biol. Trop. 63 (2: 515-524. Epub 2015 June 01.

Improving Productivity in Building Construction – by Repetitions in Products, Processes, and Organisations

DEFF Research Database (Denmark)

Bekdik, Baris

This thesis builds on several studies with connection to the lack of productivity in build-ing construction. It seeks to enhance the conditions for improving productivity in the fragmented building construction industry, by exploring how a modular thinking of products, processes and organisations...... can be reapplied on new building construction projects. Complexity theory is used for diagnosis and modularity theory for the remedy towards the high degree of complexity, which is seen as the root of unproductivity. De-sign Research Methodology is followed to structure and organise the different...... from the practitioner’s perspective. In the second part of the exploratory study, examples of the fragmented kinds of modu-lar applications around the world are compiled in order to demonstrate the inconsistent use, but still universal appeal that the approach carries with respect to building construc-tion...

Construction of pTM series plasmids for gene expression in Brucella species.

Science.gov (United States)

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

Directory of Open Access Journals (Sweden)

Ayako Chino

Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

Dynamical aspects of fragment productions in the reactions {sup 124}Sn + {sup 64}Ni and {sup 112}Sn + {sup 58}Ni at 35 A.MeV

Energy Technology Data Exchange (ETDEWEB)

Filippo, E. de; Arena, N.; Cardella, G.; Lanzano, G.; Lanzalone, G.; Lo Nigro, S.; Pagano, A.; Papa, M.; Pirrone, S.; Politi, G. [Catania Univ., INFN Catania and Dipt. di Fisica e Astronomia (Italy); Alderighi, M.; Sechi, G. [INFN Milano and Ist. di Fisica Cosmica, CNR, Milano (Italy); Amorini, F.; Anzalone, A.; Baran, V.; Bonasera, A.; Cavallaro, S.; Colonna, M.; Di Toro, M.; Giustolisi, F.; Iacono Manno, M.; La Guidara, E.; Maiolino, C.; Porto, F.; Rizzo, F.; Russotto, P.; Sperduto, M.L. [Catania, Univ., INFN-LNS and Dipt. di Fisica e Astronomia (Italy); Auditore, L.; Trifiro, A.; Trimarchi, M. [Messina Univ., INFN and Dipt. di Fisica (Italy); Bartolucci, M.; Guazzoni, P.; Manfredi, G.; Petrovici, M.; Russo, S.; Zetta, L. [Milano Univ., INFN Milano and Dipt. di Fisica (Italy); Berceanu, I.; Paduszynski, T.; Pop, A.; Simion, V. [Inst. for Physics and Nuclear Engineering, Bucharest (Romania); Blicharska, J.; Grzeszczuk, A.; Kowalski, S.; Schmidt, K.; Zipper, W. [Univ. of Silesia, Inst. of Physics, Katowice (Poland); Brzychczyk, J.; Gawlikowicz, W.; Planeta, R. [Jagellonian Univ., M. Smoluchowski Inst. of Physics, Cracow (Poland); Borderie, B.; Le Neindre, N.; Rivet, M.F. [Paris-11 Univ., IPN, IN2P3-CNRS, 91 - Orsay (France); Bougault, R.; Steckmeyer, J.C. [Caen Univ., LPC, Ensi, 14 (France); Bruno, M.; D' Agostino, M.; Geraci, E.; Vannini, G. [Bologna Univ., INFN Bologna and Dipt. di Fisica (Italy); Chatterjee, M.B. [Saha Inst. Of Nuclear Physics, Kolkata (India); Chbihi, A.; Wieleczko, J.P. [GANIL, CEA, IN2P3-CNRS, 14 - Caen (France); Cibor, J. [H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland); Dayras, R.; Majka, Z. [CEA Saclay, Dept. d' Astrophysique, de Physique des Particules, de Physique Nucleaire et de l' Instrumentation Associee, SPhN, 91- Gif sur Yvette (France); Piasecki, E.; Guinet, D.; Li, S.; Wu, H.; Xiao, Z.; Rosato, E.; Vigilante, M.; Siwek-Wilczynska, K.; Skwira, I.; Swiderski, L.; Wilczynski, J.

2003-07-01

The forward part of the 4{pi} CHIMERA detector is used to study the intermediate mass fragments (IMF) production in semi-peripheral collisions. A method is presented to disentangle intermediate mass fragments produced in the initial dynamical stage of the collision from the ones coming from sequential decay of a projectile-like or target-like sources. For these dynamical produced fragments also an iso-scaling analysis is presented. Comparison between theoretical Boltzmann Nordheim Vlasov simulations and experimental data suggests that a neck fragmentation mechanism in the overlapping zone between interacting projectile and target is at the origin of the fragments production. (authors)

Research on critical behaviour during fragmentation of the projectile in the Xe+Sn (at 50 MeV/A) reaction; Recherche d`un comportement critique dans la fragmentation du projectile dans la reaction Xe+Sn a 50 MeV/A

Energy Technology Data Exchange (ETDEWEB)

Benlliure, J

1995-03-01

The study of moments of fragments charge distributions produced in heavy ions collisions can give us evidence of a critical behavior of nuclear matter which could explain the multifragmentation pattern. From an experimental point of view, in order to perform this capabilities of the INDRA detector has made it possible to identify all these particles and to reconstruct the initial projectile-like fragment coming from binary collisions in the reaction Xe+Sn at 50 MeV/A. We have selected events where the initial projectile-like fragments keep their entire charge in a large range of excitation energy. The study of these fragment`s characteristics show clearly a change in the deexcitation pattern. The evolution of moments of the fragment charge distributions has been reproduced within a percolation model, in this sense we can interpreter this change in the deexcitation pattern as a function of the initial projectile-like fragment`s size shows the existence of finite-size effects. However, the signature of a phase transition remains independent on the projectile-like fragment`s size. (author). 74 refs., 58 figs., 9 tabs.

Revegetation of Acid Rock Drainage (ARD) Producing Slope Surface Using Phosphate Microencapsulation and Artificial Soil

Science.gov (United States)

Kim, Jae Gon

2017-04-01

Oxidation of sulfides produces acid rock drainage (ARD) upon their exposure to oxidation environment by construction and mining activities. The ARD causes the acidification and metal contamination of soil, surface water and groundwater, the damage of plant, the deterioration of landscape and the reduction of slope stability. The revegetation of slope surface is one of commonly adopted strategies to reduce erosion and to increase slope stability. However, the revegetation of the ARD producing slope surface is frequently failed due to its high acidity and toxic metal content. We developed a revegetation method consisting of microencapsualtion and artificial soil in the laboratory. The revegetation method was applied on the ARD producing slope on which the revegetation using soil coverage and seeding was failed and monitored the plant growth for one year. The phosphate solution was applied on sulfide containing rock to form stable Fe-phosphate mineral on the surface of sulfide, which worked as a physical barrier to prevent contacting oxidants such as oxygen and Fe3+ ion to the sulfide surface. After the microencapsulation, two artificial soil layers were constructed. The first layer containing organic matter, dolomite powder and soil was constructed at 2 cm thickness to neutralize the rising acidic capillary water from the subsurface and to remove the dissolved oxygen from the percolating rain water. Finally, the second layer containing seeds, organic matter, nutrients and soil was constructed at 3 cm thickness on the top. After application of the method, the pH of the soil below the artificial soil layer increased and the ARD production from the rock fragments reduced. The plant growth showed an ordinary state while the plant died two month after germination for the previous revegetation trial. No soil erosion occurred from the slope during the one year field test.

Gravitational waves from fragmentation of a primordial scalar condensate into Q balls.

Science.gov (United States)

Kusenko, Alexander; Mazumdar, Anupam

2008-11-21

A generic consequence of supersymmetry is the formation of a scalar condensate along the flat directions of the potential at the end of cosmological inflation. This condensate is usually unstable, and it can fragment into nontopological solitons, Q balls. The gravitational waves produced by the fragmentation can be detected by the Laser Interferometer Space Antenna, Advanced Laser Interferometer Gravitational-Wave Observatory, and Big Bang Observer, which can open an important window to the early Universe and the physics at some very high energy scales.

Design and Construction of a Cloning Vector Containing the hspX Gene of Mycobacterium tuberculosis.

Science.gov (United States)

Yaghoubi, Atieh; Aryan, Ehsan; Zare, Hosna; Alami, Shadi; Teimourpour, Roghayeh; Meshkat, Zahra

2016-10-01

Tuberculosis (TB) is a major cause of death worldwide. Finding an effective vaccine against TB is the best way to control it. Several vaccines against this disease have been developed but none are completely protective. The aim of this study was to design and construct a cloning vector containing the Mycobacterium tuberculosis (M. tuberculosis) heat shock protein X (hspX) . First, an hspX fragment was amplified by PCR and cloned into plasmid pcDNA3.1(+) and recombinant vector was confirmed. A 435 bp hspX fragment was isolated. The fragment was 100% homologous with hspX of M. tuberculosis strain H37Rv in GenBank. In this study, the cloning vector pcDNA3.1(+), containing a 435-bp hspX fragment of M. tuberculosis , was constructed. This could be used as a DNA vaccine to induce immune responses in animal models in future studies.

Time-zero fission-fragment detector based on low-pressure multiwire proportional chambers

International Nuclear Information System (INIS)

Assamagan, K.; Baker, K.; Bayatyan, G.; Carlini, R.; Danagoulian, S.; Eden, T.; Egiyan, K.; Ent, R.; Fenker, H.; Gan, L.; Gasparian, A.; Grigoryan, N.; Greenwood, Z.; Gueye, P.; Hashimoto, O.; Johnston, K.; Keppel, C.; Knyazyan, S.; Majewski, S.; Margaryan, A.; Margaryan, Yu.; Marikyan, G.; Martoff, J.; Mkrtchyan, H.; Parlakyan, L.; Sato, Y.; Sawafta, R.; Simicevic, N.; Tadevosyan, V.; Takahashi, T.; Tang, L.; Vartanyan, G.; Vulcan, W.; Wells, S.; Wood, S.

1999-01-01

A time-zero fission fragment (FF) detector, based on the technique of low-pressure multiwire proportional chambers (LPMWPC), has been designed and constructed for the heavy hypernuclear lifetime experiment (E95-002) at Thomas Jefferson National Accelerator Facility. Its characteristics and the method of time-zero reconstruction were investigated using fission fragments from a 252 Cf spontaneous fission source. The influence of the ionization energy loss was also studied. It is shown that Heptane, Hexane, and Isobutane gases at a pressure of 1-2 Torr are all suitable for such a FF detector. As desired by experiment, a timing resolution of about 200 ps (FWHM) for a chamber size of 21x21 cm 2 was achieved

Fragment production in 12-GeV proton-induced reactions

International Nuclear Information System (INIS)

Hirata, Yuichi; Ohnishi, Akira; Ohtsuka, Naohiko; Nara, Yasushi; Niida, Koji; Chiba, Satoshi; Takada, Hiroshi

2000-01-01

We study mass and angular distribution of Intermediate Mass Fragment (IMF) produced from p(12 GeV)+ 197 Au reaction by using JAM cascade model combined with percolation model. Although the mass distribution of IMF is well reproduced, the experimentally observed sideward peak of IMF angular distribution is not explained within present JAM + percolation model. (author)

Jets and quark fragmentations in Higgs boson decays

International Nuclear Information System (INIS)

Kalyniak, P.; Ng, J.N.

1983-02-01

We have calculated the first order QCD to the rate of the Higgs boson decaying into two heavy quarks. Our corrections are found to be numerically smaller than previously obtained. By constructing a hybrid heavy quark fragmentation model we calculated the average momentum fraction carried off by rank one and two mesons in the decay. We also found that the average charge multiplicity from Higgs boson decay is high and is estimated to be approximately 17 charged particles for a Higgs with mass of 20 GeV/c 2

Using Tree-Rings and Remote Sensing to Investigate Forest Productivity Response to Landscape Fragmentation in Northeastern Algeria

Science.gov (United States)

Rouini, N.; Lepley, K. S.; Messaoudene, M.

2017-12-01

Remote sensing and dendrochronology are valuable tools in the face of climate change and land use change, yet the connection between these resources remains largely unexploited. Research on forest fragmentation is mainly focused on animal groups, while our work focuses on tree communities. We link tree-rings and remotely-sensed Normalized Difference Vegetation Index (NDVI) using seasonal correlation analysis to investigate forest primary productivity response to fragmentation. Tree core samples from Quercus afares have been taken from two sites within the Guerrouche Forest in northeastern Algeria. The first site is located within a very fragmented area while the second site is intact. Fragmentation is estimated to have occurred with the construction of a road in 1930. We find raw tree-ring width chronologies from each site reveal growth release in the disturbed site after 1930. The means of each chronology for the 1930 to 2016 period are statistically different (p < 0.01). Based on these preliminary results we hypothesize that reconstructed primary productivity (NDVI) will be higher in the fragmented site after fragmentation took place.

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

Science.gov (United States)

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

Automated building of organometallic complexes from 3D fragments.

Science.gov (United States)

Foscato, Marco; Venkatraman, Vishwesh; Occhipinti, Giovanni; Alsberg, Bjørn K; Jensen, Vidar R

2014-07-28

A method for the automated construction of three-dimensional (3D) molecular models of organometallic species in design studies is described. Molecular structure fragments derived from crystallographic structures and accurate molecular-level calculations are used as 3D building blocks in the construction of multiple molecular models of analogous compounds. The method allows for precise control of stereochemistry and geometrical features that may otherwise be very challenging, or even impossible, to achieve with commonly available generators of 3D chemical structures. The new method was tested in the construction of three sets of active or metastable organometallic species of catalytic reactions in the homogeneous phase. The performance of the method was compared with those of commonly available methods for automated generation of 3D models, demonstrating higher accuracy of the prepared 3D models in general, and, in particular, a much wider range with respect to the kind of chemical structures that can be built automatically, with capabilities far beyond standard organic and main-group chemistry.

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

Photo fragmentation dynamics of small argon clusters and biological molecular: new tools by trapping and vectorial correlation

International Nuclear Information System (INIS)

Lepere, V.

2006-09-01

The present work concerns the building up of a complex set-up whose aim being the investigation of the photo fragmentation of ionised clusters and biological molecules. This new tool is based on the association of several techniques. Two ion sources are available: clusters produced in a supersonic beam are ionised by 70 eV electrons while ions of biological interest are produced in an 'electro-spray'. Ro-vibrational cooling is achieved in a 'Zajfman' electrostatic ion trap. The lifetime of ions can also be measured using the trap. Two types of lasers are used to excite the ionised species: the femtosecond laser available at the ELYSE facilities and a nanosecond laser. Both lasers have a repetition rate of 1 kHz. The neutral and ionised fragments are detected in coincidence using a sophisticated detection system allowing time and localisation of the various fragments to be determined. With such a tool, I was able to investigate in details the fragmentation dynamics of ionised clusters and bio-molecules. The first experiments deal with the measurement of the lifetime of the Ar 2+ dimer II(1/2)u metastable state. The relative population of this state was also determined. The Ar 2+ and Ar 3+ photo-fragmentation was then studied and electronic transitions responsible for their dissociation identified. The detailed analysis of our data allowed to distinguish the various fragmentation mechanisms. Finally, a preliminary investigation of the protonated tryptamine fragmentation is presented. (author)

Nuclear structure via isomer tagging of fission fragments

Science.gov (United States)

Wu, C. Y.; Cline, D.; Simon, M. W.; Stoyer, M. A.

1997-10-01

The high efficiency for detecting high-fold γ rays by large Ge arrays makes it possible to study the detailed spectroscopy of many neutron-rich nuclei produced by fission. Major progress has been made using sealed spontaneous fission sources. Considerable improvement in selectivity is provided, with an open source, both by gating on isomers and by detection of both fission fragments in coincidence with the deexcitation γ rays (see the preceding contribution). The reconstructed kinematics allows a measure of fragment mass and the Doppler shift correction of γ rays. In a recent experiment, fission fragments were detected using half of the CHICO array and an annular PPAC in coincidence with deexcitation γ rays detected by the Rochester array of eight Compton-suppressed Ge detectors. The annular PPAC was located only 1.0" from a 3.7 μCi ^252Cf source for efficient isomer tagging. The correlation was studied between delayed, within a time window between 150 ns and 10 μs after a fission occurring, and prompt γ rays. Several prominent feeding patterns to isomers in the mass region around 100 and 130 are identified by such correlation study. Experimental details and results will be presented.

Comparative imaging and biodistribution studies with an anti-CEA monoclonal antibody and its F(ab)2 and Fab fragments in mice with colon carcinoma xenografts

International Nuclear Information System (INIS)

Andrew, S.M.; Pimm, M.V.; Baldwin, R.W.; Perkins, A.C.

1986-01-01

An IgG1 mouse monoclonal antibody directed against CEA has been digested with papain to yield F(ab) 2 and Fab fragments. Following radioiodination, intact antibody and fragments showed specific binding to cells of a CEA-producing tumour, although the immune reactivities of the fragments were lower than that of intact antibody. Gamma scintigraphy of nude mice bearing CEA producing human tumour xenografts and injected with 131 I-labelled fragments showed earlier and superior imaging of tumours than did 131 I-intact antibody, and this was most marked with the Fab fragment. Sequential dissection analyses showed that this was due to earlier and higher tumour-to-blood ratios with fragments than with intact antibody, but in absolute terms the degree of localization of both fragment types was significantly lower than that of intact antibody. (orig.)

Gas-phase fragmentation of peptides to increase the spatial resolution of the Hydrogen Exchange Mass Spectrometry experiment

DEFF Research Database (Denmark)

Jensen, Pernille Foged; Rand, Kasper Dyrberg

2016-01-01

are produced after precursor ion selection and thus do not add complexity to the LC-MS analysis. The key to obtaining optimal spatial resolution in a hydrogen exchange mass spectrometry (HX-MS) experiment is the fragmentation efficiency. This chapter discusses common fragmentation techniques like collision....../D scrambling, thus making them suitable for HX applications. By combining the classic bottom-up HX-MS workflow with gas-phase fragmentation by ETD, detailed information on protein HX can be obtained....

Piecing together the fragments: Elucidating edge effects on forest carbon dynamics

Science.gov (United States)

Hutyra, L.; Smith, I. A.; Reinmann, A.; Marrs, J.; Thompson, J.

2017-12-01

Forest fragmentation is pervasive throughout the world's forests, impacting growing conditions and carbon dynamics through edge effects that produce gradients in microclimate, biogeochemistry, and stand structure. Despite the majority of the world's forests being biome, but current forest carbon accounting methods and ecosystem models largely do not include edge effects, highlighting an important gap in our understanding of the terrestrial carbon cycle. Characterizing the role of forest fragmentation in regional and global biogeochemical cycles necessitates advancing our understanding of how shifts in microenvironment at the forest edge interact with local prevailing drivers of global change and limitations to microbial activity and forest growth. This study synthesizes the literature related to edge effects and the carbon cycle, considering how fragmentation affects the growing conditions of the world's remaining forests based on risks and opportunities for forests near the edge.

Separation and implantation of relativistic 86Kr-fragments at the FRS

International Nuclear Information System (INIS)

Czajkowski, S.; Bernas, M.; Dessagne, Ph.; Miehe, Ch.; Audi, G.; Lee, J.K.P.

1993-01-01

Neutron-rich Co and Fe isotopes produced by 86 Kr projectile fragmentation at 500 MeV/u have been separated and identified using the Fragment Separator (FRS) in a bunched energy mode. 66 Co and 65 Fe ions were selectively implanted in a double PIN-diode array where the β-decay signals were measured. The half-lives were deduced from time correlations between implantation and β-decay signals. The re-measurement of the 66 Co half-life confirms the isotope identification. The value of 65 Fe half-life was found to be 0.45±0.15 s. (authors). 18 refs., 5 figs

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Antibody Fragments as Potential Biopharmaceuticals for Cancer Therapy: Success and Limitations.

Science.gov (United States)

Kholodenko, Roman V; Kalinovsky, Daniel V; Doronin, Igor I; Ponomarev, Eugene D; Kholodenko, Irina V

2017-08-17

Monoclonal antibodies (mAbs) are an important class of therapeutic agents approved for the therapy of many types of malignancies. However, in certain cases applications of conventional mAbs have several limitations in anticancer immunotherapy. These limitations include insufficient efficacy and adverse effects. The antigen-binding fragments of antibodies have a considerable potential to overcome the disadvantages of conventional mAbs, such as poor penetration into solid tumors and Fc-mediated bystander activation of the immune system. Fragments of antibodies retain antigen specificity and part of functional properties of conventional mAbs and at the same time have much better penetration into the tumors and a greatly reduced level of adverse effects. Recent advantages in antibody engineering allowed to produce different types of antibody fragments with improved structure and properties for efficient elimination of tumor cells. These molecules opened up new perspectives for anticancer therapy. Here we will overview the structural features of the various types of antibody fragments and their applications for anticancer therapy as separate molecules and as part of complex conjugates or structures. Mechanisms of antitumor action of antibody fragments as well as their advantages and disadvantages for clinical application will be discussed in this review. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

The Impact of Marketing Advisory Service Recommendations on Producers' Marketing Decisions

NARCIS (Netherlands)

Pennings, J.M.E.; Isengildina, O.; Irwin, S.H.; Good, D.L.

2004-01-01

Abstract To date, there is only fragmented and anecdotal information about the impact of the recommendations of market advisory services (MAS) on producers¿ decision-making. A conceptual framework is developed in which, among others, producers¿ risk attitudes and risk perceptions; producers¿

Regrowth of Cirsium arvense from intact roots and root fragments at different soil depths

Directory of Open Access Journals (Sweden)

Thomsen, Mette Goul

2014-02-01

Full Text Available In the present work we measured the shoot rate from intact roots and from root fragments of Cirsium arvense at different digging depths and the number of leaves were used as estimate of minimum regenerative capacity. The experiments were performed on four sites with three or four repetitions of each treatment. On each site plot, the soil was removed down to a given depth within a 1 x 1 m square. All plant parts was excavated from the soil and the soil was either replaced without any root material, or roots of C. arvense was cut into 10 cm long fragments and replaced into the source hole. Shoot number, aboveground biomass and number of leaves were measured. Digging depth and time explained 50% - 60% of the variation in biomass (P<0.001. Replacement of root fragments increased the shoot number in one out of four treatments but did not affect biomass produced compared to production from undisturbed root systems. Number of leaves showed that shoots from all digging depths passed the level of minimum regenerative capacity. We conclude that the intact root system from all depths was able to regenerate within one season and it has a high contribution to the produced biomass compared with root fragments in the upper soil layers.

Neutralisation and binding of VHS virus by monovalent antibody fragments

DEFF Research Database (Denmark)

Cupit, P.M.; Lorenzen, Niels; Strachan, G.

2001-01-01

We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

Imaging of Nuclear Fragmentation in Nuclear Track Emulsion Relativistic Nuclei

International Nuclear Information System (INIS)

Zarubina, I.G. JINR

2011-01-01

The method of nuclear track emulsion provides a uniquely complete observation of multiple fragment systems produced in dissociation of relativistic nuclei. The most valuable events of coherent dissociation of nuclei in narrow jets of light and the lightest nuclei with a net charge as in the initial nucleus, occurring without the production of fragments of the target nuclei and mesons (the so-called w hite s tars), comprise a few percent among the observed interactions. The data on this phenomenon are fragmented, and the interpretation is not offered. The dissociation degree of light O, Ne, Mg and Si, and as well as heavy Au, Pb and U nuclei may reach a complete destruction to light and the lightest nuclei and nucleons, resulting in cluster systems of an unprecedented complexity. Studies with relativistic neutron-deficient nuclei have special advantages due to more complete observations. An extensive collection of macro videos of such interactions in nuclear track emulsion gathered by the Becquerel collaboration is presented

The Significance of Coordination for Industrialised Building System (IBS Precast Concrete in Construction Industry

Directory of Open Access Journals (Sweden)

Fitri Othman Mohd Khairul

2017-01-01

Full Text Available IBS precast concrete is construction system which is meant to improve the conventional construction process. However IBS precast concrete projects are suffering from serious problems such as cost overrun, delays and less quality of the end product. The absence of coordination is perceived as the reason for this issue. The purpose of this paper is to review the significance of coordination for IBS precast concrete in the construction industry. It if found that the fragmentation which occurs in the construction industry requires continuity of coordination due to the construction activities are intertwined in nature. Coordination is designated to assist stakeholders in completing and complementing each other with the paramount focus of achieving the objective. Proper coordination is required in delivering the desired construction product at the ideal time, cost and quality. As for the findings, the significance of coordination for IBS precast concrete can be seen through the precast concrete construction phases which consist of planning; design; manufacturing; transportation and installation/construction. These phases are meant to complement construction process with the purpose to reduce issues of fragmentation and enhance IBS precast concrete project delivery.

Fragmentation and reactivity of energy-selected ferrocenium ions

International Nuclear Information System (INIS)

Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

2002-01-01

In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

On the relationship between microbubble fragmentation, deflation and broadband superharmonic signal production.

Science.gov (United States)

Lindsey, Brooks D; Rojas, Juan D; Dayton, Paul A

2015-06-01

Acoustic angiography imaging of microbubble contrast agents uses the superharmonic energy produced from excited microbubbles and enables high-contrast, high-resolution imaging. However, the exact mechanism by which broadband harmonic energy is produced is not fully understood. To elucidate the role of microbubble shell fragmentation in superharmonic signal production, simultaneous optical and acoustic measurements were performed on individual microbubbles at transmit frequencies from 1.75 to 3.75 MHz and pressures near the shell fragmentation threshold for microbubbles of varying diameter. High-amplitude, broadband superharmonic signals were produced with shell fragmentation, whereas weaker signals (approximately 25% of peak amplitude) were observed in the presence of shrinking bubbles. Furthermore, when populations of stationary microbubbles were imaged with a dual-frequency ultrasound imaging system, a sharper decline in image intensity with respect to frame number was observed for 1-μm bubbles than for 4-μm bubbles. Finally, in a study of two rodents, increasing frame rate from 4 to 7 Hz resulted in decreases in mean steady-state image intensity of 27% at 1000 kPa and 29% at 1300 kPa. Although the existence of superharmonic signals when bubbles shrink has the potential to prolong the imaging efficacy of microbubbles, parameters such as frame rate and peak pressure must be balanced with expected re-perfusion rate to maintain adequate contrast during in vivo imaging. Copyright © 2015. Published by Elsevier Inc.

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Straightforward hit identification approach in fragment-based discovery of bromodomain-containing protein 4 (BRD4) inhibitors.

Science.gov (United States)

Borysko, Petro; Moroz, Yurii S; Vasylchenko, Oleksandr V; Hurmach, Vasyl V; Starodubtseva, Anastasia; Stefanishena, Natalia; Nesteruk, Kateryna; Zozulya, Sergey; Kondratov, Ivan S; Grygorenko, Oleksandr O

2018-05-09

A combination approach of a fragment screening and "SAR by catalog" was used for the discovery of bromodomain-containing protein 4 (BRD4) inhibitors. Initial screening of 3695-fragment library against bromodomain 1 of BRD4 using thermal shift assay (TSA), followed by initial hit validation, resulted in 73 fragment hits, which were used to construct a follow-up library selected from available screening collection. Additionally, analogs of inactive fragments, as well as a set of randomly selected compounds were also prepared (3 × 3200 compounds in total). Screening of the resulting sets using TSA, followed by re-testing at several concentrations, counter-screen, and TR-FRET assay resulted in 18 confirmed hits. Compounds derived from the initial fragment set showed better hit rate as compared to the other two sets. Finally, building dose-response curves revealed three compounds with IC 50  = 1.9-7.4 μM. For these compounds, binding sites and conformations in the BRD4 (4UYD) have been determined by docking. Copyright © 2018 Elsevier Ltd. All rights reserved.

Design and Construction of a Cloning Vector Containing the hspX Gene of Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Atieh Yaghoubi

2016-10-01

Full Text Available Background: Tuberculosis (TB is a major cause of death worldwide. Finding an effective vaccine against TB is the best way to control it. Several vaccines against this disease have been developed but none are completely protective. The aim of this study was to design and construct a cloning vector containing the Mycobacterium tuberculosis (M. tuberculosis heat shock protein X (hspX. Methods: First, an hspX fragment was amplified by PCR and cloned into plasmid pcDNA3.1(+ and recombinant vector was confirmed. Results: A 435 bp hspX fragment was isolated. The fragment was 100% homologous with hspX of M. tuberculosis strain H37Rv in GenBank. Conclusions: In this study, the cloning vector pcDNA3.1(+, containing a 435-bp hspX fragment of M. tuberculosis, was constructed. This could be used as a DNA vaccine to induce immune responses in animal models in future studies.

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

D meson production asymmetry, unfavored fragmentation, and consequences for prompt atmospheric neutrino production

Science.gov (United States)

Maciuła, Rafał; Szczurek, Antoni

2018-04-01

We consider unfavored light quark/antiquark to D meson fragmentation. We discuss nonperturbative effects for small transverse momenta. The asymmetry for D+ and D- production measured by the LHCb collaboration provides natural constraints on the parton (quark/antiquark) fragmentation functions. We find that already a fraction of q /q ¯→D fragmentation probability is sufficient to account for the measured asymmetry. We make predictions for similar asymmetry for neutral D mesons. Large D -meson production asymmetries are found for large xF which is related to dominance of light quark/antiquark q /q ¯→D fragmentation over the standard c →D fragmentation. As a consequence, prompt atmospheric neutrino flux at high neutrino energies can be much larger than for the conventional c →D fragmentation. The latter can constitute a sizeable background for the cosmic neutrinos claimed to be observed recently by the IceCube Observatory. Large rapidity-dependent D+/D- and D0/D¯0 asymmetries are predicted for low (√{s }=20 - 100 GeV ) energies. The q /q ¯→D fragmentation leads to enhanced production of D mesons at low energies. At √{s }=20 GeV the enhancement factor with respect to the conventional contribution is larger than a factor of five. In the considered picture the large-xF D mesons are produced dominantly via fragmentation of light quarks/antiquarks. Predictions for fixed target p + 4He collisions relevant for a fixed target LHCb experiment are presented.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Behavior of fragmentation front in a porous viscoelastic material

Science.gov (United States)

Ichihara, M.; Takayama, K.

2002-12-01

We are developing laboratory experiments to investigate dynamics of magma fragmentation during explosive volcanic eruptions. Fragmentation of such a mixture as magma consisting of viscoelastic melt, bubbles and solid particles, is not known yet, and experiments are necessary to establish a mathematical model. It has been shown that viscoelastic silicone compound (Dow Corning 3179) is a useful analogous material to simulate magma fragmentation. In the previous work, a porous specimen made of the compound was rapidly decompressed and development of brittle fragmentation was observed. However, there were arguments that the experiment was different from actual processes which produce fragments as small as volcanic ash, because in the experiment the specimen was broken into only several pieces. This time, results of the improved experiments are presented. The experimental apparatus is a kind of a vertical shock tube, which mainly consists of a high pressure test section and low pressure chambers. The test section is made of acrylic tube of which inner diameter is 25 mm. The internal phenomenon is recorded by a high-speed video camera. Pressure is measured in the gas above and beneath the specimen by piezoelectric transducers. The specimen is prepared in the following way. First, an acrylic tube filled with the compound is put in a nitrogen tank and kept at 45 bar for more than 8 hours. The compound absorbs the gas and equilibrates with the nitrogen. Next, the tank is decompressed back to the atmospheric pressure slowly. Nitrogen exsolves and bubbles are formed in the compound quite uniformly. Finally, the expanded compound sticking out of both ends of the tube is cut down, and the tube containing the specimen is attached to the shock tube. The specimen is rapidly decompressed by 24, 16, and 8 bars. The high-speed video images demonstrate a sequence of the fragmentation process. We observe propagation of a clear fracture front at 50 m/s for 24 bar of decompression and at

Stripping in hot mix asphalt produced by aggregates from construction and demolition waste.

Science.gov (United States)

Pérez, I; Pasandín, A R; Gallego, J

2012-01-01

This paper analyses the effect of water on the durability of hot asphalt mixtures made with recycled aggregates from construction and demolition debris. Indirect tensile stress tests were carried out to evaluate stripping behaviour. The mixtures tested were fabricated with 0, 20, 40 and 60% recycled aggregates. Two types of natural aggregates were used: schist and calcite dolomite. An increase in the percentage of recycled aggregates was found to produce a decrease in the tensile stress ratio of the hot asphalt mixtures. To study this phenomenon, two and three factor analyses of variance (ANOVA) were performed with indirect tensile stress being used as the dependent variable. The factors studied were the percentage of recycled aggregates (0, 20, 40 and 60%), the moisture state (dry, wet) and the type of natural aggregate (schist, calcite). On the basis of the ANOVA results, it was found that the most important factor affecting resistance was the moisture state (dry, wet) of the specimens. The percentage of recycled aggregate also affected indirect tensile stress, especially in the dry state. The type of natural aggregate did not have a significant effect on indirect tensile stress. The hot asphalt mixture specimens made with different percentages of recycled aggregates from construction and demolition debris and of natural quarry aggregates showed poor stripping behaviour. This stripping behaviour can be related to both the poor adhesion of the recycled aggregates and the high absorption of the mortar of cement adhered to them.

Fractal statistics of brittle fragmentation

Directory of Open Access Journals (Sweden)

M. Davydova

2013-04-01

Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

Faunal Communities Are Invariant to Fragmentation in Experimental Seagrass Landscapes.

Directory of Open Access Journals (Sweden)

Jonathan S Lefcheck

Full Text Available Human-driven habitat fragmentation is cited as one of the most pressing threats facing many coastal ecosystems today. Many experiments have explored the consequences of fragmentation on fauna in one foundational habitat, seagrass beds, but have either surveyed along a gradient of existing patchiness, used artificial materials to mimic a natural bed, or sampled over short timescales. Here, we describe faunal responses to constructed fragmented landscapes varying from 4-400 m2 in two transplant garden experiments incorporating live eelgrass (Zostera marina L.. In experiments replicated within two subestuaries of the Chesapeake Bay, USA across multiple seasons and non-consecutive years, we comprehensively censused mesopredators and epifaunal communities using complementary quantitative methods. We found that community properties, including abundance, species richness, Simpson and functional diversity, and composition were generally unaffected by the number of patches and the size of the landscape, or the intensity of sampling. Additionally, an index of competition based on species co-occurrences revealed no trends with increasing patch size, contrary to theoretical predictions. We extend conclusions concerning the invariance of animal communities to habitat fragmentation from small-scale observational surveys and artificial experiments to experiments conducted with actual living plants and at more realistic scales. Our findings are likely a consequence of the rapid life histories and high mobility of the organisms common to eelgrass beds, and have implications for both conservation and restoration, suggesting that even small patches can rapidly promote abundant and diverse faunal communities.

Towards Integrated Team Practice: A Case of Malaysian Industrialised Building System (IBS Construction Projects

Directory of Open Access Journals (Sweden)

Mohd Nawi Mohd Nasrun

2014-01-01

Full Text Available Problems associated with fragmentation in the traditional construction process, such as isolation of professionals, lack of co-ordination between design and construction, and the sequential manner of its processes, has impacted on construction performance leading to a lack of integration, wastage, low productivity and efficiency. Integrated team practice is perceived as paramount. Unfortunately, there has a limitation of study focus on the dimension of fully integrated team especially for Malaysian Industrialised Building System (IBS projects. Accordingly, this research paper explores and identifies the dimension of fully integrated team from the traditional approach and conduct a validation process for implementing it in Malaysian IBS projects. The research presented uses interviews case study to obtain qualitative data. It was found that the dimension of fully integrated team from the traditional construction process could apply to the Malaysian IBS projects. Suggestions on how an integrated team practice in IBS design and construction process in order to minimise the fragmentation gaps will be concluded.

Analysis of Immunogenicity of Intracellular CTAR Fragments of Epstein-Barr Virus Latent Phase Protein LMP1.

Science.gov (United States)

Lomakin, Ya A; Shmidt, A A; Bobik, T V; Chernov, A S; Pyrkov, A Yu; Aleksandrova, N M; Okunola, D O; Vaskina, M I; Ponomarenko, N A; Telegin, G B; Dubina, M V; Belogurov, A A

2017-10-01

Intracellular fragments of latent phase protein LMP1 of Epstein-Barr virus, denoted as CTAR1/2/3, can trigger a variety of cell cascades and contribute to the transforming potential of the virus. Generation of recombinant proteins CTAR1/2/3 is expected to yield more ample data on functional and immunogenic characteristics of LMP1. We created genetic constructs for prokaryotic expression of LMP1 CTAR fragments and selected optimal conditions for their production and purification. Using a new library of LMP1 CTAR fragments, we carried out epitope mapping of a diagnostic anti-LMP1 antibody S12. Analysis of polyclonal serum antibodies from mice immunized with full-length LMP1 confirmed immunogenicity of CTAR elements comparable with that of full-length protein.

Recycling the construction and demolition waste to produce polymer concrete

Science.gov (United States)

Hamza, Mohammad T.; Hameed, Awham M., Dr.

2018-05-01

The sustainable management for solid wastes of the construction and demolition waste stimulates searching for safety applications for these wastes. The aim of this research is recycling of construction and demolition waste with some different types of polymeric resins to be used in manufacturing process of polymer mortar or polymer concrete, and studying their mechanical and physical properties, and also Specify how the values of compressive strength and the density are affected via the different parameters. In this research two types of construction and demolition waste were used as aggregates replacement (i.e. waste cement/concrete debris, and the waste blocks) while the two types of polymer resins (i.e. Unsaturated polyester and Epoxy) as cement replacements. The used weight percentages of the resins were changed within (1°, 20, 25 and 30) % to manufacture this polymer concrete.

Time-zero fission-fragment detector based on low-pressure multiwire proportional chambers

CERN Document Server

Assamagan, Ketevi A; Bayatyan, G L; Carlini, R; Danagulyan, S; Eden, T; Egiyan, K; Ent, R; Fenker, H; Gan, L; Gasparian, A; Grigoryan, N K; Greenwood, Z; Gueye, P; Hashimoto, O; Johnston, K; Keppel, C; Knyazyan, S; Majewski, S; Margaryan, A; Margaryan, Yu L; Marikian, G G; Martoff, J; Mkrtchyan, H G; Parlakyan, L; Sato, Y; Sawafta, R; Simicevic, N; Tadevosyan, V; Takahashi, T; Tang, L; Vartanian, G S; Vulcan, W; Wells, S; Wood, S

1999-01-01

A time-zero fission fragment (FF) detector, based on the technique of low-pressure multiwire proportional chambers (LPMWPC), has been designed and constructed for the heavy hypernuclear lifetime experiment (E95-002) at Thomas Jefferson National Accelerator Facility. Its characteristics and the method of time-zero reconstruction were investigated using fission fragments from a sup 2 sup 5 sup 2 Cf spontaneous fission source. The influence of the ionization energy loss was also studied. It is shown that Heptane, Hexane, and Isobutane gases at a pressure of 1-2 Torr are all suitable for such a FF detector. As desired by experiment, a timing resolution of about 200 ps (FWHM) for a chamber size of 21x21 cm sup 2 was achieved.

Study of fragmentation reactions of light nucleus

International Nuclear Information System (INIS)

Toneli, David Arruda; Carlson, Brett Vern

2011-01-01

Full text: The decay of the compound nucleus is traditionally calculated using a sequential emission model, such as the Weisskopf-Ewing or Hauser-Feshbach ones, in which the compound nucleus decays through a series of residual nuclei by emitting one particle at a time until there is no longer sufficient energy for further emission. In light compound nucleus, however, the excitation energy necessary to fully disintegrate the system is relatively easy to attain. In such cases, decay by simultaneous emission of two or more particles becomes important. A model which takes into account all these decay is the Fermi fragmentation model. Recently, the equivalence between the Fermi fragmentation model and statistical multifragmentation model used to describe the decay for highly excited fragments for reactions of heavy ions was demonstrated. Due the simplicity of the thermodynamic treatment used in the multifragmentation model, we have adapted it to the calculation of Fermi breakup of light nuclei. The ultimate goal of this study is to calculate the distribution of isotopes produced in proton-induced reactions on light nuclei of biological interest, such as C, O e Ca. Although most of these residual nuclei possess extremely short half-lives and thus represent little long-term danger, they tend to be deficient in neutrons and to decay by positron emission, which allows the monitoring of proton radiotherapy by PET (Positron Emission Tomography). (author)

Binary projectile fragmentation of 12C at an incident energy of 33.3 MeV/nucleon

CERN Document Server

Förtsch, S V; Gadioli, E; Bassini, R; Buthelezi, E Z; Cerutti, F; Connell, S H; Cowley, A A; Fujita, H; Mabiala, J; Mairani, A; Mira, J; Papka, P; Neveling, R; Smit, F D

2010-01-01

Direct binary projectile fragmentation is being investigated for the case where a 400 MeV 12C projectile breaks up into an particle and a 8Be fragment in the interaction with a thin 93Nb and 197Au target. While the 8Be fragments were measured at 9 , the correlated particles were detected in an angular range between 16 and 30 on the opposite side of the beam. From the preliminary results presented here one may obtain information on the amount of quasi-elastic fragmentation (both fragments do not suffer any further interactions after they are produced). These experimental results indicate that the quasi-elastic break-up process is the dominant contribution to the measured correlation spectra. As was also observed in earlier work, the most forward quasi-elastically emitted particles have energies exceeding the beam velocity.

The size distributions of fragments ejected at a given velocity from impact craters

Science.gov (United States)

O'Keefe, John D.; Ahrens, Thomas J.

1987-01-01

The mass distribution of fragments that are ejected at a given velocity for impact craters is modeled to allow extrapolation of laboratory, field, and numerical results to large scale planetary events. The model is semi-empirical in nature and is derived from: (1) numerical calculations of cratering and the resultant mass versus ejection velocity, (2) observed ejecta blanket particle size distributions, (3) an empirical relationship between maximum ejecta fragment size and crater diameter, (4) measurements and theory of maximum ejecta size versus ejecta velocity, and (5) an assumption on the functional form for the distribution of fragments ejected at a given velocity. This model implies that for planetary impacts into competent rock, the distribution of fragments ejected at a given velocity is broad, e.g., 68 percent of the mass of the ejecta at a given velocity contains fragments having a mass less than 0.1 times a mass of the largest fragment moving at that velocity. The broad distribution suggests that in impact processes, additional comminution of ejecta occurs after the upward initial shock has passed in the process of the ejecta velocity vector rotating from an initially downward orientation. This additional comminution produces the broader size distribution in impact ejecta as compared to that obtained in simple brittle failure experiments.

Shell effects at the touching point of nuclear fragments

International Nuclear Information System (INIS)

Poenaru, D.N.; Gherghescu, R.A.; Greiner, W.

1999-01-01

Shell correction energy of the fission fragments remains practically unchanged when the separation distance increases from the sum of their radii up to infinity. The variation with mass asymmetry of the total deformation energy at the touching point configuration shows the valleys corresponding to different decay modes, which are produced when the two proton and/or the two neutron numbers are magic or almost magic. We present a potential energy surface of the proton-rich α-emitter 106 Te, showing the α-decay valley, obtained with a phenomenological shell correction. We discuss the difficulties to produce such a valley on a potential energy surface of 236 Pu, calculated with the macroscopic-microscopic method, in which the nuclear level scheme is found within the two center shell model. The valleys mainly due to the double magic nuclei 100,132 Sn, 208 Pb, and other magic numbers, are illustrated by plotting the deformation energy at the touching point versus the proton number of the fragment, for the following parent nuclei: 106 Te, 116 Ce, 212 Po, 238 Th, 258 Fm and 264 Fm. For ternary fission the gain in energy of compact configurations as compared to aligned ones is analysed. (authors)

An efficient method for isolating antibody fragments against small peptides by antibody phage display

DEFF Research Database (Denmark)

Duan, Zhi; Siegumfeldt, Henrik

2010-01-01

We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

Role of mTOR, Bad, and Survivin in RasGAP Fragment N-Mediated Cell Protection

Science.gov (United States)

Yang, Jiang-Yan; Widmann, Christian

2013-01-01

Partial cleavage of p120 RasGAP by caspase-3 in stressed cells generates an N-terminal fragment, called fragment N, which activates an anti-apoptotic Akt-dependent survival response. Akt regulates several effectors but which of these mediate fragment N-dependent cell protection has not been defined yet. Here we have investigated the role of mTORC1, Bad, and survivin in the capacity of fragment N to protect cells from apoptosis. Neither rapamycin, an inhibitor of mTORC1, nor silencing of raptor, a subunit of the mTORC1 complex, altered the ability of fragment N from inhibiting cisplatin- and Fas ligand-induced death. Cells lacking Bad, despite displaying a stronger resistance to apoptosis, were still protected by fragment N against cisplatin-induced death. Fragment N was also able to protect cells from Fas ligand-induced death in conditions where Bad plays no role in apoptosis regulation. Fragment N expression in cells did neither modulate survivin mRNA nor its protein expression. Moreover, the expression of cytoplasmic survivin, known to exert anti-apoptotic actions in cells, still occurred in UV-B-irradiated epidermis of mouse expressing a caspase-3-resistant RasGAP mutant that cannot produce fragment N. Additionally, survivin function in cell cycle progression was not affected by fragment N. These results indicate that, taken individually, mTOR, Bad, or Survivin are not required for fragment N to protect cells from cell death. We conclude that downstream targets of Akt other than mTORC1, Bad, or survivin mediate fragment N-induced protection or that several Akt effectors can compensate for each other to induce the pro-survival fragment N-dependent response. PMID:23826368

Effect of iTRAQ Labeling on the Relative Abundance of Peptide Fragment Ions Produced by MALDI-MS/MS

NARCIS (Netherlands)

Gandhi, Tejas; Puri, Pranav; Fusetti, Fabrizia; Breitling, Rainer; Poolman, Bert; Permentier, Hjalmar P.

The identification of proteins in proteomics experiments is usually based on mass information derived from tandem mass spectrometry data. To improve the performance of the identification algorithms, additional information available in the fragment peak intensity patterns has been shown to be useful.

The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy

Directory of Open Access Journals (Sweden)

Pesta David

2003-06-01

Full Text Available Abstract Background DNA microarrays are a powerful tool with important applications such as global gene expression profiling. Construction of bacterial DNA microarrays from genomic sequence data using a two-stage PCR amplification approach for the production of arrayed DNA is attractive because it allows, in principal, the continued re-amplification of DNA fragments and facilitates further utilization of the DNA fragments for additional uses (e.g. over-expression of protein. We describe the successful construction and use of DNA microarrays by the two-stage amplification approach and discuss the technical challenges that were met and resolved during the project. Results Chimeric primers that contained both gene-specific and shared, universal sequence allowed the two-stage amplification of the 3,168 genes identified on the genome of Synechocystis sp. PCC6803, an important prokaryotic model organism for the study of oxygenic photosynthesis. The gene-specific component of the primer was of variable length to maintain uniform annealing temperatures during the 1st round of PCR synthesis, and situated to preserve full-length ORFs. Genes were truncated at 2 kb for efficient amplification, so that about 92% of the PCR fragments were full-length genes. The two-stage amplification had the additional advantage of normalizing the yield of PCR products and this improved the uniformity of DNA features robotically deposited onto the microarray surface. We also describe the techniques utilized to optimize hybridization conditions and signal-to-noise ratio of the transcription profile. The inter-lab transportability was demonstrated by the virtual error-free amplification of the entire genome complement of 3,168 genes using the universal primers in partner labs. The printed slides have been successfully used to identify differentially expressed genes in response to a number of environmental conditions, including salt stress. Conclusions The technique detailed

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Explosion-evaporation model for fragment production in intermediate-energy nuclear collisions

International Nuclear Information System (INIS)

Fai, G.; Randrup, J.

1981-01-01

Nuclear collisions at intermediate energies may create transient systems of hot nuclear matter that decay into many nuclear fragments. The disassembly of such a nuclear fireball is described as a two-stage process. In the primary explosion stage the system quickly fragments into nucleons and composite nuclei according to the available phase space. The explosion produces excited nuclei with half-lives longer than the time associated with the breakup. In the secondary evaporation stage, these nuclei decay, first by sequential emission of light particles (neutrons, protons, alphas), later by electromagnetic radiation. The secondary stage in general changes the relative abundancies of the various fragment species. This general feature makes it essential to take account of the composite fragments before using d/p as a measure of the entropy of the initial source. The formation of unbound nuclei at the explosion stage also has the desirable effect of enhancing the final abundancies of particularly stable nuclei, e.g., 4 He. For neutron-excessive sources the presence of composite nuclei amplifies the ratio of observed neutrons and protons; this effect persists for heavier mirror systems. Predictions of the model are qualitatively compared to available experimental data. The model offers a convenient way to augment existing dynamical models, such as intra-nuclear cascade and nuclear fluid dynamics, to yield actual nuclear fragments rather than merely matter distributions

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Fragment assignment in the cloud with eXpress-D

Science.gov (United States)

2013-01-01

Background Probabilistic assignment of ambiguously mapped fragments produced by high-throughput sequencing experiments has been demonstrated to greatly improve accuracy in the analysis of RNA-Seq and ChIP-Seq, and is an essential step in many other sequence census experiments. A maximum likelihood method using the expectation-maximization (EM) algorithm for optimization is commonly used to solve this problem. However, batch EM-based approaches do not scale well with the size of sequencing datasets, which have been increasing dramatically over the past few years. Thus, current approaches to fragment assignment rely on heuristics or approximations for tractability. Results We present an implementation of a distributed EM solution to the fragment assignment problem using Spark, a data analytics framework that can scale by leveraging compute clusters within datacenters–“the cloud”. We demonstrate that our implementation easily scales to billions of sequenced fragments, while providing the exact maximum likelihood assignment of ambiguous fragments. The accuracy of the method is shown to be an improvement over the most widely used tools available and can be run in a constant amount of time when cluster resources are scaled linearly with the amount of input data. Conclusions The cloud offers one solution for the difficulties faced in the analysis of massive high-thoughput sequencing data, which continue to grow rapidly. Researchers in bioinformatics must follow developments in distributed systems–such as new frameworks like Spark–for ways to port existing methods to the cloud and help them scale to the datasets of the future. Our software, eXpress-D, is freely available at: http://github.com/adarob/express-d. PMID:24314033

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Interactions of $^{16}$O Projectile and its Fragments in Nuclear Emulsion at about 60 and 200 GeV/nucleon

CERN Multimedia

2002-01-01

The aim of the experiment is to measure the multiplicity ``$ n _{s} $'' and pseudo-rapidity ``$\\eta$'' of the shower particles ($\\beta$~$\\geq$~0.7) produced in different types of collisions (peripheral, semi-central and central), of $^{16}$O and $^{32}$S in nuclear emulsions. The multiplicities and angular distributions of both the grey ``$ n _{g} $'' (mainly due to knock- on and recoil protons), and black ``$ n _{b} $'' (slow evaporated target fragments) particles, and the inter-correlation between them are studied. \\\\ \\\\ The yield, charge and angular distributions of produced relativistic projectile fragments P.F.S., for $ Z _{P} . _{F} . $ $\\geq$~2 are measured and their interactions in emulsions are investigated. \\\\ \\\\ The study of the mean free paths for the projectile fragments with Z $\\geq$ 3 produced from 200~A~GeV $^{16}$ 0 interactions were performed, which show the absence of the anomalous phenomena. \\\\ \\\\ The possible production of zero-spin light neutral scaler bosons and pseudoscaler bosons from...

Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

Science.gov (United States)

Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Binary fragmentation based studies for the near super-heavy compound nucleus {sup 256}Rf

Energy Technology Data Exchange (ETDEWEB)

Thakur, Meenu; Behera, B.R.; Mahajan, Ruchi; Kaur, Gurpreet; Sharma, Priya; Kapoor, Kushal; Rani, Kavita [Panjab University, Department of Physics, Chandigarh (India); Saneesh, N.; Dubey, R.; Yadav, A.; Sugathan, P.; Jhingan, A.; Chatterjee, A.; Chatterjee, M.B. [Inter University Accelerator Centre, New Delhi (India); Kumar, Neeraj; Mandal, S. [University of Delhi, Department of Physics and Astrophysics, Delhi (India); Kumar, S. [Andhra University, Department of Nuclear Physics, Visakhapatnam (India); Saxena, A.; Kailas, S. [Bhabha Atomic Research Centre, Nuclear Physics Division, Mumbai (India); Pal, Santanu [CS, Kolkata (India); Nasirov, Avazbek [JINR, Bogoliubov Laboratory of Theoretical Physics, Dubna (Russian Federation); National University, Department of Physics, Tashkent (Uzbekistan); Kayumov, Bakhodir [National University, Department of Physics, Tashkent (Uzbekistan)

2017-06-15

Binary fragmentation of the near super-heavy compound nucleus {sup 256}Rf has been studied through the reaction {sup 48}Ti + {sup 208}Pb at a bombarding energy well above the Coulomb barrier. For a better understanding of its reaction dynamics, the mass distribution, mass-energy distribution and mass-angle distribution of the fission fragments produced from {sup 256}Rf have been investigated thoroughly. The masses and kinetic energies of the fission fragments were reconstructed event-by-event from their measured velocities and emission angles. From the mass-energy analysis, a sizeable contribution from the asymmetric fission was observed on the edges of symmetric mass distribution. Evidence of asymmetric fission was also clued from the observed correlation between the masses and emission angles of the fission fragments. Contribution of the quasi-fission products has also been estimated by performing the theoretical dinuclear system calculations. (orig.)

Isotopic resolution of fission fragments from 238U + 12C transfer and fusion reactions

International Nuclear Information System (INIS)

Caamano, M.; Rejmund, F.; Derkx, X.; Schmidt, K. H.; Andouin, L.; Bacri, C. O.; Barreau, G.; Benlliure, J.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Jurado, B.; Lemasson, A.; Navin, A.; Rejmund, M.; Roger, T.; Shrivastava, A.; Schmitt, C.; Taieb, J.

2010-01-01

Recent results from an experiment at GANIL, performed to investigate the main properties of fission-fragment yields and energy distributions in different fissioning nuclei as a function of the excitation energy, in a neutron-rich region of actinides, are presented. Transfer reactions in inverse kinematics between a 238 U beam and a 12 C target produced different actinides, within a range of excitation energy below 30 MeV. These fissioning nuclei are identified by detecting the target-like recoil, and their kinetic and excitation energy are determined from the reconstruction of the transfer reaction. The large-acceptance spectrometer VAMOS was used to identify the mass, atomic number and charge state of the fission fragments in flight. As a result, the characteristics of the fission-fragment isotopic distributions of a variety of neutron-rich actinides are observed for the first time over the complete range of fission fragments. (authors)

Angular distribution of photofission fragments in 238U at 5.43 MeV

International Nuclear Information System (INIS)

Kuniyoshi, S.; Mafra, O.Y.; Renner, C.; Goldemberg, J.

1974-01-01

The angular distribution of photofission fragments of 238 U, produced by 5.43 MeV monochromatic photons from the eta,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (J sup(π), K) 1= (1 - ,0), (1 - ,1) and (2 + ,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented

Angular distribution of photofission fragments in 238U at 5.43 MeV

International Nuclear Information System (INIS)

Kuniyoshi, Susumo

1973-01-01

The angular distribution of photofission fragments of 238 U, produced by 5.43 MeV monochromatic photons from the η,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (J π , K) 1= (1 - ,0), (1 - ,1) and (2 + ,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented. (author)

Competition and fragmentation: a simple model generating lognormal-like distributions

International Nuclear Information System (INIS)

Schwaemmle, V; Queiros, S M D; Brigatti, E; Tchumatchenko, T

2009-01-01

The current distribution of language size in terms of speaker population is generally described using a lognormal distribution. Analyzing the original real data we show how the double-Pareto lognormal distribution can give an alternative fit that indicates the existence of a power law tail. A simple Monte Carlo model is constructed based on the processes of competition and fragmentation. The results reproduce the power law tails of the real distribution well and give better results for a poorly connected topology of interactions.

Protecting Spacecraft Fragments from Exposure to Small Debris

Directory of Open Access Journals (Sweden)

V. V. Zelentsov

2015-01-01

Full Text Available Since the launch of the first artificial Earth satellite a large amount of space debris has been accumulated in near-earth space. This debris comprises the exhausted spacecrafts, final stages of rocket-carriers and boosters, technological space junk, consisting of the structure elements, which are separated when deploying the solar arrays, antennas etc., as well as when undocking a booster and a spacecraft. All the debris is divided into observable one of over 100 mm in size and unobservable debris. In case of possible collision with the observed debris an avoidance manoeuvre is provided. The situation with unobservable debris is worse, its dimensions ranging from 100 mm to several microns. This debris is formed as a result of explosions of dead space objects and at collisions of destroyed spacecraft fragments against each other. This debris moves along arbitrary trajectories at different speeds.At collision of a spacecraft with fragments of small-size space debris, various consequences are possible: the device can immediately fail, suffer damages, which will have effect later and damages, which break no bones to the aircraft. Anyway, the spacecraft collision with small-size debris particles is undesirable. The protective shields are used to protect the aircraft from damage. Development of shield construction is complicated because the high cost of launch makes it impossible to conduct field tests of shields in space. All the work is carried out in the laboratory, with particles having co-impact speeds up to 10 km/s (possible speeds are up to 20 km/s and spherically shaped particles of 0.8 ... 3 mm in diameter.Various materials are used to manufacture shields. These are aluminum sheet, sandwich panels, metal mesh, metal foam, and woven materials (ballistic fabric. The paper considers single-layer (from sheet metal sandwich materials and multilayer shield designs. As experimental studies show, a single-layer shield protects colliding at speeds

Mineral-produced high-pressure striae and clay polish: Key evidence for nonballistic transport of ejecta from Ries crater

Science.gov (United States)

Chao, E.C.T.

1976-01-01

Recently discovered mineral-produced, deeply incised striae and mirror-like polish on broken surfaces of limestone fragments from the sedimentary ejecta of the Ries impact crater of southern Germany are described. The striae and polish were produced under high confining pressures during high-velocity nonballistic transport of the ejecta mass within the time span of the cratering event (measured in terms of seconds). The striae on these fragments were produced by scouring by small mineral grains embedded in the surrounding clay matrix, and the polish was formed under the same condition, by movements of relatively fragment-free clay against the fragment surfaces. The occurrence of these striae and polish is key evidence for estimating the distribution and determining the relative importance of nonballistic and ballistic transport of ejecta from the shallow Ries stony meteorite impact crater.

Reverse logistics in the construction industry.

Science.gov (United States)

Hosseini, M Reza; Rameezdeen, Raufdeen; Chileshe, Nicholas; Lehmann, Steffen

2015-06-01

Reverse logistics in construction refers to the movement of products and materials from salvaged buildings to a new construction site. While there is a plethora of studies looking at various aspects of the reverse logistics chain, there is no systematic review of literature on this important subject as applied to the construction industry. Therefore, the objective of this study is to integrate the fragmented body of knowledge on reverse logistics in construction, with the aim of promoting the concept among industry stakeholders and the wider construction community. Through a qualitative meta-analysis, the study synthesises the findings of previous studies and presents some actions needed by industry stakeholders to promote this concept within the real-life context. First, the trend of research and terminology related with reverse logistics is introduced. Second, it unearths the main advantages and barriers of reverse logistics in construction while providing some suggestions to harness the advantages and mitigate these barriers. Finally, it provides a future research direction based on the review. © The Author(s) 2015.

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

Physics-Based Fragment Acceleration Modeling for Pressurized Tank Burst Risk Assessments

Science.gov (United States)

Manning, Ted A.; Lawrence, Scott L.

2014-01-01

As part of comprehensive efforts to develop physics-based risk assessment techniques for space systems at NASA, coupled computational fluid and rigid body dynamic simulations were carried out to investigate the flow mechanisms that accelerate tank fragments in bursting pressurized vessels. Simulations of several configurations were compared to analyses based on the industry-standard Baker explosion model, and were used to formulate an improved version of the model. The standard model, which neglects an external fluid, was found to agree best with simulation results only in configurations where the internal-to-external pressure ratio is very high and fragment curvature is small. The improved model introduces terms that accommodate an external fluid and better account for variations based on circumferential fragment count. Physics-based analysis was critical in increasing the model's range of applicability. The improved tank burst model can be used to produce more accurate risk assessments of space vehicle failure modes that involve high-speed debris, such as exploding propellant tanks and bursting rocket engines.

On different experimental behaviour of fast secondary particles produced in 12C interactions at relativistic energies as studied with radiochemistry and in a propane chamber

International Nuclear Information System (INIS)

Kulakov, B.A.; Karachuk, J.; Gelovani, L.K.; Gridnev, T.G.; Sosnin, A.N.; Brandt, R.

1998-01-01

Energetic secondary fragments produced in the interaction of (41-44) GeV 12 C ions with copper exhibit experimentally a broader angular distribution as compared to energetic secondary fragments produced in the interactions at a lower 12 C-energy (15-25) GeV when studied with radiochemical techniques. Such a different experimental behaviour of secondary fragments produced by 12 C ions of the same two energy groups is not observed, when these secondary fragments are investigated with a propane bubble chamber. Separation of secondary particles is described

Measurement of a MMP-2 degraded Titin fragment in serum reflects changes in muscle turnover induced by atrophy

DEFF Research Database (Denmark)

Sun, S; Henriksen, K; Karsdal, M A

2014-01-01

used to assess biological and clinical relevance. RESULTS: A technically robust ELISA measuring the Titin fragment was developed against a Titin peptide fragment identified in human urine. The fragment was shown to be produced primarily by MMP-2 cleavage of Titin. In the rat muscle DEX induced atrophy...... model, Titin-MMP2 fragment was decreased in the beginning of DEX treatment, and then significantly increased later on during DEX administration. In the human bed rest study, the Titin-MMP2 fragment was initially decreased 11.9 (±3.7) % after 1day of bed rest, and then gradually increased ending up...... at a 16.4 (±4.6) % increase at day 47. CONCLUSIONS: We developed a robust ELISA measuring a muscle derived MMP-2 generated Titin degradation fragment in rat and human serum. Importantly, the fragment can be measured in serum and that these levels are related to induction of skeletal muscle atrophy....

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

An Analysis of the FY-1C, Iridium 33, and Cosmos 2251 Fragments

Science.gov (United States)

Liou, J.-C.

2014-01-01

The beginning of the year 2013 marks the sixth anniversary of the destruction of the Fengyun-1C (FY-1C) weather satellite as the result of an anti-satellite test conducted by China in January 2007 and the fourth anniversary of the accidental collision between Cosmos 2251 and the operational Iridium 33 in February 2009. These two events represent the worst satellite breakups in history. A total of 5579 fragments have been cataloged by the U.S. Space Surveillance Network (SSN), and almost 5000 of them were still in orbit in January 2013. In addition to these cataloged objects, hundreds of thousands (or more) of fragments down to the millimeter size regime were also generated during the breakups. These fragments are too small to be tracked by the SSN, but are large enough to be a safety concern for human space activities and robotic missions in low Earth orbit (LEO, the region below 2000 km altitude). Like their cataloged siblings, many of them remain in orbit today. These two breakup events dramatically changed the landscape of the orbital debris environment in LEO. The spatial density of the cataloged population in January 2013 is shown as the top blue curve. The combined FY-1C, Iridium 33, and Cosmos 2251 fragments (black curve) account for about 50 percent of the cataloged population below an altitude of 1000 km. They are also responsible for the concentrations at 770 km and 850 km, altitudes at which the collisions occurred. The effects of the FY-1C, Iridium 33, and Cosmos 2251 fragments will continue to be felt for decades to come. For example, approximately half of the generated FY-1C fragments will remain in orbit 20 years from now. In general, the Iridium 33 and Cosmos 2251 fragments will decay faster than the FY-1C fragments because of their lower altitudes. Of the Iridium 33 and Cosmos 2251 fragments, the former have much shorter orbital lifetimes than the latter, because lightweight composite materials were heavily used in the construction of the Iridium

Electron impact ionization of size selected hydrogen clusters (H2)N: ion fragment and neutral size distributions.

Science.gov (United States)

Kornilov, Oleg; Toennies, J Peter

2008-05-21

Clusters consisting of normal H2 molecules, produced in a free jet expansion, are size selected by diffraction from a transmission nanograting prior to electron impact ionization. For each neutral cluster (H2)(N) (N=2-40), the relative intensities of the ion fragments Hn+ are measured with a mass spectrometer. H3+ is found to be the most abundant fragment up to N=17. With a further increase in N, the abundances of H3+, H5+, H7+, and H9+ first increase and, after passing through a maximum, approach each other. At N=40, they are about the same and more than a factor of 2 and 3 larger than for H11+ and H13+, respectively. For a given neutral cluster size, the intensities of the ion fragments follow a Poisson distribution. The fragmentation probabilities are used to determine the neutral cluster size distribution produced in the expansion at a source temperature of 30.1 K and a source pressure of 1.50 bar. The distribution shows no clear evidence of a magic number N=13 as predicted by theory and found in experiments with pure para-H2 clusters. The ion fragment distributions are also used to extract information on the internal energy distribution of the H3+ ions produced in the reaction H2+ + H2-->H3+ +H, which is initiated upon ionization of the cluster. The internal energy is assumed to be rapidly equilibrated and to determine the number of molecules subsequently evaporated. The internal energy distribution found in this way is in good agreement with data obtained in an earlier independent merged beam scattering experiment.

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

Science.gov (United States)

Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

2017-08-01

Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

Science.gov (United States)

Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

2016-04-01

Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Unusual behavior of projectile fragments formed in the bombardment of copper with relativistic Ar ions

International Nuclear Information System (INIS)

Dersch, G.; Beckmann, R.; Feige, G.

1985-01-01

The interaction properties of projectile fragments from the fragmentation of 0.9 GeV/nucleon and 1.8 GeV/nucleon 40 Ar with Cu have been studied using radioactivation techniques. In this experiment, two identical copper blocks, 1 cm thick and 8 cm in diameter, are irradiated by relativistic projectiles in different configurations. In configuration 0, the blocks are touching while in configuration 10 or 20, the blocks are separated by 10 or 20 cm of air, respectively. It is assumed that when the relativistic projectiles interact with the first block of each pair, projectile fragments are created which interact with other nuclei in the first and second blocks. What is measured is the ratio of some target fragment activity, such as 24 Na or 28 Mg, produced in the second block relative to the first block, R

Status and Perspectives of the INFN-LNS In-Flight Fragment Separator

Science.gov (United States)

Russotto, P.; Calabretta, L.; Cardella, G.; Cosentino, G.; De Filippo, E.; Gnoffo, B.; La Cognata, M.; Martorana, N. S.; Pagano, E. V.; Pizzone, R. G.; Quattrocchi, L.; Romano, S.; Russo, A. D.; Santonocito, D.

2018-05-01

In the last 15 years the FRIBs@LNS facility has successfully produced Radioactive Ion Beams using the In-Flight technique. We report on the current status and future perspectives opened by FRAISE, a new fragment separator that will be build in connection with the upgrade of Superconducting Cyclotron of the INFN-LNS laboratories.

An experimental comparative study of radiography, ultrasonography and CT imaging in the IV catheter fragment

International Nuclear Information System (INIS)

Kweon, Dae Cheol

2016-01-01

The objective of this study was to detect the fragments generated during IV (intravenous) catheter injection of contrast medium and drug administration in a clinical setting and removal was performed by experimentally producing a phantom, and to compare the radiography, ultrasonography, and multi-detector computed tomography (MDCT) imaging and radiation dose. A 1 cm fragment of an 18 gage Teflon® IV catheter with saline was inserted into the IV control line. Radiography, CT, and ultrasonography were performed and radiography and CT dose were calculated. CT and ultrasonography showed an IV catheter fragment clinically and radiography showed no visible difference in the ability to provide a useful image of an IV catheter fragment modality (p >.05). Radiography of effective dose (0.2139 mSv·Gy-1·cm-2) form DAP DAP (0.93 μGy·m2 ), and dose length product (DLP) (201 mGy·cm) to effective dose was calculated as 0.483 mSv. IV catheter fragment were detected of radiography, ultrasonography and CT. These results can be obtained by menas of an excellent IV catheter fragment of detection capability CT. However, CT is followed by radiation exposure. IV catheter fragment confirming the position and information recommend an ultrasonography

Identification of special fragments containing the 5' end of polivirus RNA after ribonuclease III digestion

Energy Technology Data Exchange (ETDEWEB)

Harris, T.J.R.; Dunn, J.J.; Wimmer, E.

1978-11-01

The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.

Strong and nonlinear effects of fragmentation on ecosystem service provision at multiple scales

Science.gov (United States)

Mitchell, Matthew G. E.; Bennett, Elena M.; Gonzalez, Andrew

2015-09-01

Human actions, such as converting natural land cover to agricultural or urban land, result in the loss and fragmentation of natural habitat, with important consequences for the provision of ecosystem services. Such habitat loss is especially important for services that are supplied by fragments of natural land cover and that depend on flows of organisms, matter, or people across the landscape to produce benefits, such as pollination, pest regulation, recreation and cultural services. However, our quantitative knowledge about precisely how different patterns of landscape fragmentation might affect the provision of these types of services is limited. We used a simple, spatially explicit model to evaluate the potential impact of natural land cover loss and fragmentation on the provision of hypothetical ecosystem services. Based on current literature, we assumed that fragments of natural land cover provide ecosystem services to the area surrounding them in a distance-dependent manner such that ecosystem service flow depended on proximity to fragments. We modeled seven different patterns of natural land cover loss across landscapes that varied in the overall level of landscape fragmentation. Our model predicts that natural land cover loss will have strong and unimodal effects on ecosystem service provision, with clear thresholds indicating rapid loss of service provision beyond critical levels of natural land cover loss. It also predicts the presence of a tradeoff between maximizing ecosystem service provision and conserving natural land cover, and a mismatch between ecosystem service provision at landscape versus finer spatial scales. Importantly, the pattern of landscape fragmentation mitigated or intensified these tradeoffs and mismatches. Our model suggests that managing patterns of natural land cover loss and fragmentation could help influence the provision of multiple ecosystem services and manage tradeoffs and synergies between services across different human

Cultivation of Pichia pastoris carrying the scFv anti LDL (- antibody fragment. Effect of preculture carbon source

Directory of Open Access Journals (Sweden)

Cesar Andres Diaz Arias

Full Text Available Abstract Antibodies and antibody fragments are nowadays among the most important biotechnological products, and Pichia pastoris is one of the most important vectors to produce them as well as other recombinant proteins. The conditions to effectively cultivate a P. pastoris strain previously genetically modified to produce the single-chain variable fragment anti low density lipoprotein (- under the control of the alcohol oxidase promoter have been investigated in this study. In particular, it was evaluated if, and eventually how, the carbon source (glucose or glycerol used in the preculture preceding cryopreservation in 20% glycerol influences both cell and antibody fragment productions either in flasks or in bioreactor. Although in flasks the volumetric productivity of the antibody fragment secreted by cells precultured, cryopreserved and reactivated in glycerol was 42.9% higher compared with cells precultured in glucose, the use of glycerol in bioreactor led to a remarkable shortening of the lag phase, thereby increasing it by no less than thrice compared to flasks. These results are quite promising in comparison with those reported in the literature for possible future industrial applications of this cultivation, taking into account that the overall process time was reduced by around 8 h.

Formation and fragmentation of protostellar dense cores

International Nuclear Information System (INIS)

Maury, Anaelle

2009-01-01

Stars form in molecular clouds, when they collapse and fragment to produce protostellar dense cores. These dense cores are then likely to contract under their own gravity, and form young protostars, that further evolve while accreting their circumstellar mass, until they reach the main sequence. The main goal of this thesis was to study the formation and fragmentation of protostellar dense cores. To do so, two main studies, described in this manuscript, were carried out. First, we studied the formation of protostellar cores by quantifying the impact of protostellar outflows on clustered star formation. We carried out a study of the protostellar outflows powered by the young stellar objects currently formed in the NGc 2264-C proto-cluster, and we show that protostellar outflows seem to play a crucial role as turbulence progenitors in clustered star forming regions, although they seem unlikely to significantly modify the global infall processes at work on clump scales. Second, we investigated the formation of multiple systems by core fragmentation, by using high - resolution observations that allow to probe the multiplicity of young protostars on small scales. Our results suggest that the multiplicity rate of protostars on small scales increase while they evolve, and thus favor dynamical scenarios for the formation of multiple systems. Moreover, our results favor magnetized scenarios of core collapse to explain the small-scale properties of protostars at the earliest stages. (author) [fr

In situ fragmentation and rock particle sorting on arid hills

Science.gov (United States)

McGrath, Gavan S.; Nie, Zhengyao; Dyskin, Arcady; Byrd, Tia; Jenner, Rowan; Holbeche, Georgina; Hinz, Christoph

2013-03-01

Transport processes are often proposed to explain the sorting of rock particles on arid hillslopes, where mean rock particle size often decreases in the downslope direction. Here we show that in situ fragmentation of rock particles can also produce similar patterns. A total of 93,414 rock particles were digitized from 880 photographs of the surface of three mesa hills in the Great Sandy Desert, Australia. Rock particles were characterized by the projected Feret's diameter and circularity. Distance from the duricrust cap was found to be a more robust explanatory variable for diameter than the local hillslope gradient. Mean diameter decreased exponentially downslope, while the fractional area covered by rock particles decreased linearly. Rock particle diameters were distributed lognormally, with both the location and scale parameters decreasing approximately linearly downslope. Rock particle circularity distributions showed little change; only a slight shift in the mode to more circular particles was noted to occur downslope. A dynamic fragmentation model was used to assess whether in situ weathering alone could reproduce the observed downslope fining of diameters. Modeled and observed size distributions agreed well and both displayed a preferential loss of relatively large rock particles and an apparent approach to a terminal size distribution of the rocks downslope. We show this is consistent with a size effect in material strength, where large rocks are more susceptible to fatigue failure under stress than smaller rocks. In situ fragmentation therefore produces qualitatively similar patterns to those that would be expected to arise from selective transport.

Truncated borrelidin analogues: synthesis by sequential cross metathesis/olefination for the southern fragment and biological evaluation.

Science.gov (United States)

Gündemir-Durmaz, Tülay; Schmid, Fabian; El Baz, Yana; Häusser, Annette; Schneider, Carmen; Bilitewski, Ursula; Rauhut, Guntram; Garnier, Delphine; Baro, Angelika; Laschat, Sabine

2016-09-21

The construction of novel borrelidin analogues is reported in which the northern fragment is truncated to a simple hydroxyundecanecarboxylate and the original cyclopentanecarboxylic acid in the southern fragment is replaced with different six-membered rings. The required precursors were prepared by cross metathesis of the appropriate carbocycle-based homoallylic alcohol with crotonaldehyde followed by HWE olefination of the resulting enal with bromocyanophosphonate. The key aldehyde for intramolecular cross coupling was accessible by oxidation of the hydroxy group of the linked undecanecarboxylate unit. Grignard mediated macrocyclization finally yielded the borrelidin related products. The investigation is complemented by SAR studies and quantum-chemical calculations.

Systematic experimental survey on projectile fragmentation and fission induced in collisions of 238U at 1 A GeV with lead

International Nuclear Information System (INIS)

Enqvist, T.; Benlliure, J.; Farget, F.; Schmidt, K.H.; Armbruster, P.; Bernas, M.; Tassan-Got, L.; Boeckstiegel, C.; Jong, M. de; Dufour, J.P.

1999-03-01

Projectile fragmentation and fission, induced in collisions of 238 U at 1 A GeV with lead, have systematically been studied. A complete survey on the isotopic production cross sections of all elements between vanadium (Z = 23) and rhenium (Z = 75) down to a cross section of 0.1 mb is given. About 600 isotopes produced in fragmentation and about 600 isotopes produced in fission were identified in the GSI fragment separator FRS from magnetic rigidities, time-of-flight values, and the energy loss in an ionisation chamber. In addition, the velocity distributions of all these reaction products have been mapped, and the products are unambiguously attributed to the different reaction mechanisms due to their kinematical properties. The results are compared with empirical systematics and previous data. The velocity of the fragments obtained in the fission process by the Coulomb repulsion allows to reconstruct the TKE-value of the break-up and to identify the atomic number of the fissioning nucleus in hot fission. The mean velocities of light projectile fragments were found to be higher than the beam velocity. (orig.)

Knockout and fragmentation reactions using a broad range of tin isotopes

Science.gov (United States)

Rodríguez-Sánchez, J. L.; Benlliure, J.; Bertulani, C. A.; Vargas, J.; Ayyad, Y.; Alvarez-Pol, H.; Atkinson, J.; Aumann, T.; Beceiro-Novo, S.; Boretzky, K.; Caamaño, M.; Casarejos, E.; Cortina-Gil, D.; Díaz-Cortes, J.; Fernández, P. Díaz; Estrade, A.; Geissel, H.; Kelić-Heil, A.; Litvinov, Yu. A.; Mostazo, M.; Paradela, C.; Pérez-Loureiro, D.; Pietri, S.; Prochazka, A.; Takechi, M.; Weick, H.; Winfield, J. S.

2017-09-01

Production cross sections of residual nuclei obtained by knockout and fragmentation reactions of different tin isotopes accelerated at 1 A GeV have been measured with the fragment separator (FRS) at GSI, Darmstadt. The new measurements are used to investigate the neutron-excess dependence of the neutron- and proton-knockout cross sections. These cross sections are compared to Glauber model calculations coupled to a nuclear de-excitation code in order to investigate the role of the remnant excitations. This bench marking shows an overestimation of the cross sections for the removal of deeply bound nucleons. A phenomenological increase in the excitation energy induced in the remnants produced in these cases allows us to reproduce the measured cross sections.

Fragmentation of C2H4 by charge-changing collisions of O2+ ions

International Nuclear Information System (INIS)

Sato, S.; Mizuno, T.; Yamada, T.; Imai, M.; Shibata, H.; Itoh, A.; Tsuchida, H.

2009-01-01

We investigated molecular fragmentation of C 2 H 4 in charge-changing collisions of 1.14MeV O 2+ ions. Branching ratios associated with decaying from temporary produced (C 2 H 4 ) r+ ions into various fragment channels were obtained. Dissociation via a C-C bond breaking is preferential in 1-electron loss collisions in comparison with 1-electron capture collisions. We confirmed that multiple ionization and dissociation rarely occur in electron capture collisions, while they occur rather strongly in electron loss collisions. (author)

Fragmentation of atomic clusters: A theoretical study

International Nuclear Information System (INIS)

Lopez, M.J.; Jellinek, J.

1994-01-01

Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

Mass distribution of fission-like fragments formed in 20Ne + 165Ho system at Elab≈ 8.2 MeV/A

International Nuclear Information System (INIS)

Singh, D.; Linda, Sneha Bharti; Giri, Pankaj K.

2017-01-01

In the present work, an attempt has been made to study CFF and IFF in 20 Ne + 165 Ho system at projectile energy ≈ 8.2 MeV/A. Twelve fission like fragments (FLF) produced through complete fusion-fission (CFF) and/or incomplete fusion-fission (IFF) in the present system have been identified. The production cross-sections of identified fission like fragments have been measured and the mass distribution of fission like fragments studied

A Fragment-Cloud Model for Breakup of Asteroids with Varied Internal Structures

Science.gov (United States)

Wheeler, Lorien; Mathias, Donovan; Stokan, Ed; Brown, Peter

2016-01-01

As an asteroid descends toward Earth, it deposits energy in the atmosphere through aerodynamic drag and ablation. Asteroid impact risk assessments rely on energy deposition estimates to predict blast overpressures and ground damage that may result from an airburst, such as the one that occurred over Chelyabinsk, Russia in 2013. The rates and altitudes at which energy is deposited along the entry trajectory depend upon how the bolide fragments, which in turn depends upon its internal structure and composition. In this work, we have developed an analytic asteroid fragmentation model to assess the atmospheric energy deposition of asteroids with a range of structures and compositions. The modeling approach combines successive fragmentation of larger independent pieces with aggregate debris clouds released with each fragmentation event. The model can vary the number and masses of fragments produced, the amount of mass released as debris clouds, the size-strength scaling used to increase the robustness of smaller fragments, and other parameters. The initial asteroid body can be seeded with a distribution of independent fragment sizes amid a remaining debris mass to represent loose rubble pile conglomerations, can be given an outer regolith later, or can be defined as a coherent or fractured monolith. This approach enables the model to represent a range of breakup behaviors and reproduce detailed energy deposition features such as multiple flares due to successive burst events, high-altitude regolith blow-off, or initial disruption of rubble piles followed by more energetic breakup of the constituent boulders. These capabilities provide a means to investigate sensitivities of ground damage to potential variations in asteroid structure.

Gold-Catalyzed Enantio- and Diastereoselective Syntheses of Left Fragments of Azadirachtin/Meliacarpin-Type Limonoids.

Science.gov (United States)

Shi, Hang; Tan, Ceheng; Zhang, Weibin; Zhang, Zichun; Long, Rong; Gong, Jianxian; Luo, Tuoping; Yang, Zhen

2016-02-05

Meliacarpin-type limonoids are an important class of organic insecticides. Their syntheses are challenging due to their chemical complexity. Here, we report the highly enantio- and diastereoselective synthesis of the left fragments of azadirachtin I and 1-cinnamoylmelianolone, being two important family members of meliacarpin-type limonoids, via pairwise palladium- and gold-catalyzed cascade reactions. Gold-catalyzed reactions of 1,7-diynes were performed as model studies, and the efficient construction of tetracyclic late-stage intermediates was achieved on the basis of this key transformation. Our unique route gave both of the left fragments in 23 steps from the commercially available chiral starting material (-)-carvone. This study significantly advances research on the synthesis of the meliacarpin-type limonoids.

Humidity Effects on Fragmentation in Plasma-Based Ambient Ionization Sources.

Science.gov (United States)

Newsome, G Asher; Ackerman, Luke K; Johnson, Kevin J

2016-01-01

Post-plasma ambient desorption/ionization (ADI) sources are fundamentally dependent on surrounding water vapor to produce protonated analyte ions. There are two reports of humidity effects on ADI spectra. However, it is unclear whether humidity will affect all ADI sources and analytes, and by what mechanism humidity affects spectra. Flowing atmospheric pressure afterglow (FAPA) ionization and direct analysis in real time (DART) mass spectra of various surface-deposited and gas-phase analytes were acquired at ambient temperature and pressure across a range of observed humidity values. A controlled humidity enclosure around the ion source and mass spectrometer inlet was used to create programmed humidity and temperatures. The relative abundance and fragmentation of molecular adduct ions for several compounds consistently varied with changing ambient humidity and also were controlled with the humidity enclosure. For several compounds, increasing humidity decreased protonated molecule and other molecular adduct ion fragmentation in both FAPA and DART spectra. For others, humidity increased fragment ion ratios. The effects of humidity on molecular adduct ion fragmentation were caused by changes in the relative abundances of different reagent protonated water clusters and, thus, a change in the average difference in proton affinity between an analyte and the population of water clusters. Control of humidity in ambient post-plasma ion sources is needed to create spectral stability and reproducibility.

Construction and identification of subtracted cDNA library in bone marrow cells of radon-exposed mice

International Nuclear Information System (INIS)

Li Jianxiang; Nie Jihua; Tong Jian; Fu Chunling; Zhou Jianwei

2008-01-01

Objective: To construct and identify subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation. Methods: Adult male BALB/c mice, weighing 18-22 g, were placed in a multi- functional radon chamber. One group of mice was exposed to radon up to the accumulative dose of 105 work level month (WLM). The control group of mice was housed in a room with an accumulative dose of 1 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the SMART technique and the suppression subtractive hybridization were performed. The obtained forward and reverse cDNA fragments were directly inserted into pMD18-T vector and transformed into E. coli JM109. The inserting cDNA fragments were screened by the blue-and-white blot screening and nested PCR of bacterium liquid. Results: The 244 of 285 white bacteria clones obtained randomly were positive clones contained 100-1100 bp inserted cDNA fragments. Conclusions: The forward and reverse subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation is successfully constructed. (authors)

Analysis of proteolytic processes and enzymatic activities in the generation of huntingtin n-terminal fragments in an HEK293 cell model.

Directory of Open Access Journals (Sweden)

Andrew T N Tebbenkamp

Full Text Available N-terminal fragments of mutant huntingtin (htt that terminate between residues 90-115, termed cleavage product A or 1 (cp-A/1, form intracellular and intranuclear inclusion bodies in the brains of patients with Huntington's disease (HD. These fragments appear to be proteolytic products of the full-length protein. Here, we use an HEK293 cell culture model to investigate huntingtin proteolytic processing; previous studies of these cells have demonstrated cleavage of htt to cp-A/1 like htt fragments.Recombinant N-terminal htt fragments, terminating at residue 171 (also referred to as cp-B/2 like, were efficiently cleaved to produce cp-A/1 whereas fragments representing endogenous caspase, calpain, and metalloproteinase cleavage products, terminating between residues 400-600, were inefficiently cleaved. Using cysteine-labeling techniques and antibody binding mapping, we localized the C-terminus of the cp-A/1 fragments produced by HEK293 cells to sequences minimally limited by cysteine 105 and an antibody epitope composed of residues 115-124. A combination of genetic and pharmacologic approaches to inhibit potential proteases, including γ-secretase and calpain, proved ineffective in preventing production of cp-A/1.Our findings indicate that HEK293 cells express a protease that is capable of efficiently cleaving cp-B/2 like fragments of htt with normal or expanded glutamine repeats. For reasons that remain unclear, this protease cleaves longer htt fragments, with normal or expanded glutamine expansions, much less efficiently. The protease in HEK293 cells that is capable of generating a cp-A/1 like htt fragment may be a novel protease with a high preference for a cp-B/2-like htt fragment as substrate.

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Plasma wake and nuclear forces on fragmented H+ transport

International Nuclear Information System (INIS)

Barriga-Carrasco, Manuel D; Deutsch, Claude

2006-01-01

The objective of the present work is to study the target electronic and nuclear interactions produced when a H + ion traverses classical plasma matter. Electronic interactions are treated by means of the dielectric formalism while nuclear interactions are dealt within the classical dispersion theory through a Monte Carlo computer code. The interactions through plasma electronic medium among close ions are called wake forces. We checked that these forces screen the Coulomb explosions of the two fragmented protons from the same H + ion decreasing their relative distance in the analysed cases. These forces align the interproton vector along the motion direction. They also tend the two-proton energy loss to the value of two isolated protons when at early times it is rather larger. Nevertheless most parts of these wake effects cannot be corroborated experimentally as they are masked by the projectile collisions with target nuclei in our numerical experiment. These collisions cancel the screening produced by the wake forces, increasing the interproton distance even faster than for bare Coulomb explosion. Also they misalign the interproton vector along the motion direction and contribute moderately to increase the energy loss of the fragmented H + ion. These nuclear collisions effects are more significant in reducing projectile velocity

Heavy quarks fragmentation in charmed mesons in DELPHI experiment at LEP

International Nuclear Information System (INIS)

Levy, J.M.

1994-04-01

With the big statistics expected at LEP, the electroweak sector of the Standard Model can be tested as well as the theory of strong interactions. Quantum Chromo-Dynamics is indeed predictive for quarks properties, but does not explain how quarks fragment into hadrons. So far the hadronization can only be described with phenomenological models. The work presented in this thesis was performed on the DELPHI experiment at LEP and concerns the production and the fragmentation of heavy quarks into charmed mesons D , D* and D**. With the whole statistics of 1991 and 1992 (1 013 300 hadronic decays of the Z), more than 4500 charmed mesons decays have been reconstructed in the channels D 0 → K - π + , D + → K - π + π+ and D * +→ D 0 π + followed by D 0 → K - π + . Using also 1993 data and the channel D 0 → K - π + π + π - , evidence for D** production is presented. For the first time, the production rate is measured for each D meson separately for cc and bb contributions. In fact, D mesons can be produced either directly from the fragmentation of c quark or un-directly from the fragmentation of b quark into B mesons which decay into D mesons. (authors). 120 refs

Experimental constraints on dynamic fragmentation as a dissipative process during seismic slip.

Science.gov (United States)

Barber, Troy; Griffith, W Ashley

2017-09-28

Various fault damage fabrics, from gouge in the principal slip zone to fragmented and pulverized rocks in the fault damage zone, have been attributed to brittle deformation at high strain rates during earthquake rupture. Past experimental work has shown that there exists a critical threshold in stress-strain rate space through which rock failure transitions from failure along a few discrete fracture planes to intense fragmentation. We present new experimental results on Arkansas Novaculite (AN) and Westerly Granite (WG) in which we quantify fracture surface area produced by dynamic fragmentation under uniaxial compressive loading and examine the controls of pre-existing mineral anisotropy on dissipative processes at the microscale. Tests on AN produced substantially greater new fracture surface area (approx. 6.0 m 2  g -1 ) than those on WG (0.07 m 2  g -1 ). Estimates of the portion of energy dissipated into brittle fracture were significant for WG (approx. 5%), but appeared substantial in AN (10% to as much as 40%). The results have important implications for the partitioning of dissipated energy under extreme loading conditions expected during earthquakes and the scaling of high-speed laboratory rock mechanics experiments to natural fault zones.This article is part of the themed issue 'Faulting, friction and weakening: from slow to fast motion'. © 2017 The Author(s).

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

[Reconstruction of long polynucleotide sequences from fragments using the Iskra-226 personal computer

Science.gov (United States)

Kostetskiĭ, P V; Dobrova, I E

1988-04-01

An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

Recent progress on perturbative QCD fragmentation functions

International Nuclear Information System (INIS)

Cheung, K.

1995-05-01

The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

CALCULATION OF FRAGMENTATION FUNCTIONS IN TWO-HADRON SEMI-INCLUSIVE PROCESSES

International Nuclear Information System (INIS)

BIANCONI, A.; BOFFI, S.; BOER, D.; JAKOB, R.; RADICI, M.

2001-01-01

We investigate the properties of interference fragmentation functions arising from the emission of two leading hadrons inside the same jet for inclusive lepton-nucleon deep inelastic scattering. Using an extended spectator model for the mechanism of the hadronization, we give a complete calculation and numerical estimates for the examples of a proton-pion pair produced with invariant mass on the Roper resonance, and of two pions produced with invariant mass close to the ρ mass. We discuss azimuthal angular dependence of the leading order cross section to point up favourable conditions for extracting transversity from experimental data

Fragmentation and flow in central collisions

International Nuclear Information System (INIS)

Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

1987-01-01

Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

Science.gov (United States)

David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

2010-01-01

Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

ASSESSMENT OF SURFACE QUALITY FOR CHOSEN MILLING STRATEGIES WHEN PRODUCING RELIEF SURFACES

OpenAIRE

Jan Varga; Jozef Stahovec; Jozef Beno; Marek Vrabeľ

2014-01-01

The paper deals with design and modeling of the relief surfaces that are produced in milling. Modeled and real surface quality is presented for the chosen fragments of the relief surfaces. Fragmentation of the relief surfaces has been made by the surface sampling. Milling strategies are compared with regard to surface formation. Surface quality was checked with regard to applied cutting conditions.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

Heavy-residue isoscaling as a probe of the symmetry energy of hot fragments

International Nuclear Information System (INIS)

Souliotis, G.A.; Shetty, D.V.; Keksis, A.; Bell, E.; Jandel, M.; Veselsky, M.; Yennello, S.J.

2006-01-01

The isoscaling properties of isotopically resolved projectile residues from peripheral collisions of 86 Kr (25 MeV/nucleon) 64 Ni (25 MeV/nucleon), and 136 Xe (20 MeV/nucleon) beams on various target pairs are employed to probe the symmetry energy coefficient of the nuclear binding energy. The present study focuses on heavy projectile fragments produced in peripheral and semiperipheral collisions near the onset of multifragment emission (E * /A=2-3 MeV). For these fragments, the measured average velocities are used to extract excitation energies. The excitation energies, in turn, are used to estimate the temperatures of the fragmenting quasiprojectiles in the framework the Fermi gas model. The isoscaling analysis of the fragment yields provided the isoscaling parameters α that, in combination with temperatures and isospin asymmetries provided the symmetry energy coefficient of the nuclear binding energy of the hot fragmenting quasiprojectiles. The extracted values of the symmetry energy coefficient at this excitation energy range (2-3 MeV/nucleon) are lower than the typical liquid-drop model value ∼25 MeV corresponding to ground-state nuclei and show a monotonic decrease with increasing excitation energy. This result is of importance in the formation of hot nuclei in heavy-ion reactions and in hot stellar environments such as supernova

Polarization, motion, and fragmentation. Exploring the role of quarks in the nucleon through semi-inclusive longitudinal spin asymmetries at HERMES

International Nuclear Information System (INIS)

Rubin, Joshua George

2009-11-01

The motivation for this work was to improve upon prior analyses that extracted the quark helicity distributions, Δ(x), of the proton. Chapter 4 contains several new double-spin asymmetries which are results in their own right. The ph? dependence is plotted for the first time with HERMES data which is uniquely hadron separated. The hadron charge difference asymmetry is presented which, in combination with the quark helicity densities can put limits on fragmentation symmetry breaking in semi-inclusive DIS. Additionally, a novel method of unfolding yields (reducing smearing effects from detector resolution limitations and QED radiation) was developed and presented here for the first time which potentially allows new kinds of asymmetries to be constructed which were unavailable before. Also, this chapter describes the method by which the first ever three dimensionally binned SIDIS double-spin asymmetries were produced. These asymmetries, which will be used as the data inputs for the Δ(x) extraction, are valuable inputs to world fits being performed by theorists. Chapter 5 further explores this idea of fragmentation symmetry breaking with Monte Carlo studies of fragmentation functions. These studies test assumptions which are frequently made in the interpretation of asymmetries like the hadron charge difference of the prior chapter and suggest that these assumptions should be approached with some caution. Also, a technique for tuning and more importantly propagating systematic uncertainty through non-analytic Monte Carlo models, like the Lund-String model which provides an essential input to the Δ(x) extraction, is developed (orig.)

Polarization, motion, and fragmentation. Exploring the role of quarks in the nucleon through semi-inclusive longitudinal spin asymmetries at HERMES

Energy Technology Data Exchange (ETDEWEB)

Rubin, Joshua George

2009-11-15

The motivation for this work was to improve upon prior analyses that extracted the quark helicity distributions, {delta}(x), of the proton. Chapter 4 contains several new double-spin asymmetries which are results in their own right. The ph? dependence is plotted for the first time with HERMES data which is uniquely hadron separated. The hadron charge difference asymmetry is presented which, in combination with the quark helicity densities can put limits on fragmentation symmetry breaking in semi-inclusive DIS. Additionally, a novel method of unfolding yields (reducing smearing effects from detector resolution limitations and QED radiation) was developed and presented here for the first time which potentially allows new kinds of asymmetries to be constructed which were unavailable before. Also, this chapter describes the method by which the first ever three dimensionally binned SIDIS double-spin asymmetries were produced. These asymmetries, which will be used as the data inputs for the {delta}(x) extraction, are valuable inputs to world fits being performed by theorists. Chapter 5 further explores this idea of fragmentation symmetry breaking with Monte Carlo studies of fragmentation functions. These studies test assumptions which are frequently made in the interpretation of asymmetries like the hadron charge difference of the prior chapter and suggest that these assumptions should be approached with some caution. Also, a technique for tuning and more importantly propagating systematic uncertainty through non-analytic Monte Carlo models, like the Lund-String model which provides an essential input to the {delta}(x) extraction, is developed (orig.)

The power to detect recent fragmentation events using genetic differentiation methods.

Directory of Open Access Journals (Sweden)

Michael W Lloyd

Full Text Available Habitat loss and fragmentation are imminent threats to biological diversity worldwide and thus are fundamental issues in conservation biology. Increased isolation alone has been implicated as a driver of negative impacts in populations associated with fragmented landscapes. Genetic monitoring and the use of measures of genetic divergence have been proposed as means to detect changes in landscape connectivity. Our goal was to evaluate the sensitivity of Wright's F st, Hedrick' G'st , Sherwin's MI, and Jost's D to recent fragmentation events across a range of population sizes and sampling regimes. We constructed an individual-based model, which used a factorial design to compare effects of varying population size, presence or absence of overlapping generations, and presence or absence of population sub-structuring. Increases in population size, overlapping generations, and population sub-structuring each reduced F st, G'st , MI, and D. The signal of fragmentation was detected within two generations for all metrics. However, the magnitude of the change in each was small in all cases, and when N e was >100 individuals it was extremely small. Multi-generational sampling and population estimates are required to differentiate the signal of background divergence from changes in Fst , G'st , MI, and D associated with fragmentation. Finally, the window during which rapid change in Fst , G'st , MI, and D between generations occurs can be small, and if missed would lead to inconclusive results. For these reasons, use of F st, G'st , MI, or D for detecting and monitoring changes in connectivity is likely to prove difficult in real-world scenarios. We advocate use of genetic monitoring only in conjunction with estimates of actual movement among patches such that one could compare current movement with the genetic signature of past movement to determine there has been a change.

[Construction of enterohemorrhagic Escherichia coli O157:H7 strains with espF gene deletion and complementation].

Science.gov (United States)

Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong

2015-11-01

To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.

Construction and Characterization of an Escherichia coli Mutant Producing Kdo2-Lipid A

Directory of Open Access Journals (Sweden)

Jianli Wang

2014-03-01

Full Text Available 3-deoxy-d-manno-oct-2-ulosonic acid (Kdo2-lipid A is the conserved structure domain of lipopolysaccharide found in most Gram-negative bacteria, and it is believed to stimulate the innate immune system through the TLR4/MD2 complex. Therefore, Kdo2-lipid A is an important stimulator for studying the mechanism of the innate immune system and for developing bacterial vaccine adjuvants. Kdo2-lipid A has not been chemically synthesized to date and could only be isolated from an Escherichia coli mutant strain, WBB06. WBB06 cells grow slowly and have to grow in the presence of tetracycline. In this study, a novel E. coli mutant strain, WJW00, that could synthesize Kdo2-lipid A was constructed by deleting the rfaD gene from the genome of E. coli W3110. The rfaD gene encodes ADP-l-glycero-d-manno-heptose-6-epimerase RfaD. Based on the analysis by SDS-PAGE, thin layer chromatography (TLC and electrospray ionization mass spectrometry (ESI/MS, WJW00 could produce similar levels of Kdo2-lipid A to WBB06. WJW00 cells grow much better than WBB06 cells and do not need to add any antibiotics during growth. Compared with the wild-type strain, W3110, WJW00 showed increased hydrophobicity, higher cell permeability, greater autoaggregation and decreased biofilm-forming ability. Therefore, WJW00 could be a more suitable strain than WBB06 for producing Kdo2-lipid A and a good base strain for developing lipid A adjuvants.

An index-based framework for assessing patterns and trends in river fragmentation and flow regulation by global dams at multiple scales

International Nuclear Information System (INIS)

Grill, Günther; Lehner, Bernhard; Lumsdon, Alexander E; Zarfl, Christiane; MacDonald, Graham K; Reidy Liermann, Catherine

2015-01-01

The global number of dam constructions has increased dramatically over the past six decades and is forecast to continue to rise, particularly in less industrialized regions. Identifying development pathways that can deliver the benefits of new infrastructure while also maintaining healthy and productive river systems is a great challenge that requires understanding the multifaceted impacts of dams at a range of scales. New approaches and advanced methodologies are needed to improve predictions of how future dam construction will affect biodiversity, ecosystem functioning, and fluvial geomorphology worldwide, helping to frame a global strategy to achieve sustainable dam development. Here, we respond to this need by applying a graph-based river routing model to simultaneously assess flow regulation and fragmentation by dams at multiple scales using data at high spatial resolution. We calculated the cumulative impact of a set of 6374 large existing dams and 3377 planned or proposed dams on river connectivity and river flow at basin and subbasin scales by fusing two novel indicators to create a holistic dam impact matrix for the period 1930–2030. Static network descriptors such as basin area or channel length are of limited use in hierarchically nested and dynamic river systems, so we developed the river fragmentation index and the river regulation index, which are based on river volume. These indicators are less sensitive to the effects of network configuration, offering increased comparability among studies with disparate hydrographies as well as across scales. Our results indicate that, on a global basis, 48% of river volume is moderately to severely impacted by either flow regulation, fragmentation, or both. Assuming completion of all dams planned and under construction in our future scenario, this number would nearly double to 93%, largely due to major dam construction in the Amazon Basin. We provide evidence for the importance of considering small to medium

Fragmentation functions of polarized heavy quarkonium

International Nuclear Information System (INIS)

Ma, Yan-Qing; Qiu, Jian-Wei; Zhang, Hong

2015-01-01

Investigating the production of polarized heavy quarkonia in terms of recently proposed QCD factorization formalism requires the knowledge of a large number of input fragmentation functions (FFs) from a single parton or a heavy quark-antiquark pair to a polarized heavy quarkonium. We study these universal FFs at the input factorization scale μ 0 ≳2m Q , with heavy quark mass m Q , in the framework of nonrelativistic QCD (NRQCD) factorization. We express these FFs in terms of perturbatively calculable coefficients for producing a heavy quark-antiquark pair in all possible NRQCD states, multiplied by corresponding NRQCD long-distance matrix elements for the pair to transmute into a polarized heavy quarkonium. We derive all relevant NRQCD operators for the long-distance matrix elements based on symmetries, and introduce a self-consistent scheme to define them in arbitrary d-dimensions. We compute, up to the first non-trivial order in α s , the perturbative coefficients for producing a heavy quark pair in all possible S-wave and P-wave NRQCD states. We also discuss the role of the polarized FFs in generating QCD predictions for the polarization of J/ψ produced at collider energies.

In Vitro Magnetic Resonance Imaging Evaluation of Fragmented, Open-Coil, Percutaneous Peripheral Nerve Stimulation Leads.

Science.gov (United States)

Shellock, Frank G; Zare, Armaan; Ilfeld, Brian M; Chae, John; Strother, Robert B

2018-04-01

Percutaneous peripheral nerve stimulation (PNS) is an FDA-cleared pain treatment. Occasionally, fragments of the lead (MicroLead, SPR Therapeutics, LLC, Cleveland, OH, USA) may be retained following lead removal. Since the lead is metallic, there are associated magnetic resonance imaging (MRI) risks. Therefore, the objective of this investigation was to evaluate MRI-related issues (i.e., magnetic field interactions, heating, and artifacts) for various lead fragments. Testing was conducted using standardized techniques on lead fragments of different lengths (i.e., 50, 75, and 100% of maximum possible fragment length of 12.7 cm) to determine MRI-related problems. Magnetic field interactions (i.e., translational attraction and torque) and artifacts were tested for the longest lead fragment at 3 Tesla. MRI-related heating was evaluated at 1.5 Tesla/64 MHz and 3 Tesla/128 MHz with each lead fragment placed in a gelled-saline filled phantom. Temperatures were recorded on the lead fragments while using relatively high RF power levels. Artifacts were evaluated using T1-weighted, spin echo, and gradient echo (GRE) pulse sequences. The longest lead fragment produced only minor magnetic field interactions. For the lead fragments evaluated, physiologically inconsequential MRI-related heating occurred at 1.5 Tesla/64 MHz while under certain 3 Tesla/128 MHz conditions, excessive temperature elevations may occur. Artifacts extended approximately 7 mm from the lead fragment on the GRE pulse sequence, suggesting that anatomy located at a position greater than this distance may be visualized on MRI. MRI may be performed safely in patients with retained lead fragments at 1.5 Tesla using the specific conditions of this study (i.e., MR Conditional). Due to possible excessive temperature rises at 3 Tesla, performing MRI at that field strength is currently inadvisable. © 2017 International Neuromodulation Society.

Causes of fragmented crystals in ignimbrites: a case study of the Cardones ignimbrite, Northern Chile

Science.gov (United States)

van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.

2018-03-01

Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can

Producing Reality Stardom: Constructing, Programming, and Branding Celebrity on Reality Television

OpenAIRE

Giggey, Lindsay Nicole

2017-01-01

The popular preoccupation with celebrity in American culture in the past decade has been bolstered by a corresponding increase in the amount of reality programming across cable and broadcast networks that centers either on established celebrities or on celebrities in the making. This dissertation examines the questions: How is celebrity constructed, scheduled, and branded by networks, production companies, and individual participants, and how do the constructions and mechanisms of celebrity i...

Sustainable construction : towards a strategic approach to construction material management for waste reduction

NARCIS (Netherlands)

Abarca Guerrero, L.; Scheublin, F.J.M.; Egmond - de Wilde De Ligny, van E.L.C.; Lambert, A.J.D.

2008-01-01

The construction sector plays a key role in shaping and developing the built environment. It also has an undisputed and significant impact on it due to the amounts of materials extracted and produced as waste. The construction industry has emphasized to recycling construction waste (CW), however,

Flexible metabolic pathway construction using modular and divisible selection gene regulators

DEFF Research Database (Denmark)

Rugbjerg, Peter; Myling-Petersen, Nils; Sommer, Morten Otto Alexander

2015-01-01

Genetic selections are important to biological engineering. Although selectable traits are limited,currently each trait only permits simultaneous introduction of a single DNA fragment. Complex pathwayand strain construction however depends on rapid, combinatorial introduction of many genes thaten...

Shell closure at the touching point of nuclear fragments

International Nuclear Information System (INIS)

Poenaru, D.N.; Greiner, W.; Gherghescu, R.A.

1998-01-01

Shell correction energy of the fission fragments remains practically unchanged when the separation distance increases from the sum of their radii up to infinity. The variation with mass asymmetry of the total deformation energy at the touching point configuration shows the valleys corresponding to different decay modes, which are produced when the two proton and/or the two neutron numbers are magic or almost magic. We present a contour plot of the deformation energy of the proton-rich α-emitter 106 Te, showing for the first time the α-decay valley. Different valleys mainly due to the doubly magic nuclei 100,132 Sn, 208 Pb, and other magic numbers, are illustrated by plotting the deformation energy at the touching point versus the proton number of the fragment, for the following parent nuclei: 106 Te; 116 Ce; 212 Po; 228 Th; 258 Fm, and 264 Fm. (author). Letter-to-the-editor

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Dimensional crossover in fragmentation

Science.gov (United States)

Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

2000-11-01

Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

Characterization and constructive utilization of sludge produced in clari-flocculation unit of water treatment plant

Science.gov (United States)

Ahmad, Tarique; Ahmad, Kafeel; Alam, Mehtab

2018-03-01

All water treatment plants produce waste/residue amid the treatment of raw water. This study selectively investigates the clariflocculator sludge for its physicochemical characteristics and potential reuse options. Sieve analysis, XRF, SEM, XRD, FTIR, and TG-DTA instrumental techniques have been used to characterize the sludge sample. Results show that clariflocculator sludge contains about 78% fine sand having grain size range 150-75 μm. SiO2, Al2O3, Fe2O3 and CaO constitute the maximum percentage of chemical compounds present in the sludge and quartz is the main crystalline phase of the sludge. Recycling and reuse of this sludge, especially, as fine sand in preparing mortar, concrete mix and other civil engineering products would pave the way for constructive utilization with safe and sustainable sludge management strategies.

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

Energy Technology Data Exchange (ETDEWEB)

Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

2013-09-21

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

International Nuclear Information System (INIS)

Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

2013-01-01

The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

Novel method for the production of spin-aligned RI beams in projectile fragmentation reaction with the dispersion matching technique

Energy Technology Data Exchange (ETDEWEB)

Ichikawa, Y., E-mail: yuichikawa@phys.titech.ac.jp [Tokyo Institute of Technology, Department of Physics (Japan); Ueno, H. [RIKEN Nishina Center (Japan); Ishii, Y. [Tokyo Institute of Technology, Department of Physics (Japan); Furukawa, T. [Tokyo Metropolitan University, Department of Physics (Japan); Yoshimi, A. [Okayama University, Research Core for Extreme Quantum World (Japan); Kameda, D.; Watanabe, H.; Aoi, N. [RIKEN Nishina Center (Japan); Asahi, K. [Tokyo Institute of Technology, Department of Physics (Japan); Balabanski, D. L. [Bulgarian Academy of Sciences, Institute for Nuclear Research and Nuclear Energy (Bulgaria); Chevrier, R.; Daugas, J. M. [CEA, DAM, DIF (France); Fukuda, N. [RIKEN Nishina Center (Japan); Georgiev, G. [CSNSM, IN2P3-CNRS, Universite Paris-sud (France); Hayashi, H.; Iijima, H. [Tokyo Institute of Technology, Department of Physics (Japan); Inabe, N. [RIKEN Nishina Center (Japan); Inoue, T. [Tokyo Institute of Technology, Department of Physics (Japan); Ishihara, M.; Kubo, T. [RIKEN Nishina Center (Japan); and others

2013-05-15

A novel method to produce spin-aligned rare-isotope (RI) beam has been developed, that is the two-step projectile fragmentation method with a technique of dispersion matching. The present method was verified in an experiment at the RIKEN RIBF, where an RI beam of {sup 32}Al with spin alignment of 8(1) % was successfully produced from a primary beam of {sup 48}Ca, with {sup 33}Al as an intermediate nucleus. Figure of merit of the present method was found to be improved by a factor larger than 50 compared with a conventional method employing single-step projectile fragmentation.

Planetary Surface Power and Interstellar Propulsion Using Fission Fragment Magnetic Collimator Reactor

International Nuclear Information System (INIS)

Tsvetkov, Pavel V.; Hart, Ron R.; King, Don B.; Rochau, Gary E.

2006-01-01

Fission energy can be used directly if the kinetic energy of fission fragments is converted to electricity and/or thrust before turning into heat. The completed US DOE NERI Direct Energy Conversion (DEC) Power Production project indicates that viable DEC systems are possible. The US DOE NERI DEC Proof of Principle project began in October of 2002 with the goal to demonstrate performance principles of DEC systems. One of the emerging DEC concepts is represented by fission fragment magnetic collimator reactors (FFMCR). Safety, simplicity, and high conversion efficiency are the unique advantages offered by these systems. In the FFMCR, the basic energy source is the kinetic energy of fission fragments. Following escape from thin fuel layers, they are captured on magnetic field lines and are directed out of the core and through magnetic collimators to produce electricity and thrust. The exiting flow of energetic fission fragments has a very high specific impulse that allows efficient planetary surface power and interstellar propulsion without carrying any conventional propellant onboard. The objective of this work was to determine technological feasibility of the concept. This objective was accomplished by producing the FFMCR design and by analysis of its performance characteristics. The paper presents the FFMCR concept, describes its development to a technologically feasible level and discusses obtained results. Performed studies offer efficiencies up to 90% and velocities approaching speed of light as potentially achievable. The unmanned 10-tons probe with 1000 MW FFMCR propulsion unit would attain mission velocity of about 2% of the speed of light. If the unit is designed for 4000 MW, then in 10 years the unmanned 10-tons probe would attain mission velocity of about 10% of the speed of light

Fragment-based quantitative structure-activity relationship (FB-QSAR) for fragment-based drug design.

Science.gov (United States)

Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen

2009-01-30

In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.

Sustainable construction : towards a strategic approach to construction material management for waste reduction

OpenAIRE

Abarca Guerrero, L.; Scheublin, F.J.M.; Egmond - de Wilde De Ligny, van, E.L.C.; Lambert, A.J.D.

2008-01-01

The construction sector plays a key role in shaping and developing the built environment. It also has an undisputed and significant impact on it due to the amounts of materials extracted and produced as waste. The construction industry has emphasized to recycling construction waste (CW), however, relatively less emphasis has been paid on construction waste minimization. CW reduction can be achieved through changes in design concepts, material and construction methods selection and material ma...

Analysis for fragmentation products of proton-induced reactions on Pb with energy up to GeV

International Nuclear Information System (INIS)

Fan Sheng; Li Zhuxia; Zhao Zhixiang; Ding Dazhao

2002-01-01

The mass and charge distribution of residual products produced in the spallation reaction needs to be studied because it can provide useful information for the disposal of nuclear and the radiation damage in the spallation target. The mass and charge distribution of the spallation products is studied by using quantum molecular dynamic (QMD) models. The simulation results are well agreed with the experimental data of the spallation fragment and empirical formula. However, QMD model does not include the fission process; the calculations can not reproduce the fission fragment. The fission model is introduced into QMD model to investigate the fragment products from proton-induced reactions on Pb. The results are in good agreement with the experimental data

Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

Science.gov (United States)

Harvey, David J

2005-01-01

Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Fragment Size Distribution of Blasted Rock Mass

Science.gov (United States)

Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

2017-12-01

Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

Science.gov (United States)

Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

2008-07-22

Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

Construction dust amelioration techniques.

Science.gov (United States)

2012-04-01

Dust produced on seasonal road construction sites in Alaska is both a traffic safety and environmental concern. Dust emanating from : unpaved road surfaces during construction severely reduces visibility and impacts stopping sight distance, and contr...

Environmental Impacts by Fragments Released from Nanoenabled Products: A Multiassay, Multimaterial Exploration by the SUN Approach.

Science.gov (United States)

Amorim, Mónica J B; Lin, Sijie; Schlich, Karsten; Navas, José M; Brunelli, Andrea; Neubauer, Nicole; Vilsmeier, Klaus; Costa, Anna L; Gondikas, Andreas; Xia, Tian; Galbis, Liliana; Badetti, Elena; Marcomini, Antonio; Hristozov, Danail; Kammer, Frank von der; Hund-Rinke, Kerstin; Scott-Fordsmand, Janeck J; Nel, André; Wohlleben, Wendel

2018-02-06

Nanoenabled products (NEPs) have numerous outdoor uses in construction, transportation or consumer scenarios, and there is evidence that their fragments are released in the environment at low rates. We hypothesized that the lower surface availability of NEPs fragment reduced their environmental effects with respect to pristine nanomaterials. This hypothesis was explored by testing fragments generated by intentional micronisation ("the SUN approach"; Nowack et al. Meeting the Needs for Released Nanomaterials Required for Further Testing: The SUN Approach. Environmental Science & Technology, 2016 (50), 2747). The NEPs were composed of four matrices (epoxy, polyolefin, polyoxymethylene, and cement) with up to 5% content of three nanomaterials (carbon nanotubes, iron oxide, and organic pigment). Regardless of the type of nanomaterial or matrix used, it was observed that nanomaterials were only partially exposed at the NEP fragment surface, indicating that mostly the intrinsic and extrinsic properties of the matrix drove the NEP fragment toxicity. Ecotoxicity in multiple assays was done covering relevant media from terrestrial to aquatic, including sewage treatment plant (biological activity), soil worms (Enchytraeus crypticus), and fish (zebrafish embryo and larvae and trout cell lines). We designed the studies to explore the possible modulation of ecotoxicity by nanomaterial additives in plastics/polymer/cement, finding none. The results support NEPs grouping by the matrix material regarding ecotoxicological effect during the use phase. Furthermore, control results on nanomaterial-free polymer fragments representing microplastic had no significant adverse effects up to the highest concentration tested.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Construction and characterization of a yeast artificial chromosome library containing seven haploid human genome equivalents

International Nuclear Information System (INIS)

Albertsen, H.M.; Abderrahim, H.; Cann, H.M.; Dausset, J.; Le Paslier, D.; Cohen, D.

1990-01-01

Prior to constructing a library of yeast artificial chromosomes (YACs) containing very large human DNA fragments, the authors performed a series of preliminary experiments aimed at developing a suitable protocol. They found an inverse relationship between YAC insert size and transformation efficiency. Evidence of occasional rearrangement within YAC inserts was found resulting in clonally stable internal deletions or clonally unstable size variations. A protocol was developed for preparative electrophoretic enrichment of high molecular mass human DNA fragments from partial restriction digests and ligation with the YAC vector in agarose. A YAC library has been constructed from large fragments of DNA from an Epstein-Barr virus-transformed human lymphoblastoid cell line. The library presently contains 50,000 clones, 95% of which are greater than 250 kilobase pairs in size. The mean YAC size of the library, calculated from 132 randomly isolated clones, is 430 kilobase pairs. The library thus contains the equivalent of approximately seven haploid human genomes

Direct determination of recoil ion detection efficiency for coincidence time-of-flight studies of molecular fragmentation

International Nuclear Information System (INIS)

Ben-Itzhak, I.; Carnes, K.D.; Ginther, S.G.; Johnson, D.T.; Norris, P.J.; Weaver, O.L.

1993-01-01

Molecular fragmentation of diatomic and small polyatomic molecules caused by fast ion impact has been studied. The evaluation of the cross sections of the different fragmentation channels depends strongly on the recoil ion detection efficiency, ε r (single ions proportional to ε r , and ion pairs to ε 2 r , etc.). A method is suggested for the direct determination of this detection efficiency. This method is based on the fact that fast H + + CH 4 collisions produce C 2+ fragments only in coincidence with H + and H + 2 fragments, that is, there is a negligible number of C 2+ singles, if any. The measured yield of C 2+ singles is therefore due to events in which the H + m of the H + m + C 2+ ion pair was not detected and thus is proportional to 1 - ε r . Methane fragmentation caused by 1 MeV proton impact is used to evaluate directly the recoil ion detection efficiency and to demonstrate the method of deriving the cross sections of all breakup channels. (orig.)

PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration

Directory of Open Access Journals (Sweden)

Alexander Jonathan S

2010-12-01

Full Text Available Abstract The normal function of poly (ADP-ribose polymerase-1 (PARP-1 is the routine repair of DNA damage by adding poly (ADP ribose polymers in response to a variety of cellular stresses. Recently, it has become widely appreciated that PARP-1 also participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. In the CNS, PARP inhibition attenuates injury in pathologies like cerebral ischemia, trauma and excitotoxicity demonstrating a central role of PARP-1 in these pathologies. PARP-1 is also a preferred substrate for several 'suicidal' proteases and the proteolytic action of suicidal proteases (caspases, calpains, cathepsins, granzymes and matrix metalloproteinases (MMPs on PARP-1 produces several specific proteolytic cleavage fragments with different molecular weights. These PARP-1 signature fragments are recognized biomarkers for specific patterns of protease activity in unique cell death programs. This review focuses on specific suicidal proteases active towards PARP-1 to generate signature PARP-1 fragments that can identify key proteases and particular forms of cell death involved in pathophysiology. The roles played by some of the PARP-1 fragments and their associated binding partners in the control of different forms of cell death are also discussed.

Dual Fragment Impact of PBX Charges

Science.gov (United States)

Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

2017-06-01

Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

Fragmentation of the 56Fe in Al at 1.88A GeV

International Nuclear Information System (INIS)

Bhattacharyya, D.P.; Pal, P.; Basu, B.; Rakshit, R.; Mukherjee, S.C.

1988-01-01

The production of fragmented nuclei from relativistic 56 Fe beam available from LBL Bevalac at 1.88A GeV has been studied using CR-39 (DOP) passive detector placed at an angle of 60 degrees with respect to the beam. The histogram showing the experimental frequency distribution of minor axes of the elliptic etch pit shows the presence of the fragmented nuclei produced with charge number Z from 25 up to 21. The histogram further reveals the presence of nuclei with Z=27 and 28. The production of nuclei heavier than 56 Fe is possibly due to the charge exchange or pick-up phenomena

Construction of gateway-compatible yeast two-hybrid vectors for ...

African Journals Online (AJOL)

Yeast two-hybrid system combined with the gateway technology will greatly facilitate the cloning of interested DNA fragment into yeast two-hybrid vectors and therefore increase the efficiency of yeast two-hybrid analysis. In this study, we constructed a pair of Gateway-compatible yeast two-hybrid vectors pBTM116GW and ...

Large explosive basaltic eruptions at Katla volcano, Iceland: Fragmentation, grain size and eruption dynamics

Science.gov (United States)

Schmith, Johanne; Höskuldsson, Ármann; Holm, Paul Martin; Larsen, Guðrún

2018-04-01

Katla volcano in Iceland produces hazardous large explosive basaltic eruptions on a regular basis, but very little quantitative data for future hazard assessments exist. Here details on fragmentation mechanism and eruption dynamics are derived from a study of deposit stratigraphy with detailed granulometry and grain morphology analysis, granulometric modeling, componentry and the new quantitative regularity index model of fragmentation mechanism. We show that magma/water interaction is important in the ash generation process, but to a variable extent. By investigating the large explosive basaltic eruptions from 1755 and 1625, we document that eruptions of similar size and magma geochemistry can have very different fragmentation dynamics. Our models show that fragmentation in the 1755 eruption was a combination of magmatic degassing and magma/water-interaction with the most magma/water-interaction at the beginning of the eruption. The fragmentation of the 1625 eruption was initially also a combination of both magmatic and phreatomagmatic processes, but magma/water-interaction diminished progressively during the later stages of the eruption. However, intense magma/water interaction was reintroduced during the final stages of the eruption dominating the fine fragmentation at the end. This detailed study of fragmentation changes documents that subglacial eruptions have highly variable interaction with the melt water showing that the amount and access to melt water changes significantly during eruptions. While it is often difficult to reconstruct the progression of eruptions that have no quantitative observational record, this study shows that integrating field observations and granulometry with the new regularity index can form a coherent model of eruption evolution.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

International Nuclear Information System (INIS)

Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

2014-01-01

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

Energy Technology Data Exchange (ETDEWEB)

Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

2014-04-10

In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

Relationship between Statistical and Dynamical properties of fragments produced at Fermi Energy in Heavy ion collisions: ng; Liens entre les proprietes statistiques et dynamiques des fragments produits lors des collisions d'ions lourds autour de l'energie de Fermi

Energy Technology Data Exchange (ETDEWEB)

Lehaut, G.

2009-10-15

The properties of the fragments produced in heavy-ion collisions around the Fermi energy have been studied through the isospin degree of freedom. First, a theoretical approach based on a lattice gas model with two types of particles (neutron,proton) interacting by an isospin dependent and Coulomb interactions was developed. The study of the phase diagram shows that this system presents three different phases (liquid, gas, fission). In the liquid and gas phases, the energy of the system was described by a density functional, where the temperature dependence acts only on the density. The symmetry term of this functional was related to the isotopic content of the biggest fragment via an iso-scaling analysis. Secondly a systematic study of the stopping power of the nuclear matter and isospin equilibration of light particles in the most violent collisions was carried out using the experimental data taken by the INDRA multidetector at GANIL and GSI. Two stopping power regimes appear; at low energy (< 40 MeV/A) the stopping power decreases with increasing beam energy, whereas at high energy the stopping power is governed by the quantity of matter along the beam direction. An other study has been focused on the Xe+Sn reaction at 32 and 45 MeV/A with different isospin systems. The separation of three different reaction mechanisms by use of a principal component analysis allowed us to observe that the isospin content of light particles seems to be independent on the mechanism, but depends on the violence of the collision (i.e. impact parameter). (author)

Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.

Science.gov (United States)

Yatsuhashi, Tomoyuki; Nakashima, Nobuaki

2010-07-22

We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.

Fragmentation functions approach in pQCD fragmentation phenomena

International Nuclear Information System (INIS)

Rolli, S.

1996-07-01

Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

Measurement of charm fragmentation fractions in photoproduction at HERA

Energy Technology Data Exchange (ETDEWEB)

Abramowicz, H. [Tel Aviv Univ. (Israel). School of Physics; Max-Planck-Institute for Physics, Munich (Germany); Abt, I. [Max-Planck-Institute for Physics, Muinch (Germany); Adamczyk, L. [AGH-Univ. of Science and Technology, Krakow (Poland). Faculty of Physics and Applied Computer Science] [and others; Collaboration: ZEUS Collaboration

2013-06-15

The production of D{sup 0}, D{sup *+}, D{sup +}, D{sub s}{sup +} and {Lambda}{sub c}{sup +} charm hadrons and their antiparticles in ep scattering at HERA has been studied with the ZEUS detector, using a total integrated luminosity of 372 pb{sup -1}. The fractions of charm quarks hadronising into a particular charm hadron were derived. In addition, the ratio of neutral to charged D-meson production rates, the fraction of charged D mesons produced in a vector state, and the strangeness-suppression factor have been determined. The measurements have been performed in the photoproduction regime. The charm hadrons were reconstructed in the range of transverse momentum p{sub T} > 3.8GeV and pseudorapidity vertical stroke {eta} vertical stroke <1.6. The charm fragmentation fractions are compared to previous results from HERA and from e{sup +}e{sup -} experiments. The data support the hypothesis that fragmentation is independent of the production process.

Heavy quarks fragmentation in charmed mesons in DELPHI experiment at LEP; Etude de la fragmentation des quarks lourds en mesons charmes dans l`experience Delphi au LEP

Energy Technology Data Exchange (ETDEWEB)

Levy, J.M.

1994-04-01

With the big statistics expected at LEP, the electroweak sector of the Standard Model can be tested as well as the theory of strong interactions. Quantum Chromo-Dynamics is indeed predictive for quarks properties, but does not explain how quarks fragment into hadrons. So far the hadronization can only be described with phenomenological models. The work presented in this thesis was performed on the DELPHI experiment at LEP and concerns the production and the fragmentation of heavy quarks into charmed mesons D , D* and D**. With the whole statistics of 1991 and 1992 (1 013 300 hadronic decays of the Z), more than 4500 charmed mesons decays have been reconstructed in the channels D{sup 0}{yields} K{sup -} {pi}{sup +} , D{sup +}{yields} K{sup -} {pi}{sup +}{pi}+ and D{sup *}+{yields} D{sup 0}{pi}{sup +} followed by D{sup 0}{yields} K{sup -}{pi}{sup +} . Using also 1993 data and the channel D{sup 0}{yields} K{sup -}{pi}{sup +}{pi}{sup +}{pi}{sup -} , evidence for D** production is presented. For the first time, the production rate is measured for each D meson separately for cc and bb contributions. In fact, D mesons can be produced either directly from the fragmentation of c quark or un-directly from the fragmentation of b quark into B mesons which decay into D mesons. (authors). 120 refs.

Fragmentation of neck-like structures

International Nuclear Information System (INIS)

Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

1994-01-01

Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

Directory of Open Access Journals (Sweden)

Paula Eveline Ribeiro D’Anunciação

2013-01-01

Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

Facile construction of a random protein domain insertion library using an engineered transposon.

Science.gov (United States)

Shah, Vandan; Pierre, Brennal; Kim, Jin Ryoun

2013-01-15

Insertional fusion between multiple protein domains represents a novel means of creating integrated functionalities. Currently, there is no robust guideline for selection of insertion sites ensuring the desired functional outcome of insertional fusion. Therefore, construction and testing of random domain insertion libraries, in which a host protein domain is randomly inserted into a guest protein domain, significantly benefit extensive exploration of sequence spaces for insertion sites. Short peptide residues are usually introduced between protein domains to alleviate structural conflicts, and the interdomain linker residues may affect the functional outcome of protein insertion complexes. Unfortunately, optimal control of interdomain linker residues is not always available in conventional methods used to construct random domain insertion libraries. Moreover, most conventional methods employ blunt-end rather than sticky-end ligation between host and guest DNA fragments, thus lowering library construction efficiency. Here, we report the facile construction of random domain insertion libraries using an engineered transposon. We show that random domain insertion with optimal control of interdomain linker residues was possible with our engineered transposon-based method. In addition, our method employs sticky-end rather than blunt-end ligation between host and guest DNA fragments, thus allowing for facile construction of relatively large sized libraries. Copyright © 2012 Elsevier Inc. All rights reserved.

Double-energy double-velocity measurement system for fission fragments and its application

International Nuclear Information System (INIS)

Kanno, Ikuo

1987-10-01

A new system of double-energy double-velocity (DEDV) measurement for fission fragments has been developed. In this system, the energies of fission fragments are measured by silicon surface barrier detectors (SSB) and the velocities by the time-of-flight (TOF) method utilizing thin film detectors (TFD) as start detectors and SSBs as stop detectors of TOF. Theoretical and experimental studies on TFDs and SSBs have been performed before the construction of the DEDV measurement system. The TFD consists of a thin plastic scintillator film and light guide. The author proposes a new model of the luminescence production in a scintillator film. This model takes into account the thickness of the scintillator film and uses only one parameter. The calculated TFD response to charged particles shows good agreement with other experiments. The dependence of the TFD response to the thickness of the scintillator film has been studied experimentally and analyzed by the luminescence production model. The results of this analysis shows the validity of the luminescence production model. The time resolution of the DEDV measurement system using TFDs and SSBs was 133 ps. As an application of this system, the DEDV measurement for the thermal neutron-induced fission of 233 U has been carried out at the super mirror neutron guide tube facility of Kyoto University Reactor (KUR). The energy and velocity of each fission fragment have been stored on magnetic disk event by event in a list mode. The analyzed results of masses, energies and velocities of light and heavy fragments agree well with other authors' works. The value of the total neutron emission number is 2.53 and shows good agreement within experimental error, with the JENDL-2 value, 2.49. The light fragment shows a slightly greater number of neutrons emitted than the other works. This suggests the possibility of larger deformation of light fragments at the scission point. (author)

Monte Carlo simulation as a tool to predict blasting fragmentation based on the Kuz Ram model

Science.gov (United States)

Morin, Mario A.; Ficarazzo, Francesco

2006-04-01

Rock fragmentation is considered the most important aspect of production blasting because of its direct effects on the costs of drilling and blasting and on the economics of the subsequent operations of loading, hauling and crushing. Over the past three decades, significant progress has been made in the development of new technologies for blasting applications. These technologies include increasingly sophisticated computer models for blast design and blast performance prediction. Rock fragmentation depends on many variables such as rock mass properties, site geology, in situ fracturing and blasting parameters and as such has no complete theoretical solution for its prediction. However, empirical models for the estimation of size distribution of rock fragments have been developed. In this study, a blast fragmentation Monte Carlo-based simulator, based on the Kuz-Ram fragmentation model, has been developed to predict the entire fragmentation size distribution, taking into account intact and joints rock properties, the type and properties of explosives and the drilling pattern. Results produced by this simulator were quite favorable when compared with real fragmentation data obtained from a blast quarry. It is anticipated that the use of Monte Carlo simulation will increase our understanding of the effects of rock mass and explosive properties on the rock fragmentation by blasting, as well as increase our confidence in these empirical models. This understanding will translate into improvements in blasting operations, its corresponding costs and the overall economics of open pit mines and rock quarries.

Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles

International Nuclear Information System (INIS)

Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.

2012-01-01

Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.

Fragmentation of the radiation degraded chitosan by centrifugal filter and application of the fragmented chitosan in cotton fabrics finishing

International Nuclear Information System (INIS)

Luu Thi Tho; Nguyen Van Thong; Vu Thi Hong Khanh; Tran Minh Quynh

2014-01-01

Three kind of Vietnamese chitosans with the same deacetylation degrees of about 75% and viscosity average molecular weights are 69.000, 187.000 and 345.000 Da, respectively, were produced from shrimp shells and cuttle-bone at the MTV chitosan company (Kien Giang). These chitosans were irradiated at 25, 50, 75, 100, 200 and 500 kGy under Cobalt-60 gamma source at Hanoi Irradiation Center in order to prepare a series of chitosan segments with wide distribution of molecular weights. Different chitosan samples of the predetermined average molecular weight from 3,000 to 50,000 Da were separated from the irradiated chitosans by ultrafiltration with series of filter membranes (Centriprep devices). Molecular properties of the fragmented chitosans were analysed with gel permeation chromatography, Fourier transfer infra red spectrometry, and the results suggested that principal characteristics of chitosan were not affected by gamma irradiation, even its deacetylation degrees was increased. Solubility of the fragmented chitosans were much improved by radiation processing, and the chitosans having molecular weights below 5.000 Da were water-soluble polymers, which can easily apply as the auxiliary agent in textile. (author)

Fragmentation of Ceramics in Rapid Expansion Mode

Science.gov (United States)

Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

Ask your doctor: the construction of smoking in advertising posters produced in 1946 and 2004.

Science.gov (United States)

Street, Annette F

2004-12-01

This paper examines two full-page A3 poster advertisements in mass magazines produced at two time points over a 60-year period depicting smoking and its effects, with particular relation to lung cancer. Each poster represents the social and cultural milieu of its time. The writings of Foucault are used to explore the disciplinary technologies of sign systems as depicted in the two posters. The relationships between government, tobacco companies and drug companies and the technologies of production are examined with regard to the development of smoking cessation strategies. The technologies of power are associated with the constructions of risk and lifestyles. The technologies of the self locate smokers as culpable subjects responsible for their individual health. Finally, the meshing of these technologies places the doctor in the frame as "authoritative knower" and representative of expert systems.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS.

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H(2)O, NH(3), CH(2)O (from serine), C2H4O (from threonine), and H(3)PO(4), whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H](+) and [M + H - H](-) within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H2O, NH3, CH2O (from serine), C2H4O (from threonine), and H3PO4, whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H]+ and [M + H - H]- within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

[Construction and identification of Nogo extra cellular peptide residues 1-40 gene lentiviral vector].

Science.gov (United States)

Yuan, Haifeng; Song, Yueming; Liu, Hao; Zhou, Chunguang; Kong, Qingquan; Liu, Liming; Gong, Quan

2012-02-01

To construct a lentiviral expression vector carrying Nogo extra cellular peptide residues 1-40 (NEP1-40) and to obtain NEP1-40 efficient and stable expression in mammalian cells. The DNA fragment of NEP1-40 coding sequence was amplified by PCR with designed primer from the cDNA library including NEP1-40 gene, and then subcloned into pGC-FU vector with in-fusion technique to generate the lentiviral expression vector, pGC-FU-NEP1-40. The positive clones were screened by PCR and the correct NEP1-40 was confirmed by sequencing. Recombinant lentiviruses were produced in 293T cells after the cotransfection of pGC-FU-NEP1-40, and packaging plasmids of pHelper 1.0 and pHelper 2.0. Green fluorescent protein (GFP) expression of infected 293T cells was observed to evaluate gene delivery efficiency. NEP1-40 protein expression in 293T cells was detected by Western blot. The lentiviral expression vector carrying NEP1-40 was successfully constructed by GFP observation, and NEP1-40 protein expression was detected in 293T cells by Western blot. The recombinant lentivirus pGC-FU-NEP1-40 is successfully constructed and it lays a foundation for further molecular function study of NEP 1-40.

Fragmentation pathways of O-alkyl methylphosphonothionocyanidates in the gas phase: toward unambiguous structural characterization of chemicals in the Chemical Weapons Convention framework.

Science.gov (United States)

Saeidian, Hamid; Babri, Mehran; Ashrafi, Davood; Sarabadani, Mansour; Naseri, Mohammad Taghi

2013-08-01

The electron-impact (EI) mass spectra of a series of O-alkyl methylphosphonothionocyanidates were studied for Chemical Weapons Convention (CWC) purposes. General EI fragmentation pathways were constructed and discussed, and collision-induced dissociation studies of the major EI ions were performed to confirm proposed fragment structures by analyzing fragment ions of deuterated analogs and by use of density functional theory (DFT) calculations. Thiono-thiolo rearrangement, McLafferty-type rearrangement, and a previously unknown intramolecular electrophilic aromatic substitution reaction were observed and confirmed. The study also focused on differentiation of isomeric compounds. Retention indices for all compounds, and an electrophilicity index for several compounds, are reported and interpreted.

The formation of planets by disc fragmentation

Directory of Open Access Journals (Sweden)

Stamatellos Dimitris

2013-04-01

Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

Extraction of 16th Century Calender Fragments

DEFF Research Database (Denmark)

Holck, Jakob Povl; Etheridge, Christian

at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

Validation of ASTEC v2.0 corium jet fragmentation model using FARO experiments

International Nuclear Information System (INIS)

Hermsmeyer, S.; Pla, P.; Sangiorgi, M.

2015-01-01

Highlights: • Model validation base extended to six FARO experiments. • Focus on the calculation of the fragmented particle diameter. • Capability and limits of the ASTEC fragmentation model. • Sensitivity analysis of model outputs. - Abstract: ASTEC is an integral code for the prediction of Severe Accidents in Nuclear Power Plants. As such, it needs to cover all physical processes that could occur during accident progression, yet keeping its models simple enough for the ensemble to stay manageable and produce results within an acceptable time. The present paper is concerned with the validation of the Corium jet fragmentation model of ASTEC v2.0 rev3 by means of a selection of six experiments carried out within the FARO facility. The different conditions applied within these six experiments help to analyse the model behaviour in different situations and to expose model limits. In addition to comparing model outputs with experimental measurements, sensitivity analyses are applied to investigate the model. Results of the paper are (i) validation runs, accompanied by an identification of situations where the implemented fragmentation model does not match the experiments well, and discussion of results; (ii) its special attention to the models calculating the diameter of fragmented particles, the identification of a fault in one model implemented, and the discussion of simplification and ad hoc modification to improve the model fit; and, (iii) an investigation of the sensitivity of predictions towards inputs and parameters. In this way, the paper offers a thorough investigation of the merit and limitation of the fragmentation model used in ASTEC

General-purpose heat source: Research and development program, radioisotope thermoelectric generator/thin fragment impact test

International Nuclear Information System (INIS)

Reimus, M.A.H.; Hinckley, J.E.

1996-11-01

The general-purpose heat source provides power for space missions by transmitting the heat of 238 Pu decay to an array of thermoelectric elements in a radioisotope thermoelectric generator (RTG). Because the potential for a launch abort or return from orbit exists for any space mission, the heat source response to credible accident scenarios is being evaluated. This test was designed to provide information on the response of a loaded RTG to impact by a fragment similar to the type of fragment produced by breakup of the spacecraft propulsion module system. The results of this test indicated that impact by a thin aluminum fragment traveling at 306 m/s may result in significant damage to the converter housing, failure of one fueled clad, and release of a small quantity of fuel

Habitat fragmentation and species extirpation in freshwater ecosystems; causes of range decline of the Indus river dolphin (Platanista gangetica minor.

Directory of Open Access Journals (Sweden)

Gill T Braulik

Full Text Available Habitat fragmentation of freshwater ecosystems is increasing rapidly, however the understanding of extinction debt and species decline in riverine habitat fragments lags behind that in other ecosystems. The mighty rivers that drain the Himalaya - the Ganges, Brahmaputra, Indus, Mekong and Yangtze - are amongst the world's most biodiverse freshwater ecosystems. Many hundreds of dams have been constructed, are under construction, or are planned on these rivers and large hydrological changes and losses of biodiversity have occurred and are expected to continue. This study examines the causes of range decline of the Indus dolphin, which inhabits one of the world's most modified rivers, to demonstrate how we may expect other vertebrate populations to respond as planned dams and water developments come into operation. The historical range of the Indus dolphin has been fragmented into 17 river sections by diversion dams; dolphin sighting and interview surveys show that river dolphins have been extirpated from ten river sections, they persist in 6, and are of unknown status in one section. Seven potential factors influencing the temporal and spatial pattern of decline were considered in three regression model sets. Low dry-season river discharge, due to water abstraction at irrigation barrages, was the principal factor that explained the dolphin's range decline, influencing 1 the spatial pattern of persistence, 2 the temporal pattern of subpopulation extirpation, and 3 the speed of extirpation after habitat fragmentation. Dolphins were more likely to persist in the core of the former range because water diversions are concentrated near the range periphery. Habitat fragmentation and degradation of the habitat were inextricably intertwined and in combination caused the catastrophic decline of the Indus dolphin.

Habitat fragmentation and species extirpation in freshwater ecosystems; causes of range decline of the Indus river dolphin (Platanista gangetica minor).

Science.gov (United States)

Braulik, Gill T; Arshad, Masood; Noureen, Uzma; Northridge, Simon P

2014-01-01

Habitat fragmentation of freshwater ecosystems is increasing rapidly, however the understanding of extinction debt and species decline in riverine habitat fragments lags behind that in other ecosystems. The mighty rivers that drain the Himalaya - the Ganges, Brahmaputra, Indus, Mekong and Yangtze - are amongst the world's most biodiverse freshwater ecosystems. Many hundreds of dams have been constructed, are under construction, or are planned on these rivers and large hydrological changes and losses of biodiversity have occurred and are expected to continue. This study examines the causes of range decline of the Indus dolphin, which inhabits one of the world's most modified rivers, to demonstrate how we may expect other vertebrate populations to respond as planned dams and water developments come into operation. The historical range of the Indus dolphin has been fragmented into 17 river sections by diversion dams; dolphin sighting and interview surveys show that river dolphins have been extirpated from ten river sections, they persist in 6, and are of unknown status in one section. Seven potential factors influencing the temporal and spatial pattern of decline were considered in three regression model sets. Low dry-season river discharge, due to water abstraction at irrigation barrages, was the principal factor that explained the dolphin's range decline, influencing 1) the spatial pattern of persistence, 2) the temporal pattern of subpopulation extirpation, and 3) the speed of extirpation after habitat fragmentation. Dolphins were more likely to persist in the core of the former range because water diversions are concentrated near the range periphery. Habitat fragmentation and degradation of the habitat were inextricably intertwined and in combination caused the catastrophic decline of the Indus dolphin.

Systematic experimental survey on projectile fragmentation and fission induced in collisions of {sup 238}U at 1 A GeV with lead

Energy Technology Data Exchange (ETDEWEB)

Enquist, T.; Benlliure, J.; Farget, F.; Schmidt, K.H.; Armbruster, P. [Gesellschaft fuer Schwerionenforschung mbH, Darmstadt (Germany); Bernas, M.; Tassan-Got, L. [Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Boudard, A.; Legrain, R.; Volant, C. [CEA Centre d`Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France). Dept. d`Astrophysique, de Physique des Particules, de Physique Nucleaire et de l`Instrumentation Associee (DAPNIA); Boeckstiegel, C.; Jong, M. de [Technische Univ. Darmstadt (Germany); Dufour, J.P. [CEA Centre d`Etudes Nucleaires de Bordeaux-Gradignan, 33 - Gradignan (France)

1999-03-01

Projectile fragmentation and fission, induced in collisions of {sup 238}U at 1 A GeV with lead, have systematically been studied. A complete survey on the isotopic production cross sections of all elements between vanadium (Z = 23) and rhenium (Z = 75) down to a cross section of 0.1 mb is given. About 600 isotopes produced in fragmentation and about 600 isotopes produced in fission were identified in the GSI fragment separator FRS from magnetic rigidities, time-of-flight values, and the energy loss in an ionisation chamber. In addition, the velocity distributions of all these reaction products have been mapped, and the products are unambiguously attributed to the different reaction mechanisms due to their kinematical properties. The results are compared with empirical systematics and previous data. The velocity of the fragments obtained in the fission process by the Coulomb repulsion allows to reconstruct the TKE-value of the break-up and to identify the atomic number of the fissioning nucleus in hot fission. The mean velocities of light projectile fragments were found to be higher than the beam velocity. (orig.) 41 refs.

Fluctuations in the fragmentation process

International Nuclear Information System (INIS)

Botet, R.; Ploszajczak, M.

1993-01-01

Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

The spectroscopy of fission fragments

International Nuclear Information System (INIS)

Phillips, W.R.

1998-01-01

High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

[Fragment-based drug discovery: concept and aim].

Science.gov (United States)

Tanaka, Daisuke

2010-03-01

Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

[The fragmentation of representational space in schizophrenia].

Science.gov (United States)

Plagnol, A; Oïta, M; Montreuil, M; Granger, B; Lubart, T

2003-01-01

Existent neurocognitive models of schizophrenia converge towards a core of impairments involving working memory, context processing, action planning, controlled and intentional processing. However, the emergence of this core remains itself difficult to explain and more specific hypotheses do not explain the heterogeneity of schizophrenia. To overcome these limits, we propose a new paradigm based on representational theory from cognitive science. Some recent developments of this theory enable us to describe a subjective universe as a representational space which is displayed from memory. We outline a conceptual framework to construct such a representational space from analogical -representations that can be activated in working memory and are connected to a network of symbolic structures. These connections are notably made through an analytic process of the analogical fragments, which involves the attentional focus. This framework allows us to define rigorously some defense processes in response to traumatic tensions that are expressed on the representational space. The fragmentation of representational space is a consequence of a defensive denial based on an impairment of the analytic process. The fragmentation forms some parasitic areas in memory which are excluded from the main part of the representational space and disturb information processing. The key clinical concepts of paranoid syndromes can be defined in this conceptual framework: mental automatism, delusional intuition, acute destructuration, psychotic dissociation, and autistic withdrawal. We show that these syndromes imply each other, which in return increases the fragmentation of the representational space. Some new concepts emerge naturally in this framework, such as the concept of "suture" which is defined as a link between a parasitic area and the main representational space. Schizophrenia appears as a borderline case of fragmentation of the representational space. This conceptual framework is

Radiation produced by electrons incident on molecules

International Nuclear Information System (INIS)

Moehlman, G.R.

1977-01-01

The work described in this thesis deals with light intensity measurements of emission spectra (1850-9000 A) produced by a continuous or pulsed beam of monoenergetic electrons (0 - 2000 eV) incident on a variety of molecular gases like H 2 , D 2 , H 2 O, HCl, NH 3 and several hydrocarbons. The emission spectra are dominated by fluorescence from excited fragments produced via dissociative excitation, besides fluorescence from excited parent molecules themselves. The experimental results thus obtained are expressed in terms of emission cross sections and lifetimes