WorldWideScience

Sample records for constriction region qh

  1. Boundary critical phenomena and a quasiparticle-quasihole symmetric metal-insulator: transition in a constricted quantum hall circuit

    International Nuclear Information System (INIS)

    Lal, Siddhartha

    2007-09-01

    Motivated by surprises in recent experimental findings, we study transport in a model of a quantum Hall edge system with a gate-voltage controlled constriction. A finite backscattered current at finite edge-bias is explained as arising from the splitting of edge current caused by the difference in the filling fractions of the bulk (ν 1 ) and constriction (ν 2 ) quantum Hall fluid regions. We develop a hydrodynamic theory for bosonic edge modes inspired by this model. The constriction region splits the incident long-wavelength chiral edge density-wave excitations among the transmitting and reflecting edge states encircling it. The competition between two interedge tunneling processes taking place inside the constriction, related by a quasiparticle-quasihole (qp-qh) symmetry, is accounted for by computing the boundary theories of the system. This competition is found to determine the strong coupling configuration of the system. A separatrix of qp-qh symmetric gapless critical states is found to lie between the relevant RG flows to a metallic and an insulating configuration of the constriction system. This constitutes an interesting generalisation of the Kane-Fisher quantum impurity model. The features of the RG phase diagram are also confirmed by computing various correlators and chiral linear conductances of the system. In this way, our results find excellent agreement with many recent puzzling experimental results for the cases of ν 1 = 1/3, 1. We also discuss and make predictions for the case of a constriction system with ν 2 = 5/2. (author)

  2. Sequence Data: QH13367 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH13367 KG00D1960 c/t tgccttcaaagtaaaaccacaagtactttaggataatttttcaagagtgtacaaaaagacaaaaattaaaaacttctaaa...tgaggacagtctagtttaygaattatttaaaacttctaaattttaatgattcataagtgtgtagaaaacaggcaacaaatttcttcaa

  3. Sequence Data: QH12765 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH12765 KG00D1789 a/g aagaggtatttgcacctctgaaagggcacaaaaaaaragagagagagagaaagagaaagaaagaaaaaagaaataaagaaagaaa...aagagagaaagtggtacaagcagttcttataaaaaataaaactatgtgtcactatttcaacttgtctttattgaaactgca

  4. Sequence Data: QH06665 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH06665 KG_XK2747 c/t tggttgaatgaaaaacaaacaaaaaaaagaaattgcaaatcaataygtagactatggtcttatttatgtaaa...tataatattaatgatgacaatctgctctaaagatgaaattgtctggttataacatggtcctgctgccttaggattgataagggaaggggaaaaagagagtgacaaaaggggaagaaaatgaaaaagggaggagaaggtaataaaaa

  5. Sequence Data: QH06556 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH06556 KG11K2604 c/t cacaaaaataagtccttgtccagcaaaaatcacctttacacaggtttgcaagacagaccacagataaaa...cattttcaatgcatttaagaaaagggttgatgtccctaataaactaaaaatgaataacytacctactaatcaatataaaaagagtacttttcagaatcgttttagatttttacaacgacatgtgccattaaaaaca

  6. Sequence Data: QH12123 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH12123 KG00D1694 a/g tcccatagaaaggacccaaaaaaggggtggggcaaagggtgataaagacatggtatcaccatagaaaaa...tgrcatcaccatagaaaaaataaaaatcctatgaagagtaactggaaactctctttggaaattagttatccatgtggtcagataacagtgggga

  7. Sequence Data: QH12843 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH12843 KG00D1861 c/t aaacaaaagttaaaaccaaacaaacccatgggagtaaataagyctgtagagggaacagaaaatatacagagtaaagatgaaa...gtctaaggcagaattctaagaaacaaccatagatgttaaaatgtaaaccaacaaaatggcagaaatatgattga

  8. Sequence Data: QH11734 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH11734 KG00K5232 c/t aaataatgagtgaccagcggtttagacgggttgcaaaggacccgagattttgggaaatgccagaaaaggatcgaaaagtcaaaa...ttgacaagagatttcgagccatgtttcatgacaagaagttcaagttgaactatgccgtggataaaagagggcgccccattagcc...ayagcactacagaggatttgaagcgtttttacgacctttcagattctgattccaatctctctggtgaagatagcaaagcattgagtcaaaagaaaataaagaagaaaaaaacccagactaaaaaagaaa...tcgattcaaaaaatctagttgagaaaaagaaagaaaccaagaaggctaatcacaagggttctgaaaataaaa...ctgatttagataattctataggaattaaaaaaatgaaaacctcatgtaaatttaagatagattcaaacataagtccgaagaaggatagcaaagaatttacacaaaaaaataagaaa

  9. Sequence Data: QH10971 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH10971 KG06G1920 a/g ggccccaataccatcccggttaaaattgaataaaaggaaacttgcaggtcatcaggagacttctaccaaaa...gtagtgagactggatccacaaaagataattttatacaaaataatccttgtaatagtaatcctgagaaggataatgcattggctagtgatttaactaaaaccactcgtggagcttttgaaaa...taaaacacccacagatggttttatagactgtcactttggagatggracgttagaaactgagcagtcctttggactatatggaaataaatacacacttagagccaaa...cgcaaggtaaattatgagactgaagacagtgagtcaagttttgtaactcacaactcaaaaa...ttagtctacctcatcccatggaaattggtgaaagtttagatggaactctcaaatcccgaaaacgaagaaaaatgtctaaaaagctgccccctgtcatcataaagta

  10. Sequence Data: QH04051 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH04051 KG00K1394 at/-- ttattcctactgccctgatagttggtctggctcctagaaattcagatnntttcttccctccaggtgagawtatgcgaagaaa...ggaacactggcaaaattatttccctgattttcttctctcaggctgtctttccctcccctttaagattgtgtactccgtctcaaaaaaaaaagaaaaaaaaaa...gattgtagacccagcctataaattcataggatcaagaattcttactaacactttttctaacaaccttaaatctctgatagtagcacccac...ttgacttcgttttgtatggatagatttattctaatctctctgtagattgttttaatcccaagcaaatgcgagagcataaaa...tagtgtatttgccctccctccaggcttttctggtagtattttgtctgtgaaactaaaaggctctagctgcttttaaaaaagggaaggagtaaggatgagcttttgaaaaaaaaaaaaaaaaaaaaaccccggggggaaa

  11. Sequence Data: QH01692 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH01692 KG00B1408 a/g aagtgggggctgggattgttacatatggccaaaaatttaagcttctttcaatagtattagtattgaaataatacatctttaaaa...cgcttgagggattagatagggaaagaaaaggcacgtacaaaaaaatccaaccgatgccgatcctgtgatttacgtaacaccacaaacttgcaaaaggcaaaaaa...tcagaagcaaaaatccataaaccatcaaaatrcagaaaccaaaaatcccaagccaccacaccagaaagaaaaaaacccagaacaacagcaaaaacccctgtcctaaataaaaataaagcaaatgaacccaccgaaaa

  12. Sequence Data: QH03807 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH03807 KG00K1582 c/t ctctaagtatacatttttatgtagccttgacagttgaatcattttaatattttacatttccaaaaaataagtatgaggagataaa...cctaaaaataaatataaataaaaccaataaatctaatgatatattacattgattcaatgcctacaaagaattaaaaaactctcagtggtgtatattctaaggaaaaaa...gtaagatattggaaaaaattagatattgaacttaagttaatttggtatagcttacaaaacctgtatgttgatatttgggggtg...ctagtgttccatttgtggaagacaggaaatataaacatgggatggaggtgttgcagtcttgttgtctgaggtattaccygagctctttgtctaatgaccaagaaaa...ttaaggaccatggacaccaaaggtgaagctggggcaaaggtttaataagcaaaataggaaagctctttgcagtagaaggggga

  13. Sequence Data: QH05435 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH05435 KG00T2450 a/g tgtcacccaaaatgtacatccaaagtacaaaaagttaaaggtaaatcacgaagtattaaaaaa...tcttgttgtgcagattttgagtgtttggaaaacagtaaaaaagatgtggcattctgttattcatgccagttgttctgccaaaaatattttagctgtggaagagrg...tcatttgcaacccacggaacttctaattggaaaaaaaccctggaaaaattcagaaagcatgaaaaaagtgaaatgcatttgaagtcattggaattttggagagaatac...caattttgtgatggagctgtcagtgacgatttatctattcattcgaaacagattgagggaaataaaaagtacctaaagcttataattgaaaatattttatttcttggaaagcagtgtttaccc

  14. Sequence Data: QH04613 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH04613 KG00M1523 c/t tgttttcactgtttaaagaaagtttgataaaaaattggcttaaattaaaaattaaaatacttaataattttttaaaa...tgtagaacaagtgtgcagaatactggccgtcaatggaagagggyactcgggcttttggagatgttgttgtaaagatcaaccagcacaaaagatgtccagattacatcattcagaaa...ttgaacattgtaaatgtgagtttgctttttacataatttttgttttgatacttttttataaaaatataattatggaatattaaaagtgagaaaa

  15. Sequence Data: QH09606 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH09606 KG07G1736 a/t cctttctaaagatggaaggaaggtacaaggttgatacctgagtgcatgtaaattattgtgtttaaaatgcaccaaagaaaaaa...gtaagctagcatatgcaagtataaaaatgcttttctcaatgcaaaaaatgtttttggaaatttgttaaagtgttaagaaaacaaaaatgcattagaaaatatgaaaa...ttgttgacagtgatagctcaataaaaatttwaaaaattatgcaagttctatctgataaaagtgatatttaataaacttttagtttcttgtcattagctcttttgaaaa...tgatttttttgtattcagaacacagactccagtttagaaactaatacaaattttacctattcaagtgcttaattttacagcaaa...atggaaagtaaattttgttttgcctttatttctacagaagccactggtctcccccagacagtagtctgttataacccagaccagattcctccagaaaa

  16. Sequence Data: QH15563 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH15563 KG07K6447 c/g tgctgtctcatcttcaagacagtcaatttaaagtgaaggactsagaaatagagcttctaagggctgaaaa...cattttggtctaatttagacattaaaacgtcaattttaaatattatacaaaaaaactgccttatgtttttccccgttttaattttcagaattattgaagtaaatcaaaatcaaaa...gcaggtggaacaggatattaaagttgctatatttacactgatggtagaaataaataaaaaaggaaaagctctactgcatcagttagaggtaagtgactgcccatgggatagtata

  17. Sequence Data: QH12621 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH12621 KG00G2325 a/g ctcaaccacacacacacacccctcaaacaccacacacccacctcaaacaccacacacacatatccctcaaacactacaaaaacac...acacacacacctcaaacaccacacatgcacacacacctgaaacaccacacacctgcctcaaacactccacacacaccacacacagacacgtacaca...gccccccgcacccagccacagcttacacgcacacagacacgcgtacgcaggagaaagggtgtcaaagcttttgctagtcgtgaaggaaragcccgcagtccatggggctgcacggttttc

  18. Sequence Data: QH13192 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available QH13192 KG00G2416 c/t aaatgttttgtgaccttctctatgagtatcaaataaatagctcaaaaytgaaatatttaaaatgagactagaaaa...gtatttcttaaatatggtaaagagaatataaaataaaaaattaacattacctgtaacagaaaaacattagagaaacccttcttaaaaacaagatcaaaa...tatgggcgcacattgttaccacaggtaatgctgtcctgggtattcttatatgaaaatgaaataacaagactagtaatttaaagataaaaatgttattacactgtttaaataccaggaaaaatcaaa...tactaagaaatctgaaaaataaaaattatctagaaatttcactaacaaaggtaaccaggaatagataaacaattaaa...gatcaacttcattcaagttaattaaaacctctaaatagaaattataacacttctgcagaaatgattaaataaaaaggaggtatctcagggaggtggacctgaaagaaagattaattatatattttattagatagcacattcattcttaattatcagcagaa

  19. Type QH-200 conveyor-belt nuclear scale

    International Nuclear Information System (INIS)

    Li Shuming; Dong Shiyuan; Li Furong; Wan Zemin

    1991-01-01

    Type QH-200 conveyor-belt nuclear scale is a reliable and on-line device that weighs solids mass flow continuously by γ-ray absorption and scattering. The operation principle and measuring method are described. And some factors influencing the accuracy are discussed. The full scale total weight of type QH-200 nuclear scale is 10 6 t. The result of calibration in the industrial field shows that the accuracy of QH-200 is better than ±1.0% for typical belt loading

  20. Congenital Constriction Band Syndrome

    OpenAIRE

    Rajesh Gupta, Fareed Malik, Rishabh Gupta, M.A.Basit, Dara Singh

    2008-01-01

    Congenital constriction bands are anomalous bands that encircle a digit or an extremity. Congenitalconstriction band syndrome is rare condition and is mostly associated with other musculoskeletaldisorders.We report such a rare experience.

  1. Electrophysiology of Axonal Constrictions

    Science.gov (United States)

    Johnson, Christopher; Jung, Peter; Brown, Anthony

    2013-03-01

    Axons of myelinated neurons are constricted at the nodes of Ranvier, where they are directly exposed to the extracellular space and where the vast majority of the ion channels are located. These constrictions are generated by local regulation of the kinetics of neurofilaments the most important cytoskeletal elements of the axon. In this paper we discuss how this shape affects the electrophysiological function of the neuron. Specifically, although the nodes are short (about 1 μm) in comparison to the distance between nodes (hundreds of μm) they have a substantial influence on the conduction velocity of neurons. We show through computational modeling that nodal constrictions (all other features such as numbers of ion channels left constant) reduce the required fiber diameter for a given target conduction velocity by up to 50% in comparison to an unconstricted axon. We further show that the predicted optimal fiber morphologies closely match reported fiber morphologies. Supported by The National Science Foundation (IOS 1146789)

  2. Congenital constriction of the foramen of Monro

    International Nuclear Information System (INIS)

    Marions, O.; Boethius, J.

    1986-01-01

    We report two cases of hydrocephalus in adults. The radiological investigations and direct inspection during surgery in one of the cases indicate that the hydrocephalus is caused in both cases by a benign stricture in the region of the foramen of Monro and that this constriction is congenital. This origin of hydrocephalus has not been reported previously in adults. (orig.)

  3. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  4. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  5. Constrictive pericarditis in a contemporary Danish cohort

    DEFF Research Database (Denmark)

    Landex, Nadia Lander; Ihlemann, Nikolaj; Olsen, Peter Skov

    2015-01-01

    OBJECTIVES: The aetiology and outcome of constrictive pericarditis vary between geographic regions and has changed over time. We describe the diagnostic work-up and outcome in a contemporary cohort of Danish patients with constrictive pericarditis. DESIGN: Hospital databases were searched...... and inflammatory disease were the most prevalent underlying conditions. Diagnosis was made primarily by echocardiography and right- and left-sided cardiac catheterisation. Echocardiography was particularly notable for dilated inferior caval vein, increased E/A ratio, and high septal tissue velocity in addition...... to the presence of septal bounce. Pericardiectomy was performed in 47 patients with a 30-day mortality of 8.5%. Clinical improvement was noted in 69% of cases. Several echocardiographic parameters normalised with time, including markers of diastolic function. CONCLUSIONS: Long-term outcome after pericardiectomy...

  6. Cathode-constriction and column-constriction in high current vacuum arcs subjected to an axial magnetic field

    Science.gov (United States)

    Zhang, Zaiqin; Ma, Hui; Liu, Zhiyuan; Geng, Yingsan; Wang, Jianhua

    2018-04-01

    The influence of the applied axial magnetic field on the current density distribution in the arc column and electrodes is intensively studied. However, the previous results only provide a qualitative explanation, which cannot quantitatively explain a recent experimental data on anode current density. The objective of this paper is to quantitatively determine the current constriction subjected to an axial magnetic field in high-current vacuum arcs according to the recent experimental data. A magnetohydrodynamic model is adopted to describe the high current vacuum arcs. The vacuum arc is in a diffuse arc mode with an arc current ranged from 6 kArms to 14 kArms and an axial magnetic field ranged from 20 mT to 110 mT. By a comparison of the recent experimental work of current density distribution on the anode, the modelling results show that there are two types of current constriction. On one hand, the current on the cathode shows a constriction, and this constriction is termed as the cathode-constriction. On the other hand, the current constricts in the arc column region, and this constriction is termed as the column-constriction. The cathode boundary is of vital importance in a quantitative model. An improved cathode constriction boundary is proposed. Under the improved boundary, the simulation results are in good agreement with the recent experimental data on the anode current density distribution. It is demonstrated that the current density distribution at the anode is sensitive to that at the cathode, so that measurements of the anode current density can be used, in combination with the vacuum arc model, to infer the cathode current density distribution.

  7. Hydralazine-induced constrictive pericarditis

    NARCIS (Netherlands)

    Franssen, CFC; ElGamal, MIH; Gans, ROB; Hoorntje, SJ

    A 59-year-old man was diagnosed as having constrictive pericarditis 17 months after a typical hydralazine-induced autoimmune syndrome, This late complication of hydralazine has been reported only once. Ten years later the patient was found to have anti-neutrophil cytoplasmic antibodies directed

  8. Stenting of major airway constriction

    International Nuclear Information System (INIS)

    Wu Xiaomei

    2002-01-01

    Objective: To investigate the correlated issues in the stenting treatment of major airway constriction. Methods: Nineteen cases of major airway stenting procedure were studied retrospectively. The clinical choice of stents of different advantages or deficiencies were discussed. The importance of intravenous anesthesia supporting, life-parameters monitoring during the procedures and the prevention of complications were analysed. Results: Under intravenous and local anesthesia, 19 Wallstents had been successively placed and relieved 19 cases of major airway constrictions due to malignant or benign diseases (15 of tumors, 3 of tuberculosis, 1 of tracheomalacia). Intravenous anesthesia and life-parameters monitoring had made the procedures more safe and precise. Conclusions: Major airway stenting is an reliable method for relieving tracheobronchial stenosis; and intravenous anesthesia supporting and life-parameters monitoring guarantee the satisfactions of procedures

  9. Clogging in constricted suspension flows

    Science.gov (United States)

    Marin, Alvaro; Lhuissier, Henri; Rossi, Massimiliano; Kähler, Christian J.

    2018-02-01

    The flow of a charged-stabilized suspension through a single constricted channel is studied experimentally by tracking the particles individually. Surprisingly, the behavior is found to be qualitatively similar to that of inertial dry granular systems: For small values of the neck-to-particle size ratio (D /d reported for granular systems and agree for moderate particle volume fraction (ϕ ≈20 % ) with a simple stochastic model for the number of particles at the neck. For larger neck sizes (D /d >3 ), even at the largest ϕ (≈60 %) achievable in the experiments, an uninterrupted particle flow is observed, which resembles that of an hourglass. This particularly small value of D /d (≃3 ) at the transition to a practically uninterrupted flow is attributed to the low effective friction between the particles, achieved by the particle's functionalization and lubrication.

  10. [Permanent constrictions of the jaws (author's transl)].

    Science.gov (United States)

    Dupuis, A; Michaud, J

    1981-01-01

    Permanent constrictions of the jaws are of various types depending on the site of the lesion: temporomaxillary ankylosis, extra-articular constrictions of bone, skin, muscle, or mucosal origin, and those arising from tumors. The commonest cause is injury, those due to infection being currently less frequently observed, which cannot be said for those of tumoral origin. The consequences are difficulty in taking foud and poor buccodental hygiene, while temporomaxillary ankylosis in children provokes mandibular growth disturbances. Surgical treatment is aimed at removing the constriction. Total resection of the ankylosed block is essential to avoid recurrences, while reeducation of buccal opening must be started early and continued for long periods in all cases.

  11. Associação de retardo neuromotor e cromossomo 1qh +: registro de um caso

    Directory of Open Access Journals (Sweden)

    Salin Moyses Jorge

    1976-12-01

    Full Text Available Os autores registram um caso de retardo neuromotor em paciente com cromossomo 1qh+. A análise cromossômica do paciente e três familiares revelou igualmente em todos, aumento do braço longo do cromossomo n.° 1. Entretanto, é considerada a possibilidade de que o quadro clínico do paciente seja subordinado também a outros fatores, não genéticos.

  12. Advances towards QH-mode viability for ELM-stable operation in ITER

    International Nuclear Information System (INIS)

    Garofalo, A.M.; Burrell, K.H.; DeBoo, J.C.; Schaffer, M.J.; Snyder, P.B.; Solomon, W.M.; Park, J.-K.; Lanctot, M.J.; Reimerdes, H.; McKee, G.R.; Schmitz, L.

    2011-01-01

    The application of static, non-axisymmetric, nonresonant magnetic fields (NRMFs) to high beta DIII-D plasmas has allowed sustained operation with a quiescent H-mode (QH-mode) edge and both toroidal rotation and neutral beam injected torque near zero. Previous studies have shown that QH-mode operation can be accessed only if sufficient radial shear in the plasma flow is produced near the plasma edge. In past experiments, this flow shear was produced using neutral beam injection (NBI) to provide toroidal torque. In recent experiments, this torque was nearly completely replaced by the torque from applied NRMFs. The application of the NRMFs does not degrade the global energy confinement of the plasma. Conversely, the experiments show that the energy confinement quality increases with lower plasma rotation. Furthermore, the NRMF torque increases plasma resilience to locked modes at low rotation. These results open a path towards QH-mode utilization as an edge-localized mode (ELM)-stable H-mode in the self-heated burning plasma scenario, where toroidal momentum input from NBI may be small or absent.

  13. Echocardiography: pericardial thickening and constrictive pericarditis.

    Science.gov (United States)

    Schnittger, I; Bowden, R E; Abrams, J; Popp, R L

    1978-09-01

    A total of 167 patients with pericardial thickening noted on M node echocardiography were studied retrospectively. After the echocardiogram, 72 patients underwent cardiac surgery, cardiac catheterization or autopsy for various heart diseases; 96 patients had none of these procedures. In 49 patients the pericardium was directly visualized at surgery or autopsy; 76 percent of these had pericardial thickening or adhesions. In another 8 percent, pericardial adhesions were absent, but no comment had been made about the appearance of the pericardium itself. In the remaining 16 percent, no comment had been made about the pericardium or percardial space. Cardiac catheterization in 64 patients revealed 24 with hemodynamic findings of constrictive pericarditis or effusive constrictive disease. Seven echocardiographic patterns consistent with pericardial adhesions or pericardial thickening are described and related when possible to the subsequent findings at heart surgery or autopsy. The clinical diagnoses of 167 patients with pericardial thickening are presented. The hemodynamic diagnosis of constrictive pericardial disease was associated with the echocardiographic finding of pericardial thickening, but there were no consistent echocardiographic patterns of pericardial thickening diagnostic of constriction. However, certain other echocardiographic abnormalities of left ventricular posterior wall motion and interventricular septal motion and a high E-Fo slope were suggestive of constriction.

  14. Toward Defining "Vocal Constriction": Practitioner Perspectives.

    Science.gov (United States)

    Lemon-McMahon, Belinda; Hughes, Diane

    2018-01-01

    This research investigated the terminology used in relation to constriction of the singing voice from a range of practitioner perspectives. It focused on the locality, causes, consequences, management, trends, identification, and vocabulary of constriction. The research aimed to develop a holistic understanding of the term "vocal constriction" from participant experiences and perceptions (N = 10). Data collection occurred through in-depth, semi-structured interviews with a range of voice care professionals. Participants included three professional groups: (1) Ear, Nose, and Throat medical specialists or laryngologists, (2) speech pathologists or speech therapists, and (3) singing teachers. Purposive sampling was used to ensure that the participants from groups 1 and 2 had extensive experience with singers in their practice. The singing teachers were experienced in either classical or contemporary styles, or both. Participant responses highlighted a discrepancy in preferred terminology, with "constriction" being less favored overall. Several anatomical locations were identified including postural, supraglottic (anteroposterior and false fold), articulatory, and in the intrinsic and extrinsic laryngeal musculature; psychological issues were also identified. Primary causes, secondary causes, and influencing factors were identified. Inefficient technique and poor posture or alignment were considered primary causes; similarly, emotion and anxiety or stress were identified as influencing factors by the majority of participants. There was less uniformity in responses regarding other causes. The major findings of this research are the respective participant group distinctions, an uncertainty regarding anteroposterior constriction, and that the location and effects of constriction are individual to the singer and must be considered contextually. A definition is offered, and areas for further research are identified. Copyright © 2018 The Voice Foundation. Published by

  15. Nanoscale constrictions in superconducting coplanar waveguide resonators

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, Mark David; Naether, Uta; Ciria, Miguel; Zueco, David; Luis, Fernando, E-mail: fluis@unizar.es [Instituto de Ciencia de Materiales de Aragón, CSIC—Universidad de Zaragoza, 50009 Zaragoza (Spain); Departamento de Física de la Materia Condensada, Universidad de Zaragoza, 50009 Zaragoza (Spain); Sesé, Javier [Instituto de Nanociencia de Aragón, Universidad de Zaragoza, E-50009 Zaragoza (Spain); Departamento de Física de la Materia Condensada, Universidad de Zaragoza, 50009 Zaragoza (Spain); Atkinson, James; Barco, Enrique del [Department of Physics, University of Central Florida, Orlando, Florida 32816 (United States); Sánchez-Azqueta, Carlos [Dpto. de Ingeniería Electrónica y Telecomunicaciones, Universidad de Zaragoza, 50009 Zaragoza (Spain); Majer, Johannes [Vienna Center for Quantum Science and Technology, Atominstitut, TU Wien, 1020 Vienna (Austria)

    2014-10-20

    We report on the design, fabrication, and characterization of superconducting coplanar waveguide resonators with nanoscopic constrictions. By reducing the size of the center line down to 50 nm, the radio frequency currents are concentrated and the magnetic field in its vicinity is increased. The device characteristics are only slightly modified by the constrictions, with changes in resonance frequency lower than 1% and internal quality factors of the same order of magnitude as the original ones. These devices could enable the achievement of higher couplings to small magnetic samples or even to single molecular spins and have applications in circuit quantum electrodynamics, quantum computing, and electron paramagnetic resonance.

  16. Diastolic Pressure in Congestive Cardiomyopathy and Constrictive ...

    African Journals Online (AJOL)

    1974-03-16

    Mar 16, 1974 ... tive pericarditis was studied before pericardiectomy. The constriction was of tuberculous origin in 27 patients, amoebic in one and post-traumatic in two. All patients had rested in bed for 2-3 weeks before the study and were receiving digitalis and diuretics at the time of cardiac catheterisation. Their disability ...

  17. Pregnancy complicating irradiation-induced constrictive pericarditis

    Energy Technology Data Exchange (ETDEWEB)

    Bakri, Younes N.; Martan, Ahmed; Amri, Aladin (King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia). Dept. of Obstetrics and Gynecology); Amri, M. (King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia). Dept. of Cardiovascular Diseases)

    1992-01-01

    A case is reported of a 24 year-old primigravida who had severe effusive constrictive pericarditis secondary to mediastinal irradiation following chemotherapy for Hodgkins disease. Pregnancy was threatened by serious maternal cardiovascular complications and a non-viable fetus was born spontaneously and prematurely. Patient was completely asymptomatic before pregnancy. (au).

  18. Changes of the eye optics after iris constriction

    Directory of Open Access Journals (Sweden)

    Robert Montés-Micó

    2010-10-01

    Conclusion: Iris constriction slightly modifies the optics of the eye. The small hyperopic shift of the best image plane after iris constriction may be explained by a change in the lens shape and/or position.

  19. A constricted quantum Hall system as a beam-splitter: understanding ballistic transport on the edge

    International Nuclear Information System (INIS)

    Lal, Siddhartha

    2007-09-01

    We study transport in a model of a quantum Hall edge system with a gate-voltage controlled constriction. A finite backscattered current at finite edge-bias is explained from a Landauer- Buttiker analysis as arising from the splitting of edge current caused by the difference in the filling fractions of the bulk (ν 1 ) and constriction(ν 2 ) quantum Hall fluid regions. We develop a hydrodynamic theory for bosonic edge modes inspired by this model. The constriction region splits the incident long-wavelength chiral edge density-wave excitations among the transmitting and reflecting edge states encircling it. These findings provide satisfactory explanations for several puzzling recent experimental results. These results are confirmed by computing various correlators and chiral linear conductances of the system. In this way, our results find excellent agreement with some of the recent puzzling experimental results for the cases of ν 1 = 1/3, 1. (author)

  20. Diffuse and constricted modes of a dc discharge in neon: Simulation of the hysteresis transition

    International Nuclear Information System (INIS)

    Shkurenkov, I. A.; Mankelevich, Yu. A.; Rakhimova, T. V.

    2008-01-01

    Results are presented from theoretical studies of high-pressure (∼100 Torr) dc discharges in neon. The diffuse and constricted discharge modes are studied using a model including the equation of balance for charged and excited particles, heat conduction equations for the neutral gas and plasma electrons, and Poisson's equation for the radial electric field at a fixed total discharge current. A specific feature of the constricted mode in the investigated range of low fields and high degrees of ionization is that the excitation and ionization rates in the center of the discharge tube and at the periphery differ by several orders of magnitude. This implies that, in the constricted mode, the region where the electron energy distribution function is Maxwellian due to electron-electron collisions may adjoin the region (beyond the constriction zone) where the high-energy part of the distribution function is depleted. The hysteresis transition between the diffuse and constricted modes is analyzed. A transition from the constricted to the diffuse mode can be regarded as a manifestation of the nonlocal character of the formation of the electron distribution function, specifically, the diffusion of high-energy electrons capable of producing gas ionization from the central (constricted) region toward the periphery. The nonlocal formation of the distribution function is described by a nonlocal kinetic equation accounting for electron-electron collisions and electron transport along the radius of the discharge tube. Since only high-energy electrons produce gas ionization, the effect of the nonlocal formation of the electron distribution function is taken into account by introducing the effective temperature of the high-energy part of the distribution function and solving the equation for the radial profile of the high-energy part of the distribution function. This approach allows one to approximately take into account the nonlocal character of the electron distribution

  1. Associação de retardo neuromotor e cromossomo 1qh +: registro de um caso Significance of neuromotor retardation in association with chromosome 1qh+: a case report

    Directory of Open Access Journals (Sweden)

    Salin Moyses Jorge

    1976-12-01

    Full Text Available Os autores registram um caso de retardo neuromotor em paciente com cromossomo 1qh+. A análise cromossômica do paciente e três familiares revelou igualmente em todos, aumento do braço longo do cromossomo n.° 1. Entretanto, é considerada a possibilidade de que o quadro clínico do paciente seja subordinado também a outros fatores, não genéticos.A case of neuromotor retardation in association with chromosome 1qh+ is reported. Chromosomes analysis of the patient and three relatives showed increased long arm of the n.° 1 chromosome, in all of them. However it is emphasized that the clinical feature could be secondary to various non genetics factors, also.

  2. Improving the Q:H strength ratio in women using plyometric exercises.

    Science.gov (United States)

    Tsang, Kavin K W; DiPasquale, Angela A

    2011-10-01

    Plyometric training programs have been implemented in anterior cruciate ligament injury prevention programs. Plyometric exercises are designed to aid in the improvement of muscle strength and neuromuscular control. Our purpose was to examine the effects of plyometric training on lower leg strength in women. Thirty (age = 20.3 ± 1.9 years) recreationally active women were divided into control and experimental groups. The experimental group performed a plyometric training program for 6 weeks, 3 d·wk(-1). All subjects attended 4 testing sessions: before the start of the training program and after weeks 2, 4, and 6. Concentric quadriceps and hamstring strength (dominant leg) was assessed using an isokinetic dynamometer at speeds of 60 and 120°·s(-1). Peak torque, average peak torque, and average power (AvgPower) were measured. The results revealed a significant (p plyometric group than in the control group at testing session 4 and that AvgPower was greater in the plyometric group than in the control group in testing sessions 2-4. Our results indicate that the plyometric training program increased hamstring strength while maintaining quadriceps strength, thereby improving the Q:H strength ratio.

  3. Foam flows through a local constriction

    Science.gov (United States)

    Chevalier, T.; Koivisto, J.; Shmakova, N.; Alava, M. J.; Puisto, A.; Raufaste, C.; Santucci, S.

    2017-11-01

    We present an experimental study of the flow of a liquid foam, composed of a monolayer of millimetric bubbles, forced to invade an inhomogeneous medium at a constant flow rate. To model the simplest heterogeneous fracture medium, we use a Hele-Shaw cell consisting of two glass plates separated by a millimetric gap, with a local constriction. This single defect localized in the middle of the cell reduces locally its gap thickness, and thus its local permeability. We investigate here the influence of the geometrical property of the defect, specifically its height, on the average steady-state flow of the foam. In the frame of the flowing foam, we can observe a clear recirculation around the obstacle, characterized by a quadrupolar velocity field with a negative wake downstream the obstacle, which intensity evolves systematically with the obstacle height.

  4. Congenital constriction ring syndrome of the limbs: A prospective ...

    African Journals Online (AJOL)

    In the upper limb malformations involved 42 digits; in the lower limb malformations involved 33 toes, one foot and fi ve legs. Four main types of lesions were found: constriction rings, intrauterine amputations, acrosyndactyly, and simple syndactyly. Conclusion: Congenital constriction ring syndrome is of uncertain aetiology ...

  5. Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

    Science.gov (United States)

    Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

    1995-01-01

    Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

  6. Penile constriction injury: An experience of four cases

    Directory of Open Access Journals (Sweden)

    Ajit Somaji Sawant

    2016-01-01

    Full Text Available Penile injury due to constriction by a foreign object is a rare known complication, commonly seen in pediatric age group. We report four cases of penile constriction injury in adults due to various foreign objects and different indications. Between October 2014 and March 2016, four patients (mean age 42.5 years presented with penile constriction injury with duration at presentation ranging from 18 h to 2 months. One patient had complete transection of the corpus and penile urethra. Three patients were managed successfully with daily dressings followed by split-skin grafting in one patient. One patient required delayed primary suturing after the resolution of local edema. The outcome was satisfactory in all patients with retained erectile function. Early medical attention and management is the key to success in penile constriction injury cases and to avoid complications and morbidity. Prompt removal can be challenging in cases of metal foreign bodies.

  7. Search for top quark decays $t \\rightarrow qH$ with $H \\to \\gamma\\gamma$ using the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmad, Ashfaq; Ahmadov, Faig; Aielli, Giulio; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Sarah; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batkova, Lucia; Batley, Richard; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertolucci, Federico; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Branchini, Paolo; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Gareth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Kevin; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collins-Tooth, Christopher; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; De Zorzi, Guido; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Degenhardt, James; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobos, Daniel; Dobson, Ellie; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gandrajula, Reddy Pratap; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Grybel, Kai; Guan, Liang; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Gunther, Jaroslav; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageboeck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Heisterkamp, Simon; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hofmann, Julia Isabell; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idarraga, John; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Ivarsson, Jenny; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Karnevskiy, Mikhail; Karpov, Sergey; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Keener, Paul; Kehoe, Robert; Keil, Markus; Keller, John; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kitamura, Takumi; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le, Bao Tran; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Jean-Pierre; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Matricon, Pierre; Matsushita, Takashi; Mättig, Peter; Mättig, Stefan; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Moeller, Victoria; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newcomer, Mitchel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novakova, Jana; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Ohshima, Takayoshi; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petteni, Michele; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospelov, Guennady; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romeo, Gaston; Romero Adam, Elena; Rompotis, Nikolaos; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Christopher; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Sherwood, Peter; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snow, Joel; Snyder, Scott; Sobie, Randall; Socher, Felix; Sodomka, Jaromir; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sopko, Bruno; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spighi, Roberto; Spigo, Giancarlo; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steele, Genevieve; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramania, Halasya Siva; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tamsett, Matthew; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thoma, Sascha; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Triplett, Nathan; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Berg, Richard; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Wolfgang; Wagner, Peter; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watanabe, Ippei; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wilson, Alan; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zaytsev, Alexander; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

    2014-01-01

    A search is performed for flavour-changing neutral currents in the decay of a top quark to an up-type ($c, u$) quark and a Higgs boson, where the Higgs boson decays to two photons. The proton-proton collision data set used corresponds to 4.7 fb$^{-1}$ at $\\sqrt{s}$ = 7 TeV and 20.3 fb$^{-1}$ at $\\sqrt{s}$ = 8 TeV collected by the ATLAS experiment at the LHC. Top quark pair events are searched for in which one top quark decays to $qH$ and the other decays to $bW$. Both the hadronic and the leptonic decay modes of the $W$ boson are used. No significant signal is observed and an upper limit is set on the $t\\rightarrow qH$ branching ratio of 0.79% at the 95% confidence level. The corresponding limit on the $tqH$ coupling combination $\\sqrt{\\lambda_{tcH}^{2} + \\lambda_{tuH}^{2}}$ is 0.17.

  8. Rapidly progressive effusive constrictive pericarditis caused by methicillin sensitive Staphylococcus aureus (MSSA). samraakhtar@hotmail.com.

    Science.gov (United States)

    Akhtar, Naveed; Khalid, Ayesha; Ahmed, Waqas; Rasheed, Khalid

    2010-04-01

    Effusive-constrictive pericarditis is a clinical syndrome characterized by concurrent pericardial effusion and pericardial constriction, where constrictive hemodynamics are persistent after effusion is drained. It may present at any point along the clinical course, from the occurrence of an effusion to the development of chronic pericardial constriction. We refer an unusual case of effusive constrictive pericarditis developing rapidly within days, following purulent pericarditis secondary to chest trauma.

  9. Transport in constricted quantum Hall systems: beyond the Kane-Fisher paradigm

    International Nuclear Information System (INIS)

    Lal, Siddhartha

    2007-08-01

    A simple model of edge transport in a constricted quantum Hall system with a lowered local fi lling factor is studied. The current backscattered from the constriction is explained from a matching of the properties of the edge-current excitations in the constriction (ν 2 ) and bulk (ν 1 ) regions. We develop a hydrodynamic theory for bosonic edge modes inspired by this model, stressing the importance of boundary conditions in elucidating the nature of current transport. By invoking a generalised quasiparticle-quasihole symmetry of the quantum Hall circuit system, we fi nd that a competition between two tunneling process determines the fate of the low-bias transmission conductance. A novel generalisation of the Kane-Fisher quantum impurity model is found, describing transitions from a weak-coupling theory at partial transmission to strong- coupling theories for perfect transmission and reflection as well as a new symmetry dictated fixed point. These results provide satisfactory explanations for recent experimental results at fi lling-factors of 1/3 and 1. (author)

  10. Propionibacterium acnes: A Treatable Cause of Constrictive Pericarditis

    Directory of Open Access Journals (Sweden)

    Daniel Cruz

    2015-01-01

    Full Text Available In this case report we share a case of infective Pericarditis caused by Propionibacterium acnes (P. acnes in an immune-competent, nonsurgical patient. This case and review will illustrate the importance of considering P. acnes as a cause of idiopathic pericardial effusion and effusive constrictive disease. The patient was a 61-year-old male with history of osteoarthritis of the knee. He received an intra-articular steroid injection in July 2013. Two months later, he presented with atrial fibrillation and heart failure. He was found to have pericardial and bilateral pleural effusions which grew P. acnes. This organism was initially considered to be contaminant; however, as P. acnes was isolated from both pleural and pericardial fluids, he was started on oral amoxicillin. He was noted to have recurrence of effusions within 2 weeks with evidence of constrictive physiology by echocardiography. Treatment was subsequently changed to intravenous Penicillin G with marked symptomatic improvement, resolution of pericardial/pleural effusions, and no echocardiographic evidence of constrictive pericarditis at 10 weeks follow-up. Pursuit and treatment of P. acnes could lead to prevention of constrictive pericarditis. We believe that further studies are needed to assess prevalence of P. acnes and response to intravenous Penicillin G in patients presenting with effusive constrictive disease.

  11. Size, but not experience, affects the ontogeny of constriction performance in ball pythons (Python regius).

    Science.gov (United States)

    Penning, David A; Dartez, Schuyler F

    2016-03-01

    Constriction is a prey-immobilization technique used by many snakes and is hypothesized to have been important to the evolution and diversification of snakes. However, very few studies have examined the factors that affect constriction performance. We investigated constriction performance in ball pythons (Python regius) by evaluating how peak constriction pressure is affected by snake size, sex, and experience. In one experiment, we tested the ontogenetic scaling of constriction performance and found that snake diameter was the only significant factor determining peak constriction pressure. The number of loops applied in a coil and its interaction with snake diameter did not significantly affect constriction performance. Constriction performance in ball pythons scaled differently than in other snakes that have been studied, and medium to large ball pythons are capable of exerting significantly higher pressures than those shown to cause circulatory arrest in prey. In a second experiment, we tested the effects of experience on constriction performance in hatchling ball pythons over 10 feeding events. By allowing snakes in one test group to gain constriction experience, and manually feeding snakes under sedation in another test group, we showed that experience did not affect constriction performance. During their final (10th) feedings, all pythons constricted similarly and with sufficiently high pressures to kill prey rapidly. At the end of the 10 feeding trials, snakes that were allowed to constrict were significantly smaller than their non-constricting counterparts. © 2016 Wiley Periodicals, Inc.

  12. Multidisciplinary emergent removal of a metal penoscrotal constriction device

    LENUS (Irish Health Repository)

    Nason, GJ

    2017-03-01

    Strangulation of the genital organs is a rare presentation to the emergency department which requires urgent intervention to avoid long term complications. Penoscrotal constriction devices are either used for autoerotic stimulus or to increase sexual performance by maintaining an erection for a longer period. We report a case of a man who presented with penile strangulation following the application of a titanium penoscrotal constriction ring during sexual intercourse seven hours previously. The Fire Brigade department attended with an electric operated angle grinder to facilitate removal of the ring as standard medical equipment (orthopaedic saws, bolt and bone cutters) were insufficient. Fully functional recovery was achieved.

  13. Bubble propagation in Hele-Shaw channels with centred constrictions

    Science.gov (United States)

    Franco-Gómez, Andrés; Thompson, Alice B.; Hazel, Andrew L.; Juel, Anne

    2018-04-01

    We study the propagation of finite bubbles in a Hele-Shaw channel, where a centred occlusion (termed a rail) is introduced to provide a small axially uniform depth constriction. For bubbles wide enough to span the channel, the system’s behaviour is similar to that of semi-infinite fingers and a symmetric static solution is stable. Here, we focus on smaller bubbles, in which case the symmetric static solution is unstable and the static bubble is displaced towards one of the deeper regions of the channel on either side of the rail. Using a combination of experiments and numerical simulations of a depth-averaged model, we show that a bubble propagating axially due to a small imposed flow rate can be stabilised in a steady symmetric mode centred on the rail through a subtle interaction between stabilising viscous forces and destabilising surface tension forces. However, for sufficiently large capillary numbers Ca, the ratio of viscous to surface tension forces, viscous forces in turn become destabilising thus returning the bubble to an off-centred propagation regime. With decreasing bubble size, the range of Ca for which steady centred propagation is stable decreases, and eventually vanishes through the coalescence of two supercritical pitchfork bifurcations. The depth-averaged model is found to accurately predict all the steady modes of propagation observed experimentally, and provides a comprehensive picture of the underlying steady bifurcation structure. However, for sufficiently large imposed flow rates, we find that initially centred bubbles do not converge onto a steady mode of propagation. Instead they transiently explore weakly unstable steady modes, an evolution which results in their break-up and eventual settling into a steady propagating state of changed topology.

  14. Poor outcome in radiation-induced constrictive pericarditis

    International Nuclear Information System (INIS)

    Karram, T.; Rinkevitch, D.; Markiewicz, W.

    1993-01-01

    The purpose was to compare the outcome of patients with radiation-induced constrictive pericarditis versus patients with constiction due to another etiology. Twenty patients with constrictive pericarditis were seen during 1975-1986 at a single medical center. Six had radiation-induced constrictive pericarditis (Group A). The etiology was idiopathic in ten subjects and secondary to carcinomatous encasement, chronic renal failure, purulent infection and tuberculosis in one patient each (Group B, N = 14). Meang age was 53.4 ± 15.5 years. Extensive pericardiectomy was performed in 3/6 Group A and 13/14 Group B patients. All Group A patients died, 4 weeks - 11 years post-diagnosis (median = 10 months). Two Group A patients died suddenly, one died post-operatively of respiratory failure, another of pneumonia and two of recurrent carcinoma. Thirteen Group B patients are alive (median follow-up = 72 months). The only death in this group was due to metastatic cancer. The poor outcome with radiation-induced constriction is probably multi-factorial. Poor surgical outcome is to be expected in patients with evidence of recurrent tumor, high-dose irradiation, pulmonary fibrosis or associated radiation-induced myocardinal, valvular or coronary damage

  15. Satiety and eating patterns in two species of constricting snakes

    DEFF Research Database (Denmark)

    Nielsen, Torben P; Jacobsen, Magnus W.; Wang, Tobias

    2011-01-01

    Satiety has been studied extensively in mammals, birds and fish but very little information exists on reptiles. Here we investigate time-dependent satiation in two species of constricting snakes, ball pythons (Python regius) and yellow anacondas (Eunectes notaeus). Satiation was shown to depend...

  16. Poor outcome in radiation-induced constrictive pericarditis

    Energy Technology Data Exchange (ETDEWEB)

    Karram, T.; Rinkevitch, D.; Markiewicz, W. (Technion Medical School, Haifa (Israel))

    1993-01-15

    The purpose was to compare the outcome of patients with radiation-induced constrictive pericarditis versus patients with constiction due to another etiology. Twenty patients with constrictive pericarditis were seen during 1975-1986 at a single medical center. Six had radiation-induced constrictive pericarditis (Group A). The etiology was idiopathic in ten subjects and secondary to carcinomatous encasement, chronic renal failure, purulent infection and tuberculosis in one patient each (Group B, N = 14). Meang age was 53.4 [+-] 15.5 years. Extensive pericardiectomy was performed in 3/6 Group A and 13/14 Group B patients. All Group A patients died, 4 weeks - 11 years post-diagnosis (median = 10 months). Two Group A patients died suddenly, one died post-operatively of respiratory failure, another of pneumonia and two of recurrent carcinoma. Thirteen Group B patients are alive (median follow-up = 72 months). The only death in this group was due to metastatic cancer. The poor outcome with radiation-induced constriction is probably multi-factorial. Poor surgical outcome is to be expected in patients with evidence of recurrent tumor, high-dose irradiation, pulmonary fibrosis or associated radiation-induced myocardinal, valvular or coronary damage.

  17. Active elastohydrodynamics of vesicles in narrow blind constrictions

    Science.gov (United States)

    Fai, T. G.; Kusters, R.; Harting, J.; Rycroft, C. H.; Mahadevan, L.

    2017-11-01

    Fluid-resistance limited transport of vesicles through narrow constrictions is a recurring theme in many biological and engineering applications. Inspired by the motor-driven movement of soft membrane-bound vesicles into closed neuronal dendritic spines, here we study this problem using a combination of passive three-dimensional simulations and a simplified semianalytical theory for the active transport of vesicles forced through constrictions by molecular motors. We show that the motion of these objects is characterized by two dimensionless quantities related to the geometry and to the strength of forcing relative to the vesicle elasticity. We use numerical simulations to characterize the transit time for a vesicle forced by fluid pressure through a constriction in a channel and find that relative to an open channel, transport into a blind end leads to the formation of a smaller forward-flowing lubrication layer that strongly impedes motion. When the fluid pressure forcing is complemented by forces due to molecular motors that are responsible for vesicle trafficking into dendritic spines, we find that the competition between motor forcing and fluid drag results in multistable dynamics reminiscent of the real system. Our study highlights the role of nonlocal hydrodynamic effects in determining the kinetics of vesicular transport in constricted geometries.

  18. Shooting quasiparticles from Andreev bound states in a superconducting constriction

    Energy Technology Data Exchange (ETDEWEB)

    Riwar, R.-P.; Houzet, M.; Meyer, J. S. [University of Grenoble Alpes, INAC-SPSMS (France); Nazarov, Y. V., E-mail: Y.V.Nazarov@tudelft.nl [Delft University of Technology, Kavli Institute of NanoScience (Netherlands)

    2014-12-15

    A few-channel superconducting constriction provides a set of discrete Andreev bound states that may be populated with quasiparticles. Motivated by recent experimental research, we study the processes in an a.c. driven constriction whereby a quasiparticle is promoted to the delocalized states outside the superconducting gap and flies away. We distinguish two processes of this kind. In the process of ionization, a quasiparticle present in the Andreev bound state is transferred to the delocalized states leaving the constriction. The refill process involves two quasiparticles: one flies away while another one appears in the Andreev bound state. We notice an interesting asymmetry of these processes. The electron-like quasiparticles are predominantly emitted to one side of the constriction while the hole-like ones are emitted to the other side. This produces a charge imbalance of accumulated quasiparticles, that is opposite on opposite sides of the junction. The imbalance may be detected with a tunnel contact to a normal metal lead.

  19. Bacterial growth and motility in sub-micron constrictions

    NARCIS (Netherlands)

    Männik, J.; Driessen, R.; Galajda, P.; Keymer, J.E.; Dekker, C.

    2009-01-01

    In many naturally occurring habitats, bacteria live in micrometer-size confined spaces. Although bacterial growth and motility in such constrictions is of great interest to fields as varied as soil microbiology, water purification, and biomedical research, quantitative studies of the effects of

  20. Atypical Presentation of Constrictive Pericarditis in a Holstein Heifer

    Directory of Open Access Journals (Sweden)

    Mohamed M. Elhanafy

    2012-01-01

    Full Text Available The field diagnosis of constrictive pericardial effusion is often established on the pertinent pathognomonic physical examination findings, but the condition cannot be ruled out based on absence of these cardinal signs. Constrictive pericardial effusion is not always manifested by bilateral jugular venous distention and pulsation, brisket edema, and muffled heart sounds, all of which are considered the key points in the field diagnosis of pericardial effusion and hardware disease. This case will also document that the outcomes of hematology, serum biochemistry panels, and blood gas analysis can be totally inconsistent with passive venous congestion and constrictive pericardial effusion in cattle. Chest radiographic findings revealed radio dense, wire-like objects; the findings were suggestive but not conclusive for pericardial or pleural effusions, due to indistinguishable diaphragmatic outline and cardiopulmonary silhouette. Cardiac ultrasonography was found to be an excellent paraclinical diagnostic procedure for cases that potentially have traumatic pericarditis and constrictive pericardial effusion. Ultrasound-guided pericardiocentesis was also a valuable diagnostic aid in establishing a definitive diagnosis.

  1. Improved sensitivity and limit-of-detection of lateral flow devices using spatial constrictions of the flow-path.

    Science.gov (United States)

    Katis, Ioannis N; He, Peijun J W; Eason, Robert W; Sones, Collin L

    2018-05-03

    We report on the use of a laser-direct write (LDW) technique that allows the fabrication of lateral flow devices with enhanced sensitivity and limit of detection. This manufacturing technique comprises the dispensing of a liquid photopolymer at specific regions of a nitrocellulose membrane and its subsequent photopolymerisation to create impermeable walls inside the volume of the membrane. These polymerised structures are intentionally designed to create fluidic channels which are constricted over a specific length that spans the test zone within which the sample interacts with pre-deposited reagents. Experiments were conducted to show how these constrictions alter the fluid flow rate and the test zone area within the constricted channel geometries. The slower flow rate and smaller test zone area result in the increased sensitivity and lowered limit of detection for these devices. We have quantified these via the improved performance of a C-Reactive Protein (CRP) sandwich assay on our lateral flow devices with constricted flow paths which demonstrate an improvement in its sensitivity by 62x and in its limit of detection by 30x when compared to a standard lateral flow CRP device. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  2. A Study on Water Surface Profiles of Rivers with Constriction

    Science.gov (United States)

    Qian, Chaochao; Yamada, Tadashi

    2013-04-01

    Water surface profile of rivers with constrictions is precious in both classic hydraulics and river management practice. This study was conducted to clarify the essences of the water surface profiles. 3 cases of experiments and 1D numerical calculations with different discharges were made in the study and analysis solutions of the non-linear basic equation of surface profile in varied flow without considering friction were derived. The manning's number was kept in the same in each case by using crosspiece roughness. We found a new type of water surface profile of varied flow from the results of 1D numerical calculation and that of experiments and named it as Mc curve because of its mild condition with constriction segment. This kind of curves appears as a nature phenomenon ubiquitously. The process of water surface forming is dynamic and bore occurs at the upper side of constriction during increasing discharge before the surface profile formed. As a theoretical work, 3 analysis solutions were derived included 2 physical-meaning solutions in the study by using Man-Machine system. One of the derived physical-meaning solutions was confirmed that it is validity by comparing to the results of 1D numerical calculation and that of experiments. The solution represents a flow profile from under critical condition at the upper side to super critical condition at the down side of constriction segment. The other derived physical-meaning solution represents a flow profile from super critical condition at the upper side to under critical condition at the down side of constriction segment. These two kinds of flow profiles exist in the nature but no theoretical solution can express the phenomenon. We find the depth distribution only concerned with unit width discharge distribution and critical depth under a constant discharge from the derived solutions. Therefor, the profile can be gained simply and precisely by using the theoretical solutions instead of numerical calculation even

  3. Enhanced oxygen dissociation in a propagating constricted discharge formed in a self-pulsing atmospheric pressure microplasma jet

    Science.gov (United States)

    Schröder, Daniel; Burhenn, Sebastian; Kirchheim, Dennis; Schulz-von der Gathen, Volker

    2013-11-01

    We report on the propagation of a constricted discharge feature in a repetitively self-pulsing microplasma jet operated in helium with a 0.075 vol% molecular oxygen admixture in ambient air environment. The constricted discharge is about 1 mm in width and repetitively ignites at the point of smallest electrode distance in a wedge-shaped electrode configuration, propagates through the discharge channel towards the nozzle, extinguishes, and re-ignites at the inlet at frequencies in the kHz range. It co-exists with a homogeneous, volume-dominated low temperature (T ⋍ 300 K) α-mode glow. Time-resolved measurements of nitrogen molecule C-state and nitrogen molecule ion B-state emission bands reveal an increase of the rotational temperature within the constricted discharge to about 600 K within 50 µs. Its propagation velocity was determined by phase-resolved diagnostics to be similar to the gas velocity, in the order of 40 m s-1. Two-photon absorption laser-induced fluorescence spectroscopy synchronized to the self-pulsing reveals spatial regions of increased oxygen atom densities co-propagating with the constricted discharge feature. The generated oxygen pulse density is about ten times higher than in the co-existing homogeneous α-mode. Densities reach about 1.5 × 1016 cm-3 at average temperatures of 450 K at the nozzle. This enhanced dissociation of about 80% is attributed to the continuous interaction of the constricted discharge to the co-propagating gas volume.

  4. Physics of increased edge electron temperature and density turbulence during ELM-free QH-mode operation on DIII-D

    Science.gov (United States)

    Sung, C.; Rhodes, T. L.; Staebler, G. M.; Yan, Z.; McKee, G. R.; Smith, S. P.; Osborne, T. H.; Peebles, W. A.

    2018-05-01

    For the first time, we report increased edge electron temperature and density turbulence levels ( T˜ e and n˜ e) in Edge Localized Mode free Quiescent H-mode (ELM-free QH-mode) plasmas as compared to the ELMing time period. ELMs can severely damage plasma facing components in fusion plasma devices due to their large transient energy transport, making ELM-free operation a highly sought after goal. The QH-mode is a candidate for this goal as it is ELM-free for times limited only by hardware constraints. It is found that the driving gradients decrease during the QH-mode compared to the ELMing phase, however, a significant decrease in the ExB shearing rate is also observed that taken together is consistent with the increased turbulence. These results are significant as the prediction and control of ELM-free H-mode regimes are crucial for the operation of future fusion devices such as ITER. The changes in the linear growth rates calculated by CGYRO [Candy et al., J. Comput. Phys. 324, 73 (2016)] and the measured ExB shearing rate between ELMing and QH-mode phases are qualitatively consistent with these turbulence changes. Comparison with ELMing and 3D fields ELM suppressed H-mode finds a similar increase in T˜ e and n˜ e, however, with distinctly different origins, the increased driving gradients rather than the changes in the ExB shearing rate in 3D fields ELM suppressed the H-mode. However, linear gyrokinetic calculation results are generally consistent with the increased turbulence in both ELM-controlled discharges.

  5. A rare combination of amniotic constriction band with osteogenesis imperfecta.

    Science.gov (United States)

    Shah, Krupa Hitesh; Shah, Hitesh

    2015-11-11

    Amniotic constriction bands and osteogenesis imperfecta are disorders arising from a collagen defect. We report a rare association of amniotic bands with osteogenesis imperfecta in a child. The child was born with multiple amniotic bands involving the right leg, both hands and both feet. Multiple fractures of long bones of lower limbs occurred in childhood due to trivial trauma. Deformities of the femur and tibia due to malunion with osteopenia and blue sclerae were present. The patient was treated with z plasty of constriction band of the right tibia and bisphosphonate for osteogenesis imperfecta. This rare association of both collagen diseases may provide further insight for the pathogenesis of these diseases. 2015 BMJ Publishing Group Ltd.

  6. Occupational (? constrictive bronchiolitis with normal physical, functional and image findings

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2009-07-01

    Full Text Available Constrictive bronchiolitis is characterized by alterations in the walls of membranous and respiratory bronchioles. These changes lead to concentric narrowing or complete obliteration of the airway lumen. Suspicion of possible bronchiolar disorders may arise from clinical, funcional, and radiologic findings. However, constrictive bronchiolitis may be present even with normal physical, functional and image findings, which turns the diagnosis difficult. A high index of suspicion is necessary to justify invasive tests that lead to pulmonary biopsy. In this report, we describe a patient with cough and dyspnoea, with normal physical, functional and image findings, whose work-up leaded to the diagnosis of constrictive bronchiolitis. Resumo: A bronquiolite constritiva é caracterizada por alterações das paredes dos bronquíolos membranosos e respiratórios. Estas alterações incluem um espectro de alterações que podem variar, desde a inflamação à fibrose concêntrica progressiva, com obstrução completa do lúmen bronquiolar. O diagnóstico pode ser sugerido pela história clínica e por alterações radiológicas e funcionais. No entanto, o exame físico e os exames complementares de diagnóstico podem ser normais, o que dificulta o diagnóstico, sendo necessário um elevado índice de suspeita para se sujeitar o doente a exames invasivos, tal como a biópsia pulmonar cirúrgica. Os autores apresentam um caso clínico de uma doente com quadro arrastado de tosse e dispneia, com exame físico, funcional e imagiológico normais, cujo estudo exaustivo veio a revelar o diagnóstico de bronquiolite constritiva. Key-words: Constrictive bronchiolitis, iron oxide, Palavras-chave: Bronquiolite constritiva, óxido de ferro

  7. Relationship between conductive hearing loss and maxillary constriction.

    Science.gov (United States)

    Peyvandi, A A; Jamilian, A; Moradi, E

    2014-09-01

    To evaluate the relationship between conductive hearing loss and maxillary constriction. A total of 120 people, aged from 7 to 40 years, who were referred to an audiologist when taking out health insurance or for school pre-registration check-up, were selected for this study. A total of 60 participants who had hearing threshold levels greater than 15 dB in both ears were chosen as the conductive hearing loss group. The remaining 60, with normal hearing thresholds of less than 15 dB, were used as the control group. All participants were referred to an orthodontic clinic. Participants who had a posterior crossbite and high palatal vault were considered to suffer from maxillary constriction. There were no significant differences between the sex ratios and mean ages of the groups. However, participants with conductive hearing loss were 3.5 times more likely than controls to suffer from maxillary constriction. Patients who suffer from conductive hearing loss are likely to show a maxillary abnormality when examined by an orthodontist.

  8. Rolie-Poly fluid flowing through constrictions: Two distinct instabilities

    KAUST Repository

    Reis, T.; Wilson, H.J.

    2013-01-01

    Elastic instabilities of entangled polymer melts are common in industrial processes but the physics responsible is not well understood. We present a numerical linear stability study of a molecular based constitutive model which grants us physical insight into the underlying mechanics involved. Two constriction flows are considered - one shear dominated, the other extension dominated - and two distinct instabilities are found. The influence of the molecular structure and the behaviour of the polymer dynamics are investigated and in both cases chain relaxation and orientation play a crucial role. This suggests a molecular-based physical interpretation of the underlying mechanisms responsible for flow instabilities. © 2013 Elsevier B.V.

  9. Rolie-Poly fluid flowing through constrictions: Two distinct instabilities

    KAUST Repository

    Reis, T.

    2013-05-01

    Elastic instabilities of entangled polymer melts are common in industrial processes but the physics responsible is not well understood. We present a numerical linear stability study of a molecular based constitutive model which grants us physical insight into the underlying mechanics involved. Two constriction flows are considered - one shear dominated, the other extension dominated - and two distinct instabilities are found. The influence of the molecular structure and the behaviour of the polymer dynamics are investigated and in both cases chain relaxation and orientation play a crucial role. This suggests a molecular-based physical interpretation of the underlying mechanisms responsible for flow instabilities. © 2013 Elsevier B.V.

  10. Artificially lengthened and constricted vocal tract in vocal training methods.

    Science.gov (United States)

    Bele, Irene Velsvik

    2005-01-01

    It is common practice in vocal training to make use of vocal exercise techniques that involve partial occlusion of the vocal tract. Various techniques are used; some of them form an occlusion within the front part of the oral cavity or at the lips. Another vocal exercise technique involves lengthening the vocal tract; for example, the method of phonation into small tubes. This essay presents some studies made on the effects of various vocal training methods that involve an artificially lengthened and constricted vocal tract. The influence of sufficient acoustic impedance on vocal fold vibration and economical voice production is presented.

  11. Abnormal portal vein waveform as an indicator of constrictive pericarditis – a case report

    Directory of Open Access Journals (Sweden)

    Joanna Ścieszka

    2015-06-01

    Full Text Available We report a case of a 17-year-old patient referred to our outpatient Doppler Department due to clinical suspicion of liver cirrhosis. The patient presented with non-specifi c symptoms, such as malaise, pain in the right subcostal region, peripheral oedema. Until then, diagnostic imaging, including echocardiography was inconclusive. We performed the Doppler sonography of the portal system, which revealed normal diameter of the portal vein with abnormal, phasic and markedly pulsatile waveform. Hepatic veins distention with pathological reverse fl ow during systole was reported. Additionally, inferior vena cava was dilated and remained unchanged through the respiratory cycle. Basing on the above image a heart disease, which had not been taken into differential diagnosis before, was suggested. The following echocardiography, together with computed tomography, enabled a diagnosis of constrictive pericarditis. Successful pericardiotomy was performed. Such a complicated diagnostics happened to demonstrate an uncommon example of the use of portal vein waveform in making the proper cardiologic diagnosis.

  12. Cardiac magnetic resonance radiofrequency tissue tagging for diagnosis of constrictive pericarditis: A proof of concept study.

    Science.gov (United States)

    Power, John A; Thompson, Diane V; Rayarao, Geetha; Doyle, Mark; Biederman, Robert W W

    2016-05-01

    Invasive cardiac catheterization is the venerable "gold standard" for diagnosing constrictive pericarditis. However, its sensitivity and specificity vary dramatically from center to center. Given the ability to unequivocally define segments of the pericardium with the heart via radiofrequency tissue tagging, we hypothesize that cardiac magnetic resonance has the capability to be the new gold standard. All patients who were referred for cardiac magnetic resonance evaluation of constrictive pericarditis underwent cardiac magnetic resonance radiofrequency tissue tagging to define visceral-parietal pericardial adherence to determine constriction. This was then compared with intraoperative surgical findings. Likewise, all preoperative cardiac catheterization testing was reviewed in a blinded manner. A total of 120 patients were referred for clinical suspicion of constrictive pericarditis. Thirty-nine patients were defined as constrictive pericarditis positive solely via radiofrequency tissue-tagging cardiac magnetic resonance, of whom 21 were positive, 4 were negative, and 1 was equivocal for constrictive pericarditis, as defined by cardiac catheterization. Of these patients, 16 underwent pericardiectomy and were surgically confirmed. There was 100% agreement between cardiac magnetic resonance-defined constrictive pericarditis positivity and postsurgical findings. No patients were misclassified by cardiac magnetic resonance. In regard to the remaining constrictive pericarditis-positive patients defined by cardiac magnetic resonance, 10 were treated medically, declined, were ineligible for surgery, or were lost to follow-up. Long-term follow-up of those who were constrictive pericarditis negative by cardiac magnetic resonance showed no early or late crossover to the surgery arm. Cardiac magnetic resonance via radiofrequency tissue tagging offers a unique, efficient, and effective manner of defining clinically and surgically relevant constrictive pericarditis

  13. Differentiation of Constriction and Restriction: Complex Cardiovascular Hemodynamics.

    Science.gov (United States)

    Geske, Jeffrey B; Anavekar, Nandan S; Nishimura, Rick A; Oh, Jae K; Gersh, Bernard J

    2016-11-29

    Differentiation of constrictive pericarditis (CP) from restrictive cardiomyopathy (RCM) is a complex and often challenging process. Because CP is a potentially curable cause of heart failure and therapeutic options for RCM are limited, distinction of these 2 conditions is critical. Although different in regard to etiology, prognosis, and treatment, CP and RCM share a common clinical presentation of predominantly right-sided heart failure, in the absence of significant left ventricular systolic dysfunction or valve disease, due to impaired ventricular diastolic filling. Fundamental to the diagnosis of either condition is a clear understanding of the underlying hemodynamic principles and pathophysiology. We present a contemporary review of the pathophysiology, hemodynamics, diagnostic assessment, and therapeutic approach to patients presenting with CP and RCM. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  14. Equivalence ratio and constriction effects on RBCC thrust augmentation

    Science.gov (United States)

    Koupriyanov, M.; Etele, J.

    2011-06-01

    A theoretical analysis of a variable area rocket based combined cycle engine with and without simultaneous mixing and combustion is presented. The flowfield is solved using a steady, quasi-one-dimensional, inviscid control volume formulation with combustion effects included via a generalized equilibrium calculation. Compression augmentation is shown to be sensitive to the equivalence ratio within the primary rocket chamber, where ejector section performance is greatest at both low and high equivalence ratios but near a minimum at stoichiometric conditions. The thrust generated by the RBCC engine compared to that generated by the same rocket in isolation can be increased by as much as 12% at constriction ratios of between 45% and 50%. Thrust augmentation is also shown to vary with equivalence ratio, where for a fixed geometry the maximum thrust is generated at equivalence ratios slightly below unity.

  15. Surgical treatment of 2 cases of irradiation induced constrictive pericarditis

    Energy Technology Data Exchange (ETDEWEB)

    Osawa, Hiroshi; Takahashi, Wataru; Yoshii, Shinpei [Yamanashi Medical Univ., Tamaho (Japan)] (and others)

    1999-11-01

    A 72-years-old man underwent radiation therapy (62 Gy) for esophageal carcinoma. Twelve months later, symptoms of heart failure such as syncope, cough and hepatomegaly manifested. On catheter study, a dip and plateau pattern of right ventricular pressure curve was evident. Pericardiectomy without extracorporeal circulation was performed. Operative findings and pathological results were compatible with radiation-induced constrictive pericarditis. He recovered from the heart failure, and has been doing well 3 months after the surgery. A 54-years-old man underwent thymectomy for malignant thymoma. He underwent a radiation therapy (52 Gy) postoperatively. After 12 months from the irradiation, syncope and dyspnea manifested. On catheter study, a dip and plateau pattern of right ventricular pressure curve was observed. Pericardiectomy with extracorporeal circulation was performed. He recovered from the heart failure after pericardiectomy, however he died of radiation-induced pneumonitis 6 months later. (author)

  16. Brothers with constrictive pericarditis – A novel mutation in a rare disease

    Directory of Open Access Journals (Sweden)

    Devendra V. Patil

    2016-09-01

    Full Text Available Familial constrictive pericarditis is extremely rare. We report a case of two brothers both suffering constrictive pericarditis along with having multiple painless joint deformities. Genetic workup confirmed the clinical diagnosis of camptodactyly-arthropathy-coxa vara-pericarditis (CACP syndrome CACP syndrome and also revealed a rare mutation in the causative gene.

  17. Transpalatal distraction for the management of maxillary constriction in pediatric patients

    OpenAIRE

    Adolphs, Nicolai; Ernst, Nicole; Hoffmeister, Bodo; Raguse, Jan-Dirk

    2015-01-01

    Context: The management of severe maxillary constriction can be challenging. For that purpose surgically assisted maxillary expansion by transpalatal distraction (TPD) can typically be recommended after skeletal maturity. However in selected cases bone borne transpalatal distraction devices can contribute to improve maxillary constriction considerably earlier already during mixed dentition. Aims: To assess the possibility of bone borne transpalatal distraction in pediatric patients. Settings ...

  18. Sheath formation and extraction of ions from a constricted R.F ion source

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Salam, F W; Helal, A G; El-Khabeary, H; El-Merai, N T [Accelerators Dept., Nuclear Research Center, Atomic Energy Authority, Cairo, (Egypt)

    1997-12-31

    The present work investigates the plasma characteristics in a constricted R. F. ion source. The extraction of ions from the plasma boundary and sheath formation were studied. The ion source physical parameters are discussed in order to understand the physical processes occurring within the discharge region up to the extraction system. Electron temperature and density were determined using Langmuir probe. The probe current-voltage characteristics were measured for different extraction voltages (ext.) = 0,500,1000, and 1250 volt at various constant R.F. powers. The effect of R.F. power on electron temperature was deduced for a beam = plasma discharge. This revealed that for a quasi-neutral (plasma) region the electron temperature increased linearly with the R.F. Power which leads to substantial electron heating and efficient electron energy transport in this region. Applying extraction voltage, the electron temperature drops as the ionization rate increases. The sheath thickness was obtained at constant extraction voltages. The curves show that if the ion current density increased, the sheath thickness decreased while it increases by increasing extraction voltage, and it is negligible in the plasma region. 13 figs.

  19. Droplet squeezing through a narrow constriction: Minimum impulse and critical velocity

    Science.gov (United States)

    Zhang, Zhifeng; Drapaca, Corina; Chen, Xiaolin; Xu, Jie

    2017-07-01

    Models of a droplet passing through narrow constrictions have wide applications in science and engineering. In this paper, we report our findings on the minimum impulse (momentum change) of pushing a droplet through a narrow circular constriction. The existence of this minimum impulse is mathematically derived and numerically verified. The minimum impulse happens at a critical velocity when the time-averaged Young-Laplace pressure balances the total minor pressure loss in the constriction. Finally, numerical simulations are conducted to verify these concepts. These results could be relevant to problems of energy optimization and studies of chemical and biomedical systems.

  20. Clogging arches in grains, colloids, and pedestrians flowing through constrictions

    Science.gov (United States)

    Zuriguel, Iker

    When a group of particles pass through a narrow orifice, the flow might become intermittent due to the development of clogs that obstruct the constriction. This effect has been observed in many different fields such as mining transport, microbial growing, crowd dynamics, colloids, granular and active matter. In this work we introduce a general framework in which research in some of such scenarios can be encompassed. In particular, we analyze the statistical properties of the bottleneck flow in different experiments and simulations: granular media within vibrated silos, colloids, a flock of sheep and pedestrian evacuations. We reveal a common phenomenology that allows us to rigorously define a transition to a clogged state. Using this definition we explore the main variables involved, which are then grouped into three generic parameters. In addition, we will present results of the geometrical characteristics that the clogging arches have which are related with their stability against perturbations. We experimentally analyse the temporal evolution of the arches evidencing important differences among the structures that are easily destroyed and those that seem to resist forever (longer than the temporal window employed in our measurements). Ministerio de Economía y Competitividad (Spanish Government). Project No. FIS2014-57325.

  1. Peroral endoscopic cardial constriction in gastroesophageal reflux disease.

    Science.gov (United States)

    Hu, Hai-Qing; Li, Hui-Kai; Xiong, Ying; Zhang, Xiao-Bin; Zhi, Jun-Li; Wang, Xiao-Xiao; Ling-Hu, En-Qiang

    2018-04-01

    Gastroesophageal reflux disease (GERD) is a major digestive health problem with a high and increasing incidence worldwide. Peroral endoscopic cardial constriction (PECC) was developed by our group to provide a less invasive treatment for GERD.In this preliminary follow-up study, 16 patients were enrolled and 13 patients with GERD were targeted for analysis according to the Los Angeles classification of reflux esophagitis. The GERD health-related quality of life (GERD-HRQL) scale and esophageal pH monitoring were applied to assess clinical efficiency at 3 and 6 months after PECC treatment, respectively.All GERD patients successively received PECC, and no severe treatment-related complication was reported. Before PECC treatment, the GERD-HRQL scale was 19.92 ± 7.89. At 3 and 6 months after treatment, the GERD-HRQL scale was 4.46 ± 4.31 and 5.69 ± 5.07, respectively. DeMeester score was 125.50 ± 89.64 before PECC treatment, and 16.97 ± 12.76 and 20.32 ± 15.22 at 3 and 6 months after PECC treatment. Furthermore, the fraction time of a pH below 4 significantly decreased at 3 and 6 months after PECC treatment. Fraction time at pH reflux of stomach contents.

  2. Satiety and eating patterns in two species of constricting snakes.

    Science.gov (United States)

    Nielsen, Torben P; Jacobsen, Magnus W; Wang, Tobias

    2011-01-10

    Satiety has been studied extensively in mammals, birds and fish but very little information exists on reptiles. Here we investigate time-dependent satiation in two species of constricting snakes, ball pythons (Python regius) and yellow anacondas (Eunectes notaeus). Satiation was shown to depend on both fasting time and prey size. In the ball pythons fed with mice of a relative prey mass RPM (mass of the prey/mass of the snake×100) of 15%, we observed a satiety response that developed between 6 and 12h after feeding, but after 24h pythons regained their appetite. With an RPM of 10% the pythons kept eating throughout the experiment. The anacondas showed a non-significant tendency for satiety to develop between 6 and 12h after ingesting a prey of 20% RPM. Unlike pythons, anacondas remained satiated after 24h. Handling time (from strike until prey swallowed) increased with RPM. We also found a significant decrease in handling time between the first and the second prey and a positive correlation between handling time and the mass of the snake. 2010 Elsevier Inc. All rights reserved.

  3. Quantifying Compressibility and Slip in Multiparticle Collision (MPC Flow Through a Local Constriction

    Directory of Open Access Journals (Sweden)

    Tahmina Akhter

    2014-01-01

    Full Text Available The flow of a compressible fluid with slip through a cylinder with an asymmetric local constriction has been considered both numerically, as well as analytically. For the numerical work, a particle-based method whose dynamics is governed by the multiparticle collision (MPC rule has been used together with a generalized boundary condition that allows for slip at the wall. Since it is well known that an MPC system corresponds to an ideal gas and behaves like a compressible, viscous flow on average, an approximate analytical solution has been derived from the compressible Navier–Stokes equations of motion coupled to an ideal gas equation of state using the Karman–Pohlhausen method. The constriction is assumed to have a polynomial form, and the location of maximum constriction is varied throughout the constricted portion of the cylinder. Results for centerline densities and centerline velocities have been compared for various Reynolds numbers, Mach numbers, wall slip values and flow geometries.

  4. Infectious endocardial intracardiac defibrillator lead, infectious pericarditis, and delayed constrictive pericarditis

    Directory of Open Access Journals (Sweden)

    Mohsen Mir Mohammad Sadeghi

    2013-01-01

    Full Text Available The usage of Implantable Cardiac Defibrillator (ICD since 1980s is becoming more popular these days. The rate of both, endocarditis and constrictive pericarditis are low but it still needs attention. We are reporting a rare case of ICD endocarditis as a result of toe infection in a diabetic patient. This was followed by infectious pericarditis after device removal by open heart surgery and then delayed constrictive pericarditis.

  5. Amniotic Constriction Bands: Secondary Deformities and Their Treatments.

    Science.gov (United States)

    Drury, Benjamin T; Rayan, Ghazi M

    2018-01-01

    The purpose of this study was to report the surgical treatment experience of patients with amniotic constriction bands (ACB) over a 35-year interval and detail consequential limb deformities with emphasis on hands and upper extremities, along with the nature and frequency of their surgical treatment methods. Fifty-one patients were identified; 26 were males and 25 females. The total number of deformities was listed. The total number of operations, individual procedures, and operations plus procedures that were done for each patient and their frequency were recorded. The total number of operations was 117, and total number of procedures was 341. More procedures were performed on the upper extremity (85%) than the lower extremity (15%). Including the primary deformity ACB, 16 different hand deformities secondary to ACB were encountered. Sixteen different surgical methods for the upper extremity were utilized; a primary procedure for ACB and secondary reconstructions for all secondary deformities. Average age at the time of the first procedure was 9.3 months. The most common procedures performed, in order of frequency, were excision of ACB plus Z-plasty, release of partial syndactyly, release of fenestrated syndactyly, full-thickness skin grafts, resection of digital bony overgrowth from amputation stumps, and deepening of first and other digital web spaces. Many hand and upper extremity deformities secondary to ACB are encountered. Children with ACB may require more than one operation including multiple procedures. Numerous surgical methods of reconstruction for these children's secondary deformities are necessary in addition to the customary primary procedure of excision of ACB and Z-plasty.

  6. Modulation of apical constriction by Wnt signaling is required for lung epithelial shape transition.

    Science.gov (United States)

    Fumoto, Katsumi; Takigawa-Imamura, Hisako; Sumiyama, Kenta; Kaneiwa, Tomoyuki; Kikuchi, Akira

    2017-01-01

    In lung development, the apically constricted columnar epithelium forms numerous buds during the pseudoglandular stage. Subsequently, these epithelial cells change shape into the flat or cuboidal pneumocytes that form the air sacs during the canalicular and saccular (canalicular-saccular) stages, yet the impact of cell shape on tissue morphogenesis remains unclear. Here, we show that the expression of Wnt components is decreased in the canalicular-saccular stages, and that genetically constitutive activation of Wnt signaling impairs air sac formation by inducing apical constriction in the epithelium as seen in the pseudoglandular stage. Organ culture models also demonstrate that Wnt signaling induces apical constriction through apical actomyosin cytoskeletal organization. Mathematical modeling reveals that apical constriction induces bud formation and that loss of apical constriction is required for the formation of an air sac-like structure. We identify MAP/microtubule affinity-regulating kinase 1 (Mark1) as a downstream molecule of Wnt signaling and show that it is required for apical cytoskeletal organization and bud formation. These results suggest that Wnt signaling is required for bud formation by inducing apical constriction during the pseudoglandular stage, whereas loss of Wnt signaling is necessary for air sac formation in the canalicular-saccular stages. © 2017. Published by The Company of Biologists Ltd.

  7. A pressure-gradient mechanism for vortex shedding in constricted channels

    Science.gov (United States)

    Boghosian, M. E.; Cassel, K. W.

    2013-01-01

    Numerical simulations of the unsteady, two-dimensional, incompressible Navier–Stokes equations are performed for a Newtonian fluid in a channel having a symmetric constriction modeled by a two-parameter Gaussian distribution on both channel walls. The Reynolds number based on inlet half-channel height and mean inlet velocity ranges from 1 to 3000. Constriction ratios based on the half-channel height of 0.25, 0.5, and 0.75 are considered. The results show that both the Reynolds number and constriction geometry have a significant effect on the behavior of the post-constriction flow field. The Navier–Stokes solutions are observed to experience a number of bifurcations: steady attached flow, steady separated flow (symmetric and asymmetric), and unsteady vortex shedding downstream of the constriction depending on the Reynolds number and constriction ratio. A sequence of events is described showing how a sustained spatially growing flow instability, reminiscent of a convective instability, leads to the vortex shedding phenomenon via a proposed streamwise pressure-gradient mechanism. PMID:24399860

  8. Mast cell mediators in citric acid-induced airway constriction of guinea pigs

    International Nuclear Information System (INIS)

    Lin, C.-H.; Lai, Y.-L.

    2005-01-01

    We demonstrated previously that mast cells play an important role in citric acid (CA)-induced airway constriction. In this study, we further investigated the underlying mediator(s) for this type of airway constriction. At first, to examine effects caused by blocking agents, 67 young Hartley guinea pigs were divided into 7 groups: saline + CA; methysergide (serotonin receptor antagonist) + CA; MK-886 (leukotriene synthesis inhibitor) + CA; mepyramine (histamine H 1 receptor antagonist) + CA; indomethacin (cyclooxygenase inhibitor) + CA; cromolyn sodium (mast cell stabilizer) + CA; and compound 48/80 (mast cell degranulating agent) + CA. Then, we tested whether leukotriene C 4 (LTC 4 ) or histamine enhances CA-induced airway constriction in compound 48/80-pretreated guinea pigs. We measured dynamic respiratory compliance (Crs) and forced expiratory volume in 0.1 s (FEV 0.1 ) during either baseline or recovery period. In addition, we detected histamine level, an index of pulmonary mast cell degranulation, in bronchoalveolar lavage (BAL) samples. Citric acid aerosol inhalation caused decreases in Crs and FEV 0.1 , indicating airway constriction in the control group. This airway constriction was significantly attenuated by MK-886, mepyramine, cromolyn sodium, and compound 48/80, but not by either methysergide or indomethacin. Both LTC 4 and histamine infusion significantly increased the magnitude of CA-induced airway constriction in compound 48/80-pretreated guinea pigs. Citric acid inhalation caused significant increase in histamine level in the BAL sample, which was significantly suppressed by compound 48/80. These results suggest that leukotrienes and histamine originating from mast cells play an important role in CA inhalation-induced noncholinergic airway constriction

  9. Isobaric Tags for Relative and Absolute Quantitation-Based Proteomic Analysis of Patent and Constricted Ductus Arteriosus Tissues Confirms the Systemic Regulation of Ductus Arteriosus Closure.

    Science.gov (United States)

    Hong, Haifa; Ye, Lincai; Chen, Huiwen; Xia, Yu; Liu, Yue; Liu, Jinfen; Lu, Yanan; Zhang, Haibo

    2015-08-01

    We aimed to evaluate global changes in protein expression associated with patency by undertaking proteomic analysis of human constricted and patent ductus arteriosus (DA). Ten constricted and 10 patent human DAs were excised from infants with ductal-dependent heart disease during surgery. Using isobaric tags for relative and absolute quantitation-based quantitative proteomics, 132 differentially expressed proteins were identified. Of 132 proteins, voltage-gated sodium channel 1.3 (SCN3A), myosin 1d (Myo1d), Rho GTPase activating protein 26 (ARHGAP26), and retinitis pigmentosa 1 (RP1) were selected for validation by Western blot and quantitative real-time polymerase chain reaction analyses. Significant upregulation of SCN3A, Myo1d, and RP1 messenger RNA, and protein levels was observed in the patent DA group (all P ≤ 0.048). ARHGAP26 messenger RNA and protein levels were decreased in patent DA tissue (both P ≤ 0.018). Immunohistochemistry analysis revealed that Myo1d, ARHGAP26, and RP1 were specifically expressed in the subendothelial region of constricted DAs; however, diffuse expression of these proteins was noted in the patent group. Proteomic analysis revealed global changes in the expression of proteins that regulate oxygen sensing, ion channels, smooth muscle cell migration, nervous system, immune system, and metabolism, suggesting a basis for the systemic regulation of DA patency by diverse signaling pathways, which will be confirmed in further studies.

  10. Roles of oxygen radicals and elastase in citric acid-induced airway constriction of guinea-pigs

    OpenAIRE

    Lai, Y -L; Chiou, W -Y; Lu, F J; Chiang, L Y

    1999-01-01

    Antioxidants attenuate noncholinergic airway constriction. To further investigate the relationship between tachykinin-mediated airway constriction and oxygen radicals, we explored citric acid-induced bronchial constriction in 48 young Hartley strain guinea-pigs, divided into six groups: control; citric acid; hexa(sulphobutyl)fullerenes+citric acid; hexa(sulphobutyl)fullerenes+phosphoramidon+citric acid; dimethylthiourea (DMTU)+citric acid; and DMTU+phosphoramidon+citric acid. Hexa(sulphobutyl...

  11. A Case of Constrictive Pericarditis Associated with Melioidosis in an Immunocompetent Patient Treated by Pericardiectomy

    Science.gov (United States)

    Lu, Hou Tee; Ramsamy, Gunasekaran; Lee, Chuey Yan; Syed Hamid, Syed Rasul G.; Kan, Foong Kee; Nordin, Rusli Bin

    2018-01-01

    Patient: Male, 38 Final Diagnosis: Constrictive pericarditis Symptoms: Shortness of breath Medication: — Clinical Procedure: Pericardiocentesis • pericardiectomy Specialty: Cardiology Objective: Unusual clinical course Background: Melioidosis is a rare tropical bacterial infection caused by the Gram-negative soil saprophyte, Burkholderia pseudomallei. Melioidosis can mimic a variety of diseases due to its varied presentation, and unless it is treated rapidly, it can be fatal. A rare case of melioidosis, with pericarditis and pericardial effusion, is described, which demonstrates the value of early diagnosis with echocardiography and pericardiocentesis. Case Report: A 38-year-old native (Iban) East Malaysian man presented with shortness of breath and tachycardia. Transthoracic echocardiography (TTE) showed cardiac tamponade. Urgent pericardiocentesis drained a large amount of purulent pericardial fluid that grew Burkholderia pseudomallei. Despite appropriate dose and duration of intravenous treatment with ceftazidime followed by meropenem, the patient developed recurrent pericardial effusion and right heart failure due to constrictive pericarditis. The diagnosis of constrictive pericarditis was confirmed by computed tomography (CT) and surgical exploration. Following pericardiectomy, his symptoms resolved, but patient follow-up was recommended for possible sequelae of constrictive pericarditis. Conclusions: After the onset of melioidosis pericarditis, the authors recommend follow-up and surveillance for possible complication of constrictive pericarditis. PMID:29551765

  12. Oil-in-water emulsions flow through constricted micro-capillarities

    Energy Technology Data Exchange (ETDEWEB)

    Castillo, Oswaldo Robles; Carvalho, Marcio da Silveira [Pontificia Universidade Catolica do Rio de Janeiro (PUC-Rio), RJ (Brazil). Dept. of Mechanical Engineering

    2010-07-01

    The effect of the oil concentration and the drop size distribution on the characteristics of the flow of an emulsion through a constricted capillary was experimentally analyzed and quantified by the ratio of the pressure drop of the continuous phase flow to the pressure drop of the emulsion flow, at the same flow rate. The results confirm that the ratio between the capillary constriction diameter and the oil drop size is one of the most important parameters for this flow. For large oil drop size emulsions, the deformation of the drop as it flows through the constriction leads to a high extra pressure drop at low capillary numbers. For small oil drop size emulsions, the extra pressure drop is a function of the viscosity ratio and the disperse phase concentration. (author)

  13. Recurrent tongue tip constriction in a captive giant anteater (Myrmecophaga tridactyla).

    Science.gov (United States)

    Steinmetz, Hanspeter W; Clauss, Marcus; Feige, Karsten; Thio, Tanja; Isenbügel, Ewald; Hatt, Jean-Michel

    2007-03-01

    A male giant anteater (Myrmecophage tridactyla) was treated twice for tongue tip constrictions. Clinical signs were partial anorexia, soft stool, bleeding from the mouth, and intermittent lingual discomfort. In the first presentation, wood fibers constricting the distal part of the tongue were detected by endoscopy and were removed. In the second presentation, bands of collagenous fibers were identified and resected. Dietary elements were responsible for both cases: elongated wood fibers were present in peat, which was included as a supplement to improve stool consistency, and collagenous fibers originated from fascias of lean meat, which served as a protein source in this diet. Preventive measures included sieving of the peat to eliminate long fibers and grinding of the meat, respectively, prior to diet presentation. A homogenous diet, utilizing cellulose rather than peat and dry cat food rather than meat, will avoid tongue tip constriction as described in these cases.

  14. Classical and quantum transport through entropic barriers modeled by hardwall hyperboloidal constrictions

    International Nuclear Information System (INIS)

    Hales, R.; Waalkens, H.

    2009-01-01

    We study the quantum transport through entropic barriers induced by hardwall constrictions of hyperboloidal shape in two and three spatial dimensions. Using the separability of the Schroedinger equation and the classical equations of motion for these geometries, we study in detail the quantum transmission probabilities and the associated quantum resonances, and relate them to the classical phase structures which govern the transport through the constrictions. These classical phase structures are compared to the analogous structures which, as has been shown only recently, govern reaction type dynamics in smooth systems. Although the systems studied in this paper are special due their separability they can be taken as a guide to study entropic barriers resulting from constriction geometries that lead to non-separable dynamics.

  15. Numerical Simulation of Passage of a Neutrophil through a Rectangular Channel with a Moderate Constriction

    Science.gov (United States)

    Shirai, Atsushi; Masuda, Sunao

    2013-01-01

    The authors have previously presented a mathematical model to predict transit time of a neutrophil through an alveolar capillary segment which was modeled as an axisymmetric arc-shaped constriction settled in a cylindrical straight pipe to investigate the influence of entrance curvature of a capillary on passage of the cell. The axially asymmetric cross section of a capillary also influences the transit time because it requires three-dimensional deformation of a cell when it passes through the capillary and could lead to plasma leakage between the cell surface and the capillary wall. In this study, a rectangular channel was introduced, the side walls of which were moderately constricted, as a representative of axially asymmetric capillaries. Dependence of transit time of a neutrophil passing through the constriction on the constriction geometry, i.e., channel height, throat width and curvature radius of the constriction, was numerically investigated, the transit time being compared with that through the axisymmetric model. It was found that the transit time is dominated by the throat hydraulic diameter and curvature radius of the constriction and that the throat aspect ratio little affects the transit time with a certain limitation, indicating that if an appropriate curvature radius is chosen, such a rectangular channel model can be substituted for an axisymmetric capillary model having the same throat hydraulic diameter in terms of the transit time by choosing an appropriate curvature radius. Thus, microchannels fabricated by the photolithography technique, whose cross section is generally rectangular, are expected to be applicable to in vitro model experiments of neutrophil retention and passage in the alveolar capillaries. PMID:23527190

  16. Simulation Research of Magnetic Constriction Effect and Controlling by Axial Magnetic Field of Vacuum Arc

    Institute of Scientific and Technical Information of China (English)

    王立军; 贾申利; 史宗谦; 荣命哲

    2005-01-01

    Based on magnetohydrodynamic (MHD) model of vacuum arc, the computer simulation of vacuum arc was carried out in this paper. In the MHD model, mass conservation equation,momentum conservation equations, energy conservation equations, generalized ohm's law and Maxwell equation were considered. MHD equations were calculated by numerical method, and the distribution of vacuum arc plasma parameters and current density were obtained. Simulation results showed that the magnetic constriction effect of vacuum arc is primarily caused by the Hall effect. In addition, the inhibition of axial magnetic field (AMF) on constriction of vacuum arc was calculated and analyzed.

  17. Anomalous right coronary artery arising from the pulmonary artery and constrictive pericarditis: an unusual association

    Science.gov (United States)

    Silvestre, Odilson Marcos; Adam, Eduardo Leal; de Melo, Dirceu Thiago Pessoa; Dias, Ricardo Ribeiro; Ramires, Felix J. A.; Mady, Charles

    2013-01-01

    ABSTRACT The association of anomalous right coronary artery originating from the pulmonary artery and constrictive pericarditis has never been showed in the literature. We present the first case of this unusual association in a patient with right heart failure. After diagnosis, the patient was referred to surgery and underwent phrenic-to-phrenic pericardiectomy; graft implant of right internal thoracic artery to right coronary artery; and ligation of the anomalous origin of the right coronary artery from the pulmonary artery. Such procedures solved the potential risk of sudden death related to anomalous right coronary artery originating from the pulmonary artery and alleviated the symptoms of heart failure caused by constrictive pericarditis. PMID:24136766

  18. Chronic calcific constrictive pericarditis complicating Churg-Strauss syndrome: first reported case.

    Science.gov (United States)

    Aboukhoudir, Falah; Pansieri, Michel; Rekik, Sofiene

    2014-10-01

    Churg-Strauss syndrome is a necrotizing systemic vasculitis characterized by extravascular granulomas and eosinophilic infiltrates of small vessels. Although cardiac complications are considered to be relatively common, no case of constrictive calcified pericarditis has ever been previously described in this setting. In this report, we present the case of a 46-year-old man with Churg-Strauss syndrome, in whom we were able to document the development of symptomatic calcific constrictive pericarditis during a 10-year period despite long-term corticosteroid therapy. Georg Thieme Verlag KG Stuttgart · New York.

  19. A case of constrictive pericarditis developing 2 years after radiation therapy for carcinoma of the esophagus

    International Nuclear Information System (INIS)

    Hara, Youichi; Kuroda, Hiroaki; Ishiguro, Shingo; Hamasaki, Takafumi; Ashida, Yasushi; Tonomoto, Nagahisa; Miyasaka, Shigeto; Mori, Tohru

    1997-01-01

    A case of constrictive pericarditis developing 2 years after radiation therapy for esophageal carcinoma is reported. A man of 48 years old was diagnosed as early esophageal carcinoma and treated with radiation theraphy of 60 Gy. After 12 months, he developed acute pericarditis, which remitted spontaneously. After 18 months, he developed constrictive pericarditis, which did response to medical treatment, and became NYHA grade 4. After 25 months, pericardial sac and epicardium were resected. But dilatation of right ventricular dimension was not enough and hemodynamics did not recover. However, subjective symptom was extremely improved, and he left the hospital by walk at 29 days after the surgery. (K.H.)

  20. Renal myogenic constriction protects the kidney from age-related hypertensive renal damage in the Fawn-Hooded rat

    NARCIS (Netherlands)

    Vavrinec, Peter; Henning, Robert H.; Goris, Maaike; Landheer, Sjoerd W.; Buikema, Hendrik; van Dokkum, Richard P. E.

    Introduction:Intact myogenic constriction plays a role in renal blood flow autoregulation and protection against pressure-related (renal) injury. However, to what extent alterations in renal artery myogenic constriction are involved in development of renal damage during aging is unknown. Therefore,

  1. Transpalatal distraction for the management of maxillary constriction in pediatric patients.

    Science.gov (United States)

    Adolphs, Nicolai; Ernst, Nicole; Hoffmeister, Bodo; Raguse, Jan-Dirk

    2015-01-01

    The management of severe maxillary constriction can be challenging. For that purpose surgically assisted maxillary expansion by transpalatal distraction (TPD) can typically be recommended after skeletal maturity. However in selected cases bone borne transpalatal distraction devices can contribute to improve maxillary constriction considerably earlier already during mixed dentition. To assess the possibility of bone borne transpalatal distraction in pediatric patients. Clinical paper. Since 2010 TPD has been applied to six pediatric patients during mixed dentition when severe maxillary constriction was present and conventional orthodontic widening has already failed. Individually selected devices (Surgitec, Belgium) were inserted in general anaesthesia and distraction was performed according to well known parameters. Maxillary constriction could be improved in all six patients without any drawbacks by bone borne devices during mixed dentition. Skeletal conditions were obviously improved for subsequent orthodontic or orthognathic therapy without functional impairment. Follow-up is up to 36 months after device removal. Transpalatal Distraction is recommendable in selected pediatric patients if massive growth disturbance is present or has to be expected. TPD allows for individually adapted maxillary expansion by selection and positioning of appropriate devices in combination with intraoperative testing of maxillary movements and controlled bone removal.

  2. Ameliorative potential of Ocimum sanctum in chronic constriction injury-induced neuropathic pain in rats

    Directory of Open Access Journals (Sweden)

    GURPREET KAUR

    2015-03-01

    Full Text Available The present study was designed to investigate the ameliorative potential of Ocimumsanctum and its saponin rich fraction in chronic constriction injury-induced neuropathic pain in rats. The chronic constriction injury was induced by placing four loose ligatures around the sciatic nerve, proximal to its trifurcation. The mechanical hyperalgesia, cold allodynia, paw heat hyperalgesia and cold tail hyperalgesia were assessed by performing the pinprick, acetone, hot plate and cold tail immersion tests, respectively. Biochemically, the tissue thio-barbituric acid reactive species, super-oxide anion content (markers of oxidative stress and total calcium levels were measured. Chronic constriction injury was associated with the development of mechanical hyperalgesia, cold allodynia, heat and cold hyperalgesia along with an increase in oxidative stress and calcium levels. However, administration of Ocimumsanctum (100 and 200 mg/kg p.o. and its saponin rich fraction (100 and 200 mg/kg p.o. for 14 days significantly attenuated chronic constriction injury-induced neuropathic pain as well as decrease the oxidative stress and calcium levels. It may be concluded that saponin rich fraction of Ocimum sanctum has ameliorative potential in attenuating painful neuropathic state, which may be attributed to a decrease in oxidative stress and calcium levels.

  3. A non-equilibrium simulation of thermal constriction in a cascaded arc hydrogen plasma

    International Nuclear Information System (INIS)

    Peerenboom, K S C; Goedheer, W J; Van Dijk, J; Kroesen, G M W

    2014-01-01

    The cascaded arc hydrogen plasma of Pilot-PSI is studied in a non-LTE model. We demonstrate that the effect of vibrationally excited molecules on the heavy-particle-assisted dissociation is crucial for obtaining thermal constriction. To the best of our knowledge, thermal constriction has not been obtained before in a non-LTE simulation. Probably, realistic numerical studies of this type of plasma were hindered by numerical problems, preventing the non-LTE simulations to show characteristic physical mechanisms such as thermal constriction. In this paper we show that with the help of appropriate numerical strategies thermal constriction can be obtained in a non-LTE simulation. To this end, a new source term linearization technique is developed, which ensures physical solutions even near chemical equilibrium where the composition is dominated by chemical source terms. Results of the model are compared with experiments on Pilot-PSI and show good agreement with pressure and voltage measurements in the source. (paper)

  4. Study on Characteristics of Constricted DC Plasma Using Particle-In-Cell Simulator

    International Nuclear Information System (INIS)

    Jo, Jong Gap; Park, Yeong Shin; Hwang, Yong Seok

    2010-01-01

    In dc glow discharge, when anode size is smaller than cathode, very small and bright plasma ball occurs in front of anode. This plasma is called constricted dc plasma and characterized by a high plasma density in positive glow, so called plasma ball, compared to the conventional dc plasma. For the reason, this plasma is utilized to ion or electron beam sources since the beam currents are enhanced by the dense anode glow. However, correlations between characteristics of the plasma (plasma density, electron temperature and space potential) and discharge conditions (anode size, discharge voltage, discharge current, pressure) have been a little investigated definitely clear in previous study because of the trouble of a diagnosis. The plasma ball which is the most essential part of the constricted plasma is too small to diagnose precisely without disturbing plasma. Therefore, we tried to analyze the constricted plasma through computer simulation with Particle-In-Cell (PIC) code. In this study, simulation result of constricted dc plasma as well as conventional dc glow discharge will be addressed and compared with each others

  5. Atrial flutter ablation in a case of diuretic resistant constrictive pericarditis

    Directory of Open Access Journals (Sweden)

    James F. Pittaway

    2015-07-01

    This is the first reported case of symptomatic improvement in a patient with constrictive pericarditis and persistent atrial flutter with targeted treatment of the dysrhythmia. This offers a possible short-term palliation option in a group of patients where definitive surgical management carries too high a risk.

  6. The role of Rho-kinase and calcium ions in constriction triggered by ET-1.

    Science.gov (United States)

    Wiciński, Michał; Szadujkis-Szadurska, Katarzyna; Węclewicz, Mateusz M; Malinowski, Bartosz; Matusiak, Grzegorz; Walczak, Maciej; Wódkiewicz, Eryk; Grześk, Grzegorz; Pawlak-Osińska, Katarzyna

    2018-05-05

    Endothelin-1 (ET-1) is one of the key factors regulating tension of smooth muscles in blood vessels. It is believed that ET-1 plays an important role in pathogenesis of hypertension, and cardiovascular diseases; therefore, research in order to limit ET-1-mediated action is still in progress. The main objective of this paper was to evaluate the role of Rho-kinase in the ET-1-induced constriction of arteries. The analysis also included significance of intra- and extracellular pool of calcium ions in constriction triggered by ET-1. The studies were performed on perfused Wistar rat tail arteries. Concentration response curve (CRC) was determined for ET-1 in the presence of increased concentrations of Rho-kinase inhibitor (Y-27632) and IP3-receptor antagonist (2APB), both in reference to constriction triggered by solely ET-1. Afterwards, the influence of calcium ions present in the perfusion fluid was evaluated in terms of the effect triggered by 2APB and occurring in arteries constricted by ET-1. ET-1, in concentration dependent manner, leads to increase in perfusion pressure. Y-27632 and 2APB lead to shift of the concentration response curve for ET-1 to the right with simultaneously lowered maximum effect. There was no difference in reaction of the artery constricted by ET-1 and treated with 2APB in solution containing calcium and in calcium-free solution. Vasoconstrictive action of endothelin is not significantly dependent on the inflow of extracellular calcium, but it is proportional to inflow of Ca 2+ related to activation of IP3 receptors and to Rho-kinase activity. Copyright © 2018. Published by Elsevier Inc.

  7. Ameliorative role of gemfibrozil against partial abdominal aortic constriction-induced cardiac hypertrophy in rats.

    Science.gov (United States)

    Singh, Amrit Pal; Singh, Randhir; Krishan, Pawan

    2015-04-01

    Fibrates are peroxisome proliferator-activated receptor-α agonists and are clinically used for treatment of dyslipidemia and hypertriglyceridemia. Fenofibrate is reported as a cardioprotective agent in various models of cardiac dysfunction; however, limited literature is available regarding the role of gemfibrozil as a possible cardioprotective agent, especially in a non-obese model of cardiac remodelling. The present study investigated the role of gemfibrozil against partial abdominal aortic constriction-induced cardiac hypertrophy in rats. Cardiac hypertrophy was induced by partial abdominal aortic constriction in rats and they survived for 4 weeks. The cardiac hypertrophy was assessed by measuring left ventricular weight to body weight ratio, left ventricular wall thickness, and protein and collagen content. The oxidative stress in the cardiac tissues was assessed by measuring thiobarbituric acid-reactive substances, superoxide anion generation, and reduced glutathione level. The haematoxylin-eosin and picrosirius red staining was used to observe cardiomyocyte diameter and collagen deposition, respectively. Moreover, serum levels of cholesterol, high-density lipoproteins, triglycerides, and glucose were also measured. Gemfibrozil (30 mg/kg, p.o.) was administered since the first day of partial abdominal aortic constriction and continued for 4 weeks. The partial abdominal aortic constriction-induced cardiac oxidative stress and hypertrophy are indicated by significant change in various parameters used in the present study that were ameliorated with gemfibrozil treatment in rats. No significant change in serum parameters was observed between various groups used in the present study. It is concluded that gemfibrozil ameliorates partial abdominal aortic constriction-induced cardiac oxidative stress and hypertrophy and in rats.

  8. Numerical Simulations of the Motion and Deformation of Three RBCs during Poiseuille Flow through a Constricted Vessel Using IB-LBM.

    Science.gov (United States)

    Wang, Rongyang; Wei, Yikun; Wu, Chuanyu; Sun, Liang; Zheng, Wenguang

    2018-01-01

    The immersed boundary-lattice Boltzmann method (IB-LBM) was used to examine the motion and deformation of three elastic red blood cells (RBCs) during Poiseuille flow through constricted microchannels. The objective was to determine the effects of the degree of constriction and the Reynolds (Re) number of the flow on the physical characteristics of the RBCs. It was found that, with decreasing constriction ratio, the RBCs experienced greater forced deformation as they squeezed through the constriction area compared to at other parts of the microchannel. It was also observed that a longer time was required for the RBCs to squeeze through a narrower constriction. The RBCs subsequently regained a stable shape and gradually migrated toward the centerline of the flow beyond the constriction area. However, a sick RBC was observed to be incapable of passing through a constricted vessel with a constriction ratio ≤1/3 for Re numbers below 0.40.

  9. Computer Simulations of Coronary Blood Flow Through a Constriction

    Science.gov (United States)

    2014-03-01

    for clinical translation. Journal of the American College of Cardiology . 59(15): 1337–1349. Leimgruber, P., Roubin, G., Hollman, J., Cotsonis, G...the artery and increase blood flow. Generally a stent, or a mesh wire tube, is permanently inserted in order to scaffold open the artery wall...central regions of the channel, so the magnitude of the velocity has to be higher in the open area of the channel, overshooting the experimental results

  10. The big squeeze: scaling of constriction pressure in two of the world's largest snakes, Python reticulatus and Python molurus bivittatus.

    Science.gov (United States)

    Penning, David A; Dartez, Schuyler F; Moon, Brad R

    2015-11-01

    Snakes are important predators that have radiated throughout many ecosystems, and constriction was important in their radiation. Constrictors immobilize and kill prey by using body loops to exert pressure on their prey. Despite its importance, little is known about constriction performance or its full effects on prey. We studied the scaling of constriction performance in two species of giant pythons (Python reticulatus and Python molurus bivittatus) and propose a new mechanism of prey death by constriction. In both species, peak constriction pressure increased significantly with snake diameter. These and other constrictors can exert pressures dramatically higher than their prey's blood pressure, suggesting that constriction can stop circulatory function and perhaps kill prey rapidly by over-pressurizing the brain and disrupting neural function. We propose the latter 'red-out effect' as another possible mechanism of prey death from constriction. These effects may be important to recognize and treat properly in rare cases when constrictors injure humans. © 2015. Published by The Company of Biologists Ltd.

  11. Quantum transport through MoS2 constrictions defined by photodoping

    Science.gov (United States)

    Epping, Alexander; Banszerus, Luca; Güttinger, Johannes; Krückeberg, Luisa; Watanabe, Kenji; Taniguchi, Takashi; Hassler, Fabian; Beschoten, Bernd; Stampfer, Christoph

    2018-05-01

    We present a device scheme to explore mesoscopic transport through molybdenum disulfide (MoS2) constrictions using photodoping. The devices are based on van-der-Waals heterostructures where few-layer MoS2 flakes are partially encapsulated by hexagonal boron nitride (hBN) and covered by a few-layer graphene flake to fabricate electrical contacts. Since the as-fabricated devices are insulating at low temperatures, we use photo-induced remote doping in the hBN substrate to create free charge carriers in the MoS2 layer. On top of the device, we place additional metal structures, which define the shape of the constriction and act as shadow masks during photodoping of the underlying MoS2/hBN heterostructure. Low temperature two- and four-terminal transport measurements show evidence of quantum confinement effects.

  12. From diffusive to ballistic transport in etched graphene constrictions and nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Somanchi, Sowmya; Peiro, Julian; Staggenborg, Maximilian; Beschoten, Bernd [JARA-FIT and 2nd Institute of Physics, RWTH Aachen University (Germany); Terres, Bernat; Stampfer, Christoph [JARA-FIT and 2nd Institute of Physics, RWTH Aachen University (Germany); Peter Gruenberg Institute (PGI-9), Forschungszentrum Juelich (Germany); Watanabe, Kenji; Taniguchi, Takashi [National Institute for Materials Science, Tsukuba (Japan)

    2017-11-15

    Graphene nanoribbons and constrictions are envisaged as fundamental components of future carbon-based nanoelectronic and spintronic devices. At nanoscale, electronic effects in these devices depend heavily on the dimensions of the active channel and the nature of edges. Hence, controlling both these parameters is crucial to understand the physics in such systems. This review is about the recent progress in the fabrication of graphene nanoribbons and constrictions in terms of low temperature quantum transport. In particular, recent advancements using encapsulated graphene allowing for quantized conductance and future experiments towards exploring spin effects in these devices are presented. The influence of charge carrier inhomogeneity and the important length scales which play a crucial role for transport in high quality samples are also discussed. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. A case report of umbilical ring constriction with application of amnioinfusion.

    Science.gov (United States)

    Tokunaka, Mayumi; Hasegawa, Junichi; Nakamura, Masamitsu; Hamada, Shoko; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko; Okai, Takashi

    2013-07-01

    This is a case report of a pregnant 38-year-old primigravida woman. Due to severe fetal growth restriction and oligohydramnios, she was referred to our tertiary perinatal center at 24 weeks' gestation. To rule out chromosomal abnormalities and facilitate ultrasound evaluation of fetal morphology, we performed amniocentesis and subsequent amnioinfusion. Thereafter, a precise ultrasound examination revealed no obvious fetal morphological abnormalities except for a hyper-coiled cord and marginal placenta previa. During expectant management, the amount of amniotic fluid was maintained at 20-26 mm for a few days; however, the pregnancy resulted in intrauterine fetal death after 26 weeks + 5 days of gestation. The stillborn infant weighed 530 g (-3.3 SD) and had no obvious external abnormalities apart from umbilical ring constriction. Although a postmortem autopsy was not performed, it is suspected that the fetal growth restriction and the intrauterine fetal death were associated with the hyper-coiled cord and the umbilical ring constriction. It is thought that umbilical ring constriction might therefore be an irreversible fatal condition in cases with a hyper-coiled cord.

  14. Chirality dependent pinning and depinning of magnetic vortex domain walls at nano-constrictions

    Energy Technology Data Exchange (ETDEWEB)

    Mohanan P, Vineeth; Kumar, P.S. Anil, E-mail: anil@physics.iisc.ernet.in

    2017-01-15

    The implementation of magnetic domain wall (DW) based memory and logic devices critically depend on the control over DW assisted magnetization reversal processes. Here we investigate the magnetization reversal by DW injection, pinning and depinning at a geometrical constriction in permalloy nanowire (NW) driven by external in-plane magnetic field, using local electrical probes. The observations of two distinct depinning field values are identified with the help of micromagnetic simulations, as being due to vortex DWs of different chiralities. Statistical analysis gave an estimate of chirality dependent pinning probability of DWs at this constriction. The stochastic nature of the DW based reversal driven by magnetic field is revealed here. The asymmetry in the depinning field of the DWs to move to either side of constriction indicates the asymmetric nature of the barrier potential seen by the DWs. The results demonstrate the difficulties in achieving deterministic switching behavior of DW assisted reversal, and provide a platform to understand the main bottlenecks in the technological implementation of DWs.

  15. Flux nucleation in the current-induced resistive state of a constricted type I superconductor

    International Nuclear Information System (INIS)

    Selig, K.P.; Huebener, R.P.

    1981-01-01

    The current-induced resistive state in a constricted type I superconductor is characterized by a train of flux tubes traversing the sample perpendicular to the direction of the applied current following its nucleation at the sample edge. The temporal structure of the nucleation process can be investigated by attempting to synchronize this process with small periodic current pulses superimposed on the direct bias current. The resistive dc voltage is then to be measured as a function of the pulse parameters such as frequency and width. We have performed such experiments at 4.2 K on constricted Pb films of 6--8 μm thickness and 100 μm width. Simultaneously with the electrical measurements the dynamic behavior of the flux tubes was directly observed using a stroboscopic magnetooptical method for magnetic flux detection. Our electrical measurements clearly show how the size of the nucleated flux tubes varies with the direct bias current and the nucleation frequency. The positive wall energy in the Pb films results in a lower limit for this size as expected. The influence of the preceding flux tubes still existing within the constriction upon the flux nucleation process is revealed in detail. All observations can be understood from a consideration of the energy balance during the flux nucleation process

  16. Integrins Regulate Apical Constriction via Microtubule Stabilization in the Drosophila Eye Disc Epithelium

    Directory of Open Access Journals (Sweden)

    Vilaiwan M. Fernandes

    2014-12-01

    Full Text Available During morphogenesis, extracellular signals trigger actomyosin contractility in subpopulations of cells to coordinate changes in cell shape. To illuminate the link between signaling-mediated tissue patterning and cytoskeletal remodeling, we study the progression of the morphogenetic furrow (MF, the wave of apical constriction that traverses the Drosophila eye imaginal disc preceding photoreceptor neurogenesis. Apical constriction depends on actomyosin contractility downstream of the Hedgehog (Hh and bone morphogenetic protein (BMP pathways. We identify a role for integrin adhesion receptors in MF progression. We show that Hh and BMP regulate integrin expression, the loss of which disrupts apical constriction and slows furrow progression; conversely, elevated integrins accelerate furrow progression. We present evidence that integrins regulate MF progression by promoting microtubule stabilization, since reducing microtubule stability rescues integrin-mediated furrow acceleration. Thus, integrins act as a genetic link between tissue-level signaling events and morphological change at the cellular level, leading to morphogenesis and neurogenesis in the eye.

  17. Comparison of turbulent models in the case of a constricted tube

    Directory of Open Access Journals (Sweden)

    Elcner Jakub

    2017-01-01

    Full Text Available The validation of a proper solution is an indispensable phase of every numerical simulation. Nowadays, many turbulent models are available, whose application leads to slightly different solution of flow behaviour depending on the boundary conditions of a specific problem. It is essential to select the proper turbulence model appropriate for the given situation. The aim of this study is to select the most suitable two-equation eddy-viscosity model, which can be further used during calculations of airflow in human airways. For this purpose, geometry of a constricted tube with well-documented experimental measurements was chosen. The flow in the constricted tube was calculated using Spallart-Almaras, k-omega, k-epsilon and SST model approach using commercial software. The outcome of the comparison is a choice of the suitable model which is capable of simulating the transition of the boundary layer from laminar to turbulent flow. This transition typically arises in the upper part of the respiratory system, where the airways are constricted, specifically in the area, where the oral cavity continues through the glottis to trachea. The simulations were performed in a commercial solver Star-CCM+.

  18. One-stage release of congenital constriction band in lower limb from new born to 3 years

    OpenAIRE

    Das, Sakti Prasad; Sahoo, PK; Mohanty, RN; Das, SK

    2010-01-01

    Background: Congenital constriction band is the most common cause of terminal congenital malformation of a limb and lymphoedema. Superficial bands do not need any treatment, but deeper bands are managed with excision and Z-plasty. The circumferential bands are released in two to three stages to prevent vascular compromise. The purpose of this study was to present the outcome of one-stage release. Materials and Methods: Nineteen children, 12 boys and 7 girls, with 24 congenital constriction...

  19. Pericarditis - constrictive

    Science.gov (United States)

    ... the source of the problem, treatment may include antibiotics, medicines for tuberculosis, or other treatments. Diuretics ("water pills") are often used in small doses to help the body remove excess fluid. Pain medicines may be needed ...

  20. Imaging of cauda equina edema in lumbar canal stenosis by using gadolinium-enhanced MR imaging: experimental constriction injury.

    Science.gov (United States)

    Kobayashi, S; Uchida, K; Takeno, K; Baba, H; Suzuki, Y; Hayakawa, K; Yoshizawa, H

    2006-02-01

    It has been reported that disturbance of blood flow arising from circumferential compression of the cauda equina by surrounding tissue plays a major role in the appearance of neurogenic intermittent claudication (NIC) associated with lumbar spinal canal stenosis (LSCS). We created a model of LSCS to clarify the mechanism of enhancement within the cauda equina on gadolinium-enhanced MR images from patients with LSCS. In 20 dogs, a lumbar laminectomy was performed by applying circumferential constriction to the cauda equina by using a silicon tube, to produce 30% stenosis of the circumferential diameter of the dural tube. After 1 and 3 weeks, gadolinium and Evans blue albumin were injected intravenously at the same time. The sections were used to investigate the status of the blood-nerve barrier function under a fluorescence microscope and we compared gadolinium-enhanced MR images with Evans blue albumin distribution in the nerve. The other sections were used for light and transmission electron microscopic study. In this model, histologic examination showed congestion and dilation in many of the intraradicular veins, as well as inflammatory cell infiltration. The intraradicular edema caused by venous congestion and Wallerian degeneration can also occur at sites that are not subject to mechanical compression. Enhanced MR imaging showed enhancement of the cauda equina at the stenosed region, demonstrating the presence of edema. Gadolinium-enhanced MR imaging may be a useful tool for the diagnosis of microcirculatory disorders of the cauda equina associated with LSCS.

  1. Bone-borne palatal distraction to correct the constricted cleft maxilla.

    Science.gov (United States)

    Vyas, Raj M; Jarrahy, Reza; Sisodia, Manisha; Jourabchi, Natanel; Wasson, Kristy L; Bradley, James P

    2009-05-01

    Transverse maxillary hypoplasia, with or without cleft deformity, is typically treated with orthodontic expansion. However, the management of those patients who present later in life with severe uncorrected deformities or who have failed prior orthodontic care remains controversial. Tooth-borne palatal expanders have limitations in this subset of patients with scarred, constricted cleft palate. In this study, we assess the efficacy and safety of using a bone-borne palatal distraction device as an alternative treatment for this difficult subset of patients. Older children with a constricted maxilla who previously had unilateral or bilateral cleft lip and palate repairs and failed orthodontic expansion were included in the study (n = 15). Patients underwent Le Fort I corticotomy with placement of the bone-borne distraction device, expansion at a rate of 0.5 mm/d, and subsequent alveolar bone grafting. Preoperative and follow-up maxillary impressions were compared with assessed improvements in intermolar distance, intercanine distance, alveolar cleft width, and total palatal area. In addition, a small group of noncleft patients with constricted maxillas was treated with bone-borne palatal distraction without a corticotomy (n = 4). The mean amount of distraction in all patients was 14.1 mm, with a follow-up period of 19 months (range, 8-30 months). The average increase in intermolar distance was 8.4 mm, intercanine distance increased by an average of 9.5 mm, and palate surface areas were increased by a mean of 28.9 mm2. Relapse was between 4% and 7%, and all patients underwent subsequent alveolar bone grafting. In addition, the noncleft patients successfully underwent bone-borne palatal distraction without a corticotomy, with a 4% to 5% relapse. Rapid palatal expansion using a bone-borne distraction device in cleft patients with transverse maxillary hypoplasia who have failed nonsurgical orthodontic expansion provides adequate expansion necessary for alveolar bone

  2. DC biased low-frequency insulating constriction dielectrophoresis for protein biomolecules concentration.

    Science.gov (United States)

    Zhang, Peng; Liu, Yuxin

    2017-09-01

    Sample enrichment or molecules concentration is considered an essential step in sample processing of miniaturized devices aimed at biosensing and bioanalysis. Among all the means involved to achieve this aim, dielectrophoresis (DEP) is increasingly employed in molecules manipulation and concentration because it is non-destructive and high efficiency. This paper presents a methodology to achieve protein concentration utilizing the combination effects of electrokinetics and low frequency insulating dielectrophoresis (iDEP) generated within a microfluidic device, in which a submicron constricted channel was fabricated using DNA molecular combing and replica molding. This fabrication technique avoids using e-beam lithography or other complicated nanochannel fabrication methods, and provides an easy and low cost approach with the flexibility of controlling channel dimensions to create highly constricted channels embedded in a microfluidic device. With theoretical analysis and experiments, we demonstrated that fluorescein isothiocyanate conjugated bovine serum albumin (FITC-BSA) protein molecules can be significantly concentrated to form an arc-shaped band near the constricted channel under the effects of a negative dielectrophoretic force and DC electrokinetic forces within a short period of time. It was also observed that the amplitudes of the applied DC and AC electric fields, the AC frequencies as well as the suspending medium conductivities had strong effects on the concentration responses of the FITC-BSA molecules, including the concentrated area and position, intensities of the focused molecules, and concentration speed. Our method provides a simple and flexible approach for quickly concentrating protein molecules by controlling the applied electric field parameters. The iDEP device reported in this paper can be used as a stand-alone sensor or worked as a pre-concentration module integrated with biosensors for protein biomarker detection. Furthermore, low

  3. Application of the chronic constriction injury of the partial sciatic nerve model to assess acupuncture analgesia

    Directory of Open Access Journals (Sweden)

    Zhi MJ

    2017-09-01

    Full Text Available Mu-Jun Zhi,1,2,* Kun Liu,1,* Zhou-Li Zheng,1,3 Xun He,1 Tie Li,2 Guang Sun,1,2 Meng Zhang,4 Fu-Chun Wang,2 Xin-Yan Gao,1 Bing Zhu1 1Department of Physiology, Institute of Acupuncture and Moxibustion, China Academy of Chinese Medical Sciences, Beijing, People’s Republic of China; 2College of Acupuncture and Moxibustion, Changchun University of Chinese Medicine, Changchun, People’s Republic of China; 3College of Acupuncture and Moxibution, Shaanxi University of Chinese Medicine, People’s Republic of China; 4Department of Chinese Medicine, Dongli Hospital of Traditional Chinese Medicine, Tianjin, People’s Republic of China *These authors contributed equally to this work Purpose: To validate and explore the application of a rat model of chronic constriction injury to the partial sciatic nerve in investigation of acupuncture analgesia.Methods: Chronic constriction injury of the sciatic nerve (CCI and chronic constriction injury of the partial sciatic nerve (CCIp models were generated by ligating either the sciatic nerve trunk or its branches in rats. Both models were evaluated via paw mechanical withdrawal latency (PMWL, paw mechanical withdrawal threshold (PMWT, nociceptive reflex-induced electromyogram (C-fiber reflex EMG, and dorsal root ganglion immunohistochemistry. Electroacupuncture (EA was performed at GB30 to study the analgesic effects on neuropathic pain and the underlying mechanisms.Results: Following ligation of the common peroneal and tibial nerves, CCIp rats exhibited hindlimb dysfunction, hind paw shrinkage and lameness, mirroring those of CCI rats (generated by ligating the sciatic nerve trunk. Compared to presurgery measurements, CCIp and CCI modeling significantly decreased the PMWL and PMWT. EA at GB30 increased the PMWL and PMWT in both CCI and CCIp rats. Calcitonin gene-related polypeptide and substance P expressions were apparently increased in both CCI and CCIp groups, but were not different from each other. The C

  4. Evaluation and Comparison of the Position of the Apical Constriction in Single-root and Multiple-root Teeth

    Directory of Open Access Journals (Sweden)

    Alireza Farhad

    2017-12-01

    Full Text Available Introduction: Precise knowledge of the location of the apical constriction is essential to root canal treatment and long-term prognosis. Considering the differences in the apical constriction and size of the roots in single- and multiple-root teeth in various races, examination and comparison of the location of the apical constriction in single-root and multiple-root teeth are of paramount importance. The present studies aimed to measure and compare the distance of the apical constriction from the apical foramen and anatomical apex in single-root and multiple-root teeth. Materials and Methods: In this cross-sectional study, 60 roots of single-rooted teeth and 60 roots of multiple-rooted teeth were collected from the patients referring to the health centers in Isfahan, Iran. After cleansing and disinfecting the surface of the roots, the surface of the teeth was washed with hypochlorite. Based on the direction of the apical foramen, a longitudinal cut was made in the same direction, and the roots were examined microscopically at the magnification of 25. Following that, the distance of the apical constriction from the apical foramen and anatomical apex was measured using a digital camera. In addition, mean and standard deviation of the obtained distance values were determined. Distances in the single-root and multiple-root teeth were compared using independent t-test, at the significance level of Results: Mean distance between the apical constriction and apical foramen was 0.86±0.33 mm in the single-root teeth and 0.072±0.27 mm in the multiple-root teeth. Mean distance between the apical constriction and anatomical apex was 1.14±0.36 mm in the single-root teeth and 1.03±0.36 mm in the multiple-root teeth. Moreover, the results of independent t-test showed the distance of the apical constriction from the apical foramen to be significant between single-root and multiple-rooted teeth (P=0.013. However, the distance between the apical constriction

  5. Occult constrictive pericardial disease emerging 40 years after chest radiation therapy: a case report.

    Science.gov (United States)

    Goten, Chiaki; Murai, Hisayoshi; Takashima, Shin-Ichiro; Kato, Takeshi; Usui, Soichiro; Furusho, Hiroshi; Saeki, Takahiro; Sakagami, Satoru; Takemura, Hirofumi; Kaneko, Shuichi; Takamura, Masayuki

    2018-05-31

    The main etiology of constrictive pericarditis (CP) has changed from tuberculosis to therapeutic mediastinal radiation and cardiac surgery. Occult constrictive pericardial disease (OCPD) is a covert disease in which CP is manifested in a condition of volume overload. A 60-year-old patient with a history of thoracic radiation therapy for non-Hodgkin's lymphoma (40 years earlier) was transferred to our hospital for treatment of repeated congestive heart failure. For a preoperative hemodynamic study, pre-hydration with intravenous normal saline (50 mL/hour) was used to manifest the pericardial disease and prevent contrast-induced nephropathy. The hemodynamic study showed a right ventricular dip-plateau pattern and discordance of right and left ventricular systolic pressures during inspiration, which was not seen in the volume-controlled state. These responses were concordant with OCPD. A pericardiectomy, aortic valve replacement, and mitral and tricuspid valve repair were performed. Postoperatively, the heart failure was controlled with standard medication. This case revealed a volume-induced change in hemodynamics in OCPD with severe combined valvular heart disease, which suggests the importance of considering OCPD in patients who had undergone radiation therapy 40 years before.

  6. Congenital Constriction Ring of Limbs in Subjects with History of Maternal Substance Use

    International Nuclear Information System (INIS)

    Malik, S.; Lal, K.; Fatima, N. G.; Haque, S.; Samo, A.

    2015-01-01

    Congenital Constriction Ring (CCR) is a rare malformation which manifests itself in the form of ring-like constrictive bands. Due to its heterogeneous nature, its etiology remains unclear. Here, we present a series of seven independent individuals afflicted with CCR, which primarily involved the digits. The phenotypic manifestations included terminal phalangeal reduction, anonychia, digit hypoplasia, and acrosyndactyly. Mesoaxial digits in hands and preaxial digits in feet were most frequently affected. Camptodactyly and clubfoot were witnessed in four and one subject, respectively. Curiously, mothers of six of these subjects revealed that they consumed copious amounts of Multani mitti(Fuller's clay) and/or Naswar(nonsmoke-tobacco), during their respective pregnancies. Maternal substance use during pregnancy is not an unusual practice, however, its relationship with CCR as pregnancy outcome remains unexplored. Case-control studies are warranted to elucidate the relationship between the exposure to these substances and the etiology of CCR and/or other limb defects in the offspring. (author)

  7. Spontaneous spin polarization and charge localization in metal nanowires: the role of a geometric constriction

    Energy Technology Data Exchange (ETDEWEB)

    Cortes-Huerto, R; Ballone, P [Atomistic Simulation Centre, Queen' s University Belfast, Belfast BT7 1NN (United Kingdom)

    2010-07-28

    An idealized jellium model of conducting nanowires with a geometric constriction is investigated by density functional theory (DFT) in the local spin density (LSD) approximation. The results reveal a fascinating variety of spin and charge patterns arising in wires of sufficiently low (r{sub s} {>=} 15) average electron density, pinned at the indentation by an apparent attractive interaction with the constriction. The spin-resolved frequency-dependent conductivity shows a marked asymmetry in the two spin channels, reflecting the spontaneous spin polarization around the wire neck. The relevance of the computational results is discussed in relation to the so-called 0.7 anomaly found by experiments in the low-frequency conductivity of nanowires at near-breaking conditions (see 2008 J. Phys.: Condens Matter 20, special issue on the 0.7 anomaly). Although our mean-field approach cannot account for the intrinsic many-body effects underlying the 0.7 anomaly, it still provides a diagnostic tool to predict impending transitions in the electronic structure.

  8. Pediatric constrictive asphyxia a rare form of child abuse: A report of two cases.

    Science.gov (United States)

    Vester, M E M; Bilo, R A C; Nijs, H G T; van Rijn, R R

    2018-04-01

    We present two cases of infants who died under suspicious circumstances. After clinical and legal investigations, non-accidental constrictive asphyxia inflicted by one of the parents was established. The first case presents a to date not yet reported, unique mechanism of trauma. In order to stop his daughter from crying, the father admitted that he sometimes sat on his baby while she was lying on the bed. Occasionally increasing his force by pulling with his hands on the bottom of the bed. In the second case tight swaddling and encircling chest compression was the causative mechanism. In both cases the father was sentenced to imprisonment with mandate psychiatric care. Only two previous reports of this uncommon and relatively unknown cause of child abuse, called constrictive asphyxia, are known. In all reported cases static loading of the chest resulted in rib fractures and demise of the child. This rare abusive mechanism should be known to pediatric radiologists and pathologists. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. A Rare Case of Pneumopericardium in the Setting of Tuberculous Constrictive Pericarditis

    Directory of Open Access Journals (Sweden)

    Lauro L. Abrahan IV

    2017-01-01

    Full Text Available A 28-year-old Filipino male was admitted due to high-grade fevers and dyspnea on a background of chronic cough and weight loss. Due to clinical and echocardiographic signs of cardiac tamponade, emergency pericardiocentesis was performed on his first hospital day. Five days after, chest radiographs showed new pockets of radiolucency within the cardiac shadow, indicative of pneumopericardium. On repeat echo, air microbubbles admixed with loculated effusion were visualized in the anterior pericardial space. Constrictive physiology was also supported by a thickened pericardium, septal bounce, exaggerated respiratory variation in AV valve inflow, and IVC plethora. A chest CT scan confirmed the presence of an air-fluid level within the pericardial sac. The patient was started on a quadruple antituberculosis regimen and IV piperacillin-tazobactam to cover for superimposed acute bacterial pericarditis. Pericardiectomy was performed as definitive management, with stripped pericardium measuring 5–7 mm thick and caseous material extracted from the pericardial sac. Histopathology was consistent with tuberculosis. This report highlights pneumopericardium as a rare complication of pericardiocentesis. We focused on the utility of echocardiography for diagnosing and monitoring this condition on a background of tuberculous constrictive pericarditis, ultimately convincing us that pericardiectomy was necessary, instead of the usual conservative measures for pneumopericardium.

  10. Leucine - /sup 14/C transport through erythrocyte cell membrane in newborns with hypertrophic constriction of the pylorus

    Energy Technology Data Exchange (ETDEWEB)

    Stepniewski, M; Janik, A [Akademia Medyczna, Krakow (Poland)

    1980-01-01

    In 12 newborns with hypertrophic constriction of the pylorus the coefficient of the leucine - /sup 14/C distribution in the erythrocyte intracellular twice: the first time during day prior the operation corresponding to advanced malnutrition of the newborns, and the second time seven days after pylorotomy. During the second period the effects of hyponutrition were partially balanced. The obtained data were compared with that noted in 12 healthy newborns and additionally with data of examination done with samples of conserved blood. In newborns with hypertrophic constriction of the pylorus the coefficient of leucine distribution prior the operation was significantly lower than that in the control group and conserved blood. After seven days from operation a significant increase of above coefficient is compared with the control group and erythrocytes in conserved blood has been noted. Above results suggest that disturbances in penetration of leucine through cell membranes of erythrocytes are in association with malnutrition caused by constriction of the pylorus.

  11. Chylous ascites and chylothorax due to constrictive pericarditis in a patient infected with HIV: a case report

    Directory of Open Access Journals (Sweden)

    Summachiwakij Sarawut

    2012-06-01

    Full Text Available Abstract Introduction Chylothorax and chylous ascites are uncommon and usually associated with trauma or neoplasms. To the best of our knowledge, constrictive pericarditis leading to chylothorax and chylous ascites in a person infected with HIV has never previously been described. Case presentation A 39-year-old Thai man was referred to our institute with progressive dyspnea, edema and abdominal distension. His medical history included HIV infection and pulmonary tuberculosis that was complicated by tuberculous pericarditis and cardiac tamponade. Upon further investigation, we found constrictive pericarditis, chylothorax and chylous ascites. A pericardiectomy was performed which resulted in gradual resolution of the ascites and chylous effusion. Conclusions Although constrictive pericarditis is an exceptionally rare cause of chylothorax and chylous ascites, it should nonetheless be considered in the differential diagnosis as a potentially reversible cause.

  12. Pupil constriction evoked in vitro by stimulation of the oculomotor nerve in the turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Dearworth, James R; Brenner, J E; Blaum, J F; Littlefield, T E; Fink, D A; Romano, J M; Jones, M S

    2009-01-01

    The pond turtle (Trachemys scripta elegans) exhibits a notably sluggish pupillary light reflex (PLR), with pupil constriction developing over several minutes following light onset. In the present study, we examined the dynamics of the efferent branch of the reflex in vitro using preparations consisting of either the isolated head or the enucleated eye. Stimulation of the oculomotor nerve (nIII) using 100-Hz current trains resulted in a maximal pupil constriction of 17.4% compared to 27.1% observed in the intact animal in response to light. When current amplitude was systematically increased from 1 to 400 microA, mean response latency decreased from 64 to 45 ms, but this change was not statistically significant. Hill equations fitted to these responses indicated a current threshold of 3.8 microA. Stimulation using single pulses evoked a smaller constriction (3.8%) with response latencies and threshold similar to that obtained using train stimulation. The response evoked by postganglionic stimulation of the ciliary nerve using 100-Hz trains was largely indistinguishable from that of train stimulation of nIII. However, application of single-pulse stimulation postganglionically resulted in smaller pupil constriction at all current levels relative to that of nIII stimulation, suggesting that there is amplification of efferent drive at the ganglion. Time constants for constrictions ranged from 88 to 154 ms with relaxations occurring more slowly at 174-361 ms. These values for timing from in vitro are much faster than the time constant 1.66 min obtained for the light response in the intact animal. The rapid dynamics of pupil constriction observed here suggest that the slow PLR of the turtle observed in vivo is not due to limitations of the efferent pathway. Rather, the sluggish response probably results from photoreceptive mechanisms or central processing.

  13. One-stage release of congenital constriction band in lower limb from new born to 3 years

    Directory of Open Access Journals (Sweden)

    Das Sakti

    2010-01-01

    Full Text Available Background: Congenital constriction band is the most common cause of terminal congenital malformation of a limb and lymphoedema. Superficial bands do not need any treatment, but deeper bands are managed with excision and Z-plasty. The circumferential bands are released in two to three stages to prevent vascular compromise. The purpose of this study was to present the outcome of one-stage release. Materials and Methods: Nineteen children, 12 boys and 7 girls, with 24 congenital constriction bands constituted the clinical material. The mean age at presentation was 57 days (range 12 hours to 3 years Band was unilateral in 14 and bilateral in five limbs. In unilateral cases, right side was involved in nine cases and left side in five. The constriction band is seen at the junction of middle and distal third. The patients having constriction bands in lower limbs and age less than 3 years were included in the study. One stage circumferential release of congenital constriction band was performed. Our youngest patient was operated at the age of six months. Club feet, (n=8 and lymphedema (n=7 were associated anomalies. Club feet and band were released in one stage in three limbs. The results were evaluated by criteria described by Joseph Upton and Cissy Tan. Results: There were 18 excellent, six satisfactory results. No wound problem occurred. No vascular compromise was noted during or after the procedure. On follow-up, distal swelling reduced. Conclusion: One-stage circumferential release of congenital constriction band in lower limbs with or without lymphodema is a safe and easy procedure.

  14. Electronic conductance model in constricted MoS{sub 2} with nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Sarathy, Aditya [Beckman Institute for Advanced Science and Technology, University of Illinois, Urbana, Illinois 61801 (United States); Department of Electrical and Computer Engineering, University of Illinois, Urbana, Illinois 61801 (United States); Leburton, Jean-Pierre, E-mail: jleburto@illinois.edu [Beckman Institute for Advanced Science and Technology, University of Illinois, Urbana, Illinois 61801 (United States); Department of Electrical and Computer Engineering, University of Illinois, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois, Urbana, Illinois 61801 (United States)

    2016-02-01

    We describe a self-consistent model for electronic transport in a molybdenum di-sulphide (MoS{sub 2}) layer containing a nanopore in a constricted geometry. Our approach is based on a semi-classical thermionic Poisson-Boltzmann technique using a two-valley model within the effective mass approximation to investigate perturbations caused by the nanopore on the electronic current. In particular, we show that the effect of the nanopore on the conductance is reduced as the nanopore is moved from the center to the layer edges. Our model is applied to the detection of DNA translocating through the nanopore, which reveals current features similar to those as predicted in nanopore graphene layers.

  15. A constriction factor based particle swarm optimisation algorithm to solve the economic dispatch problem including losses

    Energy Technology Data Exchange (ETDEWEB)

    Young, Steven; Montakhab, Mohammad; Nouri, Hassan

    2011-07-15

    Economic dispatch (ED) is one of the most important problems to be solved in power generation as fractional percentage fuel reductions represent significant cost savings. ED wishes to optimise the power generated by each generating unit in a system in order to find the minimum operating cost at a required load demand, whilst ensuring both equality and inequality constraints are met. For the process of optimisation, a model must be created for each generating unit. The particle swarm optimisation technique is an evolutionary computation technique with one of the most powerful methods for solving global optimisation problems. The aim of this paper is to add in a constriction factor to the particle swarm optimisation algorithm (CFBPSO). Results show that the algorithm is very good at solving the ED problem and that CFBPSO must be able to work in a practical environment and so a valve point effect with transmission losses should be included in future work.

  16. Annexin A4 and A6 induce membrane curvature and constriction during cell membrane repair

    DEFF Research Database (Denmark)

    Boye, Theresa Louise; Maeda, Kenji; Pezeshkian, Weria

    2017-01-01

    Efficient cell membrane repair mechanisms are essential for maintaining membrane integrity and thus for cell life. Here we show that the Ca2+- and phospholipid-binding proteins annexin A4 and A6 are involved in plasma membrane repair and needed for rapid closure of micron-size holes. We demonstrate...... that annexin A4 binds to artificial membranes and generates curvature force initiated from free edges, whereas annexin A6 induces constriction force. In cells, plasma membrane injury and Ca2+ influx recruit annexin A4 to the vicinity of membrane wound edges where its homo-trimerization leads to membrane...... that induction of curvature force around wound edges is an early key event in cell membrane repair....

  17. Antiallodynic Effect of Herbal Medicine Yokukansan on Peripheral Neuropathy in Rats with Chronic Constriction Injury

    Directory of Open Access Journals (Sweden)

    Yasuyuki Suzuki

    2012-01-01

    Full Text Available Yokukansan, one of the traditional Japanese herbal medicines, ameliorated neuropathic pain symptoms in patients. In this study, we investigated the effects of yokukansan on neuropathic pain in chronic constriction injury (CCI model. Oral administration of yokukansan significantly inhibited mechanical and cold allodynia in the von Frey hair or acetone test, respectively. In comparison, amitriptyline, a tricyclic antidepressant, demonstrated moderate, but not significant, antiallodynic effects in the mechanical and cold tests. Yokukansan significantly inhibited the cerebrospinal fluid dialysate level of glutamate that had increased by the stimulation of brush or acetone. Glutamate transporter inhibitors, DL-threo-beta-hydroxy aspartate and dihydrokainate, decreased the yokukansan-induced antiallodynic actions in CCI rats. Our results suggest that yokukansan was confirmed to have antiallodynic effects in CCI rats, which are related to a blockade of glutamatergic neurotransmission via activation of glutamate transporters in the spinal cord.

  18. Tongluo Zhitong Prescription Alleviates Allodynia, Hyperalgesia, and Dyskinesia in the Chronic Constriction Injury Model of Rats

    Directory of Open Access Journals (Sweden)

    Zhiyong Wang

    2017-01-01

    Full Text Available Neuropathic pain is common in clinical practice. Exploration of new drug therapeutics has always been carried out for more satisfactory effects and fewer side-effects. In the present study, we aimed to investigate effects of Tongluo Zhitong Prescription (TZP, a compounded Chinese medicine description, on neuropathic pain model of rats with chronic constriction injury (CCI. The CCI model was established by loosely ligating sciatic nerve with catgut suture, proximal to its trifurcation. The static and dynamic allodynia, heat hyperalgesia, mechanical allodynia, cold allodynia, and gait were assessed. Our results showed that TZP alleviated CCI-induced static and dynamic allodynia, suppressed heat hyperalgesia and cold and mechanical allodynia, and improved gait function. These results suggest that TZP could alleviate neuropathic pain. Further experiments are needed to explore its mechanisms.

  19. A case of post-radiation constrictive pericarditis developing 12 years after radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Sakuraba, Motoki; Tanaka, Jun-ichi; Ikeda, Shingo; Kigawa, Ikutaro; Fukuda, Sachito; Wanibuchi, Yasuhiko [Mitsui Memorial Hospital, Tokyo (Japan)

    1997-11-01

    A 70-year-old woman underwent radical mastectomy for carcinoma of the left breast in 1982. Postoperative radiation therapy was given in a total dose of 50 Gy for parasternal and left subclavian nodes. Symptoms of heart failure such as exertional dyspnea, facial edema, and hepatomegaly manifested in 1992. Cardiac catheterization revealed marked elevation of mean right atrial pressure and right ventricular end-diastolic pressure. The pressure wave form of the right ventricle showed the so called ``dip and plateau`` feature. Pericardiectomy without using extracorporeal circulation was performed in 1994. Operative findings and pathological study results were compatible with radiation-induced constrictive pericarditis. She rapidly recovered from heart failure after this operation, and has done very well to date. (author)

  20. Constriction of juxta-ductal aorta and rapid progression of obstruction in a newborn

    Directory of Open Access Journals (Sweden)

    Awasthy Neeraj

    2010-01-01

    Full Text Available A 13-day-old baby girl presenting with features of congestive cardiac failure was found to have coarctation of the aorta (CoA and patent ductus arteriosus (PDA by echocardiography. Doppler spectral display revealed moderate CoA. Echocardiogram, 12 hours later, showed severe juxtaductal aortic coarctation with spontaneous closure of PDA. This case emphasises the need to keep a close watch on the progress of CoA in the neonatal period, even if the duct has narrowed to a small size thus demonstrating the role of constriction of juxtaductal aorta in pathogenesis of coaractation. Closure of even asmall PDA can cause acute progression CoA in the presence of posterior shelf.

  1. Constriction of juxta-ductal aorta and rapid progression of obstruction in a newborn

    International Nuclear Information System (INIS)

    Awasthy, Neeraj; Tomar, Munesh; Radhakrishnan, Sitaraman; Iyer, Krishna Subramoney

    2010-01-01

    A 13-day-old baby girl presenting with features of congestive cardiac failure was found to have coarctation of the aorta (CoA) and patent ductus arteriosus (PDA) by echocardiography. Doppler spectral display revealed moderate CoA. Echocardiogram, 12 hours later, showed severe juxtaductal aortic coarctation with spontaneous closure of PDA. This case emphasises the need to keep a close watch on the progress of CoA in the neonatal period, even if the duct has narrowed to a small size thus demonstrating the role of constriction of juxtaductal aorta in pathogenesis of coaractation. Closure of even asmall PDA can cause acute progression CoA in the presence of posterior shelf

  2. Amnioserosa cell constriction but not epidermal actin cable tension autonomously drives dorsal closure.

    Science.gov (United States)

    Pasakarnis, Laurynas; Frei, Erich; Caussinus, Emmanuel; Affolter, Markus; Brunner, Damian

    2016-11-01

    Tissue morphogenesis requires coordination of multiple force-producing components. During dorsal closure in fly embryogenesis, an epidermis opening closes. A tensioned epidermal actin/MyosinII cable, which surrounds the opening, produces a force that is thought to combine with another MyosinII force mediating apical constriction of the amnioserosa cells that fill the opening. A model proposing that each force could autonomously drive dorsal closure was recently challenged by a model in which the two forces combine in a ratchet mechanism. Acute force elimination via selective MyosinII depletion in one or the other tissue shows that the amnioserosa tissue autonomously drives dorsal closure while the actin/MyosinII cable cannot. These findings exclude both previous models, although a contribution of the ratchet mechanism at dorsal closure onset remains likely. This shifts the current view of dorsal closure being a combinatorial force-component system to a single tissue-driven closure event.

  3. Blood pressure is the major driving force for plaque formation in aortic-constricted ApoE-/- mice

    DEFF Research Database (Denmark)

    Johansson, Maria E.; Wickman, Anna; Skøtt, Ole

    2006-01-01

    OBJECTIVE: Using an aortic constriction model in mice, we studied whether the increase in pressure or the activation of the renin-angiotensin system (RAS) and its main receptors is the main driving force for plaque progression. METHODS: Male ApoE mice underwent sham surgery or placement of a supr...

  4. Importance of Clinical and Laboratory Findings in the Diagnosis and Surgical Prognosis of Patients with Constrictive Pericarditis

    Directory of Open Access Journals (Sweden)

    Fábio Fernandes

    2017-10-01

    Full Text Available Abstract Background: International studies have reported the value of the clinical profile and laboratory findings in the diagnosis of constrictive pericarditis. However, Brazilian population data are scarce. Objective: To assess the clinical characteristics, sensitivity of imaging tests and factors related to the death of patients with constrictive pericarditis undergoing pericardiectomy. Methods: Patients with constrictive pericarditis surgically confirmed were retrospectively assessed regarding their clinical and laboratory variables. Two methods were used: transthoracic echocardiography and cardiac magnetic resonance imaging. Mortality predictors were determined by use of univariate analysis with Cox proportional hazards model and hazard ratio. All tests were two-tailed, and an alpha error ≤ 5% was considered statically significant. Results: We studied 84 patients (mean age, 44 ± 17.9 years; 67% male. Signs and symptoms of predominantly right heart failure were present with jugular venous distention, edema and ascites in 89%, 89% and 62% of the cases, respectively. Idiopathic etiology was present in 69.1%, followed by tuberculosis (21%. Despite the advanced heart failure degree, low BNP levels (median, 157 pg/mL were found. The diagnostic sensitivities for constriction of echocardiography and magnetic resonance imaging were 53.6% and 95.9%, respectively. There were 9 deaths (10.7%, and the risk factors were: anemia, BNP and C reactive protein levels, pulmonary hypertension >55 mm Hg, and atrial fibrillation. Conclusions: Magnetic resonance imaging had better diagnostic sensitivity. Clinical, laboratory and imaging markers were associated with death.

  5. Pharmacological correlation between the formalin test and the neuropathic pain behavior in different species with chronic constriction injury.

    NARCIS (Netherlands)

    Vissers, K.C.P.; Geenen, F.; Biermans, R.; Meert, T.F.

    2006-01-01

    Research on mechanisms of drug action, and preclinical screening of molecules with a potential activity on neuropathic pain requires extensive animal work. The chronic constriction injury model is one of the best-characterized models of neuropathic pain behavior in rats, but requires extensive time

  6. Evaluating GPS biologging technology for studying spatial ecology of large constricting snakes

    Science.gov (United States)

    Smith, Brian; Hart, Kristen M.; Mazzotti, Frank J.; Basille, Mathieu; Romagosa, Christina M.

    2018-01-01

    Background: GPS telemetry has revolutionized the study of animal spatial ecology in the last two decades. Until recently, it has mainly been deployed on large mammals and birds, but the technology is rapidly becoming miniaturized, and applications in diverse taxa are becoming possible. Large constricting snakes are top predators in their ecosystems, and accordingly they are often a management priority, whether their populations are threatened or invasive. Fine-scale GPS tracking datasets could greatly improve our ability to understand and manage these snakes, but the ability of this new technology to deliver high-quality data in this system is unproven. In order to evaluate GPS technology in large constrictors, we GPS-tagged 13 Burmese pythons (Python bivittatus) in Everglades National Park and deployed an additional 7 GPS tags on stationary platforms to evaluate habitat-driven biases in GPS locations. Both python and test platform GPS tags were programmed to attempt a GPS fix every 90 min.Results: While overall fix rates for the tagged pythons were low (18.1%), we were still able to obtain an average of 14.5 locations/animal/week, a large improvement over once-weekly VHF tracking. We found overall accuracy and precision to be very good (mean accuracy = 7.3 m, mean precision = 12.9 m), but a very few imprecise locations were still recorded (0.2% of locations with precision > 1.0 km). We found that dense vegetation did decrease fix rate, but we concluded that the low observed fix rate was also due to python microhabitat selection underground or underwater. Half of our recovered pythons were either missing their tag or the tag had malfunctioned, resulting in no data being recovered.Conclusions: GPS biologging technology is a promising tool for obtaining frequent, accurate, and precise locations of large constricting snakes. We recommend future studies couple GPS telemetry with frequent VHF locations in order to reduce bias and limit the impact of catastrophic

  7. Pupillary Response and Phenotype in ASD: Latency to Constriction Discriminates ASD from Typically Developing Adolescents.

    Science.gov (United States)

    Lynch, Georgina T F; James, Stephen M; VanDam, Mark

    2018-02-01

    Brain imaging data describe differences in the ASD brain, including amygdala overgrowth, neural interconnectivity, and a three-phase model of neuroanatomical changes from early post-natal development through late adolescence. The pupil reflex test (PRT), a noninvasive measure of brain function, may help improve early diagnosis and elucidate underlying physiology in expression of ASD endophenotype. Commonly observed characteristics of ASD include normal visual acuity but difficulty with eye gaze and photosensitivity, suggesting deficient neuromodulation of cranial nerves. Aims of this study were to confirm sensitivity of the PRT for identifying adolescents with ASD, determine if a phenotype for a subtype of ASD marked by pupil response is present in adolescence, and determine whether differences could be observed on a neurologic exam testing cranial nerves II and III (CNII; CNIII). Using pupillometry, constriction latency was measured serving as a proxy for recording neuromodulation of cranial nerves underlying the pupillary reflex. The swinging flashlight method, used to perform the PRT for measuring constriction latency and return to baseline, discriminated ASD participants from typically developing adolescents on 72.2% of trials. Results further confirmed this measure's sensitivity within a subtype of ASD in later stages of development, serving as a correlate of neural activity within the locus-coeruleus norepinephrine (LC-NE) system. A brainstem model of atypical PRT in ASD is examined in relation to modulation of cranial nerves and atypical arousal levels subserving the atypical pupillary reflex. Autism Res 2018, 11: 364-375. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Milder forms of autism spectrum disorder (ASD) can be difficult to diagnose based on behavioral testing alone. This study used eye-tracking equipment and a hand-held penlight to measure the pupil reflex in adolescents with "high functioning" ASD and in adolescents

  8. Estimation of current constriction losses via 3D tomography reconstructions in electrochemical devices: a case study of a solid oxide cell electrode/electrolyte interface

    DEFF Research Database (Denmark)

    Nielsen, Jimmi; Jørgensen, Peter Stanley

    2017-01-01

    In the present study, the methodology for accurate estimations of the current constriction resistance in solid state electrochemical devices via 3D tomography reconstructions is developed. The methodology is used to determine the current constriction resistances at the Ni:YSZ anode/YSZ electrolyte...... of the electrolyte thickness. The obtained results on current constriction resistances from numerical calculations on a 3D reconstruction of a Ni:YSZ anode/YSZ electrolyte assembly is compared with existing models with analytical expressions. The comparison shows, that the assumptions of existing models are by far...

  9. EZH2 Inhibition Ameliorates Transverse Aortic Constriction-Induced Pulmonary Arterial Hypertension in Mice

    Directory of Open Access Journals (Sweden)

    Zhan-Li Shi

    2018-01-01

    Full Text Available Background. EPZ005687 is a selective inhibiter of methyltransferase EZH2. In this article, we investigated the protective role and mechanism of EPZ005687 in transverse aortic constriction-induced pulmonary arterial hypertension in mice. Methods. We assigned 15 (6–8 weeks old male balb/c mice to 3 groups randomly: Sham control + DMSO group, TAC + DMSO group, and TAC + EPZ005687 group (10 mg kg−1, once a week for 4 weeks. On day 28 following TAC operation, the right ventricular systolic blood pressure (RVSBP was measured, and lung tissues were collected for laboratory examinations (DHE, Western blot, real-time PCR, and ChIP. Results. Murine PAH model was successfully created by TAC operation as evidenced by increased RVSBP and hypertrophic right ventricle. Compared with the sham control, TAC-induced PAH markedly upregulated the expression of EZH2 and ROS deposition in lungs in PAH mice. The inhibiter of methyltransferase EZH2, EPZ005687 significantly inhibits the development of TAC-induced PAH in an EZH2-SOD1-ROS dependent manner. Conclusion. Our data identified that EZH2 serves a fundamental role in TAC-induced PAH, and administration of EPZ005687 might represent a novel therapeutic target for the treatment of TAC-induced PAH.

  10. Haloperidol aggravates transverse aortic constriction-induced heart failure via mitochondrial dysfunction

    Directory of Open Access Journals (Sweden)

    Yasuharu Shinoda

    2016-07-01

    Full Text Available Haloperidol is an antipsychotic drug that inhibits the dopamine D2 receptor among others. Haloperidol also binds the sigma-1 receptor (σ1R and inhibits it irreversibly. A serious outcome of haloperidol treatment of schizophrenia patients is death due to sudden cardiac failure. Although the cause remains unclear, we hypothesized that these effects were mediated by chronic haloperidol inhibition of cardiac σ1R. To test this, we treated neonatal rat cardiomyocytes with haloperidol, exposed them to angiotensin II and assessed hypertrophy, σ1R expression, mitochondrial Ca2+ transport and ATP levels. In this context, haloperidol treatment altered mitochondrial Ca2+ transport resulting in decreased ATP content by inactivating cardiac σ1R and/or reducing its expression. We also performed transverse aortic constriction (TAC and then treated mice with haloperidol. After two weeks, haloperidol-treated mice showed enhanced heart failure marked by deteriorated cardiac function, reduced ATP production and increasing mortality relative to TAC only mice. ATP supplementation via sodium pyruvate rescued phenotypes seen in haloperidol-treated TAC mice. We conclude that σ1R inactivation or downregulation in response to haloperidol treatment impairs mitochondrial Ca2+ mobilization, depleting ATP depletion from cardiomyocytes. These findings suggest a novel approach to mitigate haloperidol-related adverse effects in schizophrenia patients by ATP supplementation.

  11. Vasopressin-induced constriction of the isolated rat occipital artery is segment dependent.

    Science.gov (United States)

    Chelko, Stephen P; Schmiedt, Chad W; Lewis, Tristan H; Lewis, Stephen J; Robertson, Tom P

    2013-01-01

    Circulating factors delivered to the nodose ganglion (NG) by the occipital artery (OA) have been shown to affect vagal afferent activity, and thus the contractile state of the OA may influence blood flow to the NG. OA were isolated and bisected into proximal and distal segments relative to the external carotid artery. Bisection highlighted stark differences between maximal contractile responses and OA sensitivity. Specifically, maximum responses to vasopressin and the V1 receptor agonist were significantly higher in distal than proximal segments. Distal segments were significantly more sensitive to 5-hydroxytryptamine (5-HT) and the 5-HT2 receptor agonist than proximal segments. Angiotensin II (AT)2, V2 and 5-HT(1B/1D) receptor agonists did not elicit vascular responses. Additionally, AT1 receptor agonists elicited mild, yet not significantly different maximal responses between segments. The results of this study are consistent with contractile properties of rat OA being mediated via AT1, V1 and 5-HT2 receptors and dependent upon the OA segment. Furthermore, vasopressin-induced constriction of the OA, regardless of a bolus dose or a first and second concentration-response curve, retained this unique segmental difference. We hypothesize that these segmental differences may be important in the regulation of blood flow through the OA in health and disease. © 2013 S. Karger AG, Basel.

  12. Vasopressin-induced constriction of the isolated rat occipital artery is segment-dependent

    Science.gov (United States)

    Chelko, Stephen P.; Schmiedt, Chad W.; Lewis, Tristan H.; Lewis, Stephen J.; Robertson, Tom P.

    2014-01-01

    Background Circulating factors delivered to the nodose ganglion (NG) by the occipital artery (OA) have shown to affect vagal afferent activity, and thus the contractile state of the OA may influence blood flow to the NG. Methods OA were isolated and bisected into proximal and distal segments, relative to the external carotid artery. Results Bisection, highlighted stark differences between maximal contractile responses and OA sensitivity. Specifically, maximum responses to vasopressin and the V1 receptor agonist, were significantly higher in distal than proximal segments. Distal segments were significantly more sensitive to 5-HT and the 5-HT2 receptor agonist than proximal segments. AT2, V2 and 5-HT1B/1D receptor agonists did not elicit vascular responses. Additionally, AT1 receptor agonists elicited mild, yet not significantly different maximal responses between segments. Conclusion The results of this study are consistent with contractile properties of rat OA being mediated via AT1, V1 and 5-HT2 receptors, and are dependent upon the OA segment. Furthermore, vasopressin-induced constriction of the OA, regardless of a bolus dose or a first and second concentration response curve retained this unique segmental difference and therefore we hypothesize this may be a pathophysiological response in the regulation of blood flow through the OA. PMID:24192548

  13. Pressure Overload by Transverse Aortic Constriction Induces Maladaptive Hypertrophy in a Titin-Truncated Mouse Model

    Directory of Open Access Journals (Sweden)

    Qifeng Zhou

    2015-01-01

    Full Text Available Mutations in the giant sarcomeric protein titin (TTN are a major cause for inherited forms of dilated cardiomyopathy (DCM. We have previously developed a mouse model that imitates a TTN truncation mutation we found in a large pedigree with DCM. While heterozygous Ttn knock-in mice do not display signs of heart failure under sedentary conditions, they recapitulate the human phenotype when exposed to the pharmacological stressor angiotensin II or isoproterenol. In this study we investigated the effects of pressure overload by transverse aortic constriction (TAC in heterozygous (Het Ttn knock-in mice. Two weeks after TAC, Het mice developed marked impairment of left ventricular ejection fraction (p<0.05, while wild-type (WT TAC mice did not. Het mice also trended toward increased ventricular end diastolic pressure and volume compared to WT littermates. We found an increase in histologically diffuse cardiac fibrosis in Het compared to WT in TAC mice. This study shows that a pattern of DCM can be induced by TAC-mediated pressure overload in a TTN-truncated mouse model. This model enlarges our arsenal of cardiac disease models, adding a valuable tool to understand cardiac pathophysiological remodeling processes and to develop therapeutic approaches to combat heart failure.

  14. Haloperidol aggravates transverse aortic constriction-induced heart failure via mitochondrial dysfunction.

    Science.gov (United States)

    Shinoda, Yasuharu; Tagashira, Hideaki; Bhuiyan, Md Shenuarin; Hasegawa, Hideyuki; Kanai, Hiroshi; Fukunaga, Kohji

    2016-07-01

    Haloperidol is an antipsychotic drug that inhibits the dopamine D2 receptor among others. Haloperidol also binds the sigma-1 receptor (σ1R) and inhibits it irreversibly. A serious outcome of haloperidol treatment of schizophrenia patients is death due to sudden cardiac failure. Although the cause remains unclear, we hypothesized that these effects were mediated by chronic haloperidol inhibition of cardiac σ1R. To test this, we treated neonatal rat cardiomyocytes with haloperidol, exposed them to angiotensin II and assessed hypertrophy, σ1R expression, mitochondrial Ca(2+) transport and ATP levels. In this context, haloperidol treatment altered mitochondrial Ca(2+) transport resulting in decreased ATP content by inactivating cardiac σ1R and/or reducing its expression. We also performed transverse aortic constriction (TAC) and then treated mice with haloperidol. After two weeks, haloperidol-treated mice showed enhanced heart failure marked by deteriorated cardiac function, reduced ATP production and increasing mortality relative to TAC only mice. ATP supplementation via sodium pyruvate rescued phenotypes seen in haloperidol-treated TAC mice. We conclude that σ1R inactivation or downregulation in response to haloperidol treatment impairs mitochondrial Ca(2+) mobilization, depleting ATP depletion from cardiomyocytes. These findings suggest a novel approach to mitigate haloperidol-related adverse effects in schizophrenia patients by ATP supplementation. Copyright © 2016 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  15. Dataset of red light induced pupil constriction superimposed on post-illumination pupil response

    Directory of Open Access Journals (Sweden)

    Shaobo Lei

    2016-09-01

    Full Text Available We collected and analyzed pupil diameter data from of 7 visually normal participants to compare the maximum pupil constriction (MPC induced by “Red Only” vs. “Blue+Red” visual stimulation conditions.The “Red Only” condition consisted of red light (640±10 nm stimuli of variable intensity and duration presented to dark-adapted eyes with pupils at resting state. This condition stimulates the cone-driven activity of the intrinsically photosensitive retinal ganglion cells (ipRGC. The “Blue+Red” condition consisted of the same red light stimulus presented during ongoing blue (470±17 nm light-induced post-illumination pupil response (PIPR, representing the cone-driven ipRGC activity superimposed on the melanopsin-driven intrinsic activity of the ipRGCs (“The Absence of Attenuating Effect of Red light Exposure on Pre-existing Melanopsin-Driven Post-illumination Pupil Response” Lei et al. (2016 [1].MPC induced by the “Red Only” condition was compared with the MPC induced by the “Blue+Red” condition by multiple paired sample t-tests with Bonferroni correction. Keywords: Pupil light reflex, Chromatic pupillometry, Melanopsin, Post-illumination pupil response

  16. A constriction resistance model of conjugated polymer based piezoresistive sensors for electronic skin applications.

    Science.gov (United States)

    Khalili, N; Naguib, H E; Kwon, R H

    2016-05-14

    Human intervention can be replaced through the development of tools resulting from utilization of sensing devices possessing a wide range of applications including humanoid robots or remote and minimally invasive surgeries. Similar to the five human senses, sensors interface with their surroundings to stimulate a suitable response or action. The sense of touch which arises in human skin is among the most challenging senses to emulate due to its ultra high sensitivity. This has brought forth novel challenging issues to consider in the field of biomimetic robotics. In this work, using a multiphase reaction, a polypyrrole (PPy) based hydrogel is developed as a resistive type pressure sensor with an intrinsically elastic microstructure stemming from three dimensional hollow spheres. It is shown that the electrical conductivity of the fabricated PPy based piezoresistive sensors is enhanced as a result of adding conductive fillers and therefore, endowing the sensors with a higher sensitivity. A semi-analytical constriction resistance based model accounting for the real contact area between the PPy hydrogel sensors and the electrode along with the dependency of the contact resistance change on the applied load is developed. The model is then solved using a Monte Carlo technique and its corresponding sensitivity is obtained. Comparing the results with their experimental counterparts, the proposed modeling methodology offers a good tracking ability.

  17. Constriction of the buccal branch of the facial nerve produces unilateral craniofacial allodynia.

    Science.gov (United States)

    Lewis, Susannah S; Grace, Peter M; Hutchinson, Mark R; Maier, Steven F; Watkins, Linda R

    2017-08-01

    Despite pain being a sensory experience, studies of spinal cord ventral root damage have demonstrated that motor neuron injury can induce neuropathic pain. Whether injury of cranial motor nerves can also produce nociceptive hypersensitivity has not been addressed. Herein, we demonstrate that chronic constriction injury (CCI) of the buccal branch of the facial nerve results in long-lasting, unilateral allodynia in the rat. An anterograde and retrograde tracer (3000MW tetramethylrhodamine-conjugated dextran) was not transported to the trigeminal ganglion when applied to the injury site, but was transported to the facial nucleus, indicating that this nerve branch is not composed of trigeminal sensory neurons. Finally, intracisterna magna injection of interleukin-1 (IL-1) receptor antagonist reversed allodynia, implicating the pro-inflammatory cytokine IL-1 in the maintenance of neuropathic pain induced by facial nerve CCI. These data extend the prior evidence that selective injury to motor axons can enhance pain to supraspinal circuits by demonstrating that injury of a facial nerve with predominantly motor axons is sufficient for neuropathic pain, and that the resultant pain has a neuroimmune component. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Ameliorative effect of ethyl pyruvate in neuropathic pain induced by chronic constriction injury of sciatic nerve

    Directory of Open Access Journals (Sweden)

    Varsha J. Bansode

    2014-01-01

    Full Text Available Objective: The present study was designed to investigate the ameliorative effects of ethyl pyruvate (EP in chronic constriction injury (CCI-induced painful neuropathy in rats. Materials and Methods: EP 50 and 100 mg/kg was administered for 21 consecutive days starting from the day of surgery. The effects of EP in the paw pressure, acetone drop, and tail heat immersion tests were assessed, reflecting the degree of mechanical hyperalgesia, cold allodynia, and spinal thermal sensation, respectively. Axonal degeneration of the sciatic nerve was assessed histopathologically. The levels of thiobarbituric acid reactive species, reduced glutathione (GSH, catalase (CAT, and superoxide dismutase (SOD were determined to assess oxidative stress. Key Findings: Administration of 50 and 100 mg/kg EP attenuated the reduction of nociceptive threshold in the paw pressure, acetone drop, and tail heat immersion tests. EP 100 mg/kg significantly attenuated reactive changes in histopathology and increase in oxidative stress. Conclusion: EP 100 mg/kg showed beneficial activity against nerve trauma-induced neuropathy. Hence, it can be used as a better treatment option in neuropathic pain (NP. The observed antinociceptive effects of EP may possibly be attributed to its antioxidant and anti-inflammatory activity.

  19. Effect of Right Heart Systolic Function on Outcomes in Patients with Constrictive Pericarditis Undergoing Pericardiectomy

    Directory of Open Access Journals (Sweden)

    Xue Lin

    2016-01-01

    Full Text Available Background: To determine the influence of right ventricular function in patients with constrictive pericarditis (CP undergoing surgery and to compare the outcomes of patients who received surgery with those managed medically. Methods: Patients with the diagnosis of CP and healthy volunteers were recruited from January 2006 to November 2011. Patients with CP chose to either receive pericardiectomy or medical management. Echocardiographic measurements were performed to evaluate heart function, and survival was recorded. Results: A total of 58 patients with CP (36 received pericardiectomy, 22 managed medically, and 43 healthy volunteers were included. CP patients who received surgery had a higher survival rate than those managed medically (P = 0.003, and higher survival was also seen in the subgroup of CP patients with severely impaired right systolic function. Albumin level, left ventricular end-diastolic dimension, and tricuspid regurgitation velocity were associated with survival in CP patients who received surgery. Conclusions: Preoperative right heart function does not affect surgical outcomes. Patients with severely impaired preoperative right systolic function obtain a greater survival advantage with surgery than with medical treatment.

  20. Inhibition of Uncoupling Protein 2 Attenuates Cardiac Hypertrophy Induced by Transverse Aortic Constriction in Mice

    Directory of Open Access Journals (Sweden)

    Xiao-Bing Ji

    2015-07-01

    Full Text Available Background: Uncoupling protein 2 (UCP2 is critical in regulating energy metabolism. Due to the significant change in energy metabolism of myocardium upon pressure overload, we hypothesize that UCP2 could contribute to the etiology of cardiac hypertrophy. Methods: Adult male C57BL/6J mice were subjected to pressure overload by using transverse aortic constriction (TAC, and then received genipin (a UCP2 selective inhibitor; 25 mg/kg/d, ip or vehicle for three weeks prior to histologic assessment of myocardial hypertrophy. ATP concentration, ROS level, and myocardial apoptosis were also examined. A parallel set of experiments was also conducted in UCP2-/- mice. Results: TAC induced left ventricular hypertrophy, as reflected by increased ventricular weight/thickness and increased size of myocardial cell (vs. sham controls. ATP concentration was decreased; ROS level was increased. Apoptosis and fibrosis markers were increased. TAC increased mitochondrial UCP2 expression in the myocardium at both mRNA and protein levels. Genipin treatment attenuated cardiac hypertrophy and the histologic/biochemical changes described above. Hypertrophy and associated changes induced by TAC in UCP2-/- mice were much less pronounced than in WT mice. Conclusions: Blocking UCP2 expression attenuates cardiac hypertrophy induced by pressure overload.

  1. E3 Ubiquitin Ligase c-cbl Inhibits Microglia Activation After Chronic Constriction Injury.

    Science.gov (United States)

    Xue, Pengfei; Liu, Xiaojuan; Shen, Yiming; Ju, Yuanyuan; Lu, Xiongsong; Zhang, Jinlong; Xu, Guanhua; Sun, Yuyu; Chen, Jiajia; Gu, Haiyan; Cui, Zhiming; Bao, Guofeng

    2018-06-22

    E3 ubiquitin ligase c-Caritas B cell lymphoma (c-cbl) is associated with negative regulation of receptor tyrosine kinases, signal transduction of antigens and cytokine receptors, and immune response. However, the expression and function of c-cbl in the regulation of neuropathic pain after chronic constriction injury (CCI) are unknown. In rat CCI model, c-cbl inhibited the activation of spinal cord microglia and the release of pro-inflammatory factors including tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β) and interleukin 6 (IL-6), which alleviated mechanical and heat pain through down-regulating extracellular signal-regulated kinase (ERK) pathway. Additionally, exogenous TNF-α inhibited c-cbl protein level vice versa. In the primary microglia transfected with c-cbl siRNA, when treated with TNF-α or TNF-α inhibitor, the corresponding secretion of IL-1β and IL-6 did not change. In summary, CCI down-regulated c-cbl expression and induced the activation of microglia, then activated microglia released inflammatory factors via ERK signaling to cause pain. Our data might supply a novel molecular target for the therapy of CCI-induced neuropathic pain.

  2. The alkylation response protein AidB is localized at the new poles and constriction sites in Brucella abortus

    Directory of Open Access Journals (Sweden)

    Dotreppe Delphine

    2011-11-01

    Full Text Available Abstract Background Brucella abortus is the etiological agent of a worldwide zoonosis called brucellosis. This alpha-proteobacterium is dividing asymmetrically, and PdhS, an essential histidine kinase, was reported to be an old pole marker. Results We were interested to identify functions that could be recruited to bacterial poles. The Brucella ORFeome, a collection of cloned predicted coding sequences, was placed in fusion with yellow fluorescent protein (YFP coding sequence and screened for polar localizations in B. abortus. We report that AidB-YFP was systematically localized to the new poles and at constrictions sites in B. abortus, either in culture or inside infected HeLa cells or RAW264.7 macrophages. AidB is an acyl-CoA dehydrogenase (ACAD homolog, similar to E. coli AidB, an enzyme putatively involved in destroying alkylating agents. Accordingly, a B. abortus aidB mutant is more sensitive than the wild-type strain to the lethality induced by methanesulphonic acid ethyl ester (EMS. The exposure to EMS led to a very low frequency of constriction events, suggesting that cell cycle is blocked during alkylation damage. The localization of AidB-YFP at the new poles and at constriction sites seems to be specific for this ACAD homolog since two other ACAD homologs fused to YFP did not show specific localization. The overexpression of aidB, but not the two other ACAD coding sequences, leads to multiple morphological defects. Conclusions Data reported here suggest that AidB is a marker of new poles and constriction sites, that could be considered as sites of preparation of new poles in the sibling cells originating from cell division. The possible role of AidB in the generation or the function of new poles needs further investigation.

  3. Novel technique and simple approach for supra-alar region and supra-alar crease correction by supra-alar cinching.

    Science.gov (United States)

    Selvaraj, Loganathan

    2016-01-01

    This technical report describes a simple and innovative surgical technique for supra-alar sidewall region constriction and supra-alar crease attenuation by cinching technique through intraoral approach.

  4. Novel technique and simple approach for supra-alar region and supra-alar crease correction by supra-alar cinching

    OpenAIRE

    Selvaraj, Loganathan

    2016-01-01

    This technical report describes a simple and innovative surgical technique for supra-alar sidewall region constriction and supra-alar crease attenuation by cinching technique through intraoral approach.

  5. Alignment Strategy for Constricted Maxillary Dental Arch in Patients With Unilateral Cleft Lip and Palate Using Fixed Orthodontic Appliance.

    Science.gov (United States)

    Park, Yoon-Hee; Park, Sumin; Baek, Seung-Hak

    2018-03-01

    The purpose of this study was to compare the alignment pattern of the constricted maxillary dental arch by fixed orthodontic treatment (FOT) in the well-aligned and constricted arches of unilateral cleft lip and palate (UCLP) patients. 19 UCLP patients were divided into Group 1 (well-aligned arch, n = 9) and Group 2 (constricted arch, n = 10). After the cephalometric and maxillary dental arch variables before (T1) and after FOT (T2) were measured, statistical analysis was performed. There were no significant differences in the surgical timing of cheiloplasty, palatoplasty, and secondary alveolar bone grafting and in the surgical method of cheiloplasty between the 2 groups. However, Group 2 had a higher percentage of palatoplasty method, which could leave the denuded bone for secondary healing than Group 1 (P dental arch compared to Group 1 at the T1 stage (inter-second premolar width, greater segment angle [GSA], and lesser segment angle [LSA], all P dental arch shape, different strategy is necessary to obtain proper alignment by FOT.

  6. Introduction and pinning of domain walls in 50 nm NiFe constrictions using local and external magnetic fields

    International Nuclear Information System (INIS)

    Zahnd, G.; Pham, V.T.; Marty, A.; Jamet, M.; Beigné, C.; Notin, L.; Vergnaud, C.; Rortais, F.; Vila, L.; Attané, J.-P.

    2016-01-01

    We study domain wall injection in 100 nm wide NiFe nanowires, followed by domain wall propagation and pinning on 50 nm wide constrictions. The injection is performed using local and external magnetic fields. Using several nucleation pad geometries, we show that at these small dimensions the use of an external field only does not allow obtaining a reproducible injection/pinning process. However, the use of an additional local field, created by an Oersted line, allows to nucleate a reversed domain at zero external applied field. Then, an external field of 5 mT enables the domain wall to propagate far from the Oersted line, and the pinning occurs reproducibly. We also show that notwithstanding the reproducibility of the pinning process, the depinning field is found to be stochastic, following a bimodal distribution. Using micromagnetic simulation we link two different DW configurations, vortex and transverse, to the two typical depinning fields. - Highlights: • Magnetic domain wall introduction and pinning in Permalloy nanowires with 50 nm wide constrictions. • Magnetic domain nucleation at zero external applied field. • Bimodal distribution of the domain wall configuration in the constriction.

  7. Theory of vibratory mobilization and break-up of non-wetting fluids entrapped in pore constrictions

    Science.gov (United States)

    Beresnev, I.; Li, W.; Vigil, D.

    2006-12-01

    Quantitative dynamics of a non-wetting (e. g., NAPL) ganglion entrapped in a pore constriction and subjected to vibrations can be approximated by the equation of motion of an oscillator moving under the effect of the external pressure gradient, inertial oscillatory force, and restoring capillary force. The solution of the equation provides the conditions under which the droplet experiences forced oscillations without being mobilized or is liberated upon the acceleration of the wall exceeding an "unplugging" threshold. This solution provides a quantitative tool for the estimation of the parameters of vibratory fields needed to liberate entrapped non-wetting fluids. For typical pore sizes encountered in reservoirs and aquifers, wall accelerations must exceed at least several m/sec2 and even higher levels to mobilize the droplets of NAPL; however, in the populations of ganglia entrapped in natural porous environments, many may reside very near their mobilization thresholds and may be mobilized by extremely low accelerations as well. For given acceleration, lower seismic frequencies are more efficient. The ganglia may also break up into smaller pieces when passing through pore constrictions. The snap-off is governed by the geometry only; for constrictions with sinusoidal profile (spatial wavelength of L and maximum and minimum radii of rmax and rmin, the break-up occurs if L > 2π(rmin rmax)1/2. Computational fluid dynamics shows the details of the break-up process.

  8. Surgical Management of Massive Pericardial Effusion and Predictors for Development of Constrictive Pericarditis in a Resource Limited Setting

    Science.gov (United States)

    Okokhere, Peter O.; Iruolagbe, Christopher Ojemiega; Odike, Angela; Owobu, Clifford; Akhigbe, Theophilus

    2016-01-01

    Background. The diagnosis and treatment of massive pericardial effusion and cardiac tamponade have evolved over the years with a tendency towards a more comprehensive diagnostic workup and less traumatic intervention. Method. We reviewed and analysed the data of 32 consecutive patients who underwent surgery on account of massive pericardial effusion and cardiac tamponade in a semiurban university hospital in Nigeria from February 2010 to February 2016. Results. The majority of patients (34.4%) were between 31 and 40 years. Fourteen patients (43.8%) presented with clinical and echocardiographic feature of cardiac tamponade. The majority of patients (59.4%) presented with haemorrhagic pericardial effusion and the average volume of fluid drained intraoperatively was 846 mL  ± 67 mL. Pericardium was thickened in 50% of cases. Subxiphoid pericardiostomy was performed under local anaesthesia in 28 cases. No postoperative recurrence was observed; however 5 patients developed features of constrictive pericarditis. The relationship between pericardial thickness and development of pericardial constriction was statistically significant (p = 0.004). Conclusion. Subxiphoid pericardiostomy is a very effective way of treating massive pericardial effusion. Removing tube after adequate drainage (50 mL/day) and treatment of primary pathology are key to preventing recurrence. There is also a need to follow up patients to detect pericardial constriction especially those with thickened pericardium. PMID:27517082

  9. DPD simulation on the dynamics of a healthy and infected red blood cell in flow through a constricted channel

    Science.gov (United States)

    Hoque, Sazid Zamal; Anand, D. Vijay; Patnaik, B. S. V.

    2017-11-01

    The state of the red blood cell (either healthy or infected RBC) will influence its deformation dynamics. Since the pathological condition related to RBC, primarily originates from a single cell infection, therefore, it is important to relate the deformation dynamics to the mechanical properties (such as, bending rigidity and membrane elasticity). In the present study, numerical simulation of a healthy and malaria infected RBC in a constricted channel is analyzed. The flow simulations are carried out using finite sized dissipative particle dynamics (FDPD) method in conjunction with a discrete model that represents the membrane of the RBC. The numerical equivalent of optical tweezers test is validated against the experimental studies. Two different types of constrictions, viz., a converging-diverging type tapered channel and a stenosed microchannel are considered for the simulation. The effect of degree of constriction and the flow rate effect on the RBC is investigated. It was observed that, as the flow rate decreases, the infected RBC completely blocks the micro vessel. The transit time for infected cell drastically increases compared to healthy RBC. Our simulations indicate that, there is a critical flow rate below which infected RBC cannot pass through the micro capillary.

  10. Behavioral and anatomical characterization of the bilateral sciatic nerve chronic constriction (bCCI) injury: correlation of anatomic changes and responses to cold stimuli

    OpenAIRE

    Datta, Sukdeb; Chatterjee, Koel; Kline, Robert H; Wiley, Ronald G

    2010-01-01

    Abstract Background Unilateral constrictive sciatic nerve injury (uCCI) is a common neuropathic pain model. However, the bilateral constrictive injury (bCCI) model is less well studied, and shows unique characteristics. In the present study, we sought to correlate effects of bCCI on nocifensive responses to cold and mechanical stimuli with selected dorsal horn anatomic markers. bCCI or sham ligation of both rat sciatic nerves were followed up to 90 days of behavioural testing. Additional rats...

  11. Effect of Pulsed Radiofrequency on Rat Sciatic Nerve Chronic Constriction Injury: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Duo-Yi Li

    2015-01-01

    Full Text Available Background: Pulsed radiofrequency (PRF application to the dorsal root ganglia can reduce neuropathic pain (NP in animal models, but the effect of PRF on damaged peripheral nerves has not been examined. We investigated the effect of PRF to the rat sciatic nerve (SN on pain-related behavior and SN ultrastructure following chronic constriction injury (CCI. Methods: The analgesic effect was measured by hindpaw mechanical withdrawal threshold (MWT and thermal withdrawal latency (TWL. Twenty rats with NP induced by ligating the common SN were then randomly divided into a PRF treatment group and a sham group. The contralateral SN served as a control. The MWT and TWL were determined again 2, 4, 6, 8, 10, 12, and 14 days after the PRF or sham treatment. On day 14, ipsilateral and contralateral common SNs were excised and examined by electron microscopy. Results: Ipsilateral MWT was significantly reduced and TWL significantly shorter compared to the contralateral side 14 days after CCI (both P = 0.000. In the PRF group, MWT was significantly higher and TWL significantly longer 14 days after the PRF treatment compared to before PRF treatment (both P = 0.000, while no such difference was observed in the sham group (P > 0.05. Electron microscopy revealed extensive demyelination and collagen fiber formation in the ipsilateral SN of sham-treated rats but sparse demyelination and some nerve fiber regrowth in the PRF treatment group. Conclusions: Hyperalgesia is relieved, and ultrastructural damage ameliorated after direct PRF treatment to the SN in the CCI rat model of NP.

  12. Effects of intrathecal lidocaine on hyperalgesia and allodynia following chronic constriction injury in rats.

    Science.gov (United States)

    Tian, Jie; Gu, Yiwen; Su, Diansan; Wu, Yichao; Wang, Xiangrui

    2009-02-01

    The present study investigated the effects of different doses of intrathecal lidocaine on established thermal hyperalgesia and tactile allodynia in the chronic constriction injury model of neuropathic pain, defined the effective drug dose range, the duration of pain-relief effects, and the influence of this treatment on the body and tissues. Male Sprague-Dawley rats were divided into five groups and received intrathecal saline or lidocaine (2, 6.5, 15, and 35 mg/kg) 7 days after loose sciatic ligation. Respiratory depression and hemodynamic instability were found to become more severe as doses of lidocaine increased during intrathecal therapy. Two animals in the group receiving 35 mg/kg lidocaine developed pulmonary oedema and died. Behavioral tests indicated that 6.5, 15, and 35 mg/kg intrathecal lidocaine showed different degrees of reversal of thermal hyperalgesia, and lasted for 2-8 days, while 2 mg/kg lidocaine did not. The inhibition of tactile allodynia was only observed in rats receiving 15 and 35 mg/kg lidocaine, and the anti-allodynic effects were identical in these two groups. Histopathologic examinations on the spinal cords revealed mild changes in rats receiving 2-15 mg/kg lidocaine. However, lesions were severe after administration of 35 mg/kg lidocaine. These findings indicate that intrathecal lidocaine has prolonged therapeutic effects on established neuropathic pain. The balance between sympathetic and parasympathetic nervous activities could be well preserved in most cases, except for 35 mg/kg. Considering the ratio between useful effects and side effects, doses of 15 mg/kg are suitable for intrathecal injection for relief of neuropathic pain.

  13. Dasatinib Attenuates Pressure Overload Induced Cardiac Fibrosis in a Murine Transverse Aortic Constriction Model.

    Directory of Open Access Journals (Sweden)

    Sundaravadivel Balasubramanian

    Full Text Available Reactive cardiac fibrosis resulting from chronic pressure overload (PO compromises ventricular function and contributes to congestive heart failure. We explored whether nonreceptor tyrosine kinases (NTKs play a key role in fibrosis by activating cardiac fibroblasts (CFb, and could potentially serve as a target to reduce PO-induced cardiac fibrosis. Our studies were carried out in PO mouse myocardium induced by transverse aortic constriction (TAC. Administration of a tyrosine kinase inhibitor, dasatinib, via an intraperitoneally implanted mini-osmotic pump at 0.44 mg/kg/day reduced PO-induced accumulation of extracellular matrix (ECM proteins and improved left ventricular geometry and function. Furthermore, dasatinib treatment inhibited NTK activation (primarily Pyk2 and Fak and reduced the level of FSP1 positive cells in the PO myocardium. In vitro studies using cultured mouse CFb showed that dasatinib treatment at 50 nM reduced: (i extracellular accumulation of both collagen and fibronectin, (ii both basal and PDGF-stimulated activation of Pyk2, (iii nuclear accumulation of Ki67, SKP2 and histone-H2B and (iv PDGF-stimulated CFb proliferation and migration. However, dasatinib did not affect cardiomyocyte morphologies in either the ventricular tissue after in vivo administration or in isolated cells after in vitro treatment. Mass spectrometric quantification of dasatinib in cultured cells indicated that the uptake of dasatinib by CFb was greater that that taken up by cardiomyocytes. Dasatinib treatment primarily suppressed PDGF but not insulin-stimulated signaling (Erk versus Akt activation in both CFb and cardiomyocytes. These data indicate that dasatinib treatment at lower doses than that used in chemotherapy has the capacity to reduce hypertrophy-associated fibrosis and improve ventricular function.

  14. Effect of Pulsed Radiofrequency on Rat Sciatic Nerve Chronic Constriction Injury: A Preliminary Study

    Science.gov (United States)

    Li, Duo-Yi; Meng, Lan; Ji, Nan; Luo, Fang

    2015-01-01

    Background: Pulsed radiofrequency (PRF) application to the dorsal root ganglia can reduce neuropathic pain (NP) in animal models, but the effect of PRF on damaged peripheral nerves has not been examined. We investigated the effect of PRF to the rat sciatic nerve (SN) on pain-related behavior and SN ultrastructure following chronic constriction injury (CCI). Methods: The analgesic effect was measured by hindpaw mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL). Twenty rats with NP induced by ligating the common SN were then randomly divided into a PRF treatment group and a sham group. The contralateral SN served as a control. The MWT and TWL were determined again 2, 4, 6, 8, 10, 12, and 14 days after the PRF or sham treatment. On day 14, ipsilateral and contralateral common SNs were excised and examined by electron microscopy. Results: Ipsilateral MWT was significantly reduced and TWL significantly shorter compared to the contralateral side 14 days after CCI (both P = 0.000). In the PRF group, MWT was significantly higher and TWL significantly longer 14 days after the PRF treatment compared to before PRF treatment (both P = 0.000), while no such difference was observed in the sham group (P > 0.05). Electron microscopy revealed extensive demyelination and collagen fiber formation in the ipsilateral SN of sham-treated rats but sparse demyelination and some nerve fiber regrowth in the PRF treatment group. Conclusions: Hyperalgesia is relieved, and ultrastructural damage ameliorated after direct PRF treatment to the SN in the CCI rat model of NP. PMID:25673460

  15. A case of chronic effusive-constrictive pericarditis with slight myocardial involvement caused by radiation

    International Nuclear Information System (INIS)

    Horimoto, Masashi; Funayama, Naoki; Takenaka, Takashi; Igarashi, Takeki; Sekiguchi, Morie.

    1985-01-01

    A 25-year-old female was admitted with shortness of breath and abdominal swelling. Six years before the admission, she had received resection of 7th to 9th left ribs and subsequent radiation of 5,000 rads to the thorax for the treatment of rib osteoblastoma. One year after the radiation, marked pericardial effusion associated with acute pericarditis was observed and was improved by digitalization and diuretic therapy. Since two years after the radiation, she had felt easy fatigability, swelling of face and foot, and transient faintness on more than 10 meters running. On admission, chest X-ray photograph showed increased pulmonary vascularity without cardiac enlargement. Electrocardiogram indicated systolic right ventricular strain, mitral P, and nonspecific S-T segment depression in left precordial leads. Two-dimensional echocardiography presented pericardial effusion with posterior pericardial thickening, while M-mode echocardiography showed diastolic posterior movement of interventricular septum and diastolic flattening of left ventricular posterior wall. Cardiac catheterization revealed marked elevation of mean right atrial pressure, pulmonary arterial diastolic pressure, right and left ventricular end-diastolic pressure, accompanied with their equalization. In addition, pressure waves of right and left ventricle showed diastolic dip and plateau. Phono-cardiogram and apexcardiogram presented pericardial knock sound and systolic retraction, respectively. Cardiac angiography showed diastolic restriction of left ventricle without any stenosis of coronary artery. Computed tomography (CT) of the chest revealed thickening of anterior and left lateral pericardium with expansion of inferior vena cava, and abdominal CT revealed ascites with slight enlargements of liver and spleen. From above obtained data, chronic effusive-constrictive pericarditis, which was attributed to radiation, was strongly suggested. (J.P.N.)

  16. Disorders in melanopsin effect of pupil constriction as a risk factor causing eye diseases

    Directory of Open Access Journals (Sweden)

    V.A. Kaptsov

    2017-03-01

    Full Text Available Risks of eye damage and eyesight deterioration to a great extent depend on how efficient a biomechanical eye system is under energy-saving lighting conditions. The system's efficiency is determined by its adequacy in managing pupils and ciliary muscle. We analyzed mathematical models describing changes in pupil's diameter which were determined by light-technical parameters of illumination environment (luminance level and brightness. We highlighted the importance of ganglionic cells and the role they play in managing pupil's diameter (miosis when they are exposed to blue light within 480 nm spectrum. Basing on the assessment of a pupil's constriction under exposure to various light stimuli (blue, red, and green ones we worked out a melanopsin effect concept of a pupil's retention at miosis and showed that it could be a diagnostic sign of some diseases (age-related direct retinopathy, pancreatic diabetes under exposure to a blue light impulse with a certain wave length. Under exposure to blue light within 480 nm spectrum ganglionic cells form a managing signal for a sphincter muscle of a pupil and ciliary muscle which provides accommodation (as per Helmholtz and regulates aqueous humor flow in ciliary channel. All modern energy-saving light sources have a low energy level at wave length equal to 480 nm due to gap in their spectrum in comparison with sunlight spectrum with the same light temperature and luminance level. Inadequate management of pupil's diameter under artificial lighting conditions leads to melanopsin effect disorders and causes disharmony in managing aqueous humor outflow. All the above-stated factors under long-term visual load cause eye diseases risks in modern illumination environment. We detected that contemporary mathematic models describing pupil's diameter fluctuations needed to be refined allowing for new knowledge on functional peculiarities of retina cells and energy-saving light sources spectrum.

  17. A Novel Imaging Analysis Method for Capturing Pharyngeal Constriction During Swallowing.

    Science.gov (United States)

    Schwertner, Ryan W; Garand, Kendrea L; Pearson, William G

    2016-01-01

    Videofluoroscopic imaging of swallowing known as the Modified Barium Study (MBS) is the standard of care for assessing swallowing difficulty. While the clinical purpose of this radiographic imaging is to primarily assess aspiration risk, valuable biomechanical data is embedded in these studies. Computational analysis of swallowing mechanics (CASM) is an established research methodology for assessing multiple interactions of swallowing mechanics based on coordinates mapping muscle function including hyolaryngeal movement, pharyngeal shortening, tongue base retraction, and extension of the head and neck, however coordinates characterizing pharyngeal constriction is undeveloped. The aim of this study was to establish a method for locating the superior and middle pharyngeal constrictors using hard landmarks as guides on MBS videofluoroscopic imaging, and to test the reliability of this new method. Twenty de-identified, normal, MBS videos were randomly selected from a database. Two raters annotated landmarks for the superior and middle pharyngeal constrictors frame-by-frame using a semi-automated MATLAB tracker tool at two time points. Intraclass correlation coefficients were used to assess test-retest reliability between two raters with an ICC = 0.99 or greater for all coordinates for the retest measurement. MorphoJ integrated software was used to perform a discriminate function analysis to visualize how all 12 coordinates interact with each other in normal swallowing. The addition of the superior and middle pharyngeal constrictor coordinates to CASM allows for a robust analysis of the multiple components of swallowing mechanics interacting with a wide range of variables in both patient specific and cohort studies derived from common use imaging data.

  18. AAV-mediated knock-down of HRC exacerbates transverse aorta constriction-induced heart failure.

    Directory of Open Access Journals (Sweden)

    Chang Sik Park

    Full Text Available Histidine-rich calcium binding protein (HRC is located in the lumen of sarcoplasmic reticulum (SR that binds to both triadin (TRN and SERCA affecting Ca(2+ cycling in the SR. Chronic overexpression of HRC that may disrupt intracellular Ca(2+ homeostasis is implicated in pathogenesis of cardiac hypertrophy. Ablation of HRC showed relatively normal phenotypes under basal condition, but exhibited a significantly increased susceptibility to isoproterenol-induced cardiac hypertrophy. In the present study, we characterized the functions of HRC related to Ca(2+ cycling and pathogenesis of cardiac hypertrophy using the in vitro siRNA- and the in vivo adeno-associated virus (AAV-mediated HRC knock-down (KD systems, respectively.AAV-mediated HRC-KD system was used with or without C57BL/6 mouse model of transverse aortic constriction-induced failing heart (TAC-FH to examine whether HRC-KD could enhance cardiac function in failing heart (FH. Initially we expected that HRC-KD could elicit cardiac functional recovery in failing heart (FH, since predesigned siRNA-mediated HRC-KD enhanced Ca(2+ cycling and increased activities of RyR2 and SERCA2 without change in SR Ca(2+ load in neonatal rat ventricular cells (NRVCs and HL-1 cells. However, AAV9-mediated HRC-KD in TAC-FH was associated with decreased fractional shortening and increased cardiac fibrosis compared with control. We found that phospho-RyR2, phospho-CaMKII, phospho-p38 MAPK, and phospho-PLB were significantly upregulated by HRC-KD in TAC-FH. A significantly increased level of cleaved caspase-3, a cardiac cell death marker was also found, consistent with the result of TUNEL assay.Increased Ca(2+ leak and cytosolic Ca(2+ concentration due to a partial KD of HRC could enhance activity of CaMKII and phosphorylation of p38 MAPK, causing the mitochondrial death pathway observed in TAC-FH. Our results present evidence that down-regulation of HRC could deteriorate cardiac function in TAC-FH through

  19. The effect of concentric constriction of the visual field to 10 and 15 degrees on simulated motor vehicle accidents

    Science.gov (United States)

    Udagawa, Sachiko; Iwase, Aiko; Susuki, Yuto; Kunimatsu-Sanuki, Shiho; Fukuchi, Takeo; Matsumoto, Chota; Ohno, Yuko; Ono, Hiroshi; Sugiyama, Kazuhisa; Araie, Makoto

    2018-01-01

    Purpose Traffic accidents are associated with the visual function of drivers, as well as many other factors. Driving simulator systems have the advantage of controlling for traffic- and automobile-related conditions, and using pinhole glasses can control the degree of concentric concentration of the visual field. We evaluated the effect of concentric constriction of the visual field on automobile driving, using driving simulator tests. Methods Subjects meeting criteria for normal eyesight were included in the study. Pinhole glasses with variable aperture sizes were adjusted to mimic the conditions of concentric visual field constrictions of 10° and 15°, using a CLOCK CHART®. The test contained 8 scenarios (2 oncoming right-turning cars and 6 jump-out events from the side). Results Eighty-eight subjects were included in the study; 37 (mean age = 52.9±15.8 years) subjects were assigned to the 15° group, and 51 (mean = 48.6±15.5 years) were assigned to the 10° group. For all 8 scenarios, the number of accidents was significantly higher among pinhole wearing subjects. The average number of all types of accidents per person was significantly higher in the pinhole 10° group (4.59±1.81) than the pinhole 15° group (3.68±1.49) (P = 0.032). The number of accidents associated with jump-out scenarios, in which a vehicle approaches from the side on a straight road with a good view, was significantly higher in the pinhole 10° group than in the pinhole 15° group. Conclusions Concentric constriction of the visual field was associated with increased number of traffic accidents. The simulation findings indicated that a visual field of 10° to 15° may be important for avoiding collisions in places where there is a straight road with a good view. PMID:29538425

  20. Cognitive Machine-Learning Algorithm for Cardiac Imaging: A Pilot Study for Differentiating Constrictive Pericarditis From Restrictive Cardiomyopathy.

    Science.gov (United States)

    Sengupta, Partho P; Huang, Yen-Min; Bansal, Manish; Ashrafi, Ali; Fisher, Matt; Shameer, Khader; Gall, Walt; Dudley, Joel T

    2016-06-01

    Associating a patient's profile with the memories of prototypical patients built through previous repeat clinical experience is a key process in clinical judgment. We hypothesized that a similar process using a cognitive computing tool would be well suited for learning and recalling multidimensional attributes of speckle tracking echocardiography data sets derived from patients with known constrictive pericarditis and restrictive cardiomyopathy. Clinical and echocardiographic data of 50 patients with constrictive pericarditis and 44 with restrictive cardiomyopathy were used for developing an associative memory classifier-based machine-learning algorithm. The speckle tracking echocardiography data were normalized in reference to 47 controls with no structural heart disease, and the diagnostic area under the receiver operating characteristic curve of the associative memory classifier was evaluated for differentiating constrictive pericarditis from restrictive cardiomyopathy. Using only speckle tracking echocardiography variables, associative memory classifier achieved a diagnostic area under the curve of 89.2%, which improved to 96.2% with addition of 4 echocardiographic variables. In comparison, the area under the curve of early diastolic mitral annular velocity and left ventricular longitudinal strain were 82.1% and 63.7%, respectively. Furthermore, the associative memory classifier demonstrated greater accuracy and shorter learning curves than other machine-learning approaches, with accuracy asymptotically approaching 90% after a training fraction of 0.3 and remaining flat at higher training fractions. This study demonstrates feasibility of a cognitive machine-learning approach for learning and recalling patterns observed during echocardiographic evaluations. Incorporation of machine-learning algorithms in cardiac imaging may aid standardized assessments and support the quality of interpretations, particularly for novice readers with limited experience. © 2016

  1. High-temperature CW and pulsed operation in constricted double-heterojunction AlGaAs diode lasers

    Science.gov (United States)

    Botez, D.; Connolly, J. C.; Gilbert, D. B.

    1981-01-01

    The behavior of constricted double-heterojunction (CDH) diode lasers has been investigated up to 170 C CW and 270 C pulsed. It is found that the temperature-dependent current concentration effect responsible for low threshold-current sensitivity and temperature-invariant external differential quantum efficiency in CDH lasers saturates at about 100 C. It is also found that over a wide temperature interval (180-280 C) the threshold current density has a To value of 40-50 C and that the spontaneous emission becomes increasingly sublinear above 220 C. Both effects are believed to reflect Auger recombination.

  2. Maximum opening of the mouth by mouth prop during dental procedures increases the risk of upper airway constriction

    Directory of Open Access Journals (Sweden)

    Hiroshi Ito

    2010-05-01

    Full Text Available Hiroshi Ito1, Hiroyoshi Kawaai1, Shinya Yamazaki1, Yosuke Suzuki21Division of Systemic Management, Department of Oral Function, 2Division of Radiology and Diagnosis, Department of Medical Sciences, Ohu University, Post Graduate School of Dentistry, Koriyama City, Fukushima Prefecture, JapanAbstract: From a retrospective evaluation of data on accidents and deaths during dental procedures, it has been shown that several patients who refused dental treatment died of asphyxia during dental procedures. We speculated that forcible maximum opening of the mouth by using a mouth prop triggers this asphyxia by affecting the upper airway. Therefore, we assessed the morphological changes of the upper airway following maximal opening of the mouth. In 13 healthy adult volunteers, the sagittal diameter of the upper airway on lateral cephalogram was measured between the two conditions; closed mouth and maximally open mouth. The dyspnea in each state was evaluated by a visual analog scale. In one subject, a computed tomograph (CT was taken to assess the three-dimensional changes in the upper airway. A significant difference was detected in the mean sagittal diameter of the upper airway following use of the prop (closed mouth: 18.5 ± 3.8 mm, maximally open mouth: 10.4 ± 3.0 mm. All subjects indicated upper airway constriction and significant dyspnea when their mouth was maximally open. Although a CT scan indicated upper airway constriction when the mouth was maximally open, muscular compensation was admitted. Our results further indicate that the maximal opening of the mouth narrows the upper airway diameter and leads to dyspnea. The use of a prop for the patient who has communication problems or poor neuromuscular function can lead to asphyxia. When the prop is used for patient refusal in dentistry, the respiratory condition should be monitored strictly, and it should be kept in mind that the “sniffing position” is effective for avoiding upper airway

  3. PID Controller Design of Nonlinear System using a New Modified Particle Swarm Optimization with Time-Varying Constriction Coefficient

    Directory of Open Access Journals (Sweden)

    Alrijadjis .

    2014-12-01

    Full Text Available The proportional integral derivative (PID controllers have been widely used in most process control systems for a long time. However, it is a very important problem how to choose PID parameters, because these parameters give a great influence on the control performance. Especially, it is difficult to tune these parameters for nonlinear systems. In this paper, a new modified particle swarm optimization (PSO is presented to search for optimal PID parameters for such system. The proposed algorithm is to modify constriction coefficient which is nonlinearly decreased time-varying for improving the final accuracy and the convergence speed of PSO. To validate the control performance of the proposed method, a typical nonlinear system control, a continuous stirred tank reactor (CSTR process, is illustrated. The results testify that a new modified PSO algorithm can perform well in the nonlinear PID control system design in term of lesser overshoot, rise-time, settling-time, IAE and ISE. Keywords: PID controller, Particle Swarm Optimization (PSO,constriction factor, nonlinear system.

  4. Differential expression of miRNAs in the nervous system of a rat model of bilateral sciatic nerve chronic constriction injury.

    Science.gov (United States)

    Li, Haixia; Shen, Le; Ma, Chao; Huang, Yuguang

    2013-07-01

    Chronic neuropathic pain is associated with global changes in gene expression in different areas of the nociceptive pathway. MicroRNAs (miRNAs) are small (~22 nt long) non-coding RNAs, which are able to regulate hundreds of different genes post-transcriptionally. The aim of this study was to determine the miRNA expression patterns in the different regions of the pain transmission pathway using a rat model of human neuropathic pain induced by bilateral sciatic nerve chronic constriction injury (bCCI). Using microarray analysis and quantitative reverse transcriptase-PCR, we observed a significant upregulation in miR-341 expression in the dorsal root ganglion (DRG), but not in the spinal dorsal horn (SDH), hippocampus or anterior cingulate cortex (ACC), in the rats with neuropathic pain compared to rats in the naïve and sham-operated groups. By contrast, the expression of miR-203, miR-181a-1* and miR-541* was significantly reduced in the SDH of rats with neuropathic pain. Our data indicate that miR-341 is upregulated in the DRG, whereas miR-203, miR-181a-1* and miR-541* are downregulated in the SDH under neuropathic pain conditions. Thus, the differential expression of miRNAs in the nervous system may play a role in the development of chronic pain. These observations may aid in the development of novel treatment methods for neuropathic pain, which may involve miRNA gene therapy in local regions.

  5. Outcomes of vaginal hysterectomy and constricting colporrhaphy with concurrent levator myorrhaphy and high perineorrhaphy in women older than 75 years of age

    Directory of Open Access Journals (Sweden)

    Töz E

    2015-06-01

    Full Text Available Emrah Töz, Aykut Özcan, Nesin Apaydin, İbrahim Uyar, Betül Kocakaya, Gülin Okay Department of Gynecology and Obstetrics, Tepecik Education and Research Hospital, İzmir, Turkey Objectives: We performed constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy with concurrent hysterectomy, and investigated the intraoperative complications, and short-term outcomes of these constricting procedures in patients aged 75 years or older.Methods: We searched our hospital database for cases, between January 2011 and January 2014, of women aged over 75 years who underwent surgery for pelvic organ prolapse of stage 2 or higher, via vaginal hysterectomy, constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy, with or without treatment of urinary incontinence. All volunteers were evaluated via pelvic examination using the pelvic organ prolapse quantification system, the modified Decision Regret Scale–Pelvic Floor Disorders form, the Satisfaction Decision Scale–Pelvic Floor Disorders form, and the Pelvic Floor Distress Inventory form.Results: Fifty-four patients were included in the study. The mean follow-up time was 24.4 months after constricting surgery (range: 8–44 months. There were four cases (7% of de novo urge incontinence (the symptoms resolved upon prescription of anticholinergic medication. Two patients developed de novo stress urinary incontinence after the procedure and were treated via transobturator sling surgery using Safyre T® polypropylene monofilament slings. No anatomical or subjective recurrence of prolapse was noted during the follow-up period. No patient required additional surgery for recurrence of prolapse.Conclusion: Constricting anterior and posterior colporrhaphy, levator myorrhaphy, and high perineorrhaphy with concurrent hysterectomy is a feasible, safe, and effective surgical option in elderly patients at low anesthesiological risk. The decision

  6. Posouzení vlivu nestandardních přítokových proudových poměrů na Q/h charakteristiku ostrohranného přelivu s obdélníkovým výřezem

    OpenAIRE

    Šmidrkalová, Nina

    2012-01-01

    Tato diplomová práce se zabývá problematikou měřících systémů, především užívajících metody Q/H charakteristiky. Popisuje ostrohranné přelivy a zmiňuje se i o měrných žlabech. Uvádí možnosti monitorování průtoků v napevno nainstalovaných profilech s volnou hladinou. Součástí práce je i experiment, který je zaměřen na simulaci nestandardních přítokových proudových poměrů před instalovaným přelivem pro stanovení jejich vlivu na Q/H charakteristiku. Experiment je proveden na pravoúhlém ostrohran...

  7. Estrogen increases smooth muscle expression of alpha2C-adrenoceptors and cold-induced constriction of cutaneous arteries.

    Science.gov (United States)

    Eid, A H; Maiti, K; Mitra, S; Chotani, M A; Flavahan, S; Bailey, S R; Thompson-Torgerson, C S; Flavahan, N A

    2007-09-01

    Raynaud's phenomenon, which is characterized by intense cold-induced constriction of cutaneous arteries, is more common in women compared with men. Cold-induced constriction is mediated in part by enhanced activity of alpha(2C)-adrenoceptors (alpha(2C)-ARs) located on vascular smooth muscle cells (VSMs). Experiments were therefore performed to determine whether 17beta-estradiol regulates alpha(2C)-AR expression and function in cutaneous VSMs. 17beta-Estradiol (0.01-10 nmol/l) increased expression of the alpha(2C)-AR protein and the activity of the alpha(2C)-AR gene promoter in human cultured dermal VSMs, which was assessed following transient transfection of the cells with a promoter-reporter construct. The effect of 17beta-estradiol was associated with increased accumulation of cAMP and activation of the cAMP-responsive Rap2 GTP-binding protein. Transient transfection of VSMs with a dominant-negative mutant of Rap2 inhibited the 17beta-estradiol-induced activation of the alpha(2C)-AR gene promoter, whereas a constitutively active mutant of Rap2 increased alpha(2C)-AR promoter activity. The effects of 17beta-estradiol were inhibited by the estrogen receptor (ER) antagonist, ICI-182780 (1 micromol/l), and were mimicked by a cell-impermeable form of the hormone (estrogen:BSA) or by the selective ER-alpha receptor agonist 4,4',4'''-(4-propyl-[(1)H]-pyrazole-1,3,5-triyl)tris-phenol (PPT; 10 nmol/l) or the selective ER-beta receptor agonist 2,3-bis(4-hydroxyphenyl)-propionitrile (DPN; 10 nmol/l). Therefore, 17beta-estradiol increased expression of alpha(2C)-ARs by interacting with cell surface receptors to cause a cAMP/Rap2-dependent increase in alpha(2C)-AR transcription. In mouse tail arteries, 17beta-estradiol (10 nmol/l) increased alpha(2C)-AR expression and selectively increased the cold-induced amplification of alpha(2)-AR constriction, which is mediated by alpha(2C)-ARs. An estrogen-dependent increase in expression of cold-sensitive alpha(2C)-ARs may contribute

  8. [Expressions of neuropathic pain-related proteins in the spinal cord dorsal horn in rats with bilateral chronic constriction injury].

    Science.gov (United States)

    Shen, Le; Li, Xu; Wang, Hai-tang; Yu, Xue-rong; Huang, Yu-guang

    2013-12-01

    To evaluate the pain-related behavioral changes in rats with bilateral chronic constriction injury(bCCI)and identify the expressions of neuropathic pain-related proteins. The bCCI models were established by ligating the sciatic nerves in female Sprague Dawley rats. Both mechanical hyperalgesia and cold hyperalgesia were evaluated through electronic von Frey and acetone method. Liquid chromatography-mass spectrometry/mass spectrometry was applied to characterize the differentially expressed proteins. Both mechanical withdrawal threshold and cold hyperalgesia threshold decreased significantly on the postoperative day 7 and 14, when compared with na ve or sham rats(P <0.05). Twenty five differentially expressed proteins associated with bilateral CCI were discovered, with eighteen of them were upregulated and seven of them downregulated. The bCCT rats have remarkably decreased mechanical and cold hyperalgesia thresholds. Twenty five neuropathic pain-related proteins are found in the spinal cord dorsal horn.

  9. Calculation of the exchange coupling constants of copper binuclear systems based on spin-flip constricted variational density functional theory.

    Science.gov (United States)

    Zhekova, Hristina R; Seth, Michael; Ziegler, Tom

    2011-11-14

    We have recently developed a methodology for the calculation of exchange coupling constants J in weakly interacting polynuclear metal clusters. The method is based on unrestricted and restricted second order spin-flip constricted variational density functional theory (SF-CV(2)-DFT) and is here applied to eight binuclear copper systems. Comparison of the SF-CV(2)-DFT results with experiment and with results obtained from other DFT and wave function based methods has been made. Restricted SF-CV(2)-DFT with the BH&HLYP functional yields consistently J values in excellent agreement with experiment. The results acquired from this scheme are comparable in quality to those obtained by accurate multi-reference wave function methodologies such as difference dedicated configuration interaction and the complete active space with second-order perturbation theory. © 2011 American Institute of Physics

  10. Effects of exposure to intermittent versus continuous red light on human circadian rhythms, melatonin suppression, and pupillary constriction.

    Science.gov (United States)

    Ho Mien, Ivan; Chua, Eric Chern-Pin; Lau, Pauline; Tan, Luuan-Chin; Lee, Ivan Tian-Guang; Yeo, Sing-Chen; Tan, Sara Shuhui; Gooley, Joshua J

    2014-01-01

    Exposure to light is a major determinant of sleep timing and hormonal rhythms. The role of retinal cones in regulating circadian physiology remains unclear, however, as most studies have used light exposures that also activate the photopigment melanopsin. Here, we tested the hypothesis that exposure to alternating red light and darkness can enhance circadian resetting responses in humans by repeatedly activating cone photoreceptors. In a between-subjects study, healthy volunteers (n = 24, 21-28 yr) lived individually in a laboratory for 6 consecutive days. Circadian rhythms of melatonin, cortisol, body temperature, and heart rate were assessed before and after exposure to 6 h of continuous red light (631 nm, 13 log photons cm(-2) s(-1)), intermittent red light (1 min on/off), or bright white light (2,500 lux) near the onset of nocturnal melatonin secretion (n = 8 in each group). Melatonin suppression and pupillary constriction were also assessed during light exposure. We found that circadian resetting responses were similar for exposure to continuous versus intermittent red light (P = 0.69), with an average phase delay shift of almost an hour. Surprisingly, 2 subjects who were exposed to red light exhibited circadian responses similar in magnitude to those who were exposed to bright white light. Red light also elicited prolonged pupillary constriction, but did not suppress melatonin levels. These findings suggest that, for red light stimuli outside the range of sensitivity for melanopsin, cone photoreceptors can mediate circadian phase resetting of physiologic rhythms in some individuals. Our results also show that sensitivity thresholds differ across non-visual light responses, suggesting that cones may contribute differentially to circadian resetting, melatonin suppression, and the pupillary light reflex during exposure to continuous light.

  11. Effects of exposure to intermittent versus continuous red light on human circadian rhythms, melatonin suppression, and pupillary constriction.

    Directory of Open Access Journals (Sweden)

    Ivan Ho Mien

    Full Text Available Exposure to light is a major determinant of sleep timing and hormonal rhythms. The role of retinal cones in regulating circadian physiology remains unclear, however, as most studies have used light exposures that also activate the photopigment melanopsin. Here, we tested the hypothesis that exposure to alternating red light and darkness can enhance circadian resetting responses in humans by repeatedly activating cone photoreceptors. In a between-subjects study, healthy volunteers (n = 24, 21-28 yr lived individually in a laboratory for 6 consecutive days. Circadian rhythms of melatonin, cortisol, body temperature, and heart rate were assessed before and after exposure to 6 h of continuous red light (631 nm, 13 log photons cm(-2 s(-1, intermittent red light (1 min on/off, or bright white light (2,500 lux near the onset of nocturnal melatonin secretion (n = 8 in each group. Melatonin suppression and pupillary constriction were also assessed during light exposure. We found that circadian resetting responses were similar for exposure to continuous versus intermittent red light (P = 0.69, with an average phase delay shift of almost an hour. Surprisingly, 2 subjects who were exposed to red light exhibited circadian responses similar in magnitude to those who were exposed to bright white light. Red light also elicited prolonged pupillary constriction, but did not suppress melatonin levels. These findings suggest that, for red light stimuli outside the range of sensitivity for melanopsin, cone photoreceptors can mediate circadian phase resetting of physiologic rhythms in some individuals. Our results also show that sensitivity thresholds differ across non-visual light responses, suggesting that cones may contribute differentially to circadian resetting, melatonin suppression, and the pupillary light reflex during exposure to continuous light.

  12. Drechslerella stenobrocha genome illustrates the mechanism of constricting rings and the origin of nematode predation in fungi

    Science.gov (United States)

    2014-01-01

    Background Nematode-trapping fungi are a unique group of organisms that can capture nematodes using sophisticated trapping structures. The genome of Drechslerella stenobrocha, a constricting-ring-forming fungus, has been sequenced and reported, and provided new insights into the evolutionary origins of nematode predation in fungi, the trapping mechanisms, and the dual lifestyles of saprophagy and predation. Results The genome of the fungus Drechslerella stenobrocha, which mechanically traps nematodes using a constricting ring, was sequenced. The genome was 29.02 Mb in size and was found rare instances of transposons and repeat induced point mutations, than that of Arthrobotrys oligospora. The functional proteins involved in nematode-infection, such as chitinases, subtilisins, and adhesive proteins, underwent a significant expansion in the A. oligospora genome, while there were fewer lectin genes that mediate fungus-nematode recognition in the D. stenobrocha genome. The carbohydrate-degrading enzyme catalogs in both species were similar to those of efficient cellulolytic fungi, suggesting a saprophytic origin of nematode-trapping fungi. In D. stenobrocha, the down-regulation of saprophytic enzyme genes and the up-regulation of infection-related genes during the capture of nematodes indicated a transition between dual life strategies of saprophagy and predation. The transcriptional profiles also indicated that trap formation was related to the protein kinase C (PKC) signal pathway and regulated by Zn(2)–C6 type transcription factors. Conclusions The genome of D. stenobrocha provides support for the hypothesis that nematode trapping fungi evolved from saprophytic fungi in a high carbon and low nitrogen environment. It reveals the transition between saprophagy and predation of these fungi and also proves new insights into the mechanisms of mechanical trapping. PMID:24507587

  13. Experimental Investigation on the Influence of Axial Magnetic Field Distribution on Resisting the Constriction of a High-Current Vacuum Arc

    International Nuclear Information System (INIS)

    Shi Zongqian; Liu Zhigang; Jia Shenli; Song Xiaochuan; Wang Lijun

    2009-01-01

    Effect of the axial magnetic field (AMF) on resisting the constriction of a high-current vacuum arc is studied in this paper. Two typical AMF distributions were investigated, i.e., the traditional bell-shaped AMF, and the saddle-shaped AMF. Experiments were conducted in a detachable vacuum chamber with a rms arc current in the range of 10 kA to 25 kA. The arc column was photographed by a high-speed digital camera with an exposure time of 2 microseconds. The constriction of the vacuum arc was compared by processing the images of the arc column under the two different field configurations and numerically determining the dimensions of the arc column near the electrodes. It was also confirmed that the AMF distribution had a significant influence on its effectiveness in resisting arc constriction. Furthermore, the AMF strength near the periphery of the arc is more influential than that at the centre of the electrodes in resisting arc constriction.

  14. Topical gabapentin gel alleviates allodynia and hyperalgesia in the chronic sciatic nerve constriction injury neuropathic pain model.

    Science.gov (United States)

    Shahid, M; Subhan, F; Ahmad, N; Ali, G; Akbar, S; Fawad, K; Sewell, R D E

    2017-04-01

    Systemic gabapentin is a mainstay treatment for neuropathic pain though there are side-effects. Localized therapy may curtail such side-effects so a topical gabapentin dermal application was examined in the chronic constriction injury (CCI) model of neuropathic pain. Partial denervation CCI was achieved by rat sciatic nerve ligation. Gabapentin gel (10% w/w) was applied three times daily on the ipsilateral or contralateral plantar surface of the hind-paw, whereas in a concurrent systemic study, gabapentin was intraperitoneally administered daily (75 mg/kg) for 30 days. Tests for static- and dynamic-mechano-allodynia [paw withdrawal threshold (PWT) to von Frey filament application and latency (PWL) to light brushing], cold-allodynia [paw withdrawal duration (PWD) to acetone], heat- (PWL and PWD) and mechano-hyperalgesia (PWD to pin prick) were utilized to assess pain, whereas effects on locomotion (open field) and motor balance (rotarod and footprint analysis) were measured on days 5-30 post surgery. Topical application of gabapentin gel ipsilaterally but not contralaterally alleviated CCI-induced static- (days 10-30) and dynamic-allodynia (days 15-30), suppressed cold-allodynia (days 10-30), heat- (days 15-30) and mechano-hyperalgesia (days 5-30) indicating a local action. Systemic gabapentin exhibited similar pain profiles but was associated with motor impairment. The gabapentin gel formulation afforded desirable neuropathic pain alleviating effects devoid of unwanted systemic side-effects. These outcomes disclose an expedient pharmacological validation of the effectiveness of topical gabapentin gel against an extensive range of nociceptive stimulus modalities utilizing the CCI-induced neuropathic pain model. They also advocate further clinical studies on topical gabapentin with regard to certain neuropathic pain syndromes. Systemic gabapentin neuropathic pain management carries side-effects ostensibly preventable by localized therapy. This study validates the

  15. Parameters of the constricted plasma discharge produced by radio-frequency for atmospheric pressures

    International Nuclear Information System (INIS)

    Zambrano R, G.

    1987-01-01

    The main electrophysical characteristics of high-frequency discharge between two electrodes for pressures of the order of atmospheric pressure were investigated. The vibrational and kinetic temperatures of the discharge, and the possibilities for creating the conditions which using these type of discharge an instability between vibrational and kinetic temperatures can be obtained. For determining main characteristics of this type of discharge, argon gas, nitrogen gas and air, when oxygen and nitrogen are predominated, were used. The obtained electrical discharge parameters were: the high frequency voltage between electrocathodes, the current, the phase displacement between current and voltage, and the discharge power. The kinetic temperature distribution in the discharge region, and the vibrational temperature of the nitrogen molecules in discharge channel were also obtained. (M.C.K.) [pt

  16. Flow of two immiscible fluids in a periodically constricted tube: Transitions to stratified, segmented, churn, spray or segregated flow

    Science.gov (United States)

    Tsamopoulos, John; Fraggedakis, Dimitris; Dimakopoulos, Yiannis

    2015-11-01

    We study the flow of two immiscible, Newtonian fluids in a periodically constricted tube driven by a constant pressure gradient. Our Volume-of-Fluid algorithm is used to solve the governing equations. First the code is validated by comparing its predictions to previously reported results for stratified and pulsing flow. Then it is used to capture accurately all the significant topological changes that take place. Initially, the fluids have a core-annular arrangement, which is found to either remain the same or change to a different arrangement depending on the fluid properties, the pressure driving the flow or the flow geometry. The flow-patterns that appear are the core-annular, segmented, churn, spray and segregated flow. The predicted scalings near pinching of the core fluid concur with similarity predictions and earlier numerical results (Cohen et al. (1999)). Flow-pattern maps are constructed in terms of the Reynolds and Weber numbers. Our results provide deeper insights in the mechanism of the pattern transitions and are in agreement with previous studies on core-annular flow (Kouris & Tsamopoulos (2001 & 2002)), segmented flow (Lac & Sherwood (2009)) and churn flow (Bai et al. (1992)). GSRT of Greece through the program ``Excellence'' (Grant No. 1918, entitled ``FilCoMicrA'').

  17. PERICARDITIS CONSTRICTIVA EN UNA MUJER DE 36 AÑOS / Constrictive Pericarditis in a 36 year-old woman

    Directory of Open Access Journals (Sweden)

    Tessa Negrín Valdés

    2012-07-01

    Full Text Available ResumenPaciente femenina, de 36 años de edad, con antecedentes de dos gestaciones, dos partos y ningún aborto, que en el año 2003 tras su segundo parto, distócico por cesárea, desarrolla una pericarditis de causa no precisada que produjo un derrame pericárdico grave con signos de taponamiento cardíaco, y requirió ingreso hospitalario y pericardiocentesis. Siete años después se identifican, en la consulta de Cardiología, síntomas clínicos de una pericarditis constrictiva, corroborada por ecocardiograma y cateterismo derecho; actualmente ingresa para pericardiectomía, evaluada como alto riesgo quirúrgico. / Abstract36 year-old female patient, with a history of two pregnancies, two births and no abortion, who in 2003 after her second delivery (cesarean for dystocia she developed pericarditis of undetermined cause that produced a severe pericardial effusion with signs of cardiac tamponade and required hospital admission and pericardiocentesis. Seven years later, in the Cardiology service, clinical symptoms of constrictive pericarditis are identified and confirmed by echocardiography and right heart catheterization. This patient has been recently admitted for pericardiectomy, and evaluated as high surgical risk.

  18. The Antinociceptive Effects of Tramadol and/or Gabapentin on Rat Neuropathic Pain Induced by a Chronic Constriction Injury.

    Science.gov (United States)

    Corona-Ramos, Janette Nallely; De la O-Arciniega, Minarda; Déciga-Campos, Myrna; Medina-López, José Raúl; Domínguez-Ramírez, Adriana Miriam; Jaramillo-Morales, Osmar Antonio; Espinosa-Juárez, Josué Vidal; López-Muñoz, Francisco Javier

    2016-08-01

    Preclinical Research The current work evaluates the interaction between two commonly used drugs, tramadol (Tra) and gabapentin (Gbp). Dose-response curves (DRC) and isobolographic analysis were used to confirm their synergistic antihyperalgesic and anti-allodynic responses in a rat neuropathic pain model involving chronic constriction injury of the sciatic nerve and in von Frey and acetone tests. Tra and Gbp produced dose-dependent antihyperalgesic and anti-allodynic effects. Dose-response studies of combinations of Tra and Gbp in combination showed the DRC was leftward-shifted compared to the DRCs for each compound alone. One combination demonstrated both antihyperalgesic and anti-allodynic effects greater than those observed after individual administration. The remaining combinations demonstrated an additive effect. The Tra+Gbp combination demonstrated a potentiative effect with smaller doses of Tra. Additionally, it was determined lethal dose 50 (LD50 ) of Tra alone and tramadol + Gbp 10 using mice to 48 h post administration. The DRC (death) were similar for Tra alone and in Tra in combination, despite the improved effectiveness of Tra in the presence of GBP, 10 mg/kg. A combination of these drugs could be effective in neuropathic pain therapy because they can produce potentiative (at a low dose) or additive effects. Drug Dev Res 77 : 217-226, 2016.   © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Analgesic effect of piracetam on peripheral neuropathic pain induced by chronic constriction injury of sciatic nerve in rats.

    Science.gov (United States)

    Mehta, Ashish K; Bhati, Yogendra; Tripathi, Chakra D; Sharma, Krishna K

    2014-08-01

    Despite immense advances in the treatment strategies, management of neuropathic pain remains unsatisfactory. Piracetam is a prototype of nootropic drugs, used to improve cognitive impairment. The present study was designed to investigate the effect of piracetam on peripheral neuropathic pain in rats. Neuropathic pain was induced by the chronic constriction injury of the sciatic nerve. Following this, piracetam was intraperitoneally administered for 2 weeks in doses of 50, 100 and 200 mg/kg, and pain was assessed by employing the behavioural tests for thermal hyperalgesia (hot plate and tail flick tests) and cold allodynia (acetone test). After the induction of neuropathic pain, significant development of thermal hyperalgesia and cold allodynia was observed. The administration of piracetam (50 mg/kg) did not have any significant effect on all the behavioural tests. Further, piracetam (100 mg/kg) also had no effect on the hot plate and tail flick tests; however it significantly decreased the paw withdrawal duration in the acetone test. Piracetam in a dose of 200 mg/kg significantly modulated neuropathic pain as observed from the increased hot plate and tail flick latencies, and decreased paw withdrawal duration (in acetone test). Therefore, the present study suggests the potential use of piracetam in the treatment of neuropathic pain, which merits further clinical investigation.

  20. Flow cytometry analysis of inflammatory cells isolated from the sciatic nerve and DRG after chronic constriction injury in mice.

    Science.gov (United States)

    Liu, Liping; Yin, Yan; Li, Fei; Malhotra, Charvi; Cheng, Jianguo

    2017-06-01

    Cellular responses to nerve injury play a central role in the pathogenesis of neuropathic pain. However, the analysis of site specific cellular responses to nerve injury and neuropathic pain is limited to immunohistochemistry staining with numerous limitations. We proposed to apply flow cytometry to overcome some of the limitations and developed two protocols for isolation of cells from small specimens of the sciatic nerve and dorsal root ganglion (DRG) in mice. RESULTS AND COMPARASION WITH EXISTING: methods We found that both the non-enzymatic and enzymatic approaches were highly effective in harvesting a sufficient number of cells for flow cytometry analysis in normal and pathological conditions. The total number of cells in the injury site of the sciatic and its DRGs increased significantly 14days after chronic constriction injury (CCI) of the sciatic nerve, compared to sham surgery control or the contralateral control. The enzymatic approach yielded a significantly higher total number of cells and CD45 negative cells, suggesting that this approach allows for harvest of more resident cells, compared to the non-enzymatic method. The percentage of CD45 + /CD11b + cells was significantly increased in the sciatic nerve but not in the DRG. These results were consistent with both protocols. We thus offer two simple and effective protocols that allow for application of flow cytometry to the investigation of cellular and molecular mechanisms of neuropathic pain. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Observation of 99Tcm-MIBI uptake of ischemic myocardium in dog models after left circumflex coronary artery constriction

    International Nuclear Information System (INIS)

    Cheng Guanghua; Dai Yunhai; Wu Kefang; Xu Quanfeng

    2008-01-01

    Objective: To observe 99 Tc m -MIBI uptake of ischemic myocardium at different times (1h, 4h) in dog models after left circumflex coronary artery constriction. Methods: 12 dog models of coronary artery stenosis were prepared by left circumflex coronary ligation, and were given injection of 99 Tc m -MIBI at the dosage of 185 MBq (5 mCi). Six models were sacrificed at one hour and four hours after the injection respectively. Radio-uptake in about 100 mg myocardium from both ischemic and non-ischemic sites were measured with r-counter. Results: No significant differences were found between ratios of radioactive count of ischemic over normal myocardial tissues at 1h and 4h after injection of 99 Tc m -MIBI (0.726±0.054 and 0.673±0.080, respective, t=1.3452, P >0.05). Conclusion: The extension of post-injection time would not increase 99 Tc m -MIBI uptake in ischemic myocardium. (authors)

  2. The Effect of Alternating Current Iontophoresis on Rats with the Chronic Constriction Injury to the Infraorbital Nerve

    Directory of Open Access Journals (Sweden)

    Yoko Yamazaki

    2012-01-01

    Full Text Available This study aimed to examine the effect of AC iontophoresis on rats with the chronic constriction injury (CCI to the infraorbital nerve by animal experiments. CCI model rats were divided into four groups, namely, rats that received general anesthesia for 60 min except AC IOP (CCI: n=5, AC IOP with 0.9% physiological saline for 60 min (CCI + saline AC IOP: n=5, AC IOP with 4% lidocaine hydrochloride for 60 min (CCI + lidocaine AC IOP: n=5, and attachment of two electrodes soaked with 4% lidocaine hydrochloride to the facial skin for 60 min (CCI + attach lidocaine: n=5. In the CCI + lidocaine AC IOP group, an elevated withdrawal threshold was observed after AC IOP, and the duration of efficacy was longer compared with that in the CCI + saline AC IOP and CCI + attached lidocaine groups. A significant decrease in the number of Fos-like immunoreactive (LI cells was observed in the CCI + lidocaine AC IOP group compared with that in the CCI group. These findings suggest that the effect of CCI + lidocaine AC IOP group may be caused by active permeation of lidocaine into the facial skin and electrical stimulation of the trigeminal nucleus.

  3. Ameliorative potential of Vernonia cinerea on chronic constriction injury of sciatic nerve induced neuropathic pain in rats

    Directory of Open Access Journals (Sweden)

    VENKATA R.K. THIAGARAJAN

    2014-09-01

    Full Text Available The aim of the present study is to investigate the ameliorative potential of ethanolic extract of whole plant of Vernonia cinerea in the chronic constriction injury (CCI of sciatic nerve induced neuropathic pain in rats. Behavioral parameters such as a hot plate, acetone drop, paw pressure, Von Frey hair and tail immersion tests were performed to assess the degree of thermal, chemical and mechanical hyperalgesia and allodynia. Biochemical changes in sciatic nerve tissue were ruled out by estimating thiobarbituric acid reactive substances (TBARS, reduced glutathione (GSH and total calcium levels. Ethanolic extract of Vernonia cinerea and pregabalin were administered for 14 consecutive days starting from the day of surgery. CCI of sciatic nerve has been shown to induce significant changes in behavioral, biochemical and histopathological assessments when compared to the sham control group. Vernonia cinerea attenuated in a dose dependent manner the above pathological changes induced by CCI of the sciatic nerve, which is similar to attenuation of the pregabalin pretreated group. The ameliorating effect of ethanolic extract of Vernonia cinerea against CCI of sciatic nerve induced neuropathic pain may be due to the presence of flavonoids and this effect is attributed to anti-oxidative, neuroprotective and calcium channel modulator actions of these compounds.

  4. Chest Wall Constriction after the Nuss Procedure Identified from Chest Radiograph and Multislice Computed Tomography Shortly after Removal of the Bar.

    Science.gov (United States)

    Chang, Pei-Yeh; Zeng, Qi; Wong, Kin-Sun; Wang, Chao-Jan; Chang, Chee-Jen

    2016-01-01

    This study radiographically examined the changes in the chest walls of patients with pectus excavatum (PE) after Nuss bar removal, to define the deformation caused by the bar and stabilizer. In the first part of the study, we compared the changes in chest radiographs of patients with PE to a preoperation PE control group. In the second part, we used multislice computed tomography (CT) scans to provide three-dimensional reconstructions with which to evaluate the changes to the thoracic wall. Part 1 From June 2006 to August 2011, 1,125 patients with PE who had posteroanterior chest radiographs taken before undergoing the Nuss procedure at four hospitals were enrolled as a preoperative control group. At the same time, 203 patients who had the bar removed were enrolled as the study group. The maximum dimensions of the outer boundary of the first to ninth rib pairs (R1-R9, rib pair width), chest height, and chest width were measured. Part 2 Thirty-one consecutive patients with PE (20 males and 11 females) who underwent Nuss bar removal were evaluated 7 to 30 days after operation. During this period, a further 34 patients with PE who had undergone CT imaging before bar insertion were evaluated and compared with the postoperative group. Part 1 The width of the lower ribs (R4-R9) after bar removal was significantly less than in the age-matched controls. The ribs adjacent to the bar (R5-R7) showed the greatest restriction. The width of the upper ribs (R1-R3) 2 to 3 years after bar placement did not differ significantly from the controls. Patients who were operated on after 10 years of age had less of a restrictive effect. Three years of bar placement resulted in more restriction than a 2-year period, particularly in patients younger than 10 years old. Part 2: A significant constriction of the chest wall was observed in 13 patients after removal of the Nuss bar. Constriction at ribs 5 to 8 was found to be present adjacent to the site of bar insertion. However

  5. Constrição campimétrica causada por vigabatrin Visual field constriction caused by vigabatrin

    Directory of Open Access Journals (Sweden)

    Mário Luiz Ribeiro Monteiro

    2000-10-01

    Full Text Available Objetivo: Descrever dois pacientes que apresentaram constrição campimétrica importante e determinar a origem desta alteração visual causada pelo uso de vigabatrin, um anticonvulsivante que atua aumentando a concentração do ácido gama-aminobutírico no sistema nervoso central. Métodos: Os pacientes foram submetidos a exame e neuroftalmológico completo, avaliação cuidadosa da retina, campo visual com perímetro de Goldmann, tomografia computadorizada de crânio e órbitas, eletrorretinograma (ERG, imagem por ressonância magnética (1 paciente e potencial visual evocado (1 paciente. Resultados: A acuidade visual se mostrou preservada; o primeiro paciente apresentava campo visual restrito à área central de 20 a 30 graus centrais e o segundo uma constrição leve a moderada. Os exames de neuroimagem foram normais assim como o potencial visual evocado. Observou-se palidez discreta de papila em 3 olhos estudados e estreitamento arteriolar muito discreto dos vasos retinianos. O ERG revelou alterações importantes caracterizada por redução da onda b (caso 1 e dos potenciais oscilatórios (caso 2. Conclusões: As alterações visuais causadas pelo vigabatrin são devidas a uma alteração retiniana, envolvendo provavelmente as células amácrimas, bipolares e ganglionares mas não se acompanham de uma alteração significativa à fundoscopia. Pacientes recebendo esta medicação devem ser seguidos de perto especialmente através da avaliação do campo visual central e periférico.Purpose: To describe two patients who presented with severe campimetric constriction and to determine the source of visual symptoms caused by vigabatrin, an anticonvulsant medication that increases brain gamma-aminobutyric acid. Methods: Patients were submitted to a complete neuroophthalmologic evaluation as well as a careful retina examination, Goldmann perimetry, computerized tomography of the brain and orbits, electroretinograms (ERG, magnetic ressonance

  6. Evolution of a meander in a constricted reach of a dryland alluvial channel: Little Colorado River, Arizona

    Science.gov (United States)

    Block, D.

    2013-12-01

    Lateral migration of river meander systems is complex, particularly in drylands where fluvial processes are discontinuous. Analysis of aerial photography and GPS tracking of cutbank erosion can further empirical knowledge of meander development. Moreover, discharge records link landscape response to hydroclimatic variability. In the semiarid Little Colorado River valley, extreme erosive episodes typically result from snowmelt flow, or lately, rain-on-snow events. The 90-km reach of the Little Colorado River (LCR), from Winslow to Leupp, Arizona, meanders within a 5-km-wide valley. Near Winslow, however, the LCR is disconnected from its floodplain by a 12-km-long levee. The levee restricts the floodplain to only 450 m wide in one location. In this severely constricted river stretch, a flood event in January 2008 relocated a meander bend. Bend development followed a common sequence of migration phases long noted in the literature, but at a very rapid pace. During the flood event one meander limb migrated ~200 m, following the general northwesterly flow direction of the river. Movement vectors of meander inflection points, apex, and apical line characterize changes in bend morphology. Before the 2008 flood event the apical line of the meander bend had azimuth 50°; after the 2008 flood event the apical line of the meander bend had azimuth 345°. Since that event, the meander bend has migrated an additional ~200 m through a combination of translation, extension, and rotation. The data provide information on geomorphic response to bimodal precipitation patterns in a human-perturbed channel reach.

  7. Synergistic interaction between total glucosides and total flavonoids on chronic constriction injury induced neuropathic pain in rats.

    Science.gov (United States)

    Zhang, Juan; Lv, Chen; Wang, Hai-na; Cao, Yi

    2013-04-01

    Shaoyao Gancao Decoction (SGD), a famous herbal medicine, consists of two herbs (Paeoniae Radix and Glycyrrhizae Radix) and is traditionally used for the treatment of pain. To investigate the synergistic potential of total glucosides of Paeoniae Radix (TGP) and total flavonoids of Glycyrrhizae Radix (TFL). Oral administration of TGP and TFL alone at the doses of 60,120 and 240 mg/kg or in combination were given only one time to the neuropathic pain rat induced by chronic constriction injury. Paw pressure and heat immersion tests were performed to assess degrees of mechanical allodynia and thermal hyperalgesia, respectively. Synergistic interactions between TGP and TFL were characterized using isobolographic analysis. Expressions of Sirt1 protein were detected by immunohistochemistry. On day 14 after surgery, single oral administration of TGP and TFL both produced significant anti-allodynic and anti-hyperalgesic effects in dose-dependent and time-dependent manners. The ED(50) value of TGP was 249.4 ± 10.8 mg/kg while TFL was 871.4 ± 30.5 mg/kg. Isobolographic analysis revealed that the combination of TGP with TFL at the fixed ratios of 3:1 exerted the highest sub-additive (synergistic) interaction, of which the experimental ED(50) value was 95.1 ± 9.0 mg/kg. SGD could also downregulate Sirt1 protein expression, which was 4.2-fold higher than that of model rats in dorsal root ganglion. Analgesic effects of SGD may contribute to simultaneous inhibition of Sirt1 overexpression and could warrant further evaluation as a possible agent for the treatment of neuropathic pain.

  8. A Cognitive Machine Learning Algorithm for Cardiac Imaging: A Pilot Study for Differentiating Constrictive Pericarditis from Restrictive Cardiomyopathy

    Science.gov (United States)

    Sengupta, Partho P.; Huang, Yen-Min; Bansal, Manish; Ashrafi, Ali; Fisher, Matt; Shameer, Khader; Gall, Walt; Dudley, Joel T

    2016-01-01

    Background Associating a patient’s profile with the memories of prototypical patients built through previous repeat clinical experience is a key process in clinical judgment. We hypothesized that a similar process using a cognitive computing tool would be well suited for learning and recalling multidimensional attributes of speckle tracking echocardiography (STE) data sets derived from patients with known constrictive pericarditis (CP) and restrictive cardiomyopathy (RCM). Methods and Results Clinical and echocardiographic data of 50 patients with CP and 44 with RCM were used for developing an associative memory classifier (AMC) based machine learning algorithm. The STE data was normalized in reference to 47 controls with no structural heart disease, and the diagnostic area under the receiver operating characteristic curve (AUC) of the AMC was evaluated for differentiating CP from RCM. Using only STE variables, AMC achieved a diagnostic AUC of 89·2%, which improved to 96·2% with addition of 4 echocardiographic variables. In comparison, the AUC of early diastolic mitral annular velocity and left ventricular longitudinal strain were 82.1% and 63·7%, respectively. Furthermore, AMC demonstrated greater accuracy and shorter learning curves than other machine learning approaches with accuracy asymptotically approaching 90% after a training fraction of 0·3 and remaining flat at higher training fractions. Conclusions This study demonstrates feasibility of a cognitive machine learning approach for learning and recalling patterns observed during echocardiographic evaluations. Incorporation of machine learning algorithms in cardiac imaging may aid standardized assessments and support the quality of interpretations, particularly for novice readers with limited experience. PMID:27266599

  9. Amniotic constriction bands

    Science.gov (United States)

    ... Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Amniotic band sequence URL of this page: //medlineplus.gov/ency/ ... birth. The baby should be delivered in a medical center that has specialists experienced in caring for babies ... or partial loss of function of a body part. Congenital bands affecting large parts of the body cause the ...

  10. Cardioprotective Effects of QiShenYiQi Dripping Pills on Transverse Aortic Constriction-Induced Heart Failure in Mice.

    Science.gov (United States)

    Ruan, Guoran; Ren, Haojin; Zhang, Chi; Zhu, Xiaogang; Xu, Chao; Wang, Liyue

    2018-01-01

    QiShenYiQi dripping pills (QSYQ), a traditional Chinese medicine, are commonly used to treat coronary heart disease, and QSYQ was recently approved as a complementary treatment for ischemic heart failure in China. However, only few studies reported on whether QSYQ exerts a protective effect on heart failure induced by pressure overload. In this study, we explored the role of QSYQ in a mouse model of heart failure induced by transverse aortic constriction (TAC). Twenty-eight C57BL/6J mice were divided into four groups: Sham + NS group, Sham + QSYQ group, TAC + NS group, and TAC + QSYQ group. QSYQ dissolved in normal saline (NS) was administered intragastrically (3.5 mg/100 g/day) in the Sham + QSYQ and TAC + QSYQ groups. In the Sham + NS and TAC + NS groups, NS was provided every day intragastrically. Eight weeks after TAC, echocardiography, and cardiac catheterization were performed to evaluate the cardiac function, and immunofluorescent staining with anti-actinin2 antibody was performed to determine the structure of the myocardial fibers. Moreover, TUNEL staining and Masson trichrome staining were employed to assess the effects of QSYQ on cardiac apoptosis and cardiac fibrosis. Western blots and real-time polymerase chain reaction (PCR) were used to measure the expression levels of vascular endothelial growth factor (VEGF) in the heart, and immunohistochemical staining with anti-CD31 antibody was performed to explore the role of QSYQ in cardiac angiogenesis. Results showed that TAC-induced cardiac dysfunction and disrupted structure of myocardial fibers significantly improved after QSYQ treatment. Moreover, QSYQ treatment also significantly improved cardiac apoptosis and cardiac fibrosis in TAC-induced heart failure, which was accompanied by an increase in VEGF expression levels and maintenance of microvessel density in the heart. In conclusion, QSYQ exerts a protective effect on TAC-induced heart failure, which could be attributed to enhanced cardiac angiogenesis

  11. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei

    2016-03-01

    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  12. Ameliorative potential of Butea monosperma on chronic constriction injury of sciatic nerve induced neuropathic pain in rats

    Directory of Open Access Journals (Sweden)

    Venkata R.K. Thiagarajan

    2012-12-01

    Full Text Available The present study was designed to investigate the ameliorative role of ethanolic extract from leaves of Butea monosperma in chronic constriction injury (CCI of sciatic nerve induced neuropathic pain in rats. Hot plate, acetone drop, paw pressure, Von Frey hair and tail immersion tests were performed to assess the degree of thermal hyperalgesia, cold chemical allodynia, mechanical hyperalgesia & allodynia in the left hind paw and tail thermal hyperalgesia. Further on, thiobarbituric acid reactive substances (TBARS, reduced glutathione (GSH and total calcium levels were estimated to assess the biochemical changes in the sciatic nerve tissue. Histopathological changes were also observed in the sciatic nerve tissue. Ethanolic extract of Butea monosperma leaves and pregabalin (serving as positive control were administered for 14 consecutive days starting from the day of surgery. CCI resulted in significant changes in behavioural and biochemical parameters. Pretreatment of Butea monosperma attenuated CCI induced development of behavioural, biochemical and histopathological alterations in a dose dependent manner, which is comparable to that of pregabalin pretreated group. These findings may be attributed to its potential anti-oxidative, neuroprotective and calcium channel modulatory actions of Butea monosperma.O presente trabalho visou investigar o papel do extrato etanólico de folhas de Butea monosperma no alívio da dor neuropática pela injúria de constrição crônica (CCI do nervo ciático induzida em ratos. Placa quente, gota de acetona, pressão na pata, testes de imersão de pelo e cauda de Von Frey foram utilizados para acessar o grau de hiperalgesia térmica, alodinia química fria, hiperalgesia mecânica e alodinia na pata trazeira esquerda e hiperalgesia térmica da cauda. Além disso, substâncias reativas com ácido tiobarbitúrico (TBARS, glutatião reduzido (GSH e níveis de cálcio total foram estimados para acessar as altera

  13. Effects of calcium antagonists on isolated bovine cerebral arteries: inhibition of constriction and calcium-45 uptake induced by potassium or serotonin

    International Nuclear Information System (INIS)

    Wendling, W.W.; Harakal, C.

    1987-01-01

    The purpose of this study was to determine the mechanisms by which organic calcium channel blockers inhibit cerebral vasoconstriction. Isolated bovine middle cerebral arteries were cut into rings to measure contractility or into strips to measure radioactive calcium ( 45 Ca) influx and efflux. Calcium channel blockers (10(-5) M verapamil or 3.3 X 10(-7) M nifedipine) and calcium-deficient solutions all produced near-maximal inhibition of both potassium- and serotonin-induced constriction. In calcium-deficient solutions containing potassium or serotonin, verapamil and nifedipine each blocked subsequent calcium-induced constriction in a competitive manner. Potassium and serotonin significantly increased 45 Ca uptake into cerebral artery strips during 5 minutes of 45 Ca loading; for potassium 45 Ca uptake increased from 62 to 188 nmol/g, and for serotonin from 65 to 102 nmol/g. Verapamil or nifedipine had no effect on basal 45 Ca uptake but significantly blocked the increase in 45 Ca uptake induced by potassium or serotonin. Potassium, and to a lesser extent serotonin, each induced a brief increase in the rate of 45 Ca efflux into calcium-deficient solutions. Verapamil or nifedipine had no effect on basal or potassium-stimulated 45 Ca efflux. The results demonstrate that verapamil and nifedipine block 45 Ca uptake through both potential-operated (potassium) and receptor-operated (serotonin) channels in bovine middle cerebral arteries

  14. Treatment of skeletal class III malocclusion using face mask therapy with alternate rapid maxillary expansion and constriction (Alt-RAMEC protocol

    Directory of Open Access Journals (Sweden)

    Anand Ramchandra Rathi

    2015-01-01

    Full Text Available Class III malocclusion is very common malocclusion and can be due to maxillary retrusion, mandibular prognathism, or combination. Ellis and McNamara found a combination of maxillary retrusion and mandibular protrusion to be the most common skeletal relationship (30%. The treatment should be carried out as early as possible for permitting normal growth of the skeletal bases. Reverse pull head gear combined with maxillary expansion can effectively correct skeletal Class III malocclusion due to maxillary deficiency in growing patient. An eight-year-old female patient with chief complaint of prognathic mandible and anterior crossbite was successfully treated in duration of 5 months with facemask and expansion therapy based on Alternate Rapid Maxillary Expansion and Constriction (Alt-RAMEC protocol.

  15. Calculation of exchange coupling constants in triply-bridged dinuclear Cu(II) compounds based on spin-flip constricted variational density functional theory.

    Science.gov (United States)

    Seidu, Issaka; Zhekova, Hristina R; Seth, Michael; Ziegler, Tom

    2012-03-08

    The performance of the second-order spin-flip constricted variational density functional theory (SF-CV(2)-DFT) for the calculation of the exchange coupling constant (J) is assessed by application to a series of triply bridged Cu(II) dinuclear complexes. A comparison of the J values based on SF-CV(2)-DFT with those obtained by the broken symmetry (BS) DFT method and experiment is provided. It is demonstrated that our methodology constitutes a viable alternative to the BS-DFT method. The strong dependence of the calculated exchange coupling constants on the applied functionals is demonstrated. Both SF-CV(2)-DFT and BS-DFT affords the best agreement with experiment for hybrid functionals.

  16. Behavioral and anatomical characterization of the bilateral sciatic nerve chronic constriction (bCCI) injury: correlation of anatomic changes and responses to cold stimuli.

    Science.gov (United States)

    Datta, Sukdeb; Chatterjee, Koel; Kline, Robert H; Wiley, Ronald G

    2010-01-27

    Unilateral constrictive sciatic nerve injury (uCCI) is a common neuropathic pain model. However, the bilateral constrictive injury (bCCI) model is less well studied, and shows unique characteristics. In the present study, we sought to correlate effects of bCCI on nocifensive responses to cold and mechanical stimuli with selected dorsal horn anatomic markers. bCCI or sham ligation of both rat sciatic nerves were followed up to 90 days of behavioural testing. Additional rats sacrificed at 15, 30 and 90 days were used for anatomic analyses. Behavioural tests included hindpaw withdrawal responses to topical acetone, cold plate testing, an operant thermal preference task and hindpaw withdrawal thresholds to mechanical probing. All nocifensive responses to cold increased and remained enhanced for >45 days. Mechanical withdrawal thresholds decreased for 25 days only. Densitometric analyses of immunoperoxidase staining in the superficial dorsal horn at L4-5 revealed decreased cholecystokinin (CCK) staining at all times after bCCI, decreased mu opiate receptor (MOR) staining, maximal at 15 days, increased neuropeptide Y (NPY) staining only at days 15 and 30, and increased neurokinin-1 receptor (NK-1R) staining at all time points, maximal at 15 days. Correlation analyses at 45 days post-bCCI, were significant for individual rat nocifensive responses in each cold test and CCK and NK-1R, but not for MOR or NPY. These results confirm the usefulness of cold testing in bCCI rats, a new approach using CCI to model neuropathic pain, and suggest a potential value of studying the roles of dorsal horn CCK and substance P in chronic neuropathic pain. Compared to human subjects with neuropathic pain, responses to cold stimuli in rats with bCCI may be a useful model of neuropathic pain.

  17. Behavioral and anatomical characterization of the bilateral sciatic nerve chronic constriction (bCCI injury: correlation of anatomic changes and responses to cold stimuli

    Directory of Open Access Journals (Sweden)

    Kline Robert H

    2010-01-01

    Full Text Available Abstract Background Unilateral constrictive sciatic nerve injury (uCCI is a common neuropathic pain model. However, the bilateral constrictive injury (bCCI model is less well studied, and shows unique characteristics. In the present study, we sought to correlate effects of bCCI on nocifensive responses to cold and mechanical stimuli with selected dorsal horn anatomic markers. bCCI or sham ligation of both rat sciatic nerves were followed up to 90 days of behavioural testing. Additional rats sacrificed at 15, 30 and 90 days were used for anatomic analyses. Behavioural tests included hindpaw withdrawal responses to topical acetone, cold plate testing, an operant thermal preference task and hindpaw withdrawal thresholds to mechanical probing. Results All nocifensive responses to cold increased and remained enhanced for >45 days. Mechanical withdrawal thresholds decreased for 25 days only. Densitometric analyses of immunoperoxidase staining in the superficial dorsal horn at L4-5 revealed decreased cholecystokinin (CCK staining at all times after bCCI, decreased mu opiate receptor (MOR staining, maximal at 15 days, increased neuropeptide Y (NPY staining only at days 15 and 30, and increased neurokinin-1 receptor (NK-1R staining at all time points, maximal at 15 days. Correlation analyses at 45 days post-bCCI, were significant for individual rat nocifensive responses in each cold test and CCK and NK-1R, but not for MOR or NPY. Conclusions These results confirm the usefulness of cold testing in bCCI rats, a new approach using CCI to model neuropathic pain, and suggest a potential value of studying the roles of dorsal horn CCK and substance P in chronic neuropathic pain. Compared to human subjects with neuropathic pain, responses to cold stimuli in rats with bCCI may be a useful model of neuropathic pain.

  18. Regional environmental change and human activity over the past hundred years recorded in the sedimentary record of Lake Qinghai, China.

    Science.gov (United States)

    Sha, ZhanJiang; Wang, Qiugui; Wang, Jinlong; Du, Jinzhou; Hu, Jufang; Ma, Yujun; Kong, Fancui; Wang, Zhuan

    2017-04-01

    Environmental change and human activity can be recorded in sediment cores in aquatic systems such as lakes. Information from such records may be useful for environmental governance in the future. Six sediment cores were collected from Lake Qinghai, China and its sublakes during 2012 and 2013. Measurements of sediment grain-size fractions indicate that sedimentation in the north and southwest of Lake Qinghai is dominated by river input, whereas that in Lake Gahai and Lake Erhai is dominated by dunes. The sedimentation rates in Lake Qinghai were calculated to be 0.101-0.159 cm/y, similar to the rates in other lakes on the Qinghai-Tibetan Plateau. Using these data and sedimentation rates from the literature, we compiled the spatial distribution of sedimentation rates. Higher values were obtained in the three main areas of Lake Qinghai: two in river estuaries and one close to sand dunes. Lower values were measured in the center and south of the lake. Measurements of total organic carbon (TOC), total nitrogen (TN), phosphorus concentrations, and TOC/TN ratios in three cores (QH01, QH02, and Z04) revealed four horizons corresponding to times of increased human activity. These anthropogenic events were (1) the development of large areas of cropland in the Lake Qinghai watershed in 1960, (2) the beginning of nationwide fertilizer use and increases in cropland area in the lake watershed after 1970, (3) the implementation of the national program "Grain to Green," and (4) the rapid increase in the tourism industry from 2000. Profiles of Rb, Sr concentrations, the Rb/Sr ratio, and grain-size fraction in core Z04 indicate that the climate has become drier over the past 100 years. Therefore, we suggest that lake sediments such as those in Lake Qinghai are useful media for high-resolution studies of regional environmental change and human activity.

  19. Sequence Data: QH00814 [dbQSNP[Archive

    Lifescience Database Archive (English)

    Full Text Available aagtcctttttctttaggatgatggtgatggggaactaaatggggaaatatggaaggtcacaggaaaagttaacacaagttagcaaaaagttaacataacacaaaaaggtcttgcaggaaaaaaaaaagaaaa...gaaaagaaagaaaaagtctccaaaaatggtttggacagccaaaatgaatacttatagtcacgtatacctgctcactcctgacgcttaa

  20. Role for the disulfide-bonded region of human immunodeficiency virus type 1 gp41 in receptor-triggered activation of membrane fusion function

    International Nuclear Information System (INIS)

    Bellamy-McIntyre, Anna K.; Baer, Severine; Ludlow, Louise; Drummer, Heidi E.; Poumbourios, Pantelis

    2010-01-01

    The conserved disulfide-bonded region (DSR) of the human immunodeficiency virus type 1 (HIV-1) fusion glycoprotein, gp41, mediates association with the receptor-binding glycoprotein, gp120. Interactions between gp120, CD4 and chemokine receptors activate the fusion activity of gp41. The introduction of W596L and W610F mutations to the DSR of HIV-1 QH1549.13 blocked viral entry and hemifusion without affecting gp120-gp41 association. The fusion defect correlated with inhibition of CD4-triggered gp41 pre-hairpin formation, consistent with the DSR mutations having decoupled receptor-induced conformational changes in gp120 from gp41 activation. Our data implicate the DSR in sensing conformational changes in the gp120-gp41 complex that lead to fusion activation.

  1. Nasal inhalation of butorphanol in combination with ketamine quickly elevates the mechanical pain threshold in the model of chronic constriction injury to the sciatic nerve of rat.

    Science.gov (United States)

    Chen, Feng; Wang, LiQin; Chen, ShuJun; Li, ZhiGao; Chen, ZhouLin; Zhou, XinHua; Zhai, Dong

    2014-01-01

    The aim of the present study is to explore the impact of butorphanol in combination with ketamine via nasal inhalation (NI) on neuropathic pain induced by chronic constriction injury (CCI) to the sciatic nerve in a rat model. CCI rats (n = 12) were equally randomized to four groups based on the treatments received as follows: 100 μL of 0.9% normal saline via NI (NS/NI group); 100 μg of butorphanol plus 1 mg of ketamine via NI (B + K/NI group); 100 μg of butorphanol alone via NI (B/NI group); and 100 μg of butorphanol plus 1 mg of ketamine via subcutaneous injection (B + K/SC group). Mechanical pain threshold was measured at 10 min, 30 min, 2 h, 4 h, and 6 h after drug administration. The mechanical pain threshold in the B + K/NI group was improved significantly 4 h after drug administration as compared with that in the B/NI or B + K/SC group (P ketamine quickly elevates the mechanical pain threshold in a rat neuropathic pain model induced by CCI to the sciatic nerve. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. On transition from diffuse mode to the constricted one with high-current cathode spot in overvoltage open discharge in D2

    Science.gov (United States)

    Akishev, Yu S.; Karalnik, V. B.; Medvedev, M. A.; Petryakov, A. V.; Trushkin, N. I.; Shafikov, A. G.

    2017-11-01

    So called “open discharges” in a narrow gap between the solid cathode and grid anode are widely used for generation of the pulsed high-current electron beams with energy up to 100 keV. The need to get high-energy e-beams leads to the necessity in using of strong overvoltage of the short gas gap with the reduced electric field of the order of 105 Td or higher. The discharge under strong overvoltage is unstable and tends to transit into high-current regime with low voltage. In the case of the open discharge in D2 at low pressure (about 0.5-2 Torr) and powered by stepwise voltage with amplitude up to 25 kV we revealed that this discharge exhibits two diffuse regimes which follow one by one and finally transits into the constricted mode with formation of high-current spots on the cathode. The physical properties of these gas discharge regimes have been explored in detail with the usage of the fast multi-frame camera synchronized with the current and voltage of discharge. Our findings promote more insight into physics of the overvoltage open discharge generating the e-beams with energy up to 25 keV.

  3. A censura e o uso dos prazeres: comunicação sob constrição Censorship and the use of pleasures: communication under constriction

    Directory of Open Access Journals (Sweden)

    Mayra Rodrigues Gomes

    2008-11-01

    Full Text Available O presente artigo traz reflexões sobre os resultados parciais do trabalho de pesquisa desenvolvido em relação às expressões censuradas em peças teatrais, a partir do arquivo Miroel Silveira, que contém os processos de censura ao teatro, de 1925 a 1968. No presente estágio da pesquisa, foi possível constatar que a censura privilegiou termos relacionados à condução do corpo — exposição, gestos, trajes, sexualidade —, de um ponto de vista moral. Tornou-se necessário, portanto, um esforço para abarcar motivos e implicações desse tipo de intervenção, esforço aqui apresentado. Censorship and the use of pleasures: communication under constriction — This paper ponders upon the partial results of a research work concerning censored expressions in stage plays, based on the Miroel Silveira Archives, which contain the theater censorship processes dating from 1925 to 1968. At this point in our investigation, we have found that censorship concentrated on expressions relating to body postures — exposure, gestures, costumes, sexuality —, in short, a moral point of view. This finding led to an endeavor to understand the motives and implications of this kind of intervention, an undertaking that is presented herein.

  4. Tramadol reduces anxiety-related and depression-associated behaviors presumably induced by pain in the chronic constriction injury model of neuropathic pain in rats.

    Science.gov (United States)

    Caspani, Ombretta; Reitz, Marie-Céline; Ceci, Angelo; Kremer, Andreas; Treede, Rolf-Detlef

    2014-09-01

    Depression and anxiety are common comorbidities of neuropathic pain (NP). Pharmacological preclinical studies on NP have given abundant information on the effects of drugs on reflex measures of stimulus-evoked pain. However, few preclinical studies focus on relief of comorbidities evoked by NP. In this study, we investigated the effects of tramadol on nociceptive reflex, depression-associated and anxiety-related behaviors in a NP model in rats. We used chronic constriction injury (CCI) of the sciatic nerve as an animal model of neuropathic pain. We performed electronic von Frey tests (evF) to measure mechanical sensitivity, elevated plus maze tests (EPM) to record anxiety-related behaviors and forced swimming tests (FST) to evaluate depression-associated behaviors. In the evF, CCI rats showed a decrease of 82% of the paw withdrawal threshold (PWT) compared to sham (Ppain and its indirect consequences and comorbidities, and that this study also is a model for pharmacological studies seeking to investigate the effect of drugs on the major disabling symptoms of NP. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Concentration-Effect Relationship of Intrapritoneal Administration of 1, 25 (OH 2-Vitamin D in a Chronic Constriction Model of Neuropathic Pain

    Directory of Open Access Journals (Sweden)

    Farinaz Nasirinezhad

    2011-04-01

    Full Text Available Introduction:  Results: These findings revealed the exaggerated responses in the group which received CCI. The group which was treated by 1 μg/kg of 1,25 vit D3 showed a significant reduction in pain behavior. Injection of 1,25 vit D3 did not change the response of animals to the acetone drop and von frey filament. Discussion: Our results showed that antinoceptive effect of 1,25 vit D3 in a rodent neuropathic pain model is dose dependent and this vitamin may provide new approach for treatment of chronic pain.The presence of nuclear receptors of 1,25 dihydroxy vitamin D3 (1,25 vit D3, the biologically active metabolite of vitamin D, in neurons and glial cells indicates the biological effect of this vitamin in the nervous system. The present experiment was conducted to identify the effects of different doses of 1,25 vit D3 on mechanical and cold allodynia in rodent model of neuropatinc pain. Methods: A mononeuropathy was produced by chronic constrictive injury (CCI of the sciatic nerve. 1,25 vit D3 (0.3, 0.6 ,1 μg/Kg was administered by an i.p. injection every 2 days during a month after CCI. Mechanical and cold allodynia were evaluated by Von frey filament and acetone respectively.

  6. Limb malformations with associated congenital constriction rings in two unrelated Egyptian males, one with a disorganization-like spectrum and the other with a probable distinct type of septo-optic dysplasia.

    Science.gov (United States)

    Temtamy, Samia A; Aglan, Mona S; Ashour, Adel M; El-Badry, Tarek H

    2010-01-01

    In this report, we describe two unrelated Egyptian male infants with limb malformations and constriction rings. The first case is developing normally but has severe limb anomalies, congenital constriction rings, scoliosis because of vertebral anomalies, a left accessory nipple, a small tumor-like swelling on his lower back with tiny skin tubular appendages, a hypoplastic scrotum, and an anchored penis. The second case is developmentally delayed with limb malformations, congenital constriction rings, a lumbar myelomeningeocele, hemangioma, and tiny tubular skin appendages on the back. The patient also had bilateral optic atrophy. The constellation of features in our patients cannot be fully explained by the amniotic disruption complex. The first patient may represent an additional case of the human homolog of the mouse disorganization mutant. The presence of bilateral optic atrophy in the second case, although without an absent septum pellucidum nor other brain anomalies resembles the infrequently reported disorder of septo-optic dysplasia with limb anomalies. Both cases were sporadic and could be caused by a new dominant mutation because of the high paternal age of case 1 and the history of paternal occupational exposure to heat for both fathers. We draw attention to the phenotypic overlap between the disorganization-like syndrome and septo-optic dysplasia with limb anomalies.

  7. Identification of saline water intrusion in part of Cauvery deltaic region, Tamil Nadu, Southern India: using GIS and VES methods

    Science.gov (United States)

    Gnanachandrasamy, G.; Ramkumar, T.; Venkatramanan, S.; Chung, S. Y.; Vasudevan, S.

    2016-06-01

    We use electrical resistivity data arrayed in a 2715 km2 region with 30 locations to identify the saline water intrusion zone in part of Cauvery deltaic region, offshore Eastern India. From this dataset we are able to derive information on groundwater quality, thickness of aquifer zone, structural and stratigraphic conditions relevant to groundwater conditions, and permeability of aquifer systems. A total of 30 vertical electrode soundings (VES) were carried out by Schlumberger electrode arrangement to indicate complete lithology of this region using curve matching techniques. The electrical soundings exhibited that H and HK type curves were suitable for 16 shallow locations, and QH, KQ, K, KH, QQ, and HA curves were fit for other location. Low resistivity values suggested that saline water intrusion occurred in this region. According to final GIS map, most of the region was severely affected by seawater intrusion due to the use of over-exploitation of groundwater.The deteriorated groundwater resources in this coastal region should raise environmental and health concerns.

  8. Vitamin B complex attenuated heat hyperalgesia following infraorbital nerve constriction in rats and reduced capsaicin in vivo and in vitro effects.

    Science.gov (United States)

    Kopruszinski, Caroline M; Reis, Renata C; Bressan, Elisangela; Reeh, Peter W; Chichorro, Juliana G

    2015-09-05

    Vitamins of the B complex attenuate some neuropathic pain sensory aspects in various animal models and in patients, but the mechanisms underlying their effects remain to be elucidated. Herein it was investigated if the treatment with a vitamin B complex (VBC) reduces heat hyperalgesia in rats submitted to infraorbital nerve constriction and the possibility that TRPV1 receptors represent a target for B vitamins. In the present study, the VBC refers to a combination of vitamins B1, B6 and B12 at low- (18, 18 and 1.8mg/kg, respectively) or high- (180, 180 and 18mg/kg, respectively) doses. Acute treatment of rats with either the low- or the high-doses combination reduced heat hyperalgesia after nerve injury, but the high-doses combination resulted in a long-lasting effect. Repeated treatment with the low-dose combination reduced heat hyperalgesia on day four after nerve injury and showed a synergist effect with a single injection of carbamazepine (3 or 10mg/kg), which per se failed to modify the heat threshold. In naïve rats, acute treatment with the high-dose of VBC or B1 and B12 vitamins independently reduced heat hyperalgesia evoked by capsaicin (3µg into the upper lip). Moreover, the VBC, as well as, each one of the B vitamins independently reduced the capsaicin-induced calcium responses in HEK 293 cells transiently transfected with the human TRPV1 channels. Altogether, these results indicate that B vitamins can be useful to control heat hyperalgesia associated with trigeminal neuropathic pain and that modulation of TRPV1 receptors may contribute to their anti-hyperalgesic effects. Copyright © 2015. Published by Elsevier B.V.

  9. Depression-like behavior and mechanical allodynia are reduced by bis selenide treatment in mice with chronic constriction injury: a comparison with fluoxetine, amitriptyline, and bupropion.

    Science.gov (United States)

    Jesse, Cristiano R; Wilhelm, Ethel A; Nogueira, Cristina W

    2010-12-01

    Neuropathic pain is associated with significant co-morbidities, including depression, which impact considerably on the overall patient experience. Pain co-morbidity symptoms are rarely assessed in animal models of neuropathic pain. Neuropathic pain is characterized by hyperexcitability within nociceptive pathways and remains difficult to treat with standard analgesics. The present study determined the effect of bis selenide and conventional antidepressants (fluoxetine, amitriptyline, and bupropion) on neuropathic pain using mechanical allodynic and on depressive-like behavior. Male mice were subjected to chronic constriction injury (CCI) or sham surgery and were assessed on day 14 after operation. Mice received oral treatment with bis selenide (1-5 mg/kg), fluoxetine, amitriptyline, or bupropion (10-30 mg/kg). The response frequency to mechanical allodynia in mice was measured with von Frey hairs. Mice were evaluated in the forced swimming test (FST) test for depression-like behavior. The CCI procedure produced mechanical allodynia and increased depressive-like behavior in the FST. All of the drugs produced antiallodynic effects in CCI mice and produced antidepressant effects in control mice without altering locomotor activity. In CCI animals, however, only the amitriptyline and bis selenide treatments significantly reduced immobility in the FST. These data demonstrate an important dissociation between the antiallodynic and antidepressant effects in mice when tested in a model of neuropathic pain. Depressive behavior in CCI mice was reversed by bis selenide and amitriptyline but not by the conventional antidepressants fluoxetine and buproprion. Bis selenide was more potent than the other drugs tested for antidepressant-like and antiallodynic effects in mice.

  10. Statin therapy exacerbates alcohol-induced constriction of cerebral arteries via modulation of ethanol-induced BK channel inhibition in vascular smooth muscle.

    Science.gov (United States)

    Simakova, Maria N; Bisen, Shivantika; Dopico, Alex M; Bukiya, Anna N

    2017-12-01

    Statins constitute the most commonly prescribed drugs to decrease cholesterol (CLR). CLR is an important modulator of alcohol-induced cerebral artery constriction (AICAC). Using rats on a high CLR diet (2% CLR) we set to determine whether atorvastatin administration (10mg/kg daily for 18-23weeks) modified AICAC. Middle cerebral arteries were pressurized in vitro at 60mmHg and AICAC was evoked by 50mM ethanol, that is within the range of blood alcohol detected in humans following moderate-to-heavy drinking. AICAC was evident in high CLR+atorvastatin group but not in high CLR diet+placebo. Statin exacerbation of AICAC persisted in de-endothelialized arteries, and was blunted by CLR enrichment in vitro. Fluorescence imaging of filipin-stained arteries showed that atorvastatin decreased vascular smooth muscle (VSM) CLR when compared to placebo, this difference being reduced by CLR enrichment in vitro. Voltage- and calcium-gated potassium channels of large conductance (BK) are known VSM targets of ethanol, with their beta1 subunit being necessary for ethanol-induced channel inhibition and resulting AICAC. Ethanol-induced BK inhibition in excised membrane patches from freshly isolated myocytes was exacerbated in the high CLR diet+atorvastatin group when compared to high CLR diet+placebo. Unexpectedly, atorvastatin decreased the amount and function of BK beta1 subunit as documented by immunofluorescence imaging and functional patch-clamp studies. Atorvastatin exacerbation of ethanol-induced BK inhibition disappeared upon artery CLR enrichment in vitro. Our study demonstrates for the first time statin's ability to exacerbate the vascular effect of a widely consumed drug of abuse, this exacerbation being driven by statin modulation of ethanol-induced BK channel inhibition in the VSM via CLR-mediated mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A New Animal Model for Investigation of Mechanical Unloading in Hypertrophic and Failing Hearts: Combination of Transverse Aortic Constriction and Heterotopic Heart Transplantation.

    Directory of Open Access Journals (Sweden)

    Andreas Schaefer

    Full Text Available Previous small animal models for simulation of mechanical unloading are solely performed in healthy or infarcted hearts, not representing the pathophysiology of hypertrophic and dilated hearts emerging in heart failure patients. In this article, we present a new and economic small animal model to investigate mechanical unloading in hypertrophic and failing hearts: the combination of transverse aortic constriction (TAC and heterotopic heart transplantation (hHTx in rats.To induce cardiac hypertrophy and failure in rat hearts, three-week old rats underwent TAC procedure. Three and six weeks after TAC, hHTx with hypertrophic and failing hearts in Lewis rats was performed to induce mechanical unloading. After 14 days of mechanical unloading animals were euthanatized and grafts were explanted for further investigations.50 TAC procedures were performed with a survival of 92% (46/50. When compared to healthy rats left ventricular surface decreased to 5.8±1.0 mm² (vs. 9.6± 2.4 mm² (p = 0.001 after three weeks with a fractional shortening (FS of 23.7± 4.3% vs. 28.2± 1.5% (p = 0.01. Six weeks later, systolic function decreased to 17.1± 3.2% vs. 28.2± 1.5% (p = 0.0001 and left ventricular inner surface increased to 19.9±1.1 mm² (p = 0.0001. Intraoperative graft survival during hHTx was 80% with 46 performed procedures (37/46. All transplanted organs survived two weeks of mechanical unloading.Combination of TAC and hHTx in rats offers an economic and reproducible small animal model enabling serial examination of mechanical unloading in a truly hypertrophic and failing heart, representing the typical pressure overloaded and dilated LV, occurring in patients with moderate to severe heart failure.

  12. Dexmedetomidine attenuates neuropathic pain in chronic constriction injury by suppressing NR2B, NF-κB, and iNOS activation

    Directory of Open Access Journals (Sweden)

    Feng Liang

    2017-05-01

    Full Text Available The effective treatment of patients suffering from neuropathic pain remains challenging. Dexmedetomidine (DEX possesses anti-inflammatory activity. However, the role of DEX in neuropathic pain is still unclear. The aim of the present study was to examine DEX an α2-adrenoceptor agonist could improve pain hypersensitivity and reduce inflammatory in a chronic constriction injury (CCI model of the sciatic nerve in Sprague-Dawley rats. Dex was intrathecally administrated 1-h after operation. The paw mechanical withdrawal threshold (MWT and paw withdrawal thermal latency (PWTL were measured on day 1 before operation and on days 1, 7, 14 and 21 after operation, respectively. On day 21, all the rats were decapitated to collect the L4-6 segments of the spinal cord to examine IL-1, TNF-α, IL-6, NR2B, NF-κB, and iNOS mRNA levels using RT-PCR. The postoperative MWT and PWTL were significantly decreased in CCI, and DEX groups as compared to those before surgery and Sham group (P < 0.05. And DEX reversed this trend (P < 0.05. Interleukin 1 (IL-1, tumor necrosis factor α (TNF-α, IL-6 mRNA expression significantly increased postsurgery in CCI group as compared to that of Sham group (P < 0.05; DEX blocked increased IL-1, TNF-α, IL-6, N-methyl-D-aspartate (NMDA receptor 2B (NR2B, nuclear factor κB (NF-κB, and inducible isoform of nitric oxide synthase (iNOS mRNA levels (P < 0.05. DEX may alleviate neuropathic hypersensitivity and inflammation partially by inhibiting NR2B, NF-κB, and iNOS expression in the spinal cord of rats with neuropathic pain resulting from CCI of the sciatic nerve.

  13. Roles for both FtsA and the FtsBLQ subcomplex in FtsN-stimulated cell constriction in Escherichia coli.

    Science.gov (United States)

    Liu, Bing; Persons, Logan; Lee, Lynda; de Boer, Piet A J

    2015-03-01

    Escherichia coli FtsN is a bitopic membrane protein that is essential for triggering active cell constriction. A small periplasmic subdomain ((E) FtsN) is required and sufficient for function, but its mechanism of action is unclear. We isolated extragenic (E) FtsN*-suppressing mutations that restore division in cells producing otherwise non-functional variants of FtsN. These mapped to the IC domain of FtsA in the cytoplasm and to small subdomains of the FtsB and FtsL proteins in the periplasm. All FtsB and FtsL variants allowed survival without (E) FtsN, but many then imposed a new requirement for interaction between the cytoplasmic domain of FtsN ((N) FtsN) and FtsA. Alternatively, variants of FtsA, FtsB or FtsL acted synergistically to allow cell division in the complete absence of FtsN. Strikingly, moreover, substitution of a single residue in FtsB (E56) proved sufficient to rescue ΔftsN cells as well. In FtsN(+) cells, (E) FtsN*-suppressing mutations promoted cell fission at an abnormally small cell size, and caused cell shape and integrity defects under certain conditions. This and additional evidence support a model in which FtsN acts on either side of the membrane to induce a conformational switch in both FtsA and the FtsBLQ subcomplex to de-repress septal peptidoglycan synthesis and membrane invagination. © 2014 John Wiley & Sons Ltd.

  14. Minocycline through attenuation of oxidative stress and inflammatory response reduces the neuropathic pain in a rat model of chronic constriction injury

    Directory of Open Access Journals (Sweden)

    Abolfazl Abbaszadeh

    2018-02-01

    Full Text Available Objective(s: Several lines of evidence showed that minocycline possesses antioxidant and anti-inflammatory properties. This study aimed to demonstrate the effects of minocycline in rats subjected to chronic constriction injury (CCI. Materials and Methods: In this study four groups (n = 6–8 of rats were used as follows: Sham, CCI, CCI + minocycline (MIN 10 mg/Kg (IP and CCI + MIN 30 mg/Kg (IP. On days 3, 7, 14, and 21 post-surgery hot-plate, acetone, and von Frey tests were carried out. Finally, Motor Nerve Conduction Velocity Evaluation (MNCV assessment was performed and spinal cords were harvested in order to measure tissue concentrations of TNF_α, IL-1β, Glutathione peroxidase (GPx, Superoxide dismutase (SOD and Malondialdehyde (MDA. Extent of perineural inflammation and damage around the sciatic nerve was histopathologically evaluated. Results: Our results demonstrated that CCI significantly caused hyperalgesia and allodynia twenty-one days after CCI. MIN attenuated heat hyperalgesia, cold and mechanical allodynia and MNCV in animals. MIN also decreased the levels of TNF_α and IL-1β. Antioxidative enzymes (SOD, MDA, and GPx were restored following MIN treatment. Our findings showed that MIN decreased perineural inflammation around the sciatic nerve. According to the results, the neuropathic pain reduced in the CCI hyperalgesia model using 30 mg/kg of minocycline. Conclusion: It is suggested that antinociceptive effects of minocycline might be mediated through the inhibition of inflammatory response and attenuation of oxidative stress.

  15. Branes constrictions with White Dwarfs

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Aspeitia, Miguel A. [Consejo Nacional de Ciencia y Tecnologia, Mexico (Mexico); Unidad Academica de Fisica, Universidad Autonoma de Zacatecas (Mexico)

    2015-11-15

    We consider here a robust study of stellar dynamics for white dwarf stars with polytropic matter in the weak-field approximation using the Lane-Emden equation from the brane-world scenario. We also derive an analytical solution to the nonlocal energy density and show the behavior and sensitivity of these stars to the presence of extra dimensions. Similarly, we analyze stability and compactness, in order to show whether it is possible to agree with the conventional wisdom of white dwarfs dynamics. Our results predict an average value of the brane tension of left angle λ right angle >or similar 84.818 MeV{sup 4}, with a standard deviation σ ≅ 82.021 MeV{sup 4}, which comes from a sample of dwarf stars, being weaker than other astrophysical observations but remaining higher than cosmological results provided by nucleosynthesis among others. (orig.)

  16. Branes constrictions with White Dwarfs

    Energy Technology Data Exchange (ETDEWEB)

    García-Aspeitia, Miguel A., E-mail: aspeitia@fisica.uaz.edu.mx [Consejo Nacional de Ciencia y Tecnología, Av, Insurgentes Sur 1582, Colonia Crédito Constructor, Del. Benito Juárez, C.P. 03940, Mexico, D.F. (Mexico); Unidad Académica de Física, Universidad Autónoma de Zacatecas, Calzada Solidaridad esquina con Paseo a la Bufa S/N, C.P. 98060, Zacatecas (Mexico)

    2015-11-06

    We consider here a robust study of stellar dynamics for white dwarf stars with polytropic matter in the weak-field approximation using the Lane–Emden equation from the brane-world scenario. We also derive an analytical solution to the nonlocal energy density and show the behavior and sensitivity of these stars to the presence of extra dimensions. Similarly, we analyze stability and compactness, in order to show whether it is possible to agree with the conventional wisdom of white dwarfs dynamics. Our results predict an average value of the brane tension of <λ>≳84.818 MeV{sup 4}, with a standard deviation σ≃82.021 MeV{sup 4}, which comes from a sample of dwarf stars, being weaker than other astrophysical observations but remaining higher than cosmological results provided by nucleosynthesis among others.

  17. Branes constrictions with White Dwarfs

    International Nuclear Information System (INIS)

    García-Aspeitia, Miguel A.

    2015-01-01

    We consider here a robust study of stellar dynamics for white dwarf stars with polytropic matter in the weak-field approximation using the Lane–Emden equation from the brane-world scenario. We also derive an analytical solution to the nonlocal energy density and show the behavior and sensitivity of these stars to the presence of extra dimensions. Similarly, we analyze stability and compactness, in order to show whether it is possible to agree with the conventional wisdom of white dwarfs dynamics. Our results predict an average value of the brane tension of <λ>≳84.818 MeV 4 , with a standard deviation σ≃82.021 MeV 4 , which comes from a sample of dwarf stars, being weaker than other astrophysical observations but remaining higher than cosmological results provided by nucleosynthesis among others

  18. Aloperine attenuated neuropathic pain induced by chronic constriction injury via anti-oxidation activity and suppression of the nuclear factor kappa B pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ya-Qiong [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Jin, Shao-Ju [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Luohe Medical College, Luohe 462002, Henan Province (China); Liu, Ning [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Li, Yu-Xiang [College of Nursing, Ningxia Medical University, Yinchuan 750004 (China); Zheng, Jie [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Ma, Lin [Ningxia Key Lab of Craniocerebral Diseases of Ningxia Hui Autonomous Region, Ningxia Medical University, Yinchuan 750004 (China); Du, Juan; Zhou, Ru [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Zhao, Cheng-Jun [Key Laboratory of Fertility Preservation and Maintenance of Ministry of Education, Ningxia Medical University, Yinchuan 750000 (China); Niu, Yang [Key Laboratory of Hui Ethnic Medicine Modernization, Ministry of Education, Ningxia Medical University, Yinchuan 750004 (China); Sun, Tao [Ningxia Key Lab of Craniocerebral Diseases of Ningxia Hui Autonomous Region, Ningxia Medical University, Yinchuan 750004 (China); Yu, Jian-Qiang, E-mail: Yujq910315@163.com [Department of Pharmacology, Ningxia Medical university, Yinchuan 750000 (China); Luohe Medical College, Luohe 462002, Henan Province (China)

    2014-09-05

    Highlights: • Aloperine has anti-nociceptive effects on neuropathic pain induced CCI. • Aloperine reduces ROS in neuropathic pain mice. • Aloperine down-regulates the expression of NF-κB and its downstream pro-inflammatory cytokines in neuropathic pain mice. - Abstract: Objective: To investigate whether aloperine (ALO) has antinociceptive effects on neuropathic pain induced by chronic constriction injury, whether ALO reduces ROS against neuropathic pain, and what are the mechanisms involved in ALO attenuated neuropathic pain. Methods: Mechanical and cold allodynia, thermal and mechanical hyperalgesia and spinal thermal hyperalgesia were estimated by behavior methods such as Von Frey filaments, cold-plate, radiant heat, paw pressure and tail immersion on one day before surgery and days 7, 8, 10, 12 and 14 after surgery, respectively. In addition, T-AOC, GSH-PX, T-AOC and MDA in the spinal cord (L4/5) were measured to evaluate anti-oxidation activity of ALO on neuropathic pain. Expressions of NF-κB and pro-inflammatory cytokines (TNF-α, IL-6, IL-1β) in the spinal cord (L4/5) were analyzed by using Western blot. Results: Administration of ALO (80 mg/kg and 40 mg/kg, i.p.) significantly increased paw withdrawal threshold, paw pressure, paw withdrawal latencies, tail-curling latencies, T-AOC, GSH-PX and T-SOD concentration, reduced the numbers of paw lifts and MDA concentration compared to CCI group. ALO attenuated CCI induced up-regulation of expressions of NF-κB, TNF-α, IL-6, IL-1β at the dose of 80 mg/kg (i.p.). Pregabalin produced similar effects serving as positive control at the dose of 10 mg/kg (i.p.). Conclusion: ALO has antinociceptive effects on neuropathic pain induced by CCI. The antinociceptive effects of ALO against neuropathic pain is related to reduction of ROS, via suppression of NF-κB pathway.

  19. Aloperine attenuated neuropathic pain induced by chronic constriction injury via anti-oxidation activity and suppression of the nuclear factor kappa B pathway

    International Nuclear Information System (INIS)

    Xu, Ya-Qiong; Jin, Shao-Ju; Liu, Ning; Li, Yu-Xiang; Zheng, Jie; Ma, Lin; Du, Juan; Zhou, Ru; Zhao, Cheng-Jun; Niu, Yang; Sun, Tao; Yu, Jian-Qiang

    2014-01-01

    Highlights: • Aloperine has anti-nociceptive effects on neuropathic pain induced CCI. • Aloperine reduces ROS in neuropathic pain mice. • Aloperine down-regulates the expression of NF-κB and its downstream pro-inflammatory cytokines in neuropathic pain mice. - Abstract: Objective: To investigate whether aloperine (ALO) has antinociceptive effects on neuropathic pain induced by chronic constriction injury, whether ALO reduces ROS against neuropathic pain, and what are the mechanisms involved in ALO attenuated neuropathic pain. Methods: Mechanical and cold allodynia, thermal and mechanical hyperalgesia and spinal thermal hyperalgesia were estimated by behavior methods such as Von Frey filaments, cold-plate, radiant heat, paw pressure and tail immersion on one day before surgery and days 7, 8, 10, 12 and 14 after surgery, respectively. In addition, T-AOC, GSH-PX, T-AOC and MDA in the spinal cord (L4/5) were measured to evaluate anti-oxidation activity of ALO on neuropathic pain. Expressions of NF-κB and pro-inflammatory cytokines (TNF-α, IL-6, IL-1β) in the spinal cord (L4/5) were analyzed by using Western blot. Results: Administration of ALO (80 mg/kg and 40 mg/kg, i.p.) significantly increased paw withdrawal threshold, paw pressure, paw withdrawal latencies, tail-curling latencies, T-AOC, GSH-PX and T-SOD concentration, reduced the numbers of paw lifts and MDA concentration compared to CCI group. ALO attenuated CCI induced up-regulation of expressions of NF-κB, TNF-α, IL-6, IL-1β at the dose of 80 mg/kg (i.p.). Pregabalin produced similar effects serving as positive control at the dose of 10 mg/kg (i.p.). Conclusion: ALO has antinociceptive effects on neuropathic pain induced by CCI. The antinociceptive effects of ALO against neuropathic pain is related to reduction of ROS, via suppression of NF-κB pathway

  20. βIII Spectrin Is Necessary for Formation of the Constricted Neck of Dendritic Spines and Regulation of Synaptic Activity in Neurons.

    Science.gov (United States)

    Efimova, Nadia; Korobova, Farida; Stankewich, Michael C; Moberly, Andrew H; Stolz, Donna B; Wang, Junling; Kashina, Anna; Ma, Minghong; Svitkina, Tatyana

    2017-07-05

    Dendritic spines are postsynaptic structures in neurons often having a mushroom-like shape. Physiological significance and cytoskeletal mechanisms that maintain this shape are poorly understood. The spectrin-based membrane skeleton maintains the biconcave shape of erythrocytes, but whether spectrins also determine the shape of nonerythroid cells is less clear. We show that βIII spectrin in hippocampal and cortical neurons from rodent embryos of both sexes is distributed throughout the somatodendritic compartment but is particularly enriched in the neck and base of dendritic spines and largely absent from spine heads. Electron microscopy revealed that βIII spectrin forms a detergent-resistant cytoskeletal network at these sites. Knockdown of βIII spectrin results in a significant decrease in the density of dendritic spines. Surprisingly, the density of presynaptic terminals is not affected by βIII spectrin knockdown. However, instead of making normal spiny synapses, the presynaptic structures in βIII spectrin-depleted neurons make shaft synapses that exhibit increased amplitudes of miniature EPSCs indicative of excessive postsynaptic excitation. Thus, βIII spectrin is necessary for formation of the constricted shape of the spine neck, which in turn controls communication between the synapse and the parent dendrite to prevent excessive excitation. Notably, mutations of SPTNB2 encoding βIII spectrin are associated with neurodegenerative syndromes, spinocerebellar ataxia Type 5, and spectrin-associated autosomal recessive cerebellar ataxia Type 1, but molecular mechanisms linking βIII spectrin functions to neuronal pathologies remain unresolved. Our data suggest that spinocerebellar ataxia Type 5 and spectrin-associated autosomal recessive cerebellar ataxia Type 1 pathology likely arises from poorly controlled synaptic activity that leads to excitotoxicity and neurodegeneration. SIGNIFICANCE STATEMENT Dendritic spines are small protrusions from neuronal

  1. Optical inactivation of the anterior cingulate cortex modulate descending pain pathway in a rat model of trigeminal neuropathic pain created via chronic constriction injury of the infraorbital nerve

    Directory of Open Access Journals (Sweden)

    Moon HC

    2017-10-01

    Full Text Available Hyeong Cheol Moon,1 Won Ik Heo,2 Yon Ji Kim,3 Daae Lee,4 So Yoon Won,5 Hong Rae Kim,1 Seung Man Ha,1 Youn Joo Lee,6 Young Seok Park1 1Department of Medical Neuroscience and Neurosurgery, College of Medicine, 2Department of Veterinary, College of Veterinary Medicine, 3Department of Biology, College of Natural Sciences, 4Department of Advanced Material Engineering, College of Engineering, 5Biochemistry and Medical Research Center, Chungbuk National University, Cheongju, 6Department of Radiology, Daejoen St. Mary’s Hospital, The Catholic University of Korea, Seoul, Republic of Korea Purpose: The anterior cingulate cortex (ACC plays a critical role in the initiation, development, and maintenance of neuropathic pain. Recently, the effects of optical stimulation on pain have been investigated, but the therapeutic effects of optical stimulation on trigeminal neuralgia (TN have not been clearly shown. Here, we investigated the effects of optical inhibition of the ACC on TN lesions to determine whether the alleviation of pain affects behavior performance and thalamic neuron signaling.Materials and methods: TN lesions were established in animals by generating a chronic constriction injury of the infraorbital nerve, and the animals received injections of AAV-hSyn-eNpHR3.0-EYFP or a vehicle (phosphate-buffered saline [PBS] in the ACC. The optical fiber was fixed into the ipsilateral ACC after the injection of adeno-associated virus plasmids or vehicle. Behavioral testing, consisting of responses to an air puff and cold allodynia, was performed, and thalamic neuronal activity was monitored following optical stimulation in vivo. Optical stimulation experiments were executed in three steps: during pre-light-off, stimulation-light-on, and post-light-off states. The role of the optical modulation of the ACC in response to pain was shown using a combination of optical stimulation and electrophysiological recordings in vivo.Results: Mechanical thresholds and

  2. Focal ischaemia caused by instability of cerebrovascular tone during attacks of hemiplegic migraine. A regional cerebral blood flow study

    DEFF Research Database (Denmark)

    Friberg, L; Olsen, T S; Roland, P E

    1987-01-01

    During the course of hemiplegic migraine in 3 patients, changes in regional cerebral blood flow (rCBF) were recorded by the intracarotid 133Xe method and a 254 multidetector camera covering one hemisphere. The rCBF measurements were performed in conjunction with cerebral angiography. During...... the patients developed transient motor and/or sensory deficits and subsequently severe headache. No signs of arterial occlusion were found. In the over and underperfused regions blood flow fluctuated rapidly because of instability of cerebrovascular tone, defined as transient constriction of the smallest...

  3. Effects of uterine cervix constriction on Wistar rats Efeitos da constrição do cérvix uterino em ratos Wistar

    Directory of Open Access Journals (Sweden)

    Cassio Eduardo Raposo-Amaral

    2010-12-01

    Full Text Available PURPOSE: To verify if uterine cerclage can induce craniosynostosis or any cranial deformity in new born Wistar rats. METHODS: One pregnant female Wistar rat underwent laparotomy on day 18 of gestation and the uterus cervix was closed with a 3-0 nylon suture to avoid delivery, that occurs normally on the 21 day. The suture was released after 48 hours beyond the normal gestation period. The female rat delivered 11 pups. Six surviving rats from the delivery (group A - constrained group. Two rats were born from another mother and in the same age were used as control group (group B - 2 nonconstrained controls were allowed to grow. They were sacrificed 1.2 years after their birth all the eight animals. Linear measurement, routine histology and computed tomography of the skull were performed at the time of their death to evaluate the cranial asymmetries by mesurements of the anatomical landmarks of the craniofacial skeleton of the rats on the two groups and compared then. RESULTS: We did not observe statistically significant differences in any of the compared measurements (p>0.05 obtained through the morphologic and radiologic methods. Histologic examinations did not reveal any sign of premature fusion or suture imbrications. Critical decrease in longitudinal body size was noticed as the limbs too in all the animals of group A. CONCLUSION: Constriction of uterine cervix leads to fetus suffering, even death for a few animals, associated to small body size, but not to craniosynostosis.OBJETIVO: Verificar se a cerclagem intra-uterina pode induzir, ao nascimento de ratos Wistar, craniossinostose ou qualquer outra deformidade craniana. MÉTODOS: Uma rata Wistar prenhe foi submetida à laparotomia no 18º dia de gestação e o cérvix uterino foi suturado com 3-0 nylon, impedindo o parto normal que normalmente ocorre no 21º dia de gestação. A sutura foi liberada 48 horas após o período gestacional normal. A rata gestante deu à luz 11 animais. Seis

  4. Hemodynamic, pulmonary vascular, and myocardial abnormalities secondary to pharmacologic constriction of the fetal ductus arteriosus. A possible mechanism for persistent pulmonary hypertension and transient tricuspid insufficiency in the newborn infant.

    Science.gov (United States)

    Levin, D L; Mills, L J; Weinberg, A G

    1979-08-01

    The prostaglandin synthetase inhibitor indomethacin was given orally or intravenously to pregnant ewes. This resulted in a significant rise in the fetal pulmonary-to-systemic arterial mean blood pressure difference across the ductus arteriosus, presumably secondary to constriction of the ductus arteriosus. In five experiments the pressure difference could be promptly but temporarily reversed by the administration of prostaglandin E1 (PGE1) into the fetal inferior vena cava. Fetal lungs from study and control animals were fixed by perfusion at measured pulmonary arterial mean blood pressure, and fifth-generation resistance vessels were studied. The medial width/external diameter ratio was significantly increased in the study vs the control lungs due to increased smooth muscle and decreased external diameter. In addition, study fetuses had acute degenerative myocardial changes in the tricuspid valve papillary muscles, the right ventricular free wall and the interventricular septum. Similar changes were not seen in control fetuses. Indomethacin administration during pregnancy causes constriction of the fetal ductus arteriosus, fetal pulmonary arterial hypertension, and right ventricular damage. If severe, this may cause rapid fetal death. If less severe, in the newborn infant, this mechanism may be one cause of persistent pulmonary hypertension due to vasoconstriction and increased pulmonary arterial smooth muscle and/or tricuspid insufficiency due to papillary muscle infarction.

  5. Confinement properties of tokamak plasmas with extended regions of low magnetic shear

    Science.gov (United States)

    Graves, J. P.; Cooper, W. A.; Kleiner, A.; Raghunathan, M.; Neto, E.; Nicolas, T.; Lanthaler, S.; Patten, H.; Pfefferle, D.; Brunetti, D.; Lutjens, H.

    2017-10-01

    Extended regions of low magnetic shear can be advantageous to tokamak plasmas. But the core and edge can be susceptible to non-resonant ideal fluctuations due to the weakened restoring force associated with magnetic field line bending. This contribution shows how saturated non-linear phenomenology, such as 1 / 1 Long Lived Modes, and Edge Harmonic Oscillations associated with QH-modes, can be modelled accurately using the non-linear stability code XTOR, the free boundary 3D equilibrium code VMEC, and non-linear analytic theory. That the equilibrium approach is valid is particularly valuable because it enables advanced particle confinement studies to be undertaken in the ordinarily difficult environment of strongly 3D magnetic fields. The VENUS-LEVIS code exploits the Fourier description of the VMEC equilibrium fields, such that full Lorenzian and guiding centre approximated differential operators in curvilinear angular coordinates can be evaluated analytically. Consequently, the confinement properties of minority ions such as energetic particles and high Z impurities can be calculated accurately over slowing down timescales in experimentally relevant 3D plasmas.

  6. Regions Matter

    DEFF Research Database (Denmark)

    Laursen, Keld; Masciarelli, Francesca; Prencipe, Andrea

    2012-01-01

    capital at the regional level, with a large-scale data set of the innovative activities of a representative sample of 2,413 Italian manufacturing firms from 21 regions, and controlling for a large set of firm and regional characteristics, we find that being located in a region characterized by a high...

  7. Regional development and regional policy

    OpenAIRE

    Šabić, Dejan; Vujadinović, Snežana

    2017-01-01

    Economic polarization is a process that is present at global, national and regional level. Economic activity is extremely spatially concentrated. Cities and developed regions use the agglomeration effect to attract labor and capital, thus achieving more favorable economic conditions than the agrarian region. Scientific research and European experiences over the past decades have contributed to the discrepancy among theorists about the causes and consequences of regional inequalities. Regional...

  8. Structural region

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Structural region. The two groups had 4 substitutions similar to Yawat strain. The Yawat strain had 5 unique mutations. 3 in the E2 region and 2 in the E1 region. The mutation, I702V (E2), though different from all the recent Indian and Reunion sequences was similar ...

  9. Constricted double loop hysteresis and exchange bias attributed to the surface anisotropy in nanocrystalline La1/3Sr2/3Fe1−xCrxO3

    International Nuclear Information System (INIS)

    Sabyasachi, Sk.; Patra, M.; Majumdar, S.; Giri, S.

    2013-01-01

    We investigate magnetic properties of nanocrystalline ferrites with composition La 1/3 Sr 2/3 Fe 1−x Cr x O 3 (LSFCO) for x=0, 0.02, 0.04 and 0.06. Thermal variation of zero field cooled magnetization displays a weak signature close to the charge (T CO ) as well as antiferromagnetic ordering for x=0, 0.02 and 0.04. In addition, another disordered glassy magnetic transition (T g ) is noticed for all the compositions. T g is predominantly observed, although signature of charge ordering almost disappears for x=0.06. Interestingly, a constricted double loop type magnetic hysteresis loop is observed for x=0.02. This structure in the hysteresis loop disappears with further increase in Cr substitution. A systematic shift in the magnetic hysteresis loop is observed for all the compositions, while samples are cooled in a static magnetic field, which is the manifestation of exchange bias (EB) effect. The EB field (H E ) and magnetization (M E ) decrease remarkably due to minor Cr substitution at x=0.02 and then it reveals a sluggish increase with increasing x. For x=0.04 the EB effect emerges below ∼T CO , increases sluggishly with lowering of temperature and below ∼T g , it increases rapidly. The cooling field dependence exhibits significant increase of H E and M E for x=0.04, which is associated with the considerable increase of coercivity. Possible origin of EB correlated with the magnetic phase coexistence has been argued for nanocrystalline LSFCO. - Highlights: • Constricted double loop structure is observed for minor Cr substitution. • Exchange bias decreases significantly due to Cr substitution. • Intricate magnetic phase coexistence leads to the exchange bias effect

  10. Bringing up the rear: new premotor interneurons add regional complexity to a segmentally distributed motor pattern

    Science.gov (United States)

    Norris, Brian J.; Doloc-Mihu, Anca; Calabrese, Ronald L.

    2011-01-01

    Central pattern generators (CPGs) pace and pattern many rhythmic activities. We have uncovered a new module in the heartbeat CPG of leeches that creates a regional difference in this segmentally distributed motor pattern. The core CPG consists of seven identified pairs and one unidentified pair of heart interneurons of which 5 pairs are premotor and inhibit 16 pairs of heart motor neurons. The heartbeat CPG produces a side-to-side asymmetric pattern of activity of the premotor heart interneurons corresponding to an asymmetric fictive motor pattern and an asymmetric constriction pattern of the hearts with regular switches between the two sides. The premotor pattern progresses from rear to front on one side and nearly synchronously on the other; the motor pattern shows corresponding intersegmental coordination, but only from segment 15 forward. In the rearmost segments the fictive motor pattern and the constriction pattern progress from front to rear on both sides and converge in phase. Modeling studies suggested that the known inhibitory inputs to the rearmost heart motor neurons were insufficient to account for this activity. We therefore reexamined the constriction pattern of intact leeches. We also identified electrophysiologically two additional pairs of heart interneurons in the rear. These new heart interneurons make inhibitory connections with the rear heart motor neurons, are coordinated with the core heartbeat CPG, and are dye-coupled to their contralateral homologs. Their strong inhibitory connections with the rearmost heart motor neurons and the small side-to-side phase difference of their bursting contribute to the different motor and beating pattern observed in the animal's rear. PMID:21775711

  11. Regional Externalities

    NARCIS (Netherlands)

    Heijman, W.J.M.

    2007-01-01

    The book offers practical and theoretical insights in regional externalities. Regional externalities are a specific subset of externalities that can be defined as externalities where space plays a dominant role. This class of externalities can be divided into three categories: (1) externalities

  12. AMHARA REGION

    African Journals Online (AJOL)

    This study investigates the contribution of school curriculum committee in facilitating and coordinating ... schools of Amhara Region' ln undertaking the study the descriptive survey method was used. .... pupil and the teacher are available. ... prepared for each level and grade has ..... the principals have the opinion that the.

  13. Atlantic Region

    NARCIS (Netherlands)

    Elands, B.H.M.; Bell, S.; Blok, J.

    2010-01-01

    Chapter 2 explores recreation and tourism practices in forest areas in the Atlantic region, which refers to the geographical area close to the North Sea and the Atlantic Ocean. The Atlantic countries described in this section are Belgium (Flanders and Wallonia), Denmark, Iceland, Ireland, the

  14. Comparison of a Commonwealth-initiated regional radiation oncology facility in Toowoomba with a Queensland Health facility

    International Nuclear Information System (INIS)

    Poulsen, M.; Ramsay, R.; Gogna, K.; Middleton, M.; Martin, J.; Khoo, E.; Wong, W.; McQuitty, S.; Walpole, E.; Fairweather, R.

    2010-01-01

    The aim was to compare a private Commonwealth-initiated regional radiation oncology facility in Toowoomba with a Queensland Health facility (QHF) in Brisbane. The comparison concentrated on staffing, case mix and operational budgets, but was not able to look at changes in access to services. Data were collected from the two facilities from January 2008 to June 2008 inclusive. A number of factors were compared, including case mix, staffing levels, delay times for treatment, research, training and treatment costs. The case mix between the two areas was similar with curative treatments making up just over half the work load in both centres and two-thirds the work being made up of cancers of breast and prostate. Staffing levels were leaner in Toowoomba, especially in the areas of nursing, administration and trial coordinators. Research activity was slightly higher in Toowoomba. The average medicare cost per treatment course was similar in both centres ($5000 per course). Total costs of an average treatment including patient, State and Commonwealth costs, showed a 30% difference in costing favouring Toowoomba. This regional radiation oncology centre has provided state-of-the-art cancer care that is close to home for patients living in the Darling Downs region. Both public and private patients have been treated with modest costs to the patient and significant savings to QH. The case mix is similar to the QHF, and there has been significant activity in clinical research. A paperless working environment is one factor that has allowed staffing levels to be reduced. Ongoing support from Governments are required if private facilities are to participate in important ongoing staff training.

  15. Interaction region

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The Interaction Region Group addressed the basic questions of how to collide the SLC beams, how to maximize and monitor the luminosity, and how to minimize the detector backgrounds at the interaction region. In practice, five subgroups evolved to study these questions. The final focus group provided three alternative designs to acheive the 1 to 2 micron beam spot size required by the SLC, as well as studying other problems including: eta, eta' matching from the collider arcs, the implementation of soft bends near the interaction region, beam emittance growth, and magnet tolerances in the final focus. The beam position monitor group proposed two devices, a strip line monitor, and a beamstrahlung monitor, to bring the beams into collision. The luminosity monitor group reviewed the possible QED processes that would be insensitive to weak interaction (Z 0 ) effects. The beam dumping group proposed locations for kicker and septum magnets in the final focus that would achieve a high dumping efficiency and would meet the desired beam tolerances at the Moller scattering target in the beam dump line. Working with the Polarization Group, the Moller experiment was designed into the beam dump beam line. A beam dump was proposed that would maintain radiation backgrounds (penetrating muons) at acceptible levels. The detector backgrounds group proposed soft-bend and masking configurations to shield the detector from synchrotron radiation from the hard/soft bends and from the final focus quadrupoles and evaluated the effectiveness of these designs for the three final focus optics designs. Backgrounds were also estimated from: large angle synchrotron radiation, local and distant beam-gas interactions, 2-photon interactions, and from neutrons and backscattered photons from the beamstrahlung dump

  16. Transition region

    International Nuclear Information System (INIS)

    Jordan, C.

    1977-01-01

    The Glossary is designed to be a technical dictionary that will provide solar workers of various specialties, students, other astronomers and theoreticians with concise information on the nature and the properties of phenomena of solar and solar-terrestrial physics. Each term, or group of related terms, is given a concise phenomenological and quantitative description, including the relationship to other phenomena and an interpretation in terms of physical processes. The references are intended to lead the non-specialist reader into the literature. This section deals with: transition region; di-electronic recombination; intersystem or intercombination lines; satellite lines; grazing-incidence optics; and crystal spectrometers. (B.R.H.)

  17. Constricted nanowire with stabilized magnetic domain wall

    International Nuclear Information System (INIS)

    Sbiaa, R.; Al Bahri, M.

    2016-01-01

    Domain wall (DW)-based magnetic memory offers the possibility for increasing the storage capacity. However, stability of DW remains the major drawback of this scheme. In this letter, we propose a stepped nanowire for pinning DW in a desirable position. From micromagnetic simulation, the proposed design applied to in-plane magnetic anisotropy materials shows that by adjusting the nanowire step size and its width it is possible to stabilize DW for a desirable current density range. In contrast, only a movement of DW could be seen for conventional nanowire. An extension to a multi-stepped nanowire could be used for multi-bit per cell magnetic memory. - Highlights: • A stepped nanowire is proposed to pin domain wall in desired position. • The new structure can be made by a simple off set of two single nanowires. • The critical current for moving domain wall from one state to the other could be tuned by adjusting the geometry of the device. • The device could be used for multi-bit per cell memory by extending the steps in the device.

  18. Tracheal Constriction In A Growing Dog

    OpenAIRE

    DeArmond, Christina; Niimura del Barrio, Maria Chie; Rosati, Tomasso; McAllister, Hester; Ryan, John

    2017-01-01

    A six-month-old castrated male German Shepherd/Husky cross was presented for investigation of a progressive dyspnoea and regurgitation. A circumferential cervical wound had been identified and closed following debridement by the primary care veterinarian when the dog was three months old. There was an extraluminal tracheal compression on radiographs. Surgical exploration revealed a plastic band tied and embedded in the dorsal musculature of the neck. The band had been increasingly constrictin...

  19. The stability of a constricted gas discharge

    Energy Technology Data Exchange (ETDEWEB)

    Tayler, R J [U.K. Atomic Energy Authority, AERE, Harwell (United Kingdom)

    1958-07-01

    This paper is to be regarded as a progress report on an unfinished problem and an indication is given of aspects of the problem which, it is hoped, will be studied soon. Two theoretical models are considered here. The first approach is extremely naive: plasma dynamics is completely neglected and only the forces exerted by the electromagnetic field are considered. The second approach is to use Maxwell's equations combined with a simple one-fluid hydrodynamics - classical hydromagnetics. The paper is arranged as follows: the magnetostatic or extensible wire model of the discharge is studied; based on the hydromagnetic equations: 1) the gradual loss of stability of the stabilised pinch, due to field diffusion, is discussed and 2) another type of stable discharge configuration is introduced. In the final section there is a discussion of further problems which must be studied.

  20. Narrowing sex differences in life expectancy: regional variations, 1971-1991

    Directory of Open Access Journals (Sweden)

    Frank Trovato

    2001-12-01

    Full Text Available A number of industrialized nations have recently experienced some degrees of constriction in their long-standing sex differentials in life expectancy at birth. In this study we examine this phenomenon in the context of Canada’s regions between 1971 and 1991: Atlantic (Newfoundland, Nova Scotia, New Brunswick, Prince Edward Island; Quebec, Ontario, and the West (Manitoba, Saskatchewan, Alberta, British Columbia, Yukon and Northwest Territories. Decomposition analysis based on multiple decrement life tables is applied to address three questions: (1 Are there regional differentials in the degree of narrowing in the sex gap in life expectancy? (2 What is the relative contribution of major causes of death to observed sex differences in average length of life within and across regions? (3 How do the contributions of cause-of-death components vary across regions to either widen or narrow the sex gap in survival? It is shown that the magnitude of the sex gap is not uniform across the regions, though the differences are not large. The most important contributors to a narrowing of the sex gap in life expectancy are heart disease and external types of mortality (i.e., accidents, violence, and suicide, followed by lung cancer and other types of chronic conditions. In substantive terms these results indicate that over time men have been making sufficient gains in these causes of death as to narrow some of the gender gap in overall survival. Regions show similarity in these effects.

  1. Controlling DIII-D QH-Mode Particle and Electron Thermal Transport with ECH

    Science.gov (United States)

    Ernst, D. R.; Burrell, K. H.; Rhodes, T. L.; Guttenfelder, W.; McKee, G. R.; Grierson, B. A.; Holland, C.; Dimits, A.; Petty, C. C.; Schmitz, L.; Wang, G.; Zeng, L.; Doyle, E. J.; Austin, M. E.

    2014-10-01

    Quiescent H-mode core particle transport and density peaking are locally controlled by modulated electron cyclotron heating (ECH) at ρ ~ 0 . 2 . Gyrokinetic simulations show density gradient driven trapped electron modes (TEMs) are only unstable in the inner core, where the density profile flattens in response to ECH. Thus α-heating could reduce density peaking, providing burn control. Density fluctuations from Doppler backscattering intensify at TEM wavenumbers kθρs ~ 0 . 8 during ECH, while new quasi-coherent modes are observed with adjacent toroidal mode numbers consistent with TEMs. Separately, ECH at two-deposition locations (r / a ~ ρ = 0 . 5 & 0.7) varied the electron temperature gradient. A jump in ``heat pulse'' diffusivity during the scan indicates a critical gradient was crossed. Work supported by the US DOE under DE-FC02-08ER54966, DE-FC02-04ER54698, DE-FG02-08ER54984, DE-AC02-09CH11466, DE-FG02-89ER53296, DE-FC02-11ER55104, DE-AC52-07NA27344 & DE-FG03-97ER54415.

  2. Pain increases during sympathetic arousal in patients with complex regional pain syndrome.

    Science.gov (United States)

    Drummond, P D; Finch, P M; Skipworth, S; Blockey, P

    2001-10-09

    To investigate the effect of sympathetic arousal on pain and vasomotor responses in healthy control subjects and patients with complex regional pain syndrome (CRPS), and to determine whether pain increases in patients with particular symptoms. In experiments 1 and 2, capsaicin was applied to the forearm of 24 healthy subjects to induce thermal hyperalgesia. Vascular responses were monitored and subjects rated thermal hyperalgesia before and after being startled (experiment 1), and before, during, and after mental arithmetic, breath holding, forehead cooling, the Valsalva maneuver, and a cold pressor test in experiment 2. In a third experiment, sensitivity to heat, cold, and mechanical stimulation was investigated in 61 patients with CRPS. Pain ratings and vascular and electrodermal responses were recorded after patients were startled and during forehead cooling. In experiment 1, thermal hyperalgesia decreased in healthy control subjects after they were startled, and digital blood vessels constricted symmetrically. In experiment 2, thermal hyperalgesia decreased during and after other forms of sympathetic arousal. However, in experiment 3, ratings of clinical pain increased during forehead cooling or after being startled in over 70% of patients with CRPS. Pain increased most consistently during forehead cooling in patients with cold allodynia or punctate allodynia. Digital blood vessels constricted more intensely on the symptomatic than the nonsymptomatic side in patients with CRPS during sympathetic arousal. Normal inhibitory influences on pain during sympathetic arousal are compromised in the majority of patients with CRPS. The augmented vasoconstrictor response in the symptomatic limb during sympathetic arousal is consistent with adrenergic supersensitivity. An adrenergic sensitivity in nociceptive afferents might contribute to pain and hyperalgesia during sympathetic arousal in certain patients with CRPS.

  3. Returning "Region" to World Regional Geography

    Science.gov (United States)

    Rees, Peter W.; Legates, Margaret

    2013-01-01

    World regional geography textbooks rarely focus on the process of region formation, despite frequent calls to reincorporate a regional approach to teaching global geography. An instructional strategy using problem-based learning in a small honors section of a large world regional geography course is described. Using a hypothetical scenario…

  4. Hydraulic Characteristics of Bedrock Constrictions and Evaluation of One- and Two-Dimensional Models of Flood Flow on the Big Lost River at the Idaho National Engineering and Environmental Laboratory, Idaho

    Science.gov (United States)

    Berenbrock, Charles; Rousseau, Joseph P.; Twining, Brian V.

    2007-01-01

    A 1.9-mile reach of the Big Lost River, between the Idaho National Engineering and Environmental Laboratory (INEEL) diversion dam and the Pioneer diversion structures, was investigated to evaluate the effects of streambed erosion and bedrock constrictions on model predictions of water-surface elevations. Two one-dimensional (1-D) models, a fixed-bed surface-water flow model (HEC-RAS) and a movable-bed surface-water flow and sediment-transport model (HEC-6), were used to evaluate these effects. The results of these models were compared to the results of a two-dimensional (2-D) fixed-bed model [Transient Inundation 2-Dimensional (TRIM2D)] that had previously been used to predict water-surface elevations for peak flows with sufficient stage and stream power to erode floodplain terrain features (Holocene inset terraces referred to as BLR#6 and BLR#8) dated at 300 to 500 years old, and an unmodified Pleistocene surface (referred to as the saddle area) dated at 10,000 years old; and to extend the period of record at the Big Lost River streamflow-gaging station near Arco for flood-frequency analyses. The extended record was used to estimate the magnitude of the 100-year flood and the magnitude of floods with return periods as long as 10,000 years. In most cases, the fixed-bed TRIM2D model simulated higher water-surface elevations, shallower flow depths, higher flow velocities, and higher stream powers than the fixed-bed HEC-RAS and movable-bed HEC-6 models for the same peak flows. The HEC-RAS model required flow increases of 83 percent [100 to 183 cubic meters per second (m3/s)], and 45 percent (100 to 145 m3/s) to match TRIM2D simulations of water-surface elevations at two paleoindicator sites that were used to determine peak flows (100 m3/s) with an estimated return period of 300 to 500 years; and an increase of 13 percent (150 to 169 m3/s) to match TRIM2D water-surface elevations at the saddle area that was used to establish the peak flow (150 m3/s) of a paleoflood

  5. Bibliography on Cold Regions Science and Technology. Volume 39, Part 1, 1985,

    Science.gov (United States)

    1985-12-01

    Hteiberg Station with an inventory as of Priangar’iat, ties, Marine deposits, Theories. June 1983. Bugakova, T.M., et al, Mikrobnye sotaiatsii v les- 39.99...determination of ir ples and techaiques. remote sensing system used for sea ice resistance to a skier and the coefficieat of friction of P analysis...several aspects pro- Solifluction. ography p. 139-162. vide convenient groupings for describing present knowledge of DLC QH84.2.A58 1984 the bottom

  6. Regional alternative transportation evaluation report - Region 4

    Science.gov (United States)

    2013-08-15

    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 4, which is comprised of Alabama, Arkansas, Florida, Geor...

  7. Regional alternative transportation evaluation report - region 2

    Science.gov (United States)

    2012-03-01

    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...

  8. Regional alternative transportation evaluation report - region 5

    Science.gov (United States)

    2011-11-14

    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 3, which is comprised of Illinois, Indiana, Iowa, Michiga...

  9. Central Region Regionally Ecological Significant Areas

    Data.gov (United States)

    Minnesota Department of Natural Resources — This is an analysis of regionally significant Terrestrial and Wetland Ecological Areas in the seven county metropolitan area. Individual forest, grassland and...

  10. Regional alternative transportation evaluation report - region 1

    Science.gov (United States)

    2011-01-21

    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 1, which is comprised of Oregon, Idaho, Washington, and H...

  11. Regionalization: A Story Map Lesson on Regions

    Science.gov (United States)

    Edmondson, Deborah

    2018-01-01

    This lesson introduces the concept of regionalization and types of regions. After a brief introductory activity, students explore a story map to learn the material. The teacher can project the story map on a screen for all students to follow or students may work individually on computers. Working individually will allow students to set their own…

  12. A Comparison of Modeled and Observed Ocean Mixed Layer Behavior in a Sea Breeze Influenced Coastal Region

    Science.gov (United States)

    1993-12-21

    Latent(Lower Solid), Net Infrared (Dashed), and Net viii Heat Loss (Upper Solid - the Other 3 Surmmed) are Plotted, with Positive Values :ndicating...gained from solar insolation, Qs, and the heat lost from the surface due to latent, Qe, sensible, Qh, and net infrared radiation, Qb is positive...five empirically derived dimensionless constants in the model. With the introduction of two new unknowns, <E> and < ww2 >, the prediction of the upper

  13. Streamflow measurements in the oil sands region of northeastern Alberta[General Conference

    Energy Technology Data Exchange (ETDEWEB)

    Ashiq, M.; Ade, F. [Golder Associates Ltd., Calgary, AB (Canada). Water Resources Engineering Group

    2006-07-01

    Oil sands mining in the muskeg terrain of north-eastern Alberta will result in changes to the natural landscape, including changes to the morphology of receiving streams. The streams in the oil sands region are fed by constricted flows through the muskeg terrain. The roughness of the stream is attributed to sporadic cobbles and boulders, in-stream vegetation, over hanging vegetation and large quantities of wooden debris from beaver activities. This paper discussed stream roughness features in the oil sands region and compared the velocity profiles in these streams to the normal channel velocity profile. The study also included a comparison of computed discharges based on a simple method and a detailed method. The sources of errors in velocity measurements were then discussed. It was noted that before any oil sand mining project is approved, flows in receiving streams are monitored as part of the Environment Impact Assessment (EIA). The flows are then monitored again after project approval as part of project approval conditions.

  14. Regional controls on geomorphology, hydrology, and ecosystem integrity in the Orinoco Delta, Venezuela

    Science.gov (United States)

    Warne, A.G.; Meade, R.H.; White, W.A.; Guevara, E.H.; Gibeaut, J.; Smyth, R.C.; Aslan, A.; Tremblay, T.

    2002-01-01

    Interacting river discharge, tidal oscillation, and tropical rainfall across the 22,000 km2 Orinoco delta plain support diverse fresh and brackish water ecosystems. To develop environmental baseline information for this largely unpopulated region, we evaluate major coastal plain, shallow marine, and river systems of northeastern South America, which serves to identify principal sources and controls of water and sediment flow into, through, and out of the Orinoco Delta. The regional analysis includes a summary of the geology, hydrodynamics, sediment dynamics, and geomorphic characteristics of the Orinoco drainage basin, river, and delta system. Because the Amazon River is a major source of sediment deposited along the Orinoco coast, we summarize Amazon water and sediment input to the northeastern South American littoral zone. We investigate sediment dynamics and geomorphology of the Guiana coast, where marine processes and Holocene history are similar to the Orinoco coast. Major factors controlling Orinoco Delta water and sediment dynamics include the pronounced annual flood discharge; the uneven distribution of water and sediment discharge across the delta plain; discharge of large volumes of water with low sediment concentrations through the Rio Grande and Araguao distributaries; water and sediment dynamics associated with the Guayana littoral current along the northeastern South American coast; inflow of large volumes of Amazon sediment to the Orinoco coast; development of a fresh water plume seaward of Boca Grande; disruption of the Guayana Current by Trinidad, Boca de Serpientes, and Gulf of Paria; and the constriction at Boca de Serpientes. ?? 2002 Elsevier Science B.V. All rights reserved.

  15. Regional Alternative Transportation Evaluation: Region 8

    Science.gov (United States)

    2016-02-28

    The U.S. Fish and Wildlife Service (FWS), Federal Lands Highway (FLH), and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) have conducted regional alternative transportation evaluations (RATEs) in almost each of FWSs eight ...

  16. Local, Regional or Global?

    DEFF Research Database (Denmark)

    Geisler Asmussen, Christian

    to be consistent with models of internationalization that incorporate different assumptions about strategic choice and global competition. Preliminary results show that large multinationals follow home region oriented internationalization paths, although much of the regional effect reported by previous studies...

  17. COMPETITIVENESS IN REGIONAL DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    ELENA MĂDĂLINA OPRIȚESCU

    2012-12-01

    Full Text Available The development and diversification of the economic activities, the stimulation of investments both in the public sector, but mainly in the private one, the reduction of unemployment, the improvement of living standards are just some of the concepts aimed at by the regional development. The main method which can lead to a balanced development of the regions is financing them differentially so that the underdeveloped regions would obtain proportionally more funds that the developed ones. At a region level, the main objective is represented by the more accelerated growth of the less developed regions, in an effort to diminish the inter-regional and intra-regional development disparities. A key role is played by the sustainable economic growth concept, while also analyzing the competitiveness at a regional level, as well as the main development factors.

  18. REGIONAL DEVELOPMENT IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Remus Gherman

    2015-10-01

    Full Text Available Regional development policy is a policy of investment for economic development by supporting competitiveness, increasing the standards of living, improving the quality of life, creating new jobs. Regions and regional development policy occupies in recent decades an increasingly important position in the list of the economic and social factors being found on the agendas of governments, both central and local authorities, of political groups and civil society. Regional development and regional development policy in Romania are present both in the economic reform and in social one. Development Regions from Romania are set up in 1998 by Law number 151 and supported by their own institutional framework. The applicability of regional development in Romania must take into account the fundamental elements of the possibilities of Regional Development, meaning the major indicators of reference for measuring the level of disparities, GDP per capita and unemployment.

  19. Drycleaner Database - Region 7

    Data.gov (United States)

    U.S. Environmental Protection Agency — THIS DATA ASSET NO LONGER ACTIVE: This is metadata documentation for the Region 7 Drycleaner Database (R7DryClnDB) which tracks all Region7 drycleaners who notify...

  20. Regional Seismic Threshold Monitoring

    National Research Council Canada - National Science Library

    Kvaerna, Tormod

    2006-01-01

    ... model to be used for predicting the travel times of regional phases. We have applied these attenuation relations to develop and assess a regional threshold monitoring scheme for selected subregions of the European Arctic...

  1. Regional inequalities in mortality.

    OpenAIRE

    Illsley, R; Le Grand, J

    1993-01-01

    STUDY OBJECTIVE--To examine the hypothesis of sustained and persistent inequalities in health between British regions and to ask how far they are a consequence of using standardised mortality ratios as the tool of measurement. DESIGN, SETTING AND PARTICIPANTS--Data are regional, age specific death rates at seven points in time from 1931 to 1987-89 for the British regions, reconstructed to make them comparable with the 1981 regional definitions. Log variance is used to measure inequality; regi...

  2. Regional manpower planning

    OpenAIRE

    G. Erens; P. Salamink; C.A. Van der Merwe CA

    2003-01-01

    Particular problems come to the fore when planning development at the regional level. These range from the complexities of the multifarious interactions between the sect oral and local components of the region to the necessity of achieving extensive participation of regional stakeholders in the planning process. In this paper a methodology for regional manpower planning is proposed. The methodology is designed to accommodate the full range of problems by applying a systems approach which is b...

  3. Regional differences in actomyosin contraction shape the primary vesicles in the embryonic chicken brain

    International Nuclear Information System (INIS)

    Filas, Benjamen A; Oltean, Alina; Majidi, Shabnam; Bayly, Philip V; Taber, Larry A; Beebe, David C

    2012-01-01

    In the early embryo, the brain initially forms as a relatively straight, cylindrical epithelial tube composed of neural stem cells. The brain tube then divides into three primary vesicles (forebrain, midbrain, hindbrain), as well as a series of bulges (rhombomeres) in the hindbrain. The boundaries between these subdivisions have been well studied as regions of differential gene expression, but the morphogenetic mechanisms that generate these constrictions are not well understood. Here, we show that regional variations in actomyosin-based contractility play a major role in vesicle formation in the embryonic chicken brain. In particular, boundaries did not form in brains exposed to the nonmuscle myosin II inhibitor blebbistatin, whereas increasing contractile force using calyculin or ATP deepened boundaries considerably. Tissue staining showed that contraction likely occurs at the inner part of the wall, as F-actin and phosphorylated myosin are concentrated at the apical side. However, relatively little actin and myosin was found in rhombomere boundaries. To determine the specific physical mechanisms that drive vesicle formation, we developed a finite-element model for the brain tube. Regional apical contraction was simulated in the model, with contractile anisotropy and strength estimated from contractile protein distributions and measurements of cell shapes. The model shows that a combination of circumferential contraction in the boundary regions and relatively isotropic contraction between boundaries can generate realistic morphologies for the primary vesicles. In contrast, rhombomere formation likely involves longitudinal contraction between boundaries. Further simulations suggest that these different mechanisms are dictated by regional differences in initial morphology and the need to withstand cerebrospinal fluid pressure. This study provides a new understanding of early brain morphogenesis. (paper)

  4. HRM: HII Region Models

    Science.gov (United States)

    Wenger, Trey V.; Kepley, Amanda K.; Balser, Dana S.

    2017-07-01

    HII Region Models fits HII region models to observed radio recombination line and radio continuum data. The algorithm includes the calculations of departure coefficients to correct for non-LTE effects. HII Region Models has been used to model star formation in the nucleus of IC 342.

  5. Constructing Regional advantage

    DEFF Research Database (Denmark)

    Asheim, Bjørn T.; Boschma, Ron; Cooke, Phil

    2011-01-01

    This paper presents a regional innovation policy model based on the idea of constructing regional advantage. This policy model brings together concepts like related variety, knowledge bases and policy platforms. Related variety attaches importance to knowledge spillovers across complementary...... economic development within and between regions in action lines appropriate to incorporate the basic principles behind related variety and differentiated knowledge bases....

  6. Regional Economic Development

    Science.gov (United States)

    ; Sponsored Work Regional Economic Development Technology Opportunities User Facilities About Us Metrics In the News Publications Policies Feynman Center » Deploying Innovation » Regional Economic Development Regional Economic Development Supporting companies in every stage of development through access to

  7. The zitterbewegung region

    Science.gov (United States)

    Sidharth, B. G.; Das, Abhishek

    2017-07-01

    This paper deals with a precise description of the region of zitterbewegung below the Compton scale and the stochastic nature associated with it. We endeavor to delineate this particular region by means of Ito’s calculus and instigate certain features that are in sharp contrast with conventional physics. Interestingly, our work substantiates that the zitterbewegung region represents a pre-space-time region and from therein emerges the notion of our conventional space-time. Interestingly, this unique region engenders the relativistic and quantum mechanical aspects of space-time.

  8. Entrepreneurship and regional development

    DEFF Research Database (Denmark)

    Müller, Sabine

    This literature review examines how entrepreneurship and regional development has been previously addressed theoretically and empirically. Regional Science and Entrepreneurship are two fields with their own distinct literature's. The question is therefore, how do these two fields talk about...... the respective other? What are the commonalities and differences? The purpose of this article is to create an analytical synthesis by combining the insights of the two literature's in order to gain a fuller understanding of the relation between entrepreneurship and regional development....

  9. Regional Innovation Clusters

    Data.gov (United States)

    Small Business Administration — The Regional Innovation Clusters serve a diverse group of sectors and geographies. Three of the initial pilot clusters, termed Advanced Defense Technology clusters,...

  10. Border region studies

    DEFF Research Database (Denmark)

    Makkonen, Teemu; Williams, Allan

    2016-01-01

    The contemporary conditions of academic capitalism exert pressures on researchers to avoid ‘peripheral’ journals and ‘unfashionable’ topics. Here an attempt is made to shed light onto the structure of one such ‘offbeat’ field, namely ‘border region studies’, by discussing its geographical...... distribution, key themes, significance and impact. The review suggests that border region studies can be considered a significant and important ‘branch’ of regional studies, which accounts for a small but increasing proportion of regional studies research particularly in Europe and North America. Four main...

  11. Regional Redistribution and Migration

    DEFF Research Database (Denmark)

    Manasse, Paolo; Schultz, Christian

    We study a model with free migration between a rich and a poor region. Since there is congestion, the rich region has an incentive to give the poor region a transfer in order to reduce immigration. Faced with free migration, the rich region voluntarily chooses a transfer, which turns out...... to be equal to that a social planner would choose. Provided migration occurs in equilibrium, this conclusion holds even in the presence of moderate mobility costs. However, large migration costs will lead to suboptimal transfers in the market solution...

  12. Approaching Regional Coherence

    DEFF Research Database (Denmark)

    Vestenskov, David; Shah, Ali; Kazmi, Atia

    The report contains ideas on enhanced cooperation on both security and economy. It is a particular relevant read for regional political decision makers, institutions, private companies, and researchers that wish to gain insight into the present and future political and economic developments...... of Afghan-Pakistani relations and to the region in general. Military institutions, officers and officials facing deployment in the region as well as universities and scholars with ongoing research and programmes in the region will also benefit from output of the stabilization project that this report...

  13. Styringskapaciteten i regional arbejdsmarkedspolitik

    DEFF Research Database (Denmark)

    Hansen, Charlotte

    This book discovers the potential in regional labour market policy. It raises the question whether the regional labour market councils seek for and follows deliberative proces norms when they formulate the regional policy, and the more theoretical question about whether corporatism is compatible...... with deliberative proces norms at all. The conclusion is that if certain circumstances are fullfilled such as 1) competence to decide the policy, 2) trust from the central level and 3) an orientation towards a regional identity then there actually exists an institutional basis for deliberation....

  14. Tourism of Khmelnytskyi region

    Directory of Open Access Journals (Sweden)

    Інна Шоробура

    2017-09-01

    Full Text Available The peculiarities of tourism in Khmelnytskyi region, its priority areas, types, including cultural-educational, environmental, sportrecreative and others have been revealed in the article. The basic tasks of tourism development in the region, aimed at the formation and protection of the tourism-recreational sector, market of competitive services, attraction of maximum number of tourists to the region, etc. have been cleared out. The attention is focused on the main tourist potential of Khmelnytskyi region, including National Nature Park «Podilski Tovtry», National historical-cultural nature reserve «Kamianets», «Samchyky», Medzhybizh regional historical-ethnographic museum-fortress, sanatorium-resort facilities based on mineral waters and others. The attention is paid to the increase in income from tourism. Traditional hospitality of the population of the region, especially in rural areas, provides the possibility to combine tourists’ accommodation with the study of rural customs and traditions directly in the villages. Tourism in Khmelnytskyi region will be attractive to all tourists who want to eat healthy food, to stay outdoors and enjoy the beauty of the region. Also the article tells us about the development of other directions and familiarizes tourists with other enticements of Khmelnytskyi region using the positive brand of Kamianets-Podilskyi. All three potential areas of tourism development (historical tourism in Kamianets-Podilskyi, recreational tourism on rivers, lakes and in the forests, as well as rural tourism can be combined within the global promotion of nature and traditions of the region. It is indicated that Khmelnytskyi is a promising tourist region of Ukraine. The main problems of the region are inadequate tourism infrastructure, accommodation facilities, food and roads. The experience of the tourism cluster «Oberih» (Protective Charm proves the perspectives of agritourism. Developing these two areas together, we

  15. On Austrian regional economics

    NARCIS (Netherlands)

    Heijman, W.J.M.; Leen, A.R.

    2004-01-01

    The aim of this research note is two-fold, firstly, to clarify the growing interaction between regional science and Austrian economics and their awareness of each other. We elucidate the Austrian methodology, called praxeology, which is especially misunderstood in regional science. Secondly, we

  16. The Wealth of Regions

    DEFF Research Database (Denmark)

    Nistotskaya, Marina; Charron, Nicholas; Lapuente, Victor

    2015-01-01

    . Using original survey data on QoG from 172 regions in eighteen European Union countries, we find that regions where governments are perceived by their citizens as impartial and free from corruption have on average significantly more SMEs. We also find that in less corrupt countries the spatial...... distribution of SMEs is more even than in more corrupt countries...

  17. Forest regions of Montana

    Science.gov (United States)

    Stephen F. Arno

    1979-01-01

    In this paper, Montana is divided into eight geographic subdivisions called "forest regions," based on distributions of tree and undergrowth species and the relationship of these patterns to climate and topography. The regions serve as a geographic reference for describing patterns of forest vegetation across the State. Data on the distributions of plant...

  18. Regionalism, Devolution and Education

    Science.gov (United States)

    Bogdanor, Vernon

    1977-01-01

    Described are effects of political decentralization in the United Kingdom on political and social institutions, particularly education. The author concludes that regionalism could yield advantages of power decentralization, diversity of decision making, and educational systems which are more closely connected to regional and local traditions.…

  19. Ad Hoc Rural Regionalism

    Science.gov (United States)

    Hamin, Elisabeth M.; Marcucci, Daniel J.

    2008-01-01

    A new regionalism has been much documented and researched for metropolitan areas; this article documents that there is a new rural regionalism as well. In the United States, these groups appear most likely to emerge in areas that are challenged by outcomes characterizing globalization's effects on the rural condition: namely, exurban or…

  20. Politics, Planning and Regionalism.

    Science.gov (United States)

    Zukosky, Jerome

    The concept of regionalism identifies the issues in public affairs pertaining to a region and develops structures through which citizens can participate in the decisionmaking process. This speech describes educational decisions in the State of New York as affected by local decentralization and by concentration of power at the State level. Relevant…

  1. The Scandinavian regional model

    DEFF Research Database (Denmark)

    Torfing, Jacob; Lidström, Anders; Røiseland, Asbjørn

    2015-01-01

    This article maps how the sub-national regional levels of governance in Denmark, Norway and Sweden have changed from a high degree of institutional convergence to a pattern of institutional divergence. It analyses the similarities and differences in the changes in regional governance and discusses...

  2. Regional final energy consumptions

    International Nuclear Information System (INIS)

    2011-01-01

    This report comments the differences observed between the French regions and also between these regions and national data in terms of final energy consumption per inhabitant, per GDP unit, and per sector (housing and office building, transport, industry, agriculture). It also comments the evolutions during the last decades, identifies the most recent trends

  3. Measuring regional authority

    NARCIS (Netherlands)

    Marks, G.W.; Hooghe, E.A.E.B.; Schakel, A.H.

    2008-01-01

    This article sets out a conceptual basis for measuring regional authority and engages basic measurement issues. Regional authority is disaggregated into two domains (self-rule and shared rule) and these are operationalised in eight dimensions. The article concludes by examining the robustness of

  4. Emergence of regional clusters

    DEFF Research Database (Denmark)

    Dahl, Michael S.; Østergaard, Christian Richter; Dalum, Bent

    2010-01-01

    The literature on regional clusters has increased considerably during the last decade. The emergence and growth patterns are usually explained by such factors as unique local culture, regional capabilities, tacit knowledge or the existence of location-specific externalities (knowledge spillovers...

  5. Arkadien. Region og identitet

    DEFF Research Database (Denmark)

    Nielsen, Thomas Heine

    Oldtidens Grækenland bestod af et mylder af bystater, grupperet i regioner, og grækerne mente, at de forskellige regioners beboere havde hver deres karakteristika. Bogen undersøger dette emne nærmere i forhold til Arkadien på Peloponnes: Hvad ville det sige at være arkader? Var det et geografisk...

  6. Connecting to Regional Markets?

    DEFF Research Database (Denmark)

    Coulibaly, Souleymane; Thomsen, Lotte

    2016-01-01

    Central Asian food processors face a number of constraints when they attempt to export to the region and beyond. The Central Asian economies in focus here are landlocked, and thus lack easy access to sea transport. In addition, the region's transport network was built to reinforce the interdepend......Central Asian food processors face a number of constraints when they attempt to export to the region and beyond. The Central Asian economies in focus here are landlocked, and thus lack easy access to sea transport. In addition, the region's transport network was built to reinforce...... the interdependence of the then Soviet republics, while conflicting economic interests make cross-border cooperation difficult. Based on extensive fieldwork on infrastructure systems and firm export strategies, this paper identifies contemporary infrastructure and transportation issues within the Central Asian region...

  7. Crisis and Regional Integration

    DEFF Research Database (Denmark)

    Dosenrode, Søren

    , Tunisia, Egypt …. ), where the crisis referred to could be humanitarian, environmental, economic, political … Europe, too, has also according to mass media, been a victim of a crisis, the financial one. Could ‘crisis’ be a beginning of enhanced regional integration? This paper will try to look...... at the processes of regional integration in relation to ‘crisis’ in Africa and Europe. First, this paper will look at the concept of ‘crisis’, before it moves on to discuss ‘regional integration’ and the correlation between the two, emphasizing the approaches of neo-functionalism and federal theory....... This is the basis for two short case studies of African and European regional integration. The paper tentative answers to the question: will the crisis in Africa and Europe respectively further or block regional integration? With a ‘that depends’. But the use of Federalism theory and neo-functionalism is seen...

  8. The Regional Dimension

    DEFF Research Database (Denmark)

    Eskjær, Mikkel Fugl

    2013-01-01

    is largely dependent on regional media systems, yet the role this regional dimension plays has been largely overlooked. This article presents a comparative study of climate-change coverage in three geo-cultural regions, The Middle East, Scandinavia, and North America, and explores the link between global......Global perspectives and national approaches have dominated studies of climate-change communication, reflecting the global nature of climate change as well as the traditional research focus on national media systems. In the absence of a global public sphere, however, transnational issue attention...... climate-change communication and regional media systems. It finds that regional variations in climate-change communication carry important communicative implications concerning perceptions of climate change's relevance and urgency...

  9. Bridging regional innovation

    DEFF Research Database (Denmark)

    Hansen, Teis

    2013-01-01

    to assess the progress of integration in the regions, as well as the effect of cross-border innovation policies. Consequently, important questions are left unanswered, including the central research question of this paper: does the sudden removal of significant physical barriers directly impacts......The topics of regional innovation systems (RIS) and cross-border regions attract increasing attention, but few studies combine the themes. Further, the existing empirical studies of cross-border innovation and knowledge creation analyse one case at one point in time, thus, making it difficult...... collaboration activity in cross-border innovation systems? This paper examines regional integration in the Oresund Region over time. It deals with a specific part of the RIS, as it analyses research collaboration between actors from the Danish and Swedish sides, with a specific emphasis on the biotech industry...

  10. Die Region braucht die Kultur - die Kultur braucht die Region

    OpenAIRE

    Klemm, Ulrich

    1995-01-01

    Die Region braucht die Kultur - die Kultur braucht die Region. - In: Region in Aktion - oder: Region im Abseits? - Boxberg-Wölchingen : Eigenständige Regionalentwicklung Baden-Württemberg, 1995. - S. 25 f.

  11. Evolved H II regions

    International Nuclear Information System (INIS)

    Churchwell, E.

    1975-01-01

    A probable evolutionary sequence of H II regions based on six distinct types of observed objects is suggested. Two examples which may deviate from this idealized sequence, are discussed. Even though a size-mean density relation of H II regions can be used as a rough indication of whether a nebula is very young or evolved, it is argued that such a relation is not likely to be useful for the quantitative assignment of ages to H II regions. Evolved H II regions appear to fit into one of four structural types: rings, core-halos, smooth structures, and irregular or filamentary structures. Examples of each type are given with their derived physical parameters. The energy balance in these nebulae is considered. The mass of ionized gas in evolved H II regions is in general too large to trace the nebula back to single compact H II regions. Finally, the morphological type of the Galaxy is considered from its H II region content. 2 tables, 2 figs., 29 refs

  12. Building Regional Competencies

    DEFF Research Database (Denmark)

    Norus, Jesper

    2004-01-01

    This paper analyzes the foundations of regional knowledge and its long-term impact onthe region's companies' and how a particular knowledge has developed an ability tostay competitive within a specific technological field. The case illustrates how theCopenhagen region has been able to develop...... a dominating position in the global marketfor industrial enzymes from 1870-2004. The case of industrial enzymes shows how aregion has been able to build sustainable competitive advantages from its distinctivecompetencies. This is done through a mixture of outsourcing and in sourcing ofcompetencies, knowledge...

  13. Regional Stability & Peacebuilding

    DEFF Research Database (Denmark)

    It seems that regional decision makers during the last two decades has been unable to produce a sustainable peacebuilding plan for the region and it is questionable whether any remarkable change will occur in the near future. Some would argue that the political differences are simply too far apart...... to the process of peacebuilding, this could prove as a useful tool, and for this reason politicians, officials, and persons in general with an interest in this region will benefit from the perspectives presented here....

  14. Regional Ocean Data Assimilation

    KAUST Repository

    Edwards, Christopher A.

    2015-01-03

    This article reviews the past 15 years of developments in regional ocean data assimilation. A variety of scientific, management, and safety-related objectives motivate marine scientists to characterize many ocean environments, including coastal regions. As in weather prediction, the accurate representation of physical, chemical, and/or biological properties in the ocean is challenging. Models and observations alone provide imperfect representations of the ocean state, but together they can offer improved estimates. Variational and sequential methods are among the most widely used in regional ocean systems, and there have been exciting recent advances in ensemble and four-dimensional variational approaches. These techniques are increasingly being tested and adapted for biogeochemical applications.

  15. Regional Air Quality Data

    Data.gov (United States)

    U.S. Environmental Protection Agency — This asset provides data on regional air quality, including trace level SO2, nitric acid, ozone, carbon monoxide, and NOy; and particulate sulfate, nitrate, and...

  16. Regional Education Partners

    Science.gov (United States)

    & Development (LDRD) National Security Education Center (NSEC) Office of Science Programs Richard P Databases National Security Education Center (NSEC) Center for Nonlinear Studies Engineering Institute Scholarships STEM Education Programs Teachers (K-12) Students (K-12) Higher Education Regional Education

  17. Regional Snowfall Index (RSI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA's National Climatic Data Center is now producing the Regional Snowfall Index (RSI) for significant snowstorms that impact the eastern two thirds of the U.S. The...

  18. Aeromagnetic Regional Grid Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Several regions are represented in this unique collection of earth surface measurements of magnetic field parameters and their related anomalies. The DNAG Magnetics...

  19. Region 9 Tribal Lands

    Data.gov (United States)

    U.S. Environmental Protection Agency — Dataset of all Indian Reservations in US EPA Region 9 (California, Arizona and Nevada) with some reservation border areas of adjacent states included (adjacent areas...

  20. Paediatric regional anaesthesia:

    African Journals Online (AJOL)

    induced respiratory depression. The purpose ... regional blocks are usually performed under anaesthesia or .... brachial plexus, as well as the axillary, musculo-cutaneous, ulnar, ... of their use for continuous postoperative pain management or.

  1. Regional Ocean Data Assimilation

    KAUST Repository

    Edwards, Christopher A.; Moore, Andrew M.; Hoteit, Ibrahim; Cornuelle, Bruce D.

    2015-01-01

    This article reviews the past 15 years of developments in regional ocean data assimilation. A variety of scientific, management, and safety-related objectives motivate marine scientists to characterize many ocean environments, including coastal

  2. Second region of stability

    International Nuclear Information System (INIS)

    Greene, J.M.; Chance, M.S.

    1980-10-01

    A new type of axisymmetric magnetohydrodynamic equilibrium is presented. It is characterized by a region of pressure and safety factor variation with a short scale length imposed as a perturbation. The equilibrium consistent with these profile variations can be calculated by means of an asymptotic expansion. The flexibility obtained by generating such equilibria allows for a close examination of the mechanisms that are relevant to ballooning instabilities - ideal MHD modes with large toroidal mode number. The so-called first and second regions of stability against these modes are seen well within the limits of validity of the asymptotic expansion. It appears that the modes must be localized in regions with small values of the local shear of the magnetic field. The second region of stability occurs where the local shear is large throughout the range where the magnetic field line curvature is destabilizing

  3. Regional utvikling og partnerskap

    DEFF Research Database (Denmark)

    Halkier, H.; Gjertsen, A.

    2004-01-01

    Since the beginning of the 1990s, Danish regional policy has changed dramatically. As of January 1991, all central government incentive schemes were terminated, and since then the main components of spatial economic policy have been a host of subnational initiatives and the European Structural...... in European matters as envisaged in the ?Europe of the Regions? slogan. The aim of this chapter is to examine the transformation of regional policy in Denmark from the perspective of political decentralization and Europeanization in order to establish to what extent recent changes have increased the capacity...... of Danish regions to pursue their own agendas with regard to economic development, and explore the organizational strategies pursued by varies tiers of government in this process of rapid and profound policy change. The text is divided into three parts. The following section provides a brief outline...

  4. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  5. Southeast DIVER Regional Metadata

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — DIVER environmental data holdings are primarily comprised of datasets gathered from regional studies, site specific studies from non-NOAA entities, and NOAA...

  6. Northeast DIVER Regional Metadata

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — DIVER environmental data holdings are primarily comprised of datasets gathered from regional studies, site specific studies from non-NOAA entities, and NOAA...

  7. Regional Hearing Clerk

    Science.gov (United States)

    The Regional Hearing Clerk receives filings for proceedings under the Consolidated Rules of Practice Governing the Administrative Assessment of Civil Penalties and the Revocation/Termination or Suspension of Permits, 40 Code of Federal Regulations Part 22

  8. Regional National Cooperative Observer

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA publication dedicated to issues, news and recognition of observers in the National Weather Service Cooperative Observer program. Issues published regionally...

  9. Active regions, ch. 7

    International Nuclear Information System (INIS)

    Martres, M.J.; Bruzek, A.

    1977-01-01

    The solar Active Region is an extremely complex phenomenon comprising a large variety of features (active,region phenomena) in the photosphere, chromosphere and corona. The occurrence of the various active phenomena depends on the phase and state of evolution of the AR; their appearance depends on the radiation used for the observation. The various phenomena are described and illustrated with photographs. Several paragraphs are dedicated to magnetic classification of AR, Mt. Wilson Spot Classification, solar activity indices, and solar activity data publications

  10. RCA's regional industrial project

    International Nuclear Information System (INIS)

    Ali, A.T.

    1988-01-01

    The Regional Cooperation Agreement (RCA) for Research Development and Training Related to Nuclear Science and Technology, formulated under the auspices of the International Atomic Energy Agency (IAEA), came into force in June 1972. The overall objective of RCA is to promote technical cooperation among the developing and developed countries in the Asia Pacific region in the peaceful uses of nuclear energy and related technology. Currently, the biggest project under RCA is the Regional Project on the Industrial Applications of Isotopes and Radiation Technology for Asia and the Pacific. The project was established in 1982 for a period of five years and was completed in December 1986. The first phase of the project has generated a high degree of awareness on the industrial potential of isotopes and radiation technology throughout the region; produced a cadre of trained manpower in all areas covered by the project; identified the expertise available in the region; and developed in the region, a unique network of people and institutions involved with the utilization of isotope and radiation technology. A Phase II of the project, which cover all but one of the sub-projects under Phase I, was approved in early 1987 for another five years until 1991. (Nogami, K.)

  11. Regional boundaries study

    International Nuclear Information System (INIS)

    Zavatsky, S.; Phaneuf, P.; Topaz, D.; Ward, D.

    1978-02-01

    The NRC Office of Inspection and Enforcement (IE) has elected to evaluate the effectiveness and efficiency of its existing regional boundary alignment because of the anticipated future growth of nuclear power generating facilities and corresponding inspection requirements. This report documents a management study designed to identify, analyze, and evaluate alternative regional boundary configurations for the NRC/IE regions. Eight boundary configurations were chosen for evaluation. These configurations offered alternatives ranging from two to ten regions, and some included the concepts of subregional or satellite offices. Each alternative configuration was evaluated according to three major criteria: project workload, cost, and office location. Each major criterion included elements such as management control, program uniformity, disruption, costs, and coordination with other agencies. The conclusion reached was that regional configurations with regions of equal and relatively large workloads, combined with the concepts of subregional or satellite offices, may offer a significant benefit to the Office of Inspection and Enforcement and the Commission and are worthy of further study. A phased implementation plan, which is suitable to some configurations, may help mitigate the disruption created by realignment

  12. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    Parera, María Delia

    2011-01-01

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [es

  13. North American Regional Report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-11-15

    North America is an energy community fortunate to be endowed with a rich and varied resource base. It consumes about a third of the world's energy and produces about one quarter of world energy supply. North America depends on a mix of complementary energy sources that should remain competitive but not in conflict. The current supply mix varies between Canada, the United States and Mexico, but fossil fuels are dominant across the region, leaving the three member countries vulnerable to a myriad of risks associated with traditional supply sources. Energy trade between all three countries is also a major contributor to the region's economy. Thus, the impetus for collaboration across the region has grown out of the common goals of energy security and economic prosperity. The goal of the WEC regional group was to discuss avenues for advancing North American cooperation and coordination on a range of energy issues. An additional objective was to develop policy recommendations that will facilitate effective development and use of the region's energy resources. Results and recommendtaions are summarized from three forums that focused on the pertinent issues of energy trade, energy efficiency and energy diversification. The inaugural forum (Energy Trade) was held in Washington, D.C. in the fall of 2005. The following summer, the second forum (Energy Efficiency) took place in Mexico City. The third forum (Energy Diversification) was hosted in Halifax, Nova Scotia.

  14. North American Regional Report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-11-15

    North America is an energy community fortunate to be endowed with a rich and varied resource base. It consumes about a third of the world's energy and produces about one quarter of world energy supply. North America depends on a mix of complementary energy sources that should remain competitive but not in conflict. The current supply mix varies between Canada, the United States and Mexico, but fossil fuels are dominant across the region, leaving the three member countries vulnerable to a myriad of risks associated with traditional supply sources. Energy trade between all three countries is also a major contributor to the region's economy. Thus, the impetus for collaboration across the region has grown out of the common goals of energy security and economic prosperity. The goal of the WEC regional group was to discuss avenues for advancing North American cooperation and coordination on a range of energy issues. An additional objective was to develop policy recommendations that will facilitate effective development and use of the region's energy resources. Results and recommendtaions are summarized from three forums that focused on the pertinent issues of energy trade, energy efficiency and energy diversification. The inaugural forum (Energy Trade) was held in Washington, D.C. in the fall of 2005. The following summer, the second forum (Energy Efficiency) took place in Mexico City. The third forum (Energy Diversification) was hosted in Halifax, Nova Scotia.

  15. Transient regional osteoporosis

    Directory of Open Access Journals (Sweden)

    F. Trotta

    2011-09-01

    Full Text Available Transient osteoporosis of the hip and regional migratory osteoporosis are uncommon and probably underdiagnosed bone diseases characterized by pain and functional limitation mainly affecting weight-bearing joints of the lower limbs. These conditions are usually self-limiting and symptoms tend to abate within a few months without sequelae. Routine laboratory investigations are unremarkable. Middle aged men and women during the last months of pregnancy or in the immediate post-partum period are principally affected. Osteopenia with preservation of articular space and transitory edema of the bone marrow provided by magnetic resonance imaging are common to these two conditions, so they are also known by the term regional transitory osteoporosis. The appearance of bone marrow edema is not specific to regional transitory osteoporosis but can be observed in several diseases, i.e. trauma, reflex sympathetic dystrophy, avascular osteonecrosis, infections, tumors from which it must be differentiated. The etiology of this condition is unknown. Pathogenesis is still debated in particular the relationship with reflex sympathetic dystrophy, with which regional transitory osteoporosis is often identified. The purpose of the present review is to remark on the relationship between transient osteoporosis of the hip and regional migratory osteoporosis with particular attention to the bone marrow edema pattern and relative differential diagnosis.

  16. Migration and regional inequality

    DEFF Research Database (Denmark)

    Peng, Lianqing; Swider, Sarah

    2017-01-01

    Scholars studying economic inequality in China have maintained that regional inequality and economic divergence across provinces have steadily increased over the past 30 years. New studies have shown that this trend is a statistical aberration; calculations show that instead of quickly and sharply...... rising, regional inequality has actually decreased, and most recently, remained stable. Our study suggests that China’s unique migratory regime is crucial to understanding these findings. We conduct a counterfactual simulation to demonstrate how migration and remittances have mitigated income inequality...... across provinces in order to show that without these processes, we would have seen more of a rise in interprovincial income inequality. We conclude by arguing that inequality in China is still increasing, but it is changing and becoming less place-based. As regional inequality decreases, there are signs...

  17. Entrepreneurship and Regional Development:

    DEFF Research Database (Denmark)

    Müller, Sabine

    influenced by such interactions? In approaching these questions, this dissertation focuses on why entrepreneurs act (the causes of entrepreneurship, anchored in the context), how they act (the entrepreneurial practices, action, and activities), and what happens when they act (the outcomes and impact...... of entrepreneurship). This study sets out to obtain an in-depth understanding of the micro-, community-, and regional-level localized entrepreneurial processes as well as the way in which these processes are intertwined with the spatial context. The contribution of this dissertation lies in the illustration of how......, culture, history, and natural resources. The insights of this thesis are believed to be vital for understanding why certain types of local entrepreneurship prevail in certain regions. This can further our knowledge of how to foster and enable entrepreneurship in lagging regions. In addition, this study...

  18. GRTgaz and the regions

    International Nuclear Information System (INIS)

    2017-01-01

    GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the regional activities of GRTgaz in France in the form of 12 regional fact sheets summarizing the key data by the end of 2016: network structure, financial indicators (investments, orders), public and industrial gas consumptions, 2017 projects, institutional and environmental partnerships

  19. Northeast Regional Biomass Program

    Energy Technology Data Exchange (ETDEWEB)

    O' Connell, R.A.

    1991-11-01

    The management structure and program objectives for the Northeast Regional Biomass Program (NRBP) remain unchanged from previous years. Additional funding was provided by the Bonneville Power Administration Regional Biomass Program to continue the publication of articles in the Biologue. The Western Area Power Administration and the Council of Great Lakes Governors funded the project Characterization of Emissions from Burning Woodwaste''. A grant for the ninth year was received from DOE. The Northeast Regional Biomass Steering Committee selected the following four projects for funding for the next fiscal year. (1) Wood Waste Utilization Conference, (2) Performance Evaluation of Wood Systems in Commercial Facilities, (3) Wood Energy Market Utilization Training, (4) Update of the Facility Directory.

  20. Northeast Regional Biomass Program

    International Nuclear Information System (INIS)

    O'Connell, R.A.

    1991-11-01

    The management structure and program objectives for the Northeast Regional Biomass Program (NRBP) remain unchanged from previous years. Additional funding was provided by the Bonneville Power Administration Regional Biomass Program to continue the publication of articles in the Biologue. The Western Area Power Administration and the Council of Great Lakes Governors funded the project ''Characterization of Emissions from Burning Woodwaste''. A grant for the ninth year was received from DOE. The Northeast Regional Biomass Steering Committee selected the following four projects for funding for the next fiscal year. (1) Wood Waste Utilization Conference, (2) Performance Evaluation of Wood Systems in Commercial Facilities, (3) Wood Energy Market Utilization Training, (4) Update of the Facility Directory

  1. ASEAN : Extra-Regional Cooperation Triggers Regional Integration

    NARCIS (Netherlands)

    Krapohl, S.; Krapohl, S.

    2017-01-01

    This chapter contains two case studies of regional cooperation within Southeast Asia. The network analysis of ASEAN demonstrates that the region is dependent on extra-regional trade with the EU and the USA, but also with China and Japan. However, the region is not dominated by a single regional

  2. Regional Resource Planning Study

    International Nuclear Information System (INIS)

    2001-01-01

    Natural gas and electricity commodities are among the most volatile commodities in the world. Spurred on by the recent significant increases in the price of natural gas, the BC Utilities Commission initiated an investigation into factors impacting on natural gas prices, and the validity of the Sumas index (a market trading point, or interchange where multiple pipelines interconnect, allowing the purchase and sale of gas among market participants) as a price setting mechanism. The Commission also sought the opinions and perspectives of the the province's natural gas industry regarding the high volatility of the Sumas gas prices, and as to what could be done to alleviate the wild fluctuations. Following review of the responses from stakeholders, the Commission issued a directive to BC Gas to undertake discussions on regional resource planning with full representation from all stakeholders. This study is the result of the Commission's directive, and is intended to address the issues contained in the directives. Accordingly, the study examined gas demand in the region, demand growth, including power generation, natural gas resource balance in the region, the California impacts on demand and on supply to the region, supply shortfalls on a peak day, and on a seasonal and annual basis, near term remedies, possible resource additions in the longer term, the economic justification for adding major resources and proposed actions to develop needed resource additions. The study confirmed the existence of a growing capacity deficit, which limits the supply of natural gas to the region. Near term options to alleviate the regional capacity deficit were found to be limited to discouraging power generation from serving export markets, demand side management efforts, and expansion of the WEI's systems by 105 mmcf/d. Longer term solutions would involve larger scale expansion of WEI's T-South capacity, the BC Gas' Inland Pacific Connector Project and the Washington Lateral proposed by

  3. From corridor to region

    DEFF Research Database (Denmark)

    Jensen, Anne; Jespersen, Per Homann

    2006-01-01

    The corridor between Oslo and Berlin is by the politicians of the regional authorities in the Scandinavian part of the corridor seen a region with unique qualities and a large innovation and growth potential. In order to explore and develop this potential an In-terreg project has been launched...... this task by applying principles of participative planning and with action research methodology are involving stakeholders in the process of defining, developing and disseminating the idea of the Corridor of Innovation and Cooperation - COINCO....

  4. Cold regions isotope applications

    International Nuclear Information System (INIS)

    Perrigo, L.D.; Divine, T.E.

    1976-04-01

    Pacific Northwest Laboratories (PNL) started the Cold Regions Isotope Applications Program in FY-1975 to identify special conditions in the Arctic and similar geographic areas (Cold Regions) where radioisotope power, heater, or sterilization systems would be desirable and economically viable. Significant progress was made in the first year of this program and all objectives for this initial 12-month period were achieved. The major conclusions and recommendations resulting for this effort are described below. The areas of interest covered include: radiosterilization of sewage; heating of septic tanks; and radioisotope thermoelectric generators as power sources for meteorological instruments and navigational aids

  5. Regional Governance Matters

    DEFF Research Database (Denmark)

    Charron, Nicholas; Dijkstra, Lewis; Lapuente, Victor

    2014-01-01

    study presents novel data (European QoG Index – EQI) on the ‘quality of government’ (QoG) – understood as low corruption, impartial public services and rule of law – for national and sub-national levels in twenty-seven European Union countries. The EQI shows notable within-country variations: while...... high-performing regions in Italy and Spain (for example, Bolzano, País Vasco) rank amongst the best European Union regions, others perform well below the European Union average. The index is highly correlated with sub-national levels of socio-economic development and levels of social trust, yet...

  6. REGIONAL DEVELOPMENT STRATEGY

    Directory of Open Access Journals (Sweden)

    Vaduva Maria

    2011-01-01

    Full Text Available Regional development policies in the EU Member States have included tools whoseimportance varied from one country to another. Can be identified by negative incentives forregional development policy towards location in crowded areas or control over the location,the reallocation of economic activities in national territory, creation of adequateinfrastructure, measures to enhance development, financial incentives granted toenterprises. Sustainable business development, rehabilitation of social infrastructure,including social housing and improved social services. Improved regional and localtransportation are key areas of intervention rehabilitation and upgrading of county roads,city streets, including road construction and rehabilitation of belt.

  7. Eastern Baltic Sea Region

    DEFF Research Database (Denmark)

    Jakobsen, Johnny Grandjean Gøgsig

    2016-01-01

    Kort over den østlige Østersøregion i middelalderen med angivelse af lokaliteter omtalt i antologien, placeret på s.8 i bogen "Church and Belief in the Middle Ages", red. Kirsi Salonen & Sari Katajala-Peltomaa (Amsterdam, 2016).......Kort over den østlige Østersøregion i middelalderen med angivelse af lokaliteter omtalt i antologien, placeret på s.8 i bogen "Church and Belief in the Middle Ages", red. Kirsi Salonen & Sari Katajala-Peltomaa (Amsterdam, 2016)....

  8. Voksenuddannelse og regional udvikling

    DEFF Research Database (Denmark)

    Rasmussen, Palle

    2008-01-01

    Med udgangspunkt i regionale og lokale forskelle uddannelsesforskelle behandler artiklen uddannelsers rolle i regional udvikling. Der lægges særlig vægt på forskellige former for voksenuddannelse. Hvad betyder udviklingen mod vidensamfundet for udviklingen i erhverv, beskæftigelse og sociale...... forhold? Hvilken rolle spiller uddannelse i centerområder og udkantsområder? Hvordan kan uddannelse og læring bidrage til regional udvikling? Hvilke roller kan voksenuddannelse have i denne sammenhæng?...

  9. AFRA: Supporting regional cooperation

    International Nuclear Information System (INIS)

    2016-01-01

    The African Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology (AFRA) provides a framework for African Member States to intensify their collaboration through programmes and projects focused on the specific shared needs of its members. It is a formal intergovernmental agreement which entered into force in 1990. In the context of AFRA, Regional Designated Centres for training and education in radiation protection (RDCs) are established African institutions able to provide services, such as training of highly qualified specialists or instructors needed at the national level and also to facilitate exchange of experience and information through networks of services operating in the field

  10. Regional Geography is Dead. Long Live Regional Geography!

    Czech Academy of Sciences Publication Activity Database

    Vaishar, Antonín; Werner, M.

    2006-01-01

    Roč. 14, č. 3 (2006), s. 2-8 ISSN 1210-8812 Institutional research plan: CEZ:AV0Z30860518 Keywords : regional geography * regions * geography * methodology * Ostrava region Subject RIV: DE - Earth Magnetism, Geodesy, Geography

  11. Regionalism in Scottish Universities

    Science.gov (United States)

    Hutchison, Dougal

    1976-01-01

    It is well-known that Scottish universities are highly local institutions and that over two-fifth of Scottish university students live at home. Attempts to ascertain if this regionalism has relaxed over the past twenty years with student grant regulations, improvement in communications and the increasing affluence of today's society. (Author/RK)

  12. Regionalism. Clip and Save.

    Science.gov (United States)

    Hubbard, Guy

    2002-01-01

    Focuses on the art movement, called Regionalism, discussing the painters involved and describing the characteristics of the art movement. Provides a set of learning activities and background information on John Steuart Curry. Includes a discussion of Curry's painting, "Tornado Over Kansas," and a reproduction of the painting. (CMK)

  13. Complex Regional Pain Syndrome

    Science.gov (United States)

    Complex regional pain syndrome (CRPS) is a chronic pain condition. It causes intense pain, usually in the arms, hands, legs, or feet. It may happen ... move the affected body part The cause of CRPS is unknown. There is no specific diagnostic test. ...

  14. Global, Local, or Regional?

    DEFF Research Database (Denmark)

    Verbeke, Alain; Geisler Asmussen, Christian

    2016-01-01

    of analysis, in addition to the country-level and the global level. Regional strategy analysis requires a fundamental rethink of mainstream theories in the international strategy sphere. This rethink involves, inter alia, internalization theory, with its resource-based view and transaction cost economics...

  15. H2 region detection

    International Nuclear Information System (INIS)

    Comte, G.

    1978-01-01

    The now classical technique of detection of HII regions is by means of photography and/or interferometry through narrow-band interference filters, with a large aperture ratio of the imaging optics. It enables the detailed study of the spiral structure and the repartition of ionized gas in our Galaxy as well as in the external galaxies [fr

  16. REGIONAL CUSTOMS DIRECTORATES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    CABA STEFAN

    2009-05-01

    Full Text Available The management of a regional customs directorate is analyzed. A new approach of the managerial system, in the European integration context, is presented. The customs system is one of the first “doors” to a new economic, social and cultural community. For

  17. Modern regional innovation policy

    NARCIS (Netherlands)

    McCann, Philip; Ortega-Argiles, Raquel

    This paper analyses the evolution of regional innovation policy into the mainstream of public policy. The paper examines the empirical and theoretical developments which have shifted much of the focus on innovation-related issues to matters of economic geography. As well as academic material we also

  18. Regionalizing global climate models

    NARCIS (Netherlands)

    Pitman, A.J.; Arneth, A.; Ganzeveld, L.N.

    2012-01-01

    Global climate models simulate the Earth's climate impressively at scales of continents and greater. At these scales, large-scale dynamics and physics largely define the climate. At spatial scales relevant to policy makers, and to impacts and adaptation, many other processes may affect regional and

  19. Aid for regional development

    Directory of Open Access Journals (Sweden)

    Ion POPESCU

    2011-06-01

    Full Text Available The issue of regional development has captured the attention of researchers long UMA, but some trends in contemporary economy and international division of labor, cooperation, integration and globalization bring it back to the forefront of current theoretical and methodological concerns. Especially the process of European integration requires comprehensive and pragmatic approach, realistic subject (2, 3, 4.

  20. Regional anaesthesia in obstetrics.

    Science.gov (United States)

    Pedersen, H; Finster, M

    1984-01-01

    This review includes a brief discussion of the indications and pitfalls of regional anaesthetic techniques commonly used during parturition. Emphasis is given to the physiological changes of pregnancy and the potential effects on the fetus. The criteria for the choice of local anaesthetic are also presented.

  1. Venus - Phoebe Region

    Science.gov (United States)

    1990-01-01

    This Magellan radar image is of part of the Phoebe region of Venus. It is a mosaic of parts of revolutions 146 and 147 acquired in the first radar test on Aug. 16, 1990. The area in the image is located at 291 degrees east longitude, 19 degrees south latitude. The image shows an area 30 kilometers (19.6 miles) wide and 76 km (47 miles) long. On the basis of Pioneer Venus and Arecibo data, it is known that two major rift zones occur in southern Phoebe Regio and that they terminate at about 20 to 25 degrees south latitude, about 2,000 km (1,240 miles) apart. This image is of an area just north of the southern end of the western rift zone. The region is characterized by a complex geologic history involving both volcanism and faulting. Several of the geologic units show distinctive overlapping or cross cutting relationships that permit identification and separation of geologic events and construction of the geologic history of the region. The oldest rocks in this image form the complexly deformed and faulted, radar bright, hilly terrain in the northern half. Faults of a variety of orientations are observed. A narrow fault trough (about one-half to one km (three tenths to six tenths of a mile) wide is seen crossing the bright hills near the lower part in the middle of the image. This is one of the youngest faults in the faulted, hilly unit as it is seen to cut across many other structures. The fault trough in turn appears to be embayed and flooded by the darker plains that appear in the south half of the image. These plains are interpreted to be of volcanic origin. The dark plains may be formed of a complex of overlapping volcanic flows. For example, the somewhat darker region of plains in the lower left (southwest) corner of the image may be a different age series of plains forming volcanic lava flows. Finally, the narrow bright line crossing the image in its lower part is interpreted to be a fault which cross cuts both plains units and is thus the youngest event in

  2. Regional planning without means - search for regional leadership

    DEFF Research Database (Denmark)

    Groth, Niels Boje; Fertner, Christian

    and stakeholders, not least due to its polycentric urban structure with several medium-sized towns. Besides the regional authority and the regions 22 municipalities, sub-regional collaboration is gaining momentum. Furthermore, different fora, councils and associations are engaging in regional issues. However......, collaboration is often focused on specific sectors or sub-regions, while the joint development of the region is left behind. The regional authority has changed its focus from planning to the provision of knowledge, suitable to kick-off joint action with regional stakeholders, while municipalities keep focus...... on their own territories, eventually in the context of one of the new sub-regional collaborations. Based on an empirical analysis of the regional interplay in Southern Denmark and results from the ESPON ReSSI project, we go through these new settings of regional collaboration in the search for new forms...

  3. Midwest regional management plan

    International Nuclear Information System (INIS)

    Paton, R.F.

    1986-01-01

    In response to the Low-Level Radioactive Waste Policy Act of 1980, the States of Indiana, Iowa, Michigan, Minnesota, Missouri, Ohio and Wisconsin formed the Midwest Interstate Low-Level Radioactive Waste Compact. One of the top priorities of the Compact Commission is the development of a comprehensive regional waste management plan. The plan consists of five major elements: (1) waste inventory; (2) waste stream projections; (3) analysis of waste management and disposal options; (4) development of a regional waste management system; and (5) selection of a host state(s) for future low-level waste facilities. When completed, the Midwest Management Plan will serve as the framework for future low-level radioactive waste management and disposal decisions

  4. A region in turbulence

    International Nuclear Information System (INIS)

    Proulx, M.U.; Nicolet, R.; Dufour, J.

    1998-01-01

    On July 19 and 20 of 1996, torrential rains provoked catastrophic floods in the Saguenay Region of Quebec. The overflowing waters of the region's rivers damaged 3000 residential buildings, completely destroyed another 426, and seriously affected the activities of 850 business establishments. In this comprehensive report, the physical causes and the social, economic, psychological, cultural, political and administrative consequences of this natural catastrophe are discussed by several experts. The report is divided into three parts. The first part describes the actual flooding conditions and the immediate response of local emergency services such as the Red Cross and the Saint-Vincent-de-Paul agencies. Reactions of the various public agencies and governments to the disaster are described in Part Two. Part Three of the document focuses on lessons to be drawn from this natural disaster, in particular the need to improve emergency relief strategies. The legal implications and consequences of the disaster are also discussed. refs., tabs., figs

  5. Banks, regions and development

    Directory of Open Access Journals (Sweden)

    Pietro Alessandrini

    2003-03-01

    Full Text Available From the 1980s onwards the banking sectors in all the industrialised countries have been experiencing intense restructuring, aggregation and consolidation, radically changing their ownership structures and geography. Whatever the reasons behind such restructuring processes, the globalisation of the credit markets, the consolidation of banking structures, the removal of barriers to the free location of banks and their penetration of peripheral markets pose two main questions. Will integration of the banking systems lead to a narrowing or a widening of the development gap between regions? What relations will there be between financial centres and the periphery, and how will financial labour be divided between national (international banks and local (regional banks? The aim of this paper is to address such questions in the light of recent developments in the theoretical and empirical literature on financial integration.

  6. Entropy region and convolution

    Czech Academy of Sciences Publication Activity Database

    Matúš, František; Csirmaz, L.

    2016-01-01

    Roč. 62, č. 11 (2016), s. 6007-6018 ISSN 0018-9448 R&D Projects: GA ČR GA13-20012S Institutional support: RVO:67985556 Keywords : entropy region * information-theoretic inequality * polymatroid Subject RIV: BD - Theory of Information Impact factor: 2.679, year: 2016 http://library.utia.cas.cz/separaty/2016/MTR/matus-0465564.pdf

  7. Disarmament through regional dialogue

    International Nuclear Information System (INIS)

    Kono, Yuhei

    1994-01-01

    The role played by the United Nations in the pursuit of peace and disarmament and in support of the construction of a stable order in the region is very great. The attitude of Japan as a 'peace loving state' shown by its support to Non-proliferation is expressed by its high appreciation of the fact that this Second United Nations Conference in Hiroshima has been convened, as such exchanges of views constitute an important aspect of the process of disarmament

  8. Regional Renewable Energy Cooperatives

    Science.gov (United States)

    Hazendonk, P.; Brown, M. B.; Byrne, J. M.; Harrison, T.; Mueller, R.; Peacock, K.; Usher, J.; Yalamova, R.; Kroebel, R.; Larsen, J.; McNaughton, R.

    2014-12-01

    We are building a multidisciplinary research program linking researchers in agriculture, business, earth science, engineering, humanities and social science. Our goal is to match renewable energy supply and reformed energy demands. The program will be focused on (i) understanding and modifying energy demand, (ii) design and implementation of diverse renewable energy networks. Geomatics technology will be used to map existing energy and waste flows on a neighbourhood, municipal, and regional level. Optimal sites and combinations of sites for solar and wind electrical generation (ridges, rooftops, valley walls) will be identified. Geomatics based site and grid analyses will identify best locations for energy production based on efficient production and connectivity to regional grids and transportation. Design of networks for utilization of waste streams of heat, water, animal and human waste for energy production will be investigated. Agriculture, cities and industry produce many waste streams that are not well utilized. Therefore, establishing a renewable energy resource mapping and planning program for electrical generation, waste heat and energy recovery, biomass collection, and biochar, biodiesel and syngas production is critical to regional energy optimization. Electrical storage and demand management are two priorities that will be investigated. Regional scale cooperatives may use electric vehicle batteries and innovations such as pump storage and concentrated solar molten salt heat storage for steam turbine electrical generation. Energy demand management is poorly explored in Canada and elsewhere - our homes and businesses operate on an unrestricted demand. Simple monitoring and energy demand-ranking software can easily reduce peaks demands and move lower ranked uses to non-peak periods, thereby reducing the grid size needed to meet peak demands. Peak demand strains the current energy grid capacity and often requires demand balancing projects and

  9. Cleantech Region Stedendriehoek

    NARCIS (Netherlands)

    Heidema, A. (Andries)

    2016-01-01

      http://dx.doi.org/10.14261/postit/B1917A51-5AA6-4723-9EDF87AB64EC267B Keynote speech. In 2015 and 2016, Saxion University of Applied Sciences organized the 2nd and 3rd edition of the Regional Innovation and Entrepreneurship Conference (RIEC).  It just so happens that innovation and

  10. Regionalization Lessons from Denmark

    DEFF Research Database (Denmark)

    Vrangbæk, Karsten

    2016-01-01

    and coordination. Regions and municipalities in Denmark are governed by directly elected democratic councils. The Danish case is thus an example of democratic decentralization, but within a framework of national coordination and fiscal control. In spite of the difference in size and historical traditions...... there are also many similarities between Canada and Denmark, particularly in terms of health and social policy goals and aspirations, and in terms of the commitment to a comprehensive, universal healthcare system. These similarities provide interesting opportunities for comparison....

  11. Region 9 Tribal Lands

    Science.gov (United States)

    Dataset of all Indian Reservations in US EPA Region 9 (California, Arizona and Nevada) with some reservation border areas of adjacent states included (adjacent areas of Colorado, New Mexico and Utah). Reservation boundaries are compiled from multiple sources and are derived from several different source scales. Information such as reservation type, primary tribe name are included with the feature dataset. Public Domain Allotments are not included in this data set.

  12. Regional greenhouse climate effects

    International Nuclear Information System (INIS)

    Hansen, J.; Rind, D.; Delgenio, A.; Lacis, A.; Lebedeff, S.; Prather, M.; Ruedy, R.; Karl, T.

    1990-01-01

    The authors discuss the impact of an increasing greenhouse effect on three aspects of regional climate: droughts, storms and temperature. A continuous of current growth rates of greenhouse gases causes an increase in the frequency and severity of droughts in their climate model simulations, with the greatest impacts in broad regions of the subtropics and middle latitudes. But the greenhouse effect enhances both ends of the hydrologic cycle in the model, that is, there is an increased frequency of extreme wet situations, as well as increased drought. Model results are shown to imply that increased greenhouse warming will lead to more intense thunderstorms, that is, deeper thunderstorms with greater rainfall. Emanual has shown that the model results also imply that the greenhouse warming leads to more destructive tropical cyclones. The authors present updated records of observed temperatures and show that the observations and model results, averaged over the globe and over the US, are generally consistent. The impacts of simulated climate changes on droughts, storms and temperature provide no evidence that there will be regional winners if greenhouse gases continue to increase rapidly

  13. SERVICES AND REGIONAL DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Sven ILLERIS

    2009-12-01

    Full Text Available The purpose of this contribution is to discuss what roles the different economic sectors, and in particular services activities (the tertiary sector play in regional development, understood as growth in production, incomes and employment in weakly developedregions. This question is approached in two ways. The contribution first contains a – primarily theoretical – re-examination of the so-called economic base model, which states that services play a passive role in regional development. The discussion leads to substantial modifications of the model. The second approach is more empirical. It will take as its point of departure the proposition – often heard, but rarely examined – that since service activities are more concentrated in big cities than other activities and in recent decades have shown higher growth rates than other economic activities, it follows that the economic development is now pulled towards big city regions. Examined by way of a statistical analysisin Denmark and France, this proposition could not be verified.

  14. Alligator Rivers Region

    International Nuclear Information System (INIS)

    1992-01-01

    An introduction to the Alligator Rivers Region is presented. It contains general information regarding the physiography, climate, hydrology and mining of the region. The Alligator Rivers Region is within an ancient basin, the Pine Creek Geosyncline, which has an area of approximately 66000 km 2 . The Geosyncline has a history of mineral exploitation dating back to 1865, during which time 16 metals have been extracted (silver, arsenic, gold, bismuth, cadmium, cobalt, copper, iron, manganese, molybdenum, lead, tin, tantalum, uranium, tungsten, zinc). Uranium exploration in the Pine Creek Geosyncline was stimulated by the discovery in 1949 of secondary uranium mineralisation near Rum June, 70 km south-east of Darwin. This was followed by a decade of intense exploration activity resulting in the discoveries of economic uranium ore bodies at Rum Jungle and in the upper reaches of the South Alligator River Valley. All the known major uranium deposits of the East Alligator River uranium field have been discovered since 1969. The present known resources of the Geosyncline are approximately 360 000 tonnes of contained U 3 O 8 . 2 refs., 2 figs., 1 tab

  15. Andean region study

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    New opportunities for climate change mitigation arising from a higher energy integration among Andean Pact nations were analysed within the framework of the UNEP/GEF Project. Apart from the search for regional mitigation actions, the study was mainly aimed at detecting methodological problems which arise when passing from a strictly national view to the co-ordination of regional actions to deal with climate change. In accordance with the available resources and data, and in view of the mainly methodological nature of the project, it was decided to analyse the opportunities to delve into the energy integration of the Region as regards electricity and natural gas industries and their eventual impact on the emission of greenhouse gases. Although possibilities of setting up electricity and natural gas markets are real, their impacts on GHG emission from the energy system would not prove substantially higher than those which the nations could achieve through the use of their own energy resources, in view that the Andean systems are competitive rather than complementary. More in-depth studies and detail information will be required - unavailable for the present study - to be able to properly evaluate all benefits associated with higher energy integration. Nevertheless, the supply of natural gas to Ecuador seems to be the alternative with the highest impact on GHG emission. If we were to analyse the supply and final consumption of energy jointly, we would most certainly detect additional mitigation options resulting from higher co-operation and co-ordination in the energy field. (EHS)

  16. Regional Shelter Analysis Methodology

    Energy Technology Data Exchange (ETDEWEB)

    Dillon, Michael B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dennison, Deborah [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kane, Jave [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Walker, Hoyt [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Miller, Paul [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-08-01

    The fallout from a nuclear explosion has the potential to injure or kill 100,000 or more people through exposure to external gamma (fallout) radiation. Existing buildings can reduce radiation exposure by placing material between fallout particles and exposed people. Lawrence Livermore National Laboratory was tasked with developing an operationally feasible methodology that could improve fallout casualty estimates. The methodology, called a Regional Shelter Analysis, combines the fallout protection that existing buildings provide civilian populations with the distribution of people in various locations. The Regional Shelter Analysis method allows the consideration of (a) multiple building types and locations within buildings, (b) country specific estimates, (c) population posture (e.g., unwarned vs. minimally warned), and (d) the time of day (e.g., night vs. day). The protection estimates can be combined with fallout predictions (or measurements) to (a) provide a more accurate assessment of exposure and injury and (b) evaluate the effectiveness of various casualty mitigation strategies. This report describes the Regional Shelter Analysis methodology, highlights key operational aspects (including demonstrating that the methodology is compatible with current tools), illustrates how to implement the methodology, and provides suggestions for future work.

  17. The metabolism of 15-p-[123I]-iodophenylpentadecanoic acid in a surgically induced canine model of regional ischemia

    International Nuclear Information System (INIS)

    Hudon, M.P.J.; Jamieson, W.R.E.; Qayumi, A.K.; Lyster, D.M.; Sartori, C.; Dougan, H.

    1990-01-01

    The purpose of this study was to examine the longitudinal effect of gradual coronary occlusion on regional myocardial metabolism of 15-p- 123 I-iodophenyl pentadecanoic acid ([ 123 I]IPPA). Adult dogs were images using [ 123 I]IPPA and planar gamma imaging. A thoracotomy as performed and an ameroid constricter of appropriate size permanently positioned on the left anterior descending artery. The dogs were imaged after injection of 3-5 mCi [ 123 I]IPPA at various times over a 2-week period. With imaging on days 7 and 14, the dogs were paced at a rate of 185. Time-activity curves were generated and t 1/2 values calculated using monoexponential curve fitting. Results indicate a significant increase in t 1/2 between control and 14 days after surgery in the apical wall (29±7 to 53±18 min; P 1/2 in the lateral wall, this was not significant (27±8 to 78±99 min; P>0.05). There was no significant change in t 1/2 in the septal wall (27±9 to 33±8 min; P>0.05). We conclude that [ 123 I]IPPA is a useful indicator of developing myocardial ischemia. (orig.)

  18. A subspecies of region crossing change, region freeze crossing change

    OpenAIRE

    Inoue, Ayumu; Shimizu, Ryo

    2016-01-01

    We introduce a local move on a link diagram named a region freeze crossing change which is close to a region crossing change, but not the same. We study similarity and difference between region crossing change and region freeze crossing change.

  19. Pulsatile flow of viscous and viscoelastic fluids in constricted tubes

    Energy Technology Data Exchange (ETDEWEB)

    Javadzadegan, A.; Esmaeili, M.; Majidi, S. [University of Tehran, Tehran (Iran, Islamic Republic of); Fakhimghanbarzadeh, B. [Sharif University of Technology, Tehran (Iran, Islamic Republic of)

    2009-09-15

    The unsteady flow of blood through stenosed artery, driven by an oscillatory pressure gradient, is studied. An appropriate shape of the time-dependent stenoses which are overlapped in the realm of the formation of arterial narrowing is constructed mathematically. A mathematical model is developed by treating blood as a non-Newtonian fluid characterized by the Oldroyd-B and Cross models. A numerical scheme has been used to solve the unsteady nonlinear Navier- stokes equations in cylindrical coordinate system governing flow, assuming axial symmetry under laminar flow condition so that the problem effectively becomes two-dimensional. Finite difference technique was used to investigate the effects of parameters such as pulsatility, non-Newtonian properties and the flow time on the velocity components, the rate of flow, and the wall shear stress through their graphical representations quantitatively at the end of the paper in order to validate the applicability of the present improved mathematical model under consideration

  20. Pulsatile flow of viscous and viscoelastic fluids in constricted tubes

    International Nuclear Information System (INIS)

    Javadzadegan, A.; Esmaeili, M.; Majidi, S.; Fakhimghanbarzadeh, B.

    2009-01-01

    The unsteady flow of blood through stenosed artery, driven by an oscillatory pressure gradient, is studied. An appropriate shape of the time-dependent stenoses which are overlapped in the realm of the formation of arterial narrowing is constructed mathematically. A mathematical model is developed by treating blood as a non-Newtonian fluid characterized by the Oldroyd-B and Cross models. A numerical scheme has been used to solve the unsteady nonlinear Navier- stokes equations in cylindrical coordinate system governing flow, assuming axial symmetry under laminar flow condition so that the problem effectively becomes two-dimensional. Finite difference technique was used to investigate the effects of parameters such as pulsatility, non-Newtonian properties and the flow time on the velocity components, the rate of flow, and the wall shear stress through their graphical representations quantitatively at the end of the paper in order to validate the applicability of the present improved mathematical model under consideration

  1. Adaptive Gaze Strategies for Locomotion with Constricted Visual Field

    Directory of Open Access Journals (Sweden)

    Colas N. Authié

    2017-07-01

    Full Text Available In retinitis pigmentosa (RP, loss of peripheral visual field accounts for most difficulties encountered in visuo-motor coordination during locomotion. The purpose of this study was to accurately assess the impact of peripheral visual field loss on gaze strategies during locomotion, and identify compensatory mechanisms. Nine RP subjects presenting a central visual field limited to 10–25° in diameter, and nine healthy subjects were asked to walk in one of three directions—straight ahead to a visual target, leftward and rightward through a door frame, with or without obstacle on the way. Whole body kinematics were recorded by motion capture, and gaze direction in space was reconstructed using an eye-tracker. Changes in gaze strategies were identified in RP subjects, including extensive exploration prior to walking, frequent fixations of the ground (even knowing no obstacle was present, of door edges, essentially of the proximal one, of obstacle edge/corner, and alternating door edges fixations when approaching the door. This was associated with more frequent, sometimes larger rapid-eye-movements, larger movements, and forward tilting of the head. Despite the visual handicap, the trajectory geometry was identical between groups, with a small decrease in walking speed in RPs. These findings identify the adaptive changes in sensory-motor coordination, in order to ensure visual awareness of the surrounding, detect changes in spatial configuration, collect information for self-motion, update the postural reference frame, and update egocentric distances to environmental objects. They are of crucial importance for the design of optimized rehabilitation procedures.

  2. EFFECTS OF CONSTRICTION IN A MECHANICAL MODEL OF LUNG PARENCHYMA

    Directory of Open Access Journals (Sweden)

    Clara Ionescu

    2011-02-01

    Full Text Available The demands on materials’ properties, for medical purposes, largely depend on the site of application and the function it has to restore. Ideally a replacement material should mimic the living tissue from a mechanical, chemical, biological, and functional point of view. The estimation of the mechanical characteristics of blood vessel walls, the values of modulus of elasticity and the coefficient of transversal strain serve to determine some aspects of reconstruction of blood vessels. The tissue growth, the blood clotting and the affecting blood elements are influenced by surface energy. In this study, we address the possibility to investigate the mechanical properties of the airways in a simulation study of the human lungs.

  3. Adaptive Gaze Strategies for Locomotion with Constricted Visual Field

    Science.gov (United States)

    Authié, Colas N.; Berthoz, Alain; Sahel, José-Alain; Safran, Avinoam B.

    2017-01-01

    In retinitis pigmentosa (RP), loss of peripheral visual field accounts for most difficulties encountered in visuo-motor coordination during locomotion. The purpose of this study was to accurately assess the impact of peripheral visual field loss on gaze strategies during locomotion, and identify compensatory mechanisms. Nine RP subjects presenting a central visual field limited to 10–25° in diameter, and nine healthy subjects were asked to walk in one of three directions—straight ahead to a visual target, leftward and rightward through a door frame, with or without obstacle on the way. Whole body kinematics were recorded by motion capture, and gaze direction in space was reconstructed using an eye-tracker. Changes in gaze strategies were identified in RP subjects, including extensive exploration prior to walking, frequent fixations of the ground (even knowing no obstacle was present), of door edges, essentially of the proximal one, of obstacle edge/corner, and alternating door edges fixations when approaching the door. This was associated with more frequent, sometimes larger rapid-eye-movements, larger movements, and forward tilting of the head. Despite the visual handicap, the trajectory geometry was identical between groups, with a small decrease in walking speed in RPs. These findings identify the adaptive changes in sensory-motor coordination, in order to ensure visual awareness of the surrounding, detect changes in spatial configuration, collect information for self-motion, update the postural reference frame, and update egocentric distances to environmental objects. They are of crucial importance for the design of optimized rehabilitation procedures. PMID:28798674

  4. Sunglasses with thick temples and frame constrict temporal visual field.

    Science.gov (United States)

    Denion, Eric; Dugué, Audrey Emmanuelle; Augy, Sylvain; Coffin-Pichonnet, Sophie; Mouriaux, Frédéric

    2013-12-01

    Our aim was to compare the impact of two types of sunglasses on visual field and glare: one ("thick sunglasses") with a thick plastic frame and wide temples and one ("thin sunglasses") with a thin metal frame and thin temples. Using the Goldmann perimeter, visual field surface areas (cm²) were calculated as projections on a 30-cm virtual cupola. A V4 test object was used, from seen to unseen, in 15 healthy volunteers in the primary position of gaze ("base visual field"), then allowing eye motion ("eye motion visual field") without glasses, then with "thin sunglasses," followed by "thick sunglasses." Visual field surface area differences greater than the 14% reproducibility error of the method and having a p thick sunglasses." This decrease was most severe in the temporal quadrant (-33%; p thick sunglasses" than with the "thin sunglasses" (p thick sunglasses" is offset by the much poorer ability to use lateral space exploration; this results in a loss of most, if not all, of the additional visual field gained through eye motion.

  5. Constriction of the Stomach by an Unusual Peritoneal Band.

    Science.gov (United States)

    Kassem, Mohammad W; Patel, Mayank; Iwanaga, Joe; Loukas, Marios; Tubbs, R Shane

    2018-02-03

    Compression of intraabdominal contents can occur due to anomalous congenital bands. Herein, we describe, to our knowledge, the first case of compression of the stomach by an anomalous band extending from the lesser omentum to the greater omentum. Relevant literature is reviewed and the clinical implications of such a case are described.

  6. Recruitment, diversity and the influence of constrictions on the ...

    African Journals Online (AJOL)

    1986-09-15

    Sep 15, 1986 ... Eilandvlei has an intermediate diversity with the Wildemess lagoon supporting the most diverse ... deflation basin which has been artificially connected by a .... water levels approached high tide and decreased towards low.

  7. Hawaii Regional Sediment Management (RSM): Regional Sediment Budget for the West Maui Region

    Science.gov (United States)

    2016-06-01

    ER D C/ CH L TR -1 6- 5 Regional Sediment Management (RSM) Program Hawaii Regional Sediment Management (RSM): Regional Sediment Budget...acwc.sdp.sirsi.net/client/default. Regional Sediment Management (RSM) Program ERDC/CHL TR-16-5 June 2016 Hawaii Regional Sediment Management...distribution is unlimited. Prepared for U.S. Army Corps of Engineers Washington, DC 20314-1000 Under Project 454632, “ Hawaii Regional Sediment Management

  8. Regional Studies Program

    International Nuclear Information System (INIS)

    Parzyck, D.C.

    1978-01-01

    Progress is reported on methodology studies with regard to hydrologic analysis; atmospheric transport; forest growth models; distribution of sensitive species; agricultural analysis; and environmental objectives in energy facility siting. National coal utilization assessment studies are reported with regard to technology characterization; air quality impacts; water resources; regional characterization; forest impacts; coal extraction impacts on sensitive animal species; and health impacts. The following special projects were carried out: water resource aspects of inexhaustible technology deployment; ecological constraints on the rapidly expanded use of coal; and U.S. coal and the global carbon problem

  9. Region & Gateway Mapping

    OpenAIRE

    Schröter, Derik

    2007-01-01

    State-of-the-art robot mapping approaches are capable of acquiring impressively accurate 2D and 3D models of their environments. To the best of our knowledge, few of them represent structure or acquire models of task-relevant objects. In this work, a new approach to mapping of indoor environments is presented, in which the environment structure in terms of regions and gateways is automatically extracted, while the robot explores. Objects, both in 2D and 3D, are modeled explicitly in those map...

  10. Regional Legal Assistance

    Directory of Open Access Journals (Sweden)

    Abdul Fatah

    2015-06-01

    Full Text Available Legal aid policy in the area carried out on several considerations including: Implementation of the authority given to the legal aid act, granting the guarantee and protection of access to justice and equality before the law in the area, equitable distribution of justice and increase public awareness and understanding of the law, and legal implications that accompanied the emergence of the right to legal counsel without pay and the right to choose the legal settlement. How To Cite Fatah, A. (2015. Regional Legal Assistance. Rechtsidee, 2(1, 1-10. doi:http://dx.doi.org/10.21070/jihr.v2i1.7

  11. OECD Reviews of Regional Innovation

    DEFF Research Database (Denmark)

    Maguire, Karen; Marsan, Giulia Ajmone; Nauwelaers, Claire

    This book examines regional innovation in central and southern Denmark, looking at its role in the economy, its governance and policy context and regional strategies for innovation driven growth.......This book examines regional innovation in central and southern Denmark, looking at its role in the economy, its governance and policy context and regional strategies for innovation driven growth....

  12. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  13. Active region structures in the transition region and corona

    International Nuclear Information System (INIS)

    Webb, D.F.

    1981-01-01

    Observational aspects of the transition region and coronal structures of the solar active region are reviewed with an emphasis on imaging of the plasma loops which act as tracers of the magnetic flux loops. The study of the basic structure of an active region is discussed in terms of the morphological and thermal classifications of active region loops, including umbral structures, and observational knowledge of the thermal structure of loops is considered in relation to scaling laws, emission measures and the structures of individual loops. The temporal evolution of active region loop structures is reviewed with emphasis on ephemeral regions and the emergence of active regions. Planned future spaceborne observations of active region loop structures in the EUV and soft X-ray regions are also indicated

  14. Regional climate change scenarios

    International Nuclear Information System (INIS)

    Somot, S.

    2005-01-01

    Because studies of the regional impact of climate change need higher spatial resolution than that obtained in standard global climate change scenarios, developing regional scenarios from models is a crucial goal for the climate modelling community. The zoom capacity of ARPEGE-Climat, the Meteo-France climate model, allows use of scenarios with a horizontal resolution of about 50 km over France and the Mediterranean basin. An IPCC-A2 scenario for the end of the 21. century in France shows higher temperatures in each season and more winter and less summer precipitation than now. Tuning the modelled statistical distributions to observed temperature and precipitation allows us to study changes in the frequency of extreme events between today's climate and that at the end of century. The frequency of very hot days in summer will increase. In particular, the frequency of days with a maximum temperature above 35 deg C will be multiplied by a factor of 10, on average. In our scenario, the Toulouse area and Provence might see one quarter of their summer days with a maximum temperature above 35 deg C. (author)

  15. Transient regional osteoporosis.

    Science.gov (United States)

    Cano-Marquina, Antonio; Tarín, Juan J; García-Pérez, Miguel-Ángel; Cano, Antonio

    2014-04-01

    Transient regional osteoporosis (TRO) is a disease that predisposes to fragility fracture in weight bearing joints of mid-life women and men. Pregnant women may also suffer the process, usually at the hip. The prevalence of TRO is lower than the systemic form, associated with postmenopause and advanced age, but may be falsely diminished by under-diagnosis. The disease may be uni- or bilateral, and may migrate to distinct joints. One main feature of TRO is spontaneous recovery. Pain and progressive limitation in the functionality of the affected joint(s) are key symptoms. In the case of the form associated with pregnancy, difficulties in diagnosis derive from the relatively young age at presentation and from the clinical overlapping with the frequent aches during gestation. Densitometric osteoporosis in the affected region is not always present, but bone marrow edema, with or without joint effusion, is detected by magnetic resonance. There are not treatment guidelines, but the association of antiresorptives to symptomatic treatment seems to be beneficial. Surgery or other orthopedic interventions can be required for specific indications, like hip fracture, intra-medullary decompression, or other. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Regional Population Projections for China

    OpenAIRE

    Toth, F.L.; Cao, G.-Y.; Hizsnyik, E.

    2003-01-01

    Considering the size and the regional diversity of China, a prudent analysis of many economic and policy issues needs to consider the regional differences in climate, soil, water, and other natural resource endowments, population density, and social and economic development. Future-oriented multi-regional assessments require regionally detailed scenarios. A key component of such scenarios is the evolution of the population in different regions. For studies of land-use change and agriculture, ...

  17. Investigation of the short argon arc with hot anode. I. Numerical simulations of non-equilibrium effects in the near-electrode regions

    Science.gov (United States)

    Khrabry, A.; Kaganovich, I. D.; Nemchinsky, V.; Khodak, A.

    2018-01-01

    The atmospheric pressure arcs have recently found application in the production of nanoparticles. The distinguishing features of such arcs are small length and hot ablating anode characterized by intensive electron emission and radiation from its surface. We performed a one-dimensional modeling of argon arc, which shows that near-electrode effects of thermal and ionization non-equilibrium play an important role in the operation of a short arc, because the non-equilibrium regions are up to several millimeters long and are comparable to the arc length. The near-anode region is typically longer than the near-cathode region and its length depends more strongly on the current density. The model was extensively verified and validated against previous simulation results and experimental data. The Volt-Ampere characteristic (VAC) of the near-anode region depends on the anode cooling mechanism. The anode voltage is negative. In the case of strong anode cooling (water-cooled anode) when the anode is cold, temperature and plasma density gradients increase with current density, resulting in a decrease of the anode voltage (the absolute value increases). Falling VAC of the near-anode region suggests the arc constriction near the anode. Without anode cooling, the anode temperature increases significantly with the current density, leading to a drastic increase in the thermionic emission current from the anode. Correspondingly, the anode voltage increases to suppress the emission, and the opposite trend in the VAC is observed. The results of simulations were found to be independent of sheath model used: collisional (fluid) or collisionless model gave the same plasma profiles for both near-anode and near-cathode regions.

  18. Statistical downscaling of historical monthly mean winds over a coastal region of complex terrain. II. Predicting wind components

    Energy Technology Data Exchange (ETDEWEB)

    Kamp, Derek van der [University of Victoria, Pacific Climate Impacts Consortium, Victoria, BC (Canada); University of Victoria, School of Earth and Ocean Sciences, Victoria, BC (Canada); Curry, Charles L. [Environment Canada University of Victoria, Canadian Centre for Climate Modelling and Analysis, Victoria, BC (Canada); University of Victoria, School of Earth and Ocean Sciences, Victoria, BC (Canada); Monahan, Adam H. [University of Victoria, School of Earth and Ocean Sciences, Victoria, BC (Canada)

    2012-04-15

    A regression-based downscaling technique was applied to monthly mean surface wind observations from stations throughout western Canada as well as from buoys in the Northeast Pacific Ocean over the period 1979-2006. A predictor set was developed from principal component analysis of the three wind components at 500 hPa and mean sea-level pressure taken from the NCEP Reanalysis II. Building on the results of a companion paper, Curry et al. (Clim Dyn 2011), the downscaling was applied to both wind speed and wind components, in an effort to evaluate the utility of each type of predictand. Cross-validated prediction skill varied strongly with season, with autumn and summer displaying the highest and lowest skill, respectively. In most cases wind components were predicted with better skill than wind speeds. The predictive ability of wind components was found to be strongly related to their orientation. Wind components with the best predictions were often oriented along topographically significant features such as constricted valleys, mountain ranges or ocean channels. This influence of directionality on predictive ability is most prominent during autumn and winter at inland sites with complex topography. Stations in regions with relatively flat terrain (where topographic steering is minimal) exhibit inter-station consistencies including region-wide seasonal shifts in the direction of the best predicted wind component. The conclusion that wind components can be skillfully predicted only over a limited range of directions at most stations limits the scope of statistically downscaled wind speed predictions. It seems likely that such limitations apply to other regions of complex terrain as well. (orig.)

  19. Regional Healthcare Effectiveness

    Directory of Open Access Journals (Sweden)

    Olga Vladimirovna Kudelina

    2016-03-01

    Full Text Available An evaluation of healthcare systems effectiveness of the regions of the Russian Federation (federal districts was conducted using the Minmax method based on the data available at the United Interdepartmental Statistical Information System. Four groups of components (i.e. availability of resources; use of resources; access to resources and medical effectiveness decomposed into 17 items were analyzed. The resource availability was measured by four indicators, including the provision of doctors, nurses, hospital beds; agencies providing health care to the population. Use of resources was measured by seven indicators: the average hospital stay, days; the average bed occupancy, days; the number of operations per 1 physician surgical; the cost per unit volume of medical care: in outpatient clinics, day hospitals, inpatient and emergency care. Access to the resources was measured by three indicators: the satisfaction of the population by medical care; the capacity of outpatient clinics; the average number of visits to health facility. The medical effectiveness was also measured by three indicators: incidence with the "first-ever diagnosis of malignancy"; life expectancy at birth, years; the number of days of temporary disability. The study of the dynamics of the components and indexes for 2008–2012 allows to indicate a multidirectional influence on the regional healthcare system. In some federal districts (e.g. North Caucasian, the effectiveness decreases due to resource availability, in others (South, North Caucasian — due to the use of resources, in others (Far Eastern, Ural — due to access to resources. It is found that the effectiveness of the healthcare systems of the federal districts differs significantly. In addition, the built matrix proves the variability the of effectiveness (comparison of expenditures and results of healthcare systems of the federal districts of the Russian Federation: the high results can be obtained at high costs

  20. Strengthening regional safeguards

    International Nuclear Information System (INIS)

    Palhares, L.; Almeida, G.; Mafra, O.

    1996-01-01

    Nuclear cooperation between Argentina and Brazil has been growing since the early 1980's and as it grew, so did cooperation with the US Department of Energy (DOE). The Brazilian-Argentine Agency for Accounting and Control of Nuclear Materials (ABACC) was formed in December 1991 to operate the Common System of Accounting and Control of Nuclear Materials (SCCC). In April 1994, ABACC and the DOE signed an Agreement of Cooperation in nuclear material safeguards. This cooperation has included training safeguards inspectors, exchanging nuclear material measurement and containment and surveillance technology, characterizing reference materials, and studying enrichment plant safeguards. The goal of the collaboration is to exchange technology, evaluate new technology in Latin American nuclear facilities, and strengthen regional safeguards. This paper describes the history of the cooperation, its recent activities, and future projects. The cooperation is strongly supported by all three governments: the Republics of Argentina and Brazil and the United States

  1. Regional Course: Progress Report

    International Nuclear Information System (INIS)

    Cordero Calderon, C.F.

    1995-01-01

    They chose the Arenal's Dam and its damming, which has a control established from 1978. Currently, this technique is not applied in any other work of the 'Instituto Costarricense de Electricidad'. Their interest is to apply it in similar works. Among the projects that has been accomplished, they have the sampling of different sites water, the most representative to see the quality of water, the most representative waters Ions analysis of the damming, in underground waters of the region, in the available wells and for all of the river banks about the dam. With this technique they hope to obtain some parameters to define the water sources, the underground flow dynamics, the water turbulent stream, the mixings, the movement time and the relation to the damming. (author)

  2. Regional transmission subsystem planning

    Energy Technology Data Exchange (ETDEWEB)

    Costa Bortoni, Edson da [Quadrante Softwares Especializados Ltda., Itajuba, MG (Brazil); Bajay, Sergio Valdir; Barros Correia, Paulo de [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Santos, Afonso Henriques Moreira; Haddad, Jamil [Escola Federal de Engenharia de Itajuba, MG (Brazil)

    1994-12-31

    This work presents an approach for the planning of transmission systems by employing mixed--integer linear programming to obtain a cost and operating characteristics optimized system. The voltage loop equations are written in a modified form, so that, at the end of the analysis, the model behaves as a DC power flow, with the help of the two Kirchhoff`s laws, exempting the need of interaction with an external power flow program for analysis of the line loading. The model considers the occurrence of contingencies, so that the final result is a network robust to the most severe contingencies. This whole technique is adapted to the regional electric power transmission subsystems. (author) 9 refs., 4 figs.

  3. Regional Sociological Research Experience

    Directory of Open Access Journals (Sweden)

    Mikhail Vladimirovich Morev

    2015-11-01

    Full Text Available The article presents the experience of the Institute of Socio-Economic Development of Territories of RAS in conducting sociological research on the territory of the Vologda Oblast and the Northwestern Federal District. It describes the historical aspects of formation of the system for public opinion monitoring and examines its theoretical and methodological foundations. The author of the article analyzes the structure of monitoring indicators and provides a brief interpretation of research findings that reflect social wellbeing and social perception trends. In addition, the paper analyzes people’s attitude toward the activities of federal and regional authorities, trends in social well-being, consumer sentiment and also the complex indicator – the index of public sentiment in the region – developed by ISEDT RAS researchers. The results of sociological studies carried out at ISEDT RAS correlate with the dynamics of the all-Russian public opinion polls conducted by the Institute of Sociology of the Russian Academy of Sciences, the Russian Public Opinion Research Center (VCIOM, Levada-Center, etc. They indicate that Russian society gradually adapts to new conditions of life after the collapse of the USSR. Besides, opinion polls show the most important features of the post-Soviet Russian history at its present stage; they are associated with the intensification of international political relations, the consequences of the “Crimean spring” and the new challenges Russia’s economy is facing now. The article concludes that as global community, of which Russian society is part, is evolving, sociological knowledge begins to play an increasingly important role in administration and national security; this is associated with the greater importance attached to intangible development factors. Therefore, a necessary prerequisite for administration effectiveness in all its stages is to implement the results of sociological research on social

  4. Landslides of Palestinian Region

    Science.gov (United States)

    Alwahsh, H.

    2013-12-01

    Natural disasters are extreme sudden events caused by environmental and natural actors that take away the lives of many thousands of people each year and damage large amount of properties. They strike anywhere on earth, often without any warning. A risk maps of natural disaster are very useful to identify the places that might be adversely affected in the event of natural disaster. The earthquakes are one of natural disaster that have the greatest hazards and will cause loss of life and properties due to damaging the structures of building, dams, bridges. In addition, it will affect local geology and soil conditions. The site effects play an important role in earthquake risk because of its amplification or damping simulation. Another parameter in developing risk map is landslide, which is also one of the most important topics in site effect hazards. Palestine region has been suffering landslide hazards because of the topographical and geological conditions of this region. Most Palestine consists of mountainous area, which has great steep slopes and the type of soil is mainly grayish to yellowish silty clay (Marl Soil). Due to the above mentioned factors many landslides have been occurred from Negev south to the northern borders of Palestine. An example of huge and destruction landslide in a Palestine authority is the landslide in the White Mountain area in the city of Nablus, which occurred in 1997. The geotechnical and geophysical investigation as well as slope stability analysis should be considered in making landslide maps that are necessary to develop risk levels of the natural disaster. Landslides occurred in slopes that are created naturally or by human beings. Failure of soil mass occurs, and hence landslide of soil mass happen due to sliding of soil mass along a plane or curved surface. In general, the slopes become unstable when the shear stresses (driving force) generated in the soil mass exceed the available shearing resistance on the rupture surface

  5. MOVES regional level sensitivity analysis

    Science.gov (United States)

    2012-01-01

    The MOVES Regional Level Sensitivity Analysis was conducted to increase understanding of the operations of the MOVES Model in regional emissions analysis and to highlight the following: : the relative sensitivity of selected MOVES Model input paramet...

  6. American Red Cross Chapter Regions

    Data.gov (United States)

    Department of Homeland Security — The Regions are part of the national field level structure to support chapters. The Regions role is admistrative as well as provides oversight and program technical...

  7. CLIMATE IMPACTS ON REGIONAL WATER

    Science.gov (United States)

    The New England region (including the 6 New Englandstates plus upstate New York) offers a very diverse geography,matched by an equally diverse economy and humanpopulation. Livelihoods throughout the region are basedon service industries that depend heavily on comm...

  8. Region Sønderjylland-Schleswig

    DEFF Research Database (Denmark)

    Klatt, Martin

    2011-01-01

    3 bidrag til leksikon over Sønderjylland: Dansk Generalsekretariat, dansk foreningsliv, Region Sønderjylland-Schleswig......3 bidrag til leksikon over Sønderjylland: Dansk Generalsekretariat, dansk foreningsliv, Region Sønderjylland-Schleswig...

  9. Regional employment growth, shocks and regional industrial resilience

    DEFF Research Database (Denmark)

    Holm, Jacob Rubæk; Østergaard, Christian Richter

    2013-01-01

    The resilience of regional industries to economic shocks has gained a lot of attention in evolutionary economic geography recently. This paper uses a novel quantitative approach to investigate the regional industrial resilience of the Danish ICT sector to the shock following the burst of the dot......-com bubble. It is shown that regions characterised by small and young ICT service companies were more adaptable and grew more than others, while diversity and urbanisation increased the sensitivity to the business cycle after the shock. Different types of resilient regions are found: adaptively resilient......, rigidly resilient, entrepreneurially resilient and non-resilient regions....

  10. Regional Employment Growth, Shocks and Regional Industrial Resilience

    DEFF Research Database (Denmark)

    Holm, J.R.; Østergaard, Christian Richter

    2015-01-01

    The resilience of regional industries to economic shocks has gained a lot of attention in evolutionary economic geography recently. This paper uses a novel quantitative approach to investigate the regional industrial resilience of the Danish information and communication technology (ICT) sector...... to the shock following the burst of the dot.com bubble. It is shown that regions characterized by small and young ICT service companies were more adaptable and grew more than others, while diversity and urbanization increased the sensitivity to the business cycle after the shock. Different types of resilient...... regions are found: adaptively resilient, rigidly resilient, entrepreneurially resilient and non-resilient regions....

  11. Regional odontodysplasia: case report

    Directory of Open Access Journals (Sweden)

    Ana Carolina Magalhães

    2007-12-01

    Full Text Available Regional odontodysplasia (RO is a rare developmental anomaly involving both mesodermal and ectodermal dental components in a group of contiguous teeth. It affects the primary and permanent dentitions in the maxilla and mandible or both jaws. Generally it is localized in only one arch. The etiology of this dental anomaly is uncertain. Clinically, affected teeth have an abnormal morphology, are soft on probing and typically discolored, yellow or yellowish-brown. Radiographically, the affected teeth show a "ghostlike" appearance. This paper reports the case of a 5-year-old girl presenting this rare anomaly on the left side of the maxillary arch, which crossed the midline. The primary maxillary left teeth (except for the canine and the primary maxillary right central incisor were missing due to previous extractions. The permanent teeth had a "ghostlike" appearance radiographically. The treatment performed was rehabilitation with temporary partial acrylic denture and periodic controls. In the future, the extraction of affected permanent teeth and rehabilitation with dental implants will be evaluated. The presentation of this case adds valuable information to pediatric dentists to review special clinical and radiographic features of RO, which will facilitate the diagnosis and treatment of patients with this condition.

  12. regional economic development

    Directory of Open Access Journals (Sweden)

    Robert J. Stimson

    2005-01-01

    Full Text Available Este artículo propone que un círculo virtuoso para el desarrollo sostenible de una ciudad o región se logra a través de un proceso por el que el liderazgo proactivo y fuerte y las instituciones efectivas refuerzan la capacidad y aptitud de un lugar para hacer un mejor uso de sus dotaciones de recursos y lograr un mercado mejorado que consiga ser competitivo y emprendedor. Se propone que el funcionamiento de una ciudad o región en un punto en el tiempo y la trayectoria de su desarrollo económico a lo largo del tiempo puede representarse por su posición en un Cubo de resultados de Competitividad Regional. El artículo propone una nueva estructura de modelo donde el desarrollo económico y funcionamiento de una ciudad o región sea un resultado dependiente de cómo sus dotaciones de recursos y mercado ajustadas como variables cuasi-independientes son mediadas por la interacción entre el liderazgo, instituciones y espíritu empresarial como variables intervinientes. Las experiencias de un cierto número de casos de estudio de ciudades dentro de una variedad de lugares en EE.UU., Europa, Asia y Australia se exploran dentro de esa estructura.

  13. Brazil: anchoring the region

    International Nuclear Information System (INIS)

    Costamilan, L.C.L.

    1997-01-01

    The role of Brazil's state-run petroleum company, Petrobras, in providing a national supply of oil and natural gas and their products to Brazil was discussed. Petrobras is the sole state-run enterprise which carries out research, exploration, production, refining, imports, exports and the transportation of oil and gas in Brazil. Petrobras has built a complete and modern infrastructure made up of refineries, distribution bases, terminals and oil and gas pipelines. Recently (1995) the Brazilian National Assembly approved legislation that while confirming the state monopoly, also provides private contractors and other state-owned companies ways to participate in the petroleum sector. There exists a great potential for oil and gas in many of Brazil's 29 sedimentary basins. The regulatory legislation also created two new organs to deal with the partial deregulation of the petroleum sector, the National Board for Energy Policy and the National Petroleum Agency. The first of these will deal with policy issues, measures and guidelines regarding regional energy supply and demand and specific programs such as those affecting natural gas, fuel alcohol, coal and nuclear energy. The National Petroleum Agency will manage the hydrocarbon sector on behalf of the government. Its functions will include regulation and monitoring of the sector, managing the bidding process for concessions for exploration and production, and other related activities. The new legislation opens up new horizons for the Brazilian oil sector, providing opportunities for private investment, both domestic and foreign, as well as for new technological capabilities associated with these investments. 1 tab., 6 figs

  14. Regional identity and family

    Directory of Open Access Journals (Sweden)

    Tripković Gordana D.

    2003-01-01

    Full Text Available This paper is a continuation of a study on regionalisation and family, within the project named Sociological Aspects of Multiculturality and Regionalisation and their influence on the development of AP Vojvodina and the Republic of Serbia. The author focuses her attention to operationalisation of the theoretical and methodological premises that were developed in the previous paper (Tripković, 2002: 111-127, which means that it represents the results of the second phase of the research plan. This phase includes adjusting of theoretical concepts to the fieldwork displaying the results of the research and the analysis of the findings that put a family in the context of confronting different identities, above all national and regional. As possible "identity difference" was emphasized in the research, theoretical and methodological apparatus was adjusted to this goal. That is why in this paper the replies of interviewees that can suggest or reject the assumption that their national identity can influence significantly the evaluation of identity specificities are presented and analyzed, concerning more or less visible aspects of family life, like welfare status, relations between spouses, respect to the elder, family harmony, number of children, connections with relatives, etc.

  15. Planning for regional centers

    International Nuclear Information System (INIS)

    O'Donnell, A.J.

    1981-01-01

    In conclusion, the successful development and implementation of a multinational nuclear fuel cycle project will require that it be economically viable and satisfy the overlying interests and concerns of the participants. To assure success, it is absolutely essential that the initial planning, development of project criteria, and implementation be based on an authoritative understanding of the real needs of and benefits to all potential participants. The organizational structure for such a project must contain appropriate checks and balances that are sufficient to protect investors, owners, and consumers. Because of its special nature, these checks and balances must also provide for satisfying other important interests, such as an operating organization that addresses nonproliferation concerns and nuclear safeguards. The next logical step in the evolution of regional nuclear complexes is to determine whether such an approach is, indeed, economically viable, financially attractive, and operationally practical. Those who have succeeded in structuring nonnuclear, energy-related complexes currently operating throughout the world today should be looked to for developing the feasibility study of this concept in the nuclear field

  16. Regional differences in family poverty

    OpenAIRE

    Robert K. Triest

    1997-01-01

    Poverty rates vary considerably over regions, as do the demographic characteristics of the poor, but why the extent of poverty varies as much as it does across different regions of the country is not fully understood. This is an unfortunate gap in our knowledge, since it is difficult to analyze how recent changes in federal anti-poverty policy will affect the regional distribution of poverty without a better understanding of current regional differences in the poverty rate.> The main goal of ...

  17. Networking in gendered regional development

    OpenAIRE

    Mona Hedfeldt; Gun Hedlund

    2011-01-01

    The present Swedish regionalization process creates a lack of institutionalisation called the "regional mess" (Stegmann McCallion 2008:587). According to a state investigation, Sweden has a "fragmented growth- and development policy as well as a weak and unclear regional organisation of society" (SOU 2007:10:18). Old and new structures are intertwined and the question emerges if this situation may create a space for women regarding regional development (Hedfeldt & Hedlund 2009). A multi-level...

  18. Physics of fully ionized regions

    International Nuclear Information System (INIS)

    Flower, D.

    1975-01-01

    In this paper the term fully ionised regions is taken to embrace both planetary nebulae and the so-called 'H II' regions referred to as H + regions. Whilst these two types of gaseous nebulae are very different from an evolutionary standpoint, they are physically very similar, being characterised by photoionisation of a low-density plasma by a hot star. (Auth.)

  19. Regional futures: British Columbia

    International Nuclear Information System (INIS)

    Rees, W.

    1993-01-01

    Two paradigms that are the source of present-day economic development policies are described. The dominant paradigm is the expansionist world view that assumes economic growth is essentially unlimited, subject to certain constraints, and that the best way to monitor the human economy is through money flows. The steady-state or ecological world view assumes there are real constraints on material throughput and growth, and puts a significant emphasis on natural capital as a form of wealth which is distinct from economic or manufactured capital. Over the long term, each generation must receive from the previous generation at least an adequate stock of natural capital assets to ensure long-term sustainability. For every major category of consumption, such as food and energy, an ecological footprint can be assigned which represents the land needed to sustain a given pattern of consumption. For the lower mainland of British Columbia, this footprint would be about 22 times the actual land area; for the Netherlands, it would be about 15 times larger than the country itself. On a global basis, only about 1.7 hectares per capita of ecologically productive land is actually available, showing that Canadian material standards would not be sustainable on a global level. The steady-state approach to economic development would involve a local and regional approach from the bottom up, preferring small-scale labor-intensive enterprise. Trade would be limited to trading in real ecological surpluses, and value-added products would be made locally instead of shipping raw materials for processing elsewhere. 5 figs

  20. Regional and economic development

    International Nuclear Information System (INIS)

    Fortin, P.

    2004-01-01

    A leading economics expert was asked to list the economic advantages and disadvantages associated with electricity exports. This paper presents his expert opinion and presents a regional and economic analysis of the hydroelectric reserves that Hydro-Quebec should maintain in order to ensure long-term reliability of energy supplies while maintaining its potential for profitable exports. Electricity exports from Hydro-Quebec are extremely profitable for the province. From 1999 to 2003, net cumulative exports of 63 TWh brought in 4.2 billion dollars to the province of Quebec. This income was redistributed to Quebecers in the form of low energy prices. From 1994 to 2003, the average annual electricity export from Hydro-Quebec was 18 TWh which represents 11 per cent of all electricity delivered by the producer. Most of this export was sold to short-term markets. This ensures that electricity remains available to Quebec should the need arise. Long term sales agreement have never dominated the utility, and today account for only 1.5 per cent of electricity production. In order to ensure a secure electricity supply, Hydro-Quebec has kept a safety margin of 10 TWh through its large hydro-reservoirs. However, the year 2003 proved to be a difficult year for the producer due to low precipitation. The safety margin was completely consumed and the utility had to import electricity. A theoretical analysis of the market suggests that Hydro-Quebec's safety margin should be increased from 10 to 20 TWh to better meet energy demands during years of low precipitation. 1 tab., 2 figs

  1. Thinking regionally: narrative, the medical humanities and region.

    Science.gov (United States)

    Waddington, Keir

    2015-06-01

    Drawing on multiple literatures from history, geography, anthropology, sociology and literature, this essay asks questions about what we mean by region and why narratives of region should matter to the medical humanities. The essay surveys how region can be used as a lens of analysis, exploring the various academic approaches to region and their limitations. It argues that regions are dynamic but also unstable as a category of analysis and are often used uncritically by scholars. In encouraging scholars working in the medical humanities to be aware that regions are not simple objective or analytical boxes, the essay shows how an awareness of region helps challenge metropolitan whiggism and ideas of core and periphery to give a more prominent place to hinterlands, market towns and rural environments. Furthermore, the essay considers how incorporating region into our understanding of illness can offer new insights. It demonstrates the need for scholars to be attuned to the narratives constructed around regions, suggesting that regions can be viewed as discursive formations that provide a frame for understanding both collective and personal ideas of, and responses to, health and illness, disease and healing, to create what Megan Davies calls a more nuanced 'intellectual cartography'. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Food Independence of the Region

    Directory of Open Access Journals (Sweden)

    Vasiliy Vladimirovich Tyutyunik

    2016-06-01

    Full Text Available The article deals with such basic definitions as food security, food independence and food self- sufficiency of the region. The author shows the ambiguity problem of interpretations of these terms in the Russian legislation, which is especially evident in the transition from the national to the regional level. Using the example of legislative acts of some of the Russian Federation’s subjects the study demonstrates the incorrect use of mentioned terms. In author’s opinion, regional authorities in the Russian Federation must introduce amendments to the legislative documents concerning food security. To be more concrete, the regional authorities should either deny the goal of food independence for a particular region, or specify that the goal of reaching food independence for the region does not mean food self-sufficiency, but just import substitution on the regional level

  3. Edge Pedestal Control in Quiescent H-Mode Discharges in DIII-D Using Co Plus Counter Neutral Beam Injection

    International Nuclear Information System (INIS)

    Burrell, K.H.; Osborne, T.H.; Snyder, P.B.; West, W.P.; Chu, M.S.; Fenstermacher, M.E.; Gohil, P.; Solomon, W.M.

    2008-01-01

    We have made two significant discoveries in our recent studies of quiescent H-mode (QH-mode) plasmas in DIII-D. First, we have found that we can control the edge pedestal density and pressure by altering the edge particle transport through changes in the edge toroidal rotation. This allows us to adjust the edge operating point to be close to, but below the ELM stability boundary, maintaining the ELM-free state while allowing up to a factor of two increase in edge pressure. The ELM boundary is significantly higher in more strongly shaped plasmas, which broadens the operating space available for QH-mode and leads to improved core performance. Second, for the first time on any tokamak, we have created QH-mode plasmas with strong edge co-rotation; previous QH-modes in all tokamaks had edge counter rotation. This result demonstrates that counter NBI and edge counter rotation are not essential conditions for QH-mode. Both these investigations benefited from the edge stability predictions based on peeling-ballooning mode theory. The broadening of the ELM-stable region with plasma shaping is predicted by that theory. The theory has also been extended to provide a model for the edge harmonic oscillation (EHO) that regulates edge transport in the QH-mode. Many of the features of that theory agree with the experimental results reported either previously or in the present paper. One notable example is the prediction that co-rotating QH-mode is possible provided sufficient shear in the edge rotation can be created

  4. The quiescent H-mode regime for high performance edge localized mode-stable operation in future burning plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Garofalo, A. M., E-mail: garofalo@fusion.gat.com; Burrell, K. H.; Meneghini, O.; Osborne, T. H.; Paz-Soldan, C.; Smith, S. P.; Snyder, P. B.; Turnbull, A. D. [General Atomics, P.O. Box 85608, San Diego, California 92186-5608 (United States); Eldon, D.; Grierson, B. A.; Solomon, W. M. [Princeton Plasma Physics Laboratory, P.O. Box 451, Princeton, New Jersey 08543-0451 (United States); Hanson, J. M. [Columbia University, 2960 Broadway, New York, New York 10027-6900 (United States); Holland, C. [University of California San Diego, 9500 Gilman Dr., La Jolla, California 92093-0417 (United States); Huijsmans, G. T. A.; Liu, F.; Loarte, A. [ITER Organization, Route de Vinon sur Verdon, 13067 St Paul Lez Durance (France); Zeng, L. [University of California Los Angeles, P.O. Box 957099, Los Angeles, California 90095-7099 (United States)

    2015-05-15

    For the first time, DIII-D experiments have achieved stationary quiescent H-mode (QH-mode) operation for many energy confinement times at simultaneous ITER-relevant values of beta, confinement, and safety factor, in an ITER-like shape. QH-mode provides excellent energy confinement, even at very low plasma rotation, while operating without edge localized modes (ELMs) and with strong impurity transport via the benign edge harmonic oscillation (EHO). By tailoring the plasma shape to improve the edge stability, the QH-mode operating space has also been extended to densities exceeding 80% of the Greenwald limit, overcoming the long-standing low-density limit of QH-mode operation. In the theory, the density range over which the plasma encounters the kink-peeling boundary widens as the plasma cross-section shaping is increased, thus increasing the QH-mode density threshold. The DIII-D results are in excellent agreement with these predictions, and nonlinear magnetohydrodynamic analysis of reconstructed QH-mode equilibria shows unstable low n kink-peeling modes growing to a saturated level, consistent with the theoretical picture of the EHO. Furthermore, high density operation in the QH-mode regime has opened a path to a new, previously predicted region of parameter space, named “Super H-mode” because it is characterized by very high pedestals that can be more than a factor of two above the peeling-ballooning stability limit for similar ELMing H-mode discharges at the same density.

  5. Regional Trends in Electromobility - Regional Study North America

    OpenAIRE

    Turrentine, Tom; Garas, Dhalia

    2015-01-01

    The subproject “Regional Trends in Electro mobility” aims at identifying and analyzing major trends in the field of electro mobility. The trend analysis will monitor research effort and upcoming technologies, policies, products and market developments in different focus regions around the world continuously to enable a systematic analysis of global trends. The regional trend analysis for electro mobility is a major keystone for the project success and therefore cooperation with...

  6. Regional geochemical prospecting of uranium in the Amazon region

    International Nuclear Information System (INIS)

    Zenker, A.O.; Hohn, H.

    1982-01-01

    A regional geochemical prospecting program for uranium in the Serra dos Carajas area, south of Para, was performed by NUCLEBRAS using stream sediment samples obtained from other companies acting in this area. The results of the survey are presented compared to regional geology and an aerial total count map. The different data showed a good correlation, particularly in areas mapped regionally as granitic rocks. (Author) [pt

  7. Regional Stability & Lessons Learned in Regional Peace Building

    DEFF Research Database (Denmark)

    Vestenskov, David; Johnsen, Anton Asklund

    , as none of the countries is able to deal with the intrastate and interstate conflicts on its own. The conference Regional Stability & Lessons Learned in Regional Peace Building was the result of comprehensive cooperation between Pakistan’s National Defence University and the Royal Danish Defence College......The NATO-led intervention in Afghanistan is coming to an end, and the necessity of regional peace building solutions for the region’s security issues seems more exigent than ever before. Regional states have to come to terms with each other in some ways if violent extremists are to be countered...

  8. A Declining Region: Provincial Renaissance Revisited (Case of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Drozdova Yuliya

    2014-12-01

    Full Text Available The paper analyzes findings yielded by the empirical study performed in the framework of an RGNF grant entitled “Image of a region as a communicative strategy for the authorities and mass media”. The methods of study included expert survey and formal survey (N=1000, July-September 2013, studying the opinion of respondents who were either internal experts residing in the Volgograd region (N=20; May-September 2013 or external experts who reside outside the region but maintain stable ties with the representatives of state and municipal authorities, regional mass media and business. The findings indicate that the Volgograd region has fallen behind other modernized Russian regions, that young people tend to leave it, that a negative image of the region as a declining territory persists. Answers to the open question “What is unacceptable for you in the existing image of the Volgograd region?” revealed major problems determining the local context of a declining region, and those were issues associated with inefficient regional/municipal administration: “the condition of the roads”, “constant replacement of people in the administration”, “politics as a whole”, “a destitute region without a good manager”, “unemployment”, “countryside is dying off”, “indifference of the authorities”, “roads, housing and public utilities and the administration”, “the authorities are not responsible for the people”, “the authorities do not solve the problems of the city or its people”, “thieving”, “dishonest authorities”, “the region goes to rack and ruin, no kindergartens or jobs”, “one cannot even walk in the streets”, “corruption”, “a stagnant region with low pay”, “no perspectives in the future”, “the region is stagnating due to corruption among officials”. According to the local Census Bureau, the Volgograd region can be classified as a declining territory where the population decline

  9. Regional governance: strategies and disputes in health region management

    Directory of Open Access Journals (Sweden)

    Adriano Maia dos Santos

    2014-08-01

    Full Text Available OBJECTIVE To analyze the regional governance of the health systemin relation to management strategies and disputes. METHODOLOGICAL PROCEDURES A qualitative study with health managers from 19 municipalities in the health region of Bahia, Northeastern Brazil. Data were drawn from 17 semi-structured interviews of state, regional, and municipal health policymakers and managers; a focus group; observations of the regional interagency committee; and documents in 2012. The political-institutional and the organizational components were analyzed in the light of dialectical hermeneutics. RESULTS The regional interagency committee is the chief regional governance strategy/component and functions as a strategic tool for strengthening governance. It brings together a diversity of members responsible for decision making in the healthcare territories, who need to negotiate the allocation of funding and the distribution of facilities for common use in the region. The high turnover of health secretaries, their lack of autonomy from the local executive decisions, inadequate technical training to exercise their function, and the influence of party politics on decision making stand as obstacles to the regional interagency committee’s permeability to social demands. Funding is insufficient to enable the fulfillment of the officially integrated agreed-upon program or to boost public supply by the system, requiring that public managers procure services from the private market at values higher than the national health service price schedule (Brazilian Unified Health System Table. The study determined that “facilitators” under contract to health departments accelerated access to specialized (diagnostic, therapeutic and/or surgical services in other municipalities by direct payment to physicians for procedure costs already covered by the Brazilian Unified Health System. CONCLUSIONS The characteristics identified a regionalized system with a conflictive pattern of

  10. Cooperation in regional nuclear training

    International Nuclear Information System (INIS)

    Newstead, C.M.; Lee, D.S.; Spitalnik, J.

    1985-01-01

    This paper presents an overview of the nuclear training currently being undertaken in the countries of the co-authors, and considers the degree to which training problems are amenable to common solutions such as cooperative regional training programs. Different types of cooperation are discussed including the development of regional and international training centers, cooperative bilateral and multilateral training, and the proposed US International Nuclear Safety Training Academy. The paper provides suggestions of ways for enhancing regional cooperation

  11. Vietnam and the regional crisis

    DEFF Research Database (Denmark)

    Masina, Pietro Paolo

    2002-01-01

    inflows, should be understood in the broader frame of regional contingencies, and not be simplistically explained as investors' discontent (i.e., in order to pressure Vietnamese authorities into implementing a more orthodox neo-liberal agenda). And in a post-crisis regional economic reorganisation...... that Vietnam can successfully exploit market niches opened up by postcrisis regional economic reorganisation, thus offering some optimism for the country's immediate economic future....

  12. Fiscal competition and regional differentiation

    OpenAIRE

    Justman, Moshe; Thisse, Jacques-François; Van Ypersele, Tanguy

    2001-01-01

    Regions can benefit by offering infrastructure services that are differentiated. Competition between regions over potential investors is then less direct, allowing them to realize greater benefits from external investors. The two polar cases of full and incomplete information about investors' needs are studied. In both cases, there is regional differentiation. However, fiscal competition is efficient in the former case but not in the latter. Finally, it is shown that free entry in the loc...

  13. Regional energy facility siting analysis

    International Nuclear Information System (INIS)

    Eberhart, R.C.; Eagles, T.W.

    1976-01-01

    Results of the energy facility siting analysis portion of a regional pilot study performed for the anticipated National Energy Siting and Facility Report are presented. The question of cell analysis versus site-specific analysis is explored, including an evaluation of the difference in depth between the two approaches. A discussion of the possible accomplishments of regional analysis is presented. It is concluded that regional sitting analysis could be of use in a national siting study, if its inherent limits are recognized

  14. Regional radiation standards for population of Chelyabinsk region

    International Nuclear Information System (INIS)

    Kravtsova, Eh.M.; Zajtseva, Yh.A.; Panteleev, V.V.; Gavrilov, A.P.; Kolotygina, N.V.; Pudovkina, L.V.; Kravtsova, O.S.

    1996-01-01

    Regional radiation regulations for population exposures in Chelyabinsk region are developed which are to play the role of standard limits. The priority goal of setting standard level is to consolidate the achieved radioecological balance on the contaminated territories and to establish a mechanism of control over the activities of the facility and over the use of lands in restriction zone by the population

  15. Cloaks with multiple invisible regions

    International Nuclear Information System (INIS)

    Luo, Yang; Zhu, Shouzheng; He, Lianxing; Wang, Yu

    2011-01-01

    This paper proposes a general method of extending the effective invisible regions for both the shell-like interior cloak and the complementary media exterior cloak, without affecting their original cloaking regions. The proposed method is based on layered spatial mapping instead of the intact mapping. Certain interior or exterior invisible regions can be obtained by properly using a compressed or folded transformation in each space layer. Therefore, the proposal enables the as-designed cloaks to provide multiple invisible regions of different types simultaneously. Thus objects can be hidden in the interior cavity and/or in the exterior space, or even be embedded between the cloaking shells

  16. Productive Regions: Criteria and Classification

    Directory of Open Access Journals (Sweden)

    Vlasyuk L. I.

    2012-03-01

    Full Text Available An official statistical dataset for 80 territorial subjects of the Russian Federation for 2000, 2007 and 2009 has proved the hypothesis that, under the neoclassical concept, the resources move to regions with the highest marginal productivity of the factors of production, which leads to the accumulation of investment resources, while providing financial and social efficiency. Based on cluster analysis by three performance criteria, productive regions are identified, which are dominated by regions productive in the extraction of minerals. It is shown that the stability of the factors’ distribution in space determines the current and future specialization of regional economies

  17. THE REGIONAL STRUCTURE OF SERBIA

    Directory of Open Access Journals (Sweden)

    Marina TODOROVIC

    2009-12-01

    Full Text Available This paper approaches some of the characteristics of the regional development of Serbia, from the perspective of two models of territorial organization: one is governmental (administrative and statistical, and the other is functional. The imbalances in the levels of development of various territorial units of Serbia (regional disproportions are the consequence of many structural disharmonies, material limitations, and problems with populationstructure, during many years, all worsened by political and economic events at the end of the twentieth century. Also, in this paper we point out the main characteristics of undeveloped regions, the criteria with which we can define them, and a typology of the municipalities inside each such region.

  18. Regions and the Territorial Cohesion

    Directory of Open Access Journals (Sweden)

    Ioan Ianos

    2013-08-01

    Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.

  19. VT Regional Development Corporation (RDC)

    Data.gov (United States)

    Vermont Center for Geographic Information — The Department of Economic Development partners with the twelve Regional Development Corporations around the state to provide technical assistance. They can assist...

  20. Regional cooperation in transportation planning.

    Science.gov (United States)

    2012-02-01

    As Floridas urbanized areas grow and merge, : neighboring jurisdictions experience interrelated : problems and opportunities, and regional : cooperation becomes an imperative. In the : transportation sector, Floridas metropolitan : planning org...

  1. Latin America Region: Between Dependence and Autonomy in Regional Processes

    Directory of Open Access Journals (Sweden)

    Wendy Vaca Hernández

    2017-01-01

    Full Text Available The space called Latin America has a particular history marked by centuries of colonialism and coloniality. The latter concept implies that the basic structure of the colonial system has not changed even though formal independence has been achieved. For this reason, the subcontinent has fluctuated between dependence and the quest for autonomy. These successive cycles have manifested themselves both in the internal configurations and in the regional schemes that have been undertaken. This paper analyzes the construction and evolution of the idea of a region: Latin America and the Caribbean. To that end it examines the concepts of region, regionalism, what Latin America and the Caribbean implies, and what are the transformations in these ideas that have emerged from the regional configurations of the Union of South American Nations (UNASUR and the Community of Latin American and Caribbean States (CELAC as plural organisms with broad objectives.

  2. Survey, Culture, and Genome Analysis of Ocular Chlamydia trachomatis in Tibetan Boarding Primary Schools in Qinghai Province, China.

    Science.gov (United States)

    Feng, Le; Lu, Xinxin; Yu, Yonghui; Wang, Tao; Luo, Shengdong; Sun, Zhihui; Duan, Qing; Wang, Ningli; Song, Lihua

    2016-01-01

    Trachoma, the leading infectious cause of blindness worldwide, is an ancient human disease. Its existence in China can be traced back to as early as the twenty-seventh century BC. In modern China, the overall prevalence of trachoma has dramatically reduced, but trachoma is still endemic in many areas of the country. Here, we report that 26 (8%) of 322 students from two rural boarding schools of Qinghai province, west China, were identified as having ocular C. trachomatis infection; and 15 ocular C. trachomatis strains were isolated from these trachoma patients. Chlamydiae in 37 clinical samples were genotyped as type B based on ompA gene analyses. Three ompA variants with one or two in-between SNP differences in the second or fourth variable domain were found. C. trachomatis strains QH111L and QH111R were from the same patient's left and right conjunctival swabs, respectively, but their ompA genes have a non-synonymous base difference in the second variable domain. Moreover, this SNP only exists in this single sample, suggesting QH111L is a newly emerged ompA variant. Interestingly, chromosomal phylogeny analysis found QH111L clusters between a branch of two type B strains and a branch of both A and C strains, but is significantly divergent from both branches. Comparative chromosome analysis found that compared to sequences of reference B/TZ1A828/OT strain, 12 of 22 QH111L's chromosomal genes exhibiting more than nine SNPs have the best homology with reciprocal genes of UGT strains while 9 of 22 genes are closest to those of type C strains. Consistent with findings of UGT-type genetic features in the chromosome, the QH111L plasmid appears to be intermediate between UGT and classical ocular plasmids due to the existence of UGT-type SNPs in the QH111L plasmid. Moreover, the QH111L strain has a unique evolutionarily older cytotoxin region compared to cytotoxin regions of other C. trachomatis strains. The genome analyses suggest that the QH111L strain is derived from

  3. NOAA Miami Regional Library > Home

    Science.gov (United States)

    Library Collections Open Access Resources Research Tools E-resources NOAA S. and NOAA N.E. Library Institutional Repository DIVE INTO About the Library | Collections | Research Tools | Library Services & NOAA Miami Regional Library @ AOML & NHC NOAA Miami Regional Library at National Hurricane

  4. Regional Inflation and Financial Dollarization

    NARCIS (Netherlands)

    Brown, M.; de Haas, R.; Sokolov, V.

    2013-01-01

    Abstract: We exploit variation in consumer price inflation across 71 Russian regions to examine the relationship between the perceived stability of the local currency and financial dollarization. Our results show that regions with higher inflation experience an increase in the dollarization of

  5. Robustness Regions for Dichotomous Decisions.

    Science.gov (United States)

    Vijn, Pieter; Molenaar, Ivo W.

    1981-01-01

    In the case of dichotomous decisions, the total set of all assumptions/specifications for which the decision would have been the same is the robustness region. Inspection of this (data-dependent) region is a form of sensitivity analysis which may lead to improved decision making. (Author/BW)

  6. Metropolitan region of Copenhagen, Denmark

    DEFF Research Database (Denmark)

    Fertner, Christian

    the boundaries of the city further out. With the opening of the suburban train lines in 1934, the until today known finger structure was consolidated. A regional strategy, the “Fingerplan”, incorporating this structure was elaborated in 1947, but individual motorisation eroded some of the principles. Still...... in Sweden, forming a cross-border region with around 3.5 mio. inhabitants....

  7. Archives: Town and Regional Planning

    African Journals Online (AJOL)

    Items 1 - 12 of 12 ... Archives: Town and Regional Planning. Journal Home > Archives: Town and Regional Planning. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives. 1 - 12 of 12 ...

  8. Risk assessment: A regional approach

    Energy Technology Data Exchange (ETDEWEB)

    Palecek, M [Occupational Safety Research Institute, Prague (Czech Republic)

    1992-07-01

    An assessment of the region of North Bohemia which suffered from forty years socialist economy and heavy emissions from German and Polish factories and power stations is presented. The case strongly underlines the need for regional and international cooperation both in the assessment of hazards and finding solution to public health and environmental problems.

  9. Risk assessment: A regional approach

    International Nuclear Information System (INIS)

    Palecek, M.

    1992-01-01

    An assessment of the region of North Bohemia which suffered from forty years socialist economy and heavy emissions from German and Polish factories and power stations is presented. The case strongly underlines the need for regional and international cooperation both in the assessment of hazards and finding solution to public health and environmental problems

  10. Analysis of regional climate strategies in the Barents region

    Energy Technology Data Exchange (ETDEWEB)

    Himanen, S.; Inkeroeinen, J.; Latola, K.; Vaisanen, T.; Alasaarela, E.

    2012-11-15

    Climate change is a global phenomenon with especially harsh effects on the Arctic and northern regions. The Arctic's average temperature has risen at almost twice the rate as elsewhere in the past few decades. Since 1966, the Arctic land area covered by snow in early summer has shrunk by almost a fifth. The Barents Region consists of the northern parts of Norway, Sweden, Finland and Russia (i.e. the European part of Russia). Climate change will cause serious impacts in the Barents Region because of its higher density of population living under harsh climatic conditions, thus setting it apart from other Arctic areas. In many cases, economic activities, like tourism, rely on certain weather conditions. For this reason, climate change and adaptation to it is of special urgency for the region. Regional climate change strategies are important tools for addressing mitigation and adaptation to climate change as they can be used to consolidate the efforts of different stakeholders of the public and private sectors. Regional strategies can be important factors in achieving the national and international goals. The study evaluated how the national climate change goals were implemented in the regional and local strategies and programmes in northern Finland. The specific goal was to describe the processes by which the regional strategies were prepared and implemented, and how the work was expanded to include the whole of northern Finland. Finally, the Finnish preparatory processes were compared to case examples of processes for preparing climate change strategies elsewhere in the Barents Region. This analysis provides examples of good practices in preparing a climate change strategy and implementing it. (orig.)

  11. COMBINATION OF GOALS STRATEGY REGION

    Directory of Open Access Journals (Sweden)

    Denys Yu. Lapigin

    2015-01-01

    Full Text Available Currently the tools to identify strategicallyimportant objectives of regional development is not enough to build a developmentperspective, relying on something special,what distinguishes each region from therest. The article discusses approaches to the formation of the regional developmentstrategy, which is based on goals set by the results of the analysis of the main factors inthe development of the region. The study is based on the methodology of systems theoryand methods of strategic management. The most important results should include tools tobuild the tree of strategic objectives resultingfrom the implementation of the algorithm forconstructing planes of analysis and development of the region. The results can be used to develop a strategy for the developmentof socio-economic systems of various typesand forms.

  12. Croatia in a Regional Context

    Directory of Open Access Journals (Sweden)

    Branko Caratan

    2007-01-01

    Full Text Available In this paper, the author examines the regional context of Croatian politics, highlighting the main reasons for its significance: involvement of the region in war in recent history, the rootedness, aside from that, of extremely strong economic, political and cultural bonds between the countries in the region, and the importance of cooperation in the region for EU accession and further economic development. On these grounds, the author seeks to examine the possibility for stabilisation of the region, and to establish what interests the neighbouring countries such as Italy, Austria, Hungary and others have in strenghtening the bonds with the new democracies in Central and Southeast Europe. All of this eventually provides the answer to the question what is the interest of the EU in this region’s stability and in its admission to the European Union

  13. Dust in H II regions

    International Nuclear Information System (INIS)

    Isobe, S.

    1977-01-01

    Several pieces of evidence indicate that H II regions may contain dust: 1) the continuum light scattered by dust grains (O'Dell and Hubbard, 1965), 2) thermal radiation from dust grains at infrared wavelengths (Ney and Allen, 1969), 3) the abnormal helium abundance in some H II regions (Peimbert and Costero, 1969), etc. Although observations of the scattered continuum suggest that the H II region cores may be dust-free, dust grains and gas must be well mixed in view of the infrared observations. This difficulty may be solved by introducing globules with sizes approximately 0.001 pc. These globules and the molecular clouds adjacent to H II regions are the main sources supplying dust to H II regions. (Auth.)

  14. Initiatives for regional dialogue consideration of regional disarmament guidelines

    International Nuclear Information System (INIS)

    Marschik, R.

    1994-01-01

    The General Assembly of the United Nations adopted guidelines and recommendations for regional approaches to disarmament within the context of global security. The guidelines contain 52 principles on: relationship between regional disarmament, arm limitation and global security; general guidelines and recommendations for regional disarmament efforts; possible ways and means to assist and implement these efforts; possible role of the United Nations in aiding these efforts. Experiences gained in Europe and Near East are analysed in the framework of the situation in Northeast, South and Southeast Asia

  15. The Region is Dead, Long Live the Region

    DEFF Research Database (Denmark)

    Metzger, Jonathan; Olesen, Kristian

    2017-01-01

    If it today is commonly accepted that regions are ‘constructs’ – then who or what construct them, for what reasons, and by which means? How are they made manifest and durable as both mental geographies and mundane everyday realities (cf. Metzger, 2013)? Paasi (2010, p.2298) suggests that regions...... practices that have led to the formation and more recently encroaching dissipation of a well-known EUropean region: Öresund. In this endeavour we will make an effort to be sensitive to how Öresund as a spatial entity interrelates with, depends upon or partially challenges/is challenged by other geographical...

  16. Regional Development of Eastern Slovakia

    Directory of Open Access Journals (Sweden)

    Monika Hergezelová

    2017-08-01

    Full Text Available Purpose and Originality: The aim of the work is to provide an overview of regional development in Eastern Slovakia, where are Košice and Prešov Region. The originality of the work lies in the work of enriching the SWOT analysis from the author Eve Rajčáková, which is given in the book deals with the issue of Regional development and regional policy of the European Union and Slovakia. Research question: The conditions of life of people in eastern Slovakia. Method: For writing this contribution will be used method of analysis and statistics. Knowledge on this subject have been looking on the internet and in books and sources of information publicly available. Using the data collected, we dealt with the issue of regional development in the Košice and Prešov regions. Results: The topic was the beginning focused on the overall characteristics of eastern Slovakia. Furthermore, we are at work we dealt with social and economic phenomena in both regions of eastern Slovakia. We focused on GDP, unemployment and tourism, which is in the region is widespread. Society: It is well known that there are obviously different living conditions in eastern Slovakia as in other parts of Slovakia. People are forced to, mainly because of employment, leave their region to move or commute to work to the west. The paper point out the right of this negative phenomenon that is quite visible - high unemployment. Limitations: The limits of work are limited by problems of regional development in eastern Slovakia, mainly focusing on economic and social phenomena in the society.

  17. Sources of Regional Banks Capitalization

    Directory of Open Access Journals (Sweden)

    Olga Sergeevna Miroshnichenko

    2018-03-01

    Full Text Available Searching of sources to increase the capitalization of Russian banks is an important economic problem for both the national and regional economy. Moreover, a strong capital base allows to credit institutions to meet the demands of economic agents for banking service. The research focuses on the choice of sources of regulatory capital for the banks of Tyumen region in the context of changing supervisory requirements in the period of 2005–2016, in different phases of the business cycle. We apply econometric methods of statistical information using IBM SPSS Statistics software. We have calculated the individual correlations of regional banks’ capital with gross domestic product (GDP (excluding gross regional product (GRP and GRP (with the exception of the effect of GDP. These calculations have shown that the capital of regional banks is related only to GDP. The increase in the capital of regional banks is accompanied by a change in its structure: the share of authorized capital has halved, and the share of subordinated debt has grown. All sources of capital, other than the reserve fund, are related to GDP. Authorized capital is associated with the profit of profitable lending institutions; retained earnings in the capital of regional banks — with the aggregated amount of risks of the banking system of the Russian Federation. Subordinated debt, like capital as a whole, is negatively affected by the profitability of the banking sector. The change in the capital of regional banks is determined by the change in retained earnings, subordinated debt and reserve fund. Modelling of these relations has allowed to obtain a system of equations. This system synthesizes linear regression models of changing the capital of regional banks in the context of their sourcing. The results of this study are significant for theoretical justification and practical development of a balanced financial policy of regional banks. Our research will contribute to

  18. Tribal Land Polygons, Region 9, 2006, US EPA Region 9

    Data.gov (United States)

    U.S. Environmental Protection Agency — Dataset of all Indian Reservations in US EPA Region 9 (California, Arizona and Nevada) with some reservation border areas of adjacent states included (adjacent areas...

  19. regional. Un análisis para las regiones europeas

    Directory of Open Access Journals (Sweden)

    José A. Camacho

    2005-01-01

    Full Text Available Pese a encontrarnos inmersos en una economía globalizada, la innovación es en muchos aspectos un fenómeno esencialmente regional, donde los servicios (ignorados hasta ahora, y en particular aquellos denominados como servicios intensivos conocimiento (SIC, adquieren un papel central, gracias a su capacidad para transmitir conocimiento, en especial de tipo tácito. El objetivo de este trabajo es realizar una primera aproximación empírica a los efectos asociados a la localización de SIC, tomando 107 regiones europeas. Los resultados obtenidos apoyan la hipótesis de que los SIC ejercen un impacto positivo sobre el desempeño innovador regional, impacto que podría desbordarse hacia las regiones vecinas.

  20. Tribal Boundary Polygons, Region 9, 2007, US EPA Region 9

    Data.gov (United States)

    U.S. Environmental Protection Agency — Dataset of all Indian Reservations in US EPA Region 9 (California, Arizona and Nevada) with some reservation border areas of adjacent states included (adjacent areas...

  1. Minimum deterrence and regional security. Section 2. Other regions

    International Nuclear Information System (INIS)

    Azikiwe, A.E.

    1993-01-01

    Compared to European political and security circumstance, minimum deterrence is less an illusion in other regions where weapon free zones already exist. It will continue to be relevant to the security of other regions. Strategic arms limitation should be pursued vigorously in a constructive and pragmatic manner, bearing in mind the need to readjust to new global challenges. The Comprehensive Test Ban Treaty is the linchpin on which the Non-proliferation Treaty rests

  2. Malaysia in international regional relationships

    International Nuclear Information System (INIS)

    Kamarulnizam Abdullah

    2010-01-01

    The changes in the international system saw the structure and survival issues that grip the country will also change. The main challenge to the nation is how to adapt these changes that running quite rapidly and outside the country's ability to cope alone. Issues and global structural changes also affect the international system of East Asia region that contains two important sub-Southeast Asia and Northeast Asia. Changes inherent in both these sub certainly affect the foreign policy and diplomacy, security and bilateral relations between Malaysia and other countries. Malaysia is not a global power capable of changing the international system. However, Malaysia is an important country in East Asia that has contributed to the prosperity of this region. The big question is how to adapt these changes into the Malaysia international regional policy and bilateral relations? What extent international issues affecting the regional survival of the country? What is the contribution to regional stability of Malaysia? This book explores the impact of selective regional issues to Malaysia, while also discussing the role and response to changes in regional Malaysia since the country gained independence. (author)

  3. Regional Courts as Judicial Brakes?

    Directory of Open Access Journals (Sweden)

    Metcalf Katrin Nyman

    2017-12-01

    Full Text Available The article examines how regional integration courts can act as judicial brakes, at a time when “constitutional coups” – leaders staying in power past constitutional time limits or other forms of actions against the spirit if not always the letter of the constitution – are alarmingly common. The article discusses how regional courts can be used to modify or protect national rule of law and the constitutional order from the outside (i.e. from the regional integration aspect and the extent to which this can be valid particularly to promote a uniform interpretation and application of human rights. Although this trend is visible in Europe, it is more striking, because less expected, on other continents, in particular Africa and the Americas, where the developments take place in less than perfect democratic environments. The article contains evidence from cases dealt with in the various regional courts, supporting that a system of political and judicial oversight, especially in regions with weak or fragile democratic systems, can be a useful addition to national judicial or other mechanisms of protection of rule of law and control of the executive. Action by regional courts helps defeat perceptions of majoritarian politics, which in many countries allow for the winner to take all. Under a system of regional oversight, states become aware of the limits they themselves have set and citizens become aware of their possibilities to challenge political power.

  4. Regional Branding: Building Brand Value

    Directory of Open Access Journals (Sweden)

    Klára Margarisová

    2016-01-01

    Full Text Available Regional branding is one of several ways to promote rural regions and support development of socially, culturally and environmentally oriented economies in areas that are interesting due to their natural and cultural heritage. The article attempts to review the conceptual and theoretical underpinnings of branding as conveyed by leading authors in the marketing field. The aim of this paper is to define brand as a broad complex of variables, which are used in building of its identity as a basis for creating value proposition and the position of a brand. Article briefly describes the most comprehensive labeling system for regional products at the micro-regional level is the one guaranteed by Association of Regional Brands (ARB. The main contribution of this article is a theoretical model of strategic management of a regional brand, which captures the interdependence of the individual steps of brand building as well as stakeholders. The starting point for building of brand value is a strategic analysis of the brand, including analysis of customer and competitors. The analysis of external factors is followed by analysis of the brand itself. The resulting relationship between the brand and the customer is based on value proposition representing benefits (functional, emotional, self‑expression. The concept of total product is connected with the concept of total brand and it is offered to the customer as a regional product. Finally it suggests possibilities for further research.

  5. Regional climate change mitigation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Rowlands, Ian H [UNEP Collaborating Centre on Energy and Environment, and Univ. of Waterloo (Canada)

    1998-10-01

    The purpose of this paper is to explore some of the key methodological issues that arise from an analysis of regional climate change mitigation options. The rationale for any analysis of regional mitigation activities, emphasising both the theoretical attractiveness and the existing political encouragement and the methodology that has been developed are reviewed. The differences arising from the fact that mitigation analyses have been taken from the level of the national - where the majority of the work has been completed to date - to the level of the international - that is, the `regional` - will be especially highlighted. (EG)

  6. LLNL's Regional Seismic Discrimination Research

    International Nuclear Information System (INIS)

    Hanley, W; Mayeda, K; Myers, S; Pasyanos, M; Rodgers, A; Sicherman, A; Walter, W

    1999-01-01

    As part of the Department of Energy's research and development effort to improve the monitoring capability of the planned Comprehensive Nuclear-Test-Ban Treaty international monitoring system, Lawrence Livermore Laboratory (LLNL) is testing and calibrating regional seismic discrimination algorithms in the Middle East, North Africa and Western Former Soviet Union. The calibration process consists of a number of steps: (1) populating the database with independently identified regional events; (2) developing regional boundaries and pre-identifying severe regional phase blockage zones; (3) measuring and calibrating coda based magnitude scales; (4a) measuring regional amplitudes and making magnitude and distance amplitude corrections (MDAC); (4b) applying the DOE modified kriging methodology to MDAC results using the regionalized background model; (5) determining the thresholds of detectability of regional phases as a function of phase type and frequency; (6) evaluating regional phase discriminant performance both singly and in combination; (7) combining steps 1-6 to create a calibrated discrimination surface for each stations; (8) assessing progress and iterating. We have now developed this calibration procedure to the point where it is fairly straightforward to apply earthquake-explosion discrimination in regions with ample empirical data. Several of the steps outlined above are discussed in greater detail in other DOE papers in this volume or in recent publications. Here we emphasize the results of the above process: station correction surfaces and their improvement to discrimination results compared with simpler calibration methods. Some of the outstanding discrimination research issues involve cases in which there is little or no empirical data. For example in many cases there is no regional nuclear explosion data at IMS stations or nearby surrogates. We have taken two approaches to this problem, first finding and using mining explosion data when available, and

  7. Regional climate change mitigation analysis

    International Nuclear Information System (INIS)

    Rowlands, Ian H.

    1998-01-01

    The purpose of this paper is to explore some of the key methodological issues that arise from an analysis of regional climate change mitigation options. The rationale for any analysis of regional mitigation activities, emphasising both the theoretical attractiveness and the existing political encouragement and the methodology that has been developed are reviewed. The differences arising from the fact that mitigation analyses have been taken from the level of the national - where the majority of the work has been completed to date - to the level of the international - that is, the 'regional' - will be especially highlighted. (EG)

  8. BUDGETARY REGIONAL POLICY: THEORETICAL CONCEPTUALIZATION

    Directory of Open Access Journals (Sweden)

    Shyshpanova Nataliia

    2018-01-01

    Full Text Available Introduction. Formation and implementation of the budget policy of the regions in Ukraine is directly related to the processes of decentralization of power, increase of budget powers and strengthening of financial capacity of the territories. Formation of balanced local budgets and support of an effective system of managing budget resources is a key to strengthening the economic potential of the regions and increasing the well-being of citizens. The purpose of this article is to assess the current concepts of the fiscal policy of the region in Ukraine and to determine the impact of fiscal policy on the socio-economic development of the regions. Results. In this article the essence and content of budget policy are considered, the interpretation of different scientists is presented. An author’s approach to the definition of the essence of the budget policy of the region as a set of economic and administrative measures in the budget sphere, determined by the interrelated goals and objectives of the state and local self-government, aimed at the socio-economic development of the territory. The conceptual model of the fiscal policy of the region is presented and it is determined that the strategic goal of fiscal policy at the local level should be to ensure sustainable socio-economic development of the territories. The main principles that need to be observed during the implementation of the budget policy of the region are described; functions to be performed by local level fiscal policy; and the main tools by which local authorities carry out their functions. Conclusions. It is noted that the content of the budget policy of the region should be to determine the course, tasks and directions of the state and local self-government activities in the field of the formation and use of budget funds. The budget policy of the region should respond to a combination of the following systemic challenges: 1. the restoration of economic growth, as soon as

  9. Centromere Destiny in Dicentric Chromosomes: New Insights from the Evolution of Human Chromosome 2 Ancestral Centromeric Region.

    Science.gov (United States)

    Chiatante, Giorgia; Giannuzzi, Giuliana; Calabrese, Francesco Maria; Eichler, Evan E; Ventura, Mario

    2017-07-01

    Dicentric chromosomes are products of genomic rearrangements that place two centromeres on the same chromosome. Due to the presence of two primary constrictions, they are inherently unstable and overcome their instability by epigenetically inactivating and/or deleting one of the two centromeres, thus resulting in functionally monocentric chromosomes that segregate normally during cell division. Our understanding to date of dicentric chromosome formation, behavior and fate has been largely inferred from observational studies in plants and humans as well as artificially produced de novo dicentrics in yeast and in human cells. We investigate the most recent product of a chromosome fusion event fixed in the human lineage, human chromosome 2, whose stability was acquired by the suppression of one centromere, resulting in a unique difference in chromosome number between humans (46 chromosomes) and our most closely related ape relatives (48 chromosomes). Using molecular cytogenetics, sequencing, and comparative sequence data, we deeply characterize the relicts of the chromosome 2q ancestral centromere and its flanking regions, gaining insight into the ancestral organization that can be easily broadened to all acrocentric chromosome centromeres. Moreover, our analyses offered the opportunity to trace the evolutionary history of rDNA and satellite III sequences among great apes, thus suggesting a new hypothesis for the preferential inactivation of some human centromeres, including IIq. Our results suggest two possible centromere inactivation models to explain the evolutionarily stabilization of human chromosome 2 over the last 5-6 million years. Our results strongly favor centromere excision through a one-step process. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Regional transport sector mitigation options

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Peter [EECG Consultants, Gaborone (Botswana)

    1998-10-01

    The rationale for conducting climate change mitigation studies in the transport sector is on the premise that: The transport sector is the second largest consumer of fossil fuels in the region; The regional transport sector is an area with high opportunity for infrastructural development under UNFCCC financial mechanism; The regional transport sector is crucial in the SADC region for trade and coupled with the Trade Protocol will play a major role in development hence the need to make it efficient in terms of energy demand and provision of services; The sector offers many mitigation options but with a challenge to evaluate their energy saving and GHG saving potential and yet there is need to quantify possible emission reduction for possible future emission trading. This is also a sector with potential to qualify for financing through Clean Development Mechanism (CDM) recently stipulated in the Kyoto Protocol. (au)

  11. Region 7 Title V facilities

    Data.gov (United States)

    U.S. Environmental Protection Agency — This web map shows the Region 7 Title V facilities (Clean Air Act major sources), any Class I areas within 300 km of R7 States, and any Tribal areas within 50 miles...

  12. Penguins of the Magellan region

    Directory of Open Access Journals (Sweden)

    M. Bingham

    1999-12-01

    Full Text Available The Magellan region, including the Falkland Islands, is one of the world´s most important areas for seabirds, and especially penguins. World-wide there are 17 species of penguin; 7 of these regularly breed around the coastal waters of South America, and 5 within the Magellan region. These are the King Penguin (Aptenodytes patagonicus, Gentoo Penguin (Pygoscelis papua, Rockhopper Penguin (Eudyptes c. chrysocome, Macaroni Penguin (Eudyptes chrysolophus and Magellanic Penguin (Spheniscus magellanicus. During the last five years, a review of the breeding populations of penguins within the Magellan region was conducted. This work included population censuses of all the surface breeding species throughout the Falkland Islands and southern South America. The results of this work are presented, along with other cited information, to provide a summary of the current knowledge of penguin populations within the Magellan region.

  13. Regional Assessment of South America

    National Research Council Canada - National Science Library

    Jarrett, Kenneth; McMillen, Gary K

    1997-01-01

    .... Economically, the countries of the region have emerged from the debt crisis of the 1980s with a zealous belief in the advantages of export-oriented policies, privatization, and the elimination...

  14. Acoustic holograms of active regions

    International Nuclear Information System (INIS)

    Chou, Dean-Yi

    2008-01-01

    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  15. Acoustic holograms of active regions

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Dean-Yi [Physics Department, National Tsing Hua University, Hsinchu, 30013, Taiwan (China)], E-mail: chou@phys.nthu.edu.tw

    2008-10-15

    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  16. Regions compete for French synchrotron

    CERN Multimedia

    2000-01-01

    Ten regions in France have placed bids to host the planned national synchrotron Soleil. Leading contenders include a joint bid from Ile-de-France and Essonne for Orsay, offering FF 1 billion towards the construction costs (2 paragraphs).

  17. Pacific Northwest DIVER Regional Metadata

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — DIVER environmental data holdings are primarily comprised of datasets gathered from regional studies, site specific studies from non-NOAA entities, and NOAA...

  18. Groundwater Vulnerability Regions of Iowa

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — The regions onThis map represent areas with similar hydrogeologic characteristics thought to represent similar potentials for contamination of groundwater and/or...

  19. Conformity Adequacy Review: Region 5

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the conformity SIP adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 5 (IL, IN, MI, OH, WI) is provided here.

  20. Conformity Adequacy Review: Region 7

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 7 (IA, KS, MO, NE) is provided here.

  1. Conformity Adequacy Review: Region 9

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 9 (AZ, CA, HI, NV, AS, GU) is provided here.

  2. Conformity Adequacy Review: Region 2

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 2 (NJ, NY, PR, VI) is provided here.

  3. Conformity Adequacy Review: Region 1

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 1 (CT, ME, MA, NH, RI, VT) is provided here.

  4. Conformity Adequacy Review: Region 10

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 10 (AK, ID, OR, WA) is provided here.

  5. Conformity Adequacy Review: Region 4

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 4 (AL, FL, GA, KY, MS, NC, SC, TN) is provided here.

  6. Conformity Adequacy Review: Region 6

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 6 (AR, LA, NM, OK, TX) is provided here.

  7. Conformity Adequacy Review: Region 3

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 3 (DE, DC, MD, PA, VA, WV) is provided here.

  8. Conformity Adequacy Review: Region 8

    Science.gov (United States)

    Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 3 (CO, MT, ND, SD, UT, WY) is provided here.

  9. National Marine Fisheries Service Regions

    Data.gov (United States)

    Department of Homeland Security — The NOAA Coastal Services Center's Legislative Atlas is a regional geographic information system (GIS) that provides spatial data for state and federal coastal and...

  10. The Landform Regions of Iowa

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — A landscape is a collection of land shapes or land forms. Landform regions are a grouping of individual landscape features that have a common geomophology. In Iowa,...

  11. Regional transport sector mitigation options

    International Nuclear Information System (INIS)

    Zhou, Peter

    1998-01-01

    The rationale for conducting climate change mitigation studies in the transport sector is on the premise that: The transport sector is the second largest consumer of fossil fuels in the region; The regional transport sector is an area with high opportunity for infrastructural development under UNFCCC financial mechanism; The regional transport sector is crucial in the SADC region for trade and coupled with the Trade Protocol will play a major role in development hence the need to make it efficient in terms of energy demand and provision of services; The sector offers many mitigation options but with a challenge to evaluate their energy saving and GHG saving potential and yet there is need to quantify possible emission reduction for possible future emission trading. This is also a sector with potential to qualify for financing through Clean Development Mechanism (CDM) recently stipulated in the Kyoto Protocol. (au)

  12. Regional differences of consumer preferences when shopping for regional products

    Directory of Open Access Journals (Sweden)

    Jitka Kalábová

    2013-01-01

    Full Text Available This paper presents partial results of a research on consumer preferences when shopping for groceries. It is focused on regional products and consumer preferences in relation to the country of origin of food products. The main objective of this paper is to find the existence of spatial relationships between spatial deployment of regional products and consumer preferences for regional products. It will be necessary to create a data model for monitoring the deployment of regional products and also a data model for tracking important indicators of consumer behavior in all regions of the Czech Republic. The results are based on questionnaire survey that was conducted within the period from October 2010 to January 2011 on a sample of 3767 respondents from the Czech Republic, via both online questionnaires and their printed version. For the data collection the questionnaire system ReLa, developed by the Department of Marketing and Trade at Faculty of Business and Economics at Mendel University in Brno, was used. Data was processed with statistical software STATISTICA (ver. 10. Spatial visualisation was processed with GIS software ArcGIS (ver. 10.1. Preferences for food of Czech origin were analysed in relation to identification criteria. The research results show that the origin of food has an important role in consumer purchase decision-making. There is no significant difference in importance of this factor based on gender of consumers, however, we could prove moderate dependence on respondent’s occupation, education and age. We could also experience regional differences in levels of preferences of local products or products of Czech origin in regard of 14 regions of the Czech Republic. χ2 (N = 3767 = 245.25; p < 0.001. Value of Pearson’s coefficient of contingency is 0.334.

  13. Efeito analgésico de longa duração da dipirona sobre a hiperalgesia persistente induzida pela constrição do nervo ciático em ratos: participação do óxido nítrico Long term analgesic effect of dipyrone on the persistent hyperalgesia induced by chronic constriction injury of sciatic nerve in rats: involviment of nitric oxide

    Directory of Open Access Journals (Sweden)

    Fábio José Reis

    2006-12-01

    Full Text Available O efeito analgésico de longa duração da dipirona foi avaliado em um modelo de dor neuropática assim como a participação da via óxido nítrico-GMPc neste mecanismo analgésico. Uma única administração intraplantar de dipirona (80 µg, no 14º dia após a instalação da hiperalgesia neuropática induzida pela constrição do nervo ciático exerceu um efeito analgésico, significativo e de longa duração. A inibição da óxido nítrico sintetase com L-NAME (50 ou 100 µg/pata, ou do óxido nítrico (NO endógeno com hemoglobina (10 ou 30 µg/pata, bloquearam o desenvolvimento do efeito analgésico da dipirona. A L-arginina (500 µg/pata reverteu o efeito do L-NAME. Cloreto de metiltionínio (azul de metileno (500 µg/pata, ODQ (50 µg/pata (bloqueadores da guanilil ciclase ou glibenclamida (100, 200 ou 300 µg/pata (bloqueador de canais de K+ sensíveis ao ATP inibiram o efeito analgésico da dipirona. O nitroprussiato de sódio administrado no 14º dia após a instalação da hiperalgesia neuropática também exerceu efeito analgésico de longa duração, semelhante ao observado com a dipirona. Sugerimos que a ação analgésica periférica e de longa duração da dipirona, neste modelo experimental, ocorra devido a provável dessensibilização dos nociceptores, envolvendo a via óxido nítrico - GMPc e canais de K+ sensíveis ao ATP.The long term analgesic effect of dipyrone was evaluated on a model of neuropathic pain and the role of nitric oxide/GMPc pathway in this antinociceptive mechanism. One intraplantar dipyrone administration (80 mg, at 14th day after the chronic constriction injury of the sciatic nerve, induced a significant and long term analgesic effect. The inhibition of nitric oxide synthase (NOS with L-NAME (50 or 100 mg/paw or scavenging of the endogenous NO with hemoglobin (10 or 30 mg/paw inhibited the development of the dipyrone analgesia. L-arginine (500 mg/paw could reverted the effect of L-NAME. Metylene blue

  14. Regional energy-environmental planning

    International Nuclear Information System (INIS)

    Colavecchio, Antonio

    2007-01-01

    In consideration of the relationship existing between energy and environment, it's clear that tools are needed to reach a pre-emptive convergence of different interests coming from the management of these sectors. The main tool to realize the above-mentioned convergence of interests in the Regional Energy and Environment Plan (PEAR). The plan allows italian Regions to schedule and to address energy measures in their own area and to regulate Local entities functions [it

  15. Managing regional innovation strategy projects

    OpenAIRE

    Wolf, Patricia; Hanisch, Christoph

    2014-01-01

    This paper presents a qualitative interview study with 28 RIS project managers that aimed at understanding whether or not this is true in the context of regional innovation and what the specifics of managing regional innovation projects are. In taking up a recent claim for policy intervention studies which allow to “derive precise suggestions for their design and management”.  The study investigated the interrelation between the agility of the management approach and the achievements of RIS p...

  16. Competition for biomass. Regional imbalances

    International Nuclear Information System (INIS)

    Wiklund, S.E.; Bohlin, B.; Remes, M.; Aakesson, H.; Warnqvist, B.; Norrstroem, H.; Jonsson, Tomas

    1997-04-01

    The main aim of this study has been to investigate if a substantial increase in biofuel utilization may lead to pronounced regional differences in supply and demand, and what effects such imbalances could lead to. In the study the country has been split up into ten regions, from north to south, and it is confirmed that there would be an imbalance effect. confirmed that there would be an imbalance effect

  17. Regional and Global Monetary Cooperation

    OpenAIRE

    Mario Lamberte; Peter J. Morgan

    2012-01-01

    The increasing occurrence of national, regional, and global financial crises, together with their rising costs and complexity, have increased calls for greater regional and global monetary cooperation. This is particularly necessary in light of volatile capital flow movements that can quickly transmit crisis developments in individual countries to other countries around the world. Global financial safety nets (GFSNs) are one important area for monetary cooperation. This paper reviews the c...

  18. ASEAN: Regional Integration and Reforms

    OpenAIRE

    Mari PANGESTU; Lili Yan ING

    2015-01-01

    Over recent decades, the Association of Southeast Asian Nations (ASEAN) has advanced a policy of regional integration, starting with the ASEAN Free Trade Area, followed by the ASEAN+1 free trade agreements with its six main trading partners, and now with ASEAN+6. For ASEAN to further advance regional integration in the East Asian context, it should continue to focus on trade in goods, investment, and services, to smooth out the process of trade creation and investment realisation. East Asian ...

  19. Why are Trade Agreements Regional?

    OpenAIRE

    Zissimos, Ben

    2007-01-01

    This paper shows how distance may be used to coordinate on a unique equilibrium in which trade agreements are regional. Trade agreement formation is modeled as coalition formation. In a standard trade model with no distance between countries, a familiar problem of coordination failure arises giving rise to multiple equilibria; any one of many possible trade agreements can form. With distance between countries, and through strategic interaction in tariff setting, regional trade agreements gene...

  20. Social attitudes and regional inequalities

    Directory of Open Access Journals (Sweden)

    Vinko Muštra

    2014-03-01

    Full Text Available As the budgets of the European Union (EU become tighter, the questions about the effectiveness of EU’s expenditure, especially the most important parts such as Cohesion policy, are hotly debated. The aim of this paper is to examine whether the presence of social attitudes may influence the effectiveness of EU budget expenditure, measured by the level of regional inequalities. The analysis starts by focusing on individuals’ attitudes towards income from their own effort and income which is derived from other people’s effort, having in mind that individual actions depend on their attitudes. The next step establishes the link between the income from other people’s effort with the re-distributive dimension of the EU budget, considering that different attitudes among individuals in the EU could lead to significant differences in effectiveness of this redistributive policy among European regions and, consequently, diverse regional inequalities. Empirical research uses data for 27 EU countries observed over two waves of European Value Surveys: 1999-2000 (Wave 1 and 2008–2009 (Wave 2. The results indicate a significant role of social attitudes for regional inequalities, which raises the question of the appropriateness of simplification and uniform regional policy instruments in solving EU regional problems.