Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Abstract. Purpose: To develop specific single chain variable fragments (scFv) against ... libraries. The binding ability of the selected scFv antibody fragments against the IBDV particles was ..... Hermelink H, Koscielniak E. A human recombinant.
Production of a phage-displayed single chain variable fragment ...
African Journals Online (AJOL)
Purpose: To develop specific single chain variable fragments (scFv) against infectious bursal disease virus (IBDV) via phage display technology. Methods: Purified viruses were initially applied for iterative panning rounds of scFv phage display libraries. The binding ability of the selected scFv antibody fragments against the ...
Olefin copolymerization via reversible addition-fragmentation chain transfer
Venkatesh, R.; Staal, B.B.P.; Klumperman, B.
2004-01-01
Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished
Automated main-chain model building by template matching and iterative fragment extension
International Nuclear Information System (INIS)
Terwilliger, Thomas C.
2003-01-01
A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition
Automated main-chain model building by template matching and iterative fragment extension.
Terwilliger, Thomas C
2003-01-01
An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.
DEFF Research Database (Denmark)
Olsen, K E; Sletten, K; Westermark, Per
1998-01-01
Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin l...... light chain are a constituent of the AL-amyloid proteins of kappa type. A specific antiserum has identified these fragments in gel filtration fractions where the absorbance approached the base line after the main retarded peak. The fragments are small and have been overlooked previously......Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin...... in the purification process. The significance of the constant part in AL-proteins is unclear, but adds new aspects to the discussion of pre- or post-fibrillogenic cleavage of the immunoglobulin light chains....
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-07-01
The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.
FragKB: structural and literature annotation resource of conserved peptide fragments and residues.
Directory of Open Access Journals (Sweden)
Ashish V Tendulkar
Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.
Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.
2005-01-01
We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA
Shuey, John A
2013-12-05
Because of their vast diversity, measured by both numbers of species as well as life history traits, insects defy comprehensive conservation planning. Thus, almost all insect conservation efforts target individual species. However, serious insect conservation requires goals that are set at the faunal level and conservation success requires strategies that conserve intact communities. This task is complicated in agricultural landscapes by high levels of habitat fragmentation and isolation. In many regions, once widespread insect communities are now functionally trapped on islands of ecosystem remnants and subject to a variety of stressors associated with isolation, small population sizes and artificial population fragmentation. In fragmented landscapes ecological restoration can be an effective strategy for reducing localized insect extinction rates, but insects are seldom included in restoration design criteria. It is possible to incorporate a few simple conservation criteria into restoration designs that enhance impacts to entire insect communities. Restoration can be used as a strategy to address fragmentation threats to isolated insect communities if insect communities are incorporated at the onset of restoration planning. Fully incorporating insect communities into restoration designs may increase the cost of restoration two- to three-fold, but the benefits to biodiversity conservation and the ecological services provided by intact insect communities justify the cost.
Improved production and function of llama heavy chain antibody fragments by molecular evolution
Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.
2000-01-01
The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In
Optimization of the crystallizability of a single-chain antibody fragment
Czech Academy of Sciences Publication Activity Database
Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína
2014-01-01
Roč. 70, č. 12 (2014), s. 1701-1706 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014
Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An
2015-01-01
Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665
Regularity and mass conservation for discrete coagulation–fragmentation equations with diffusion
Cañizo, J.A.
2010-03-01
We present a new a priori estimate for discrete coagulation-fragmentation systems with size-dependent diffusion within a bounded, regular domain confined by homogeneous Neumann boundary conditions. Following from a duality argument, this a priori estimate provides a global L2 bound on the mass density and was previously used, for instance, in the context of reaction-diffusion equations. In this paper we demonstrate two lines of applications for such an estimate: On the one hand, it enables to simplify parts of the known existence theory and allows to show existence of solutions for generalised models involving collision-induced, quadratic fragmentation terms for which the previous existence theory seems difficult to apply. On the other hand and most prominently, it proves mass conservation (and thus the absence of gelation) for almost all the coagulation coefficients for which mass conservation is known to hold true in the space homogeneous case. © 2009 Elsevier Masson SAS. All rights reserved.
Combining measures of dispersal to identify conservation strategies in fragmented landscapes.
Leidner, Allison K; Haddad, Nick M
2011-10-01
Understanding the way in which habitat fragmentation disrupts animal dispersal is key to identifying effective and efficient conservation strategies. To differentiate the potential effectiveness of 2 frequently used strategies for increasing the connectivity of populations in fragmented landscapes-corridors and stepping stones-we combined 3 complimentary methods: behavioral studies at habitat edges, mark-recapture, and genetic analyses. Each of these methods addresses different steps in the dispersal process that a single intensive study could not address. We applied the 3 methods to the case study of Atrytonopsis new species 1, a rare butterfly endemic to a partially urbanized stretch of barrier islands in North Carolina (U.S.A.). Results of behavioral analyses showed the butterfly flew into urban and forested areas, but not over open beach; mark-recapture showed that the butterfly dispersed successfully through short stretches of urban areas (5 km) were a dispersal barrier, but shorter stretches of urban areas (≤5 km) were not. Although results from all 3 methods indicated natural features in the landscape, not urbanization, were barriers to dispersal, when we combined the results we could determine where barriers might arise: forests restricted dispersal for the butterfly only when there were long stretches with no habitat. Therefore, urban areas have the potential to become a dispersal barrier if their extent increases, a finding that may have gone unnoticed if we had used a single approach. Protection of stepping stones should be sufficient to maintain connectivity for Atrytonopsis new species 1 at current levels of urbanization. Our research highlights how the use of complementary approaches for studying animal dispersal in fragmented landscapes can help identify conservation strategies. ©2011 Society for Conservation Biology.
Ligand deconstruction: Why some fragment binding positions are conserved and others are not
Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor
2015-01-01
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377
Ligand deconstruction: Why some fragment binding positions are conserved and others are not.
Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor
2015-05-19
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.
Directory of Open Access Journals (Sweden)
R Cavasini
Full Text Available Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA – Parque Municipal das Araucárias and the other a private property without any conservational policy (FBL – Fazenda Brandalise, in space and time, using species abundances and richness, ecological indexes and Neotropical and exotic species proportions as parameters to establish the level of environmental quality of these fragments. Our results showed that the observed diversity in PMA (H′ = 2.221 was approximately 40% higher than in FBL (H′ = 1.592. This could be due to higher preservation quality and habitat diversity in PMA, indicating the importance of conservation units. However, richness were similar for these areas, with PMA (Dmg = 6.602 only 8% higher than FBL (Dmg = 6.128, which suggest that the larger distance from city limits and the larger size of FBL forested area could be compensating the higher disturbance caused by antrophic extractive exploitation of this fragment. This points out that, besides the quality of presevertion, the size and/or connection with other fragments should be considered for areas destined for biodiversity conservation. In general, both areas presented similar drosophilid assemblages, and the expressive abundance of both Neotropical species (mostly of the subgroup willistoni and the exotic species D. kikkawai suggests that these areas are in intermediate stages of conservation.
Cavasini, R; Buschini, M L T; Machado, L P B; Mateus, R P
2014-11-01
Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA - Parque Municipal das Araucárias) and the other a private property without any conservational policy (FBL - Fazenda Brandalise), in space and time, using species abundances and richness, ecological indexes and Neotropical and exotic species proportions as parameters to establish the level of environmental quality of these fragments. Our results showed that the observed diversity in PMA (H' = 2.221) was approximately 40% higher than in FBL (H' = 1.592). This could be due to higher preservation quality and habitat diversity in PMA, indicating the importance of conservation units. However, richness were similar for these areas, with PMA (Dmg = 6.602) only 8% higher than FBL (Dmg = 6.128), which suggest that the larger distance from city limits and the larger size of FBL forested area could be compensating the higher disturbance caused by antrophic extractive exploitation of this fragment. This points out that, besides the quality of presevertion, the size and/or connection with other fragments should be considered for areas destined for biodiversity conservation. In general, both areas presented similar drosophilid assemblages, and the expressive abundance of both Neotropical species (mostly of the subgroup willistoni) and the exotic species D. kikkawai suggests that these areas are in intermediate stages of conservation.
Essentials of Conservation Biotechnology: A mini review
Merlyn Keziah, S.; Subathra Devi, C.
2017-11-01
Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.
International Nuclear Information System (INIS)
Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun
2009-01-01
An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1
Fenced and Fragmented: Conservation Value of Managed Metapopulations
Miller, Susan M.; Harper, Cindy K.; Bloomer, Paulette; Hofmeyr, Jennifer; Funston, Paul J.
2015-01-01
Population fragmentation is threatening biodiversity worldwide. Species that once roamed vast areas are increasingly being conserved in small, isolated areas. Modern management approaches must adapt to ensure the continued survival and conservation value of these populations. In South Africa, a managed metapopulation approach has been adopted for several large carnivore species, all protected in isolated, relatively small, reserves that are fenced. As far as possible these approaches are based on natural metapopulation structures. In this network, over the past 25 years, African lions (Panthera leo) were reintroduced into 44 fenced reserves with little attention given to maintaining genetic diversity. To examine the situation, we investigated the current genetic provenance and diversity of these lions. We found that overall genetic diversity was similar to that in a large national park, and included a mixture of four different southern African evolutionarily significant units (ESUs). This mixing of ESUs, while not ideal, provides a unique opportunity to study the impact of mixing ESUs over the long term. We propose a strategic managed metapopulation plan to ensure the maintenance of genetic diversity and improve the long-term conservation value of these lions. This managed metapopulation approach could be applied to other species under similar ecological constraints around the globe. PMID:26699333
Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo
2004-05-25
Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the
Variable fragments of heavy chain antibodies (VHHs: a new magic bullet molecule of medicine?
Directory of Open Access Journals (Sweden)
Dorota Smolarek
2012-06-01
Full Text Available Serum of animals belonging to the Camelidae family (camels and llamas contains fully active antibodies that are naturally devoid of light chains. Variable domains derived from heavy chain antibodies (hcAb called VHHs or nanobodies™ can bind antigens as effectively as full-length antibodies and are easy to clone and express. Because of their potential, VHHs are being intensively studied as potential therapeutic, diagnostic and imaging tools. The paper reviews the molecular background of heavy chain antibodies and describes methods of obtaining recombinant fragments of heavy chain antibodies as well as their therapeutic, diagnostic and other applications.
Directory of Open Access Journals (Sweden)
K. Anne-Isola Nekaris
2015-01-01
Full Text Available Flagship species are traditionally large, charismatic animals used to rally conservation efforts. Accepted flagship definitions suggest they need only fulfil a strategic role, unlike umbrella species that are used to shelter cohabitant taxa. The criteria used to select both flagship and umbrella species may not stand up in the face of dramatic forest loss, where remaining fragments may only contain species that do not suit either set of criteria. The Cinderella species concept covers aesthetically pleasing and overlooked species that fulfil the criteria of flagships or umbrellas. Such species are also more likely to occur in fragmented habitats. We tested Cinderella criteria on mammals in the fragmented forests of the Sri Lankan Wet Zone. We selected taxa that fulfilled both strategic and ecological roles. We created a shortlist of ten species, and from a survey of local perceptions highlighted two finalists. We tested these for umbrella characteristics against the original shortlist, utilizing Maximum Entropy (MaxEnt modelling, and analysed distribution overlap using ArcGIS. The criteria highlighted Loris tardigradus tardigradus and Prionailurus viverrinus as finalists, with the former having highest flagship potential. We suggest Cinderella species can be effective conservation surrogates especially in habitats where traditional flagship species have been extirpated.
Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.
2009-01-01
Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a
Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene
Pullan, Nikki; Liu, Max; Topham, Paul D.
2013-01-01
Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...
Diverse responses of species to landscape fragmentation in a simple food chain.
Liao, Jinbao; Bearup, Daniel; Blasius, Bernd
2017-09-01
Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.
Sudhakar Reddy, C; Vazeed Pasha, S; Jha, C S; Dadhwal, V K
2015-07-01
Conservation of biodiversity has been put to the highest priority throughout the world. The process of identifying threatened ecosystems will search for different drivers related to biodiversity loss. The present study aimed to generate spatial information on deforestation and ecological degradation indicators of fragmentation and forest fires using systematic conceptual approach in Telangana state, India. Identification of ecosystems facing increasing vulnerability can help to safeguard the extinctions of species and useful for conservation planning. The technological advancement of satellite remote sensing and Geographical Information System has increased greatly in assessment and monitoring of ecosystem-level changes. The areas of threat were identified by creating grid cells (5 × 5 km) in Geographical Information System (GIS). Deforestation was assessed using multi-source data of 1930, 1960, 1975, 1985, 1995, 2005 and 2013. The forest cover of 40,746 km(2), 29,299 km(2), 18,652 km(2), 18,368 km(2), 18,006 km(2), 17,556 km(2) and 17,520 km(2) was estimated during 1930, 1960, 1975, 1985, 1995, 2005 and 2013, respectively. Historical evaluation of deforestation revealed that major changes had occurred in forests of Telangana and identified 1095 extinct, 397 critically endangered, 523 endangered and 311 vulnerable ecosystem grid cells. The fragmentation analysis has identified 307 ecosystem grid cells under critically endangered status. Forest burnt area information was extracted using AWiFS data of 2005 to 2014. Spatial analysis indicates total fire-affected forest in Telangana as 58.9% in a decadal period. Conservation status has been recorded depending upon values of threat for each grid, which forms the basis for conservation priority hotspots. Of existing forest, 2.1% grids had severe ecosystem collapse and had been included under the category of conservation priority hotspot-I, followed by 27.2% in conservation priority hotspot-II and 51.5% in conservation
Sustainable chains and energy conservation. Final report of the preliminary phase
International Nuclear Information System (INIS)
Bakker, C.; Bonekamp, L.
2002-01-01
An overview is given of the preparatory phase of the project on the title subject. Eleven pre-pilot projects (feasibility studies) are described of which 6 are elaborated in detail: energy conservation in the pig meat chain; Novel Protein Foods; dairy industry, in particular so-called cheese cows; dry matter content of potatoes for french fries; tare reduction of potatoes in the chain of pre-baked fries; and the export of tomatoes by maritime transport [nl
Cavasini, R; Buschini, MLT; Machado, LPB; Mateus, RP
2014-01-01
Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA – Parque Municipal das Araucárias) and the...
Conservation value of a native forest fragment in a region of extensive agriculture.
Chiarello
2000-05-01
A survey of mammals and birds was carried out in a semi-deciduous forest fragment of 150 ha located in a zone of intensive agriculture in Ribeirão Preto, State of São Paulo, south-eastern Brazil. Line transect sampling was used to census mammals and birds during six days, totalling 27.8 km of trails and 27.8 hours of observation. Twenty mammal species were confirmed in the area (except bats and small mammals), including rare or endangered species, such as the mountain lion (Puma concolor), the maned wolf (Chrysocyon brachyurus), and the ocelot (Leopardus pardalis). The brown capuchin monkey (Cebus apella) and the black-tufted-ear marmoset (Callithrix penicillata) were found frequently, suggesting high population density in the fragment. Regarding the avifauna, 49 bird species were recorded, most of them typical of open areas or forest edges. Some confirmed species, however, are becoming increasingly rare in the region, as for example the muscovy duck (Cairina moschata) and the toco toucan (Ramphastos toco). The results demonstrate that forest fragment of this size are refuges for native fauna in a region dominated almost exclusively by sugar-cane plantations. Besides faunal aspects, the conservation of these fragments is of great importance for the establishment of studies related to species preservation in the long term, including reintroduction and translocation projects, as well as studies related to genetic health of isolated populations.
Quasilocal conservation laws in XXZ spin-1/2 chains: Open, periodic and twisted boundary conditions
Directory of Open Access Journals (Sweden)
Tomaž Prosen
2014-09-01
Full Text Available A continuous family of quasilocal exact conservation laws is constructed in the anisotropic Heisenberg (XXZ spin-1/2 chain for periodic (or twisted boundary conditions and for a set of commensurate anisotropies densely covering the entire easy plane interaction regime. All local conserved operators follow from the standard (Hermitian transfer operator in fundamental representation (with auxiliary spin s=1/2, and are all even with respect to a spin flip operation. However, the quasilocal family is generated by differentiation of a non-Hermitian highest weight transfer operator with respect to a complex auxiliary spin representation parameter s and includes also operators of odd parity. For a finite chain with open boundaries the time derivatives of quasilocal operators are not strictly vanishing but result in operators localized near the boundaries of the chain. We show that a simple modification of the non-Hermitian transfer operator results in exactly conserved, but still quasilocal operators for periodic or generally twisted boundary conditions. As an application, we demonstrate that implementing the new exactly conserved operator family for estimating the high-temperature spin Drude weight results, in the thermodynamic limit, in exactly the same lower bound as for almost conserved family and open boundaries. Under the assumption that the bound is saturating (suggested by agreement with previous thermodynamic Bethe ansatz calculations we propose a simple explicit construction of infinite time averages of local operators such as the spin current.
Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran
2014-01-01
Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404
Directory of Open Access Journals (Sweden)
Hossein Roghani-Mamaqani
2017-09-01
Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.
Directory of Open Access Journals (Sweden)
Oliinyk O. S.
2014-02-01
Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.
International Nuclear Information System (INIS)
Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.
1990-01-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein
Energy Technology Data Exchange (ETDEWEB)
Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))
1990-06-01
Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.
Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis
Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.
2018-04-01
Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Zhai, De-Li; Cannon, Charles H; Dai, Zhi-Cong; Zhang, Cui-Ping; Xu, Jian-Chu
2015-01-01
Hainan, the largest tropical island in China, belongs to the Indo-Burma biodiversity hotspot. The Changhua watershed is a center of endemism for plants and birds and the cradle of Hainan's main rivers. However, this area has experienced recent and ongoing deforestation and habitat fragmentation. To quantify habitat loss and fragmentation of natural forests, as well as the land-cover changes in the Changhua watershed, we analyzed Landsat images obtained in 1988, 1995, and 2005. Land-cover dynamics analysis showed that natural forests increased in area (97,909 to 104,023 ha) from 1988 to 1995 but decreased rapidly to 76,306 ha over the next decade. Rubber plantations increased steadily throughout the study period while pulp plantations rapidly expanded after 1995. Similar patterns of land cover change were observed in protected areas, indicating a lack of enforcement. Natural forests conversion to rubber and pulp plantations has a general negative effect on biodiversity, primarily through habitat fragmentation. The fragmentation analysis showed that natural forests area was reduced and patch number increased, while patch size and connectivity decreased. These land-cover changes threatened local biodiversity, especially island endemic species. Both natural forests losses and fragmentation should be stopped by strict enforcement to prevent further damage. Preserving the remaining natural forests and enforcing the status of protected areas should be a management priority to maximize the watershed's biodiversity conservation value.
Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E
2017-10-01
The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)
2012-01-15
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
International Nuclear Information System (INIS)
Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.
2012-01-01
Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.
Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko
2012-10-01
We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Wong, Chun Wa; Yasui, Kosuke
2005-01-01
The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is inco...
Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng
2013-10-01
To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.
Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins
de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin
2016-01-01
Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381
Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.
2000-01-01
The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio
Torrico, Jordana; Ohanyan, Vadim; Rojas, Onofre
2018-05-01
We consider the diamond chain with S = 1/2 XYZ vertical dimers which interact with the intermediate sites via the interaction of the Ising type. We also suppose all four spins form the diamond-shaped plaquette to have different g-factors. The non-uniform g-factors within the quantum spin dimer as well as the XY-anisotropy of the exchange interaction lead to the non-conserving magnetization for the chain. We analyze the effects of non-conserving magnetization as well as the effects of the appearance of negative g-factors among the spins from the unit cell. A number of unusual frustrated states for ferromagnetic couplings and g-factors with non-uniform signs are found out. These frustrated states generalize the "half-fire-half-ice" state introduced in reference Yin et al. (2015). The corresponding zero-temperature ground state phase diagrams are presented.
Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar
2015-09-08
Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.
Completion of autobuilt protein models using a database of protein fragments
International Nuclear Information System (INIS)
Cowtan, Kevin
2012-01-01
Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature
Kulkarni, Gargi; Kridelbaugh, Donna M; Guss, Adam M; Metcalf, William W
2009-09-15
Methanogens use an unusual energy-conserving electron transport chain that involves reduction of a limited number of electron acceptors to methane gas. Previous biochemical studies suggested that the proton-pumping F(420)H(2) dehydrogenase (Fpo) plays a crucial role in this process during growth on methanol. However, Methanosarcina barkeri Delta fpo mutants constructed in this study display no measurable phenotype on this substrate, indicating that Fpo plays a minor role, if any. In contrast, Delta frh mutants lacking the cytoplasmic F(420)-reducing hydrogenase (Frh) are severely affected in their ability to grow and make methane from methanol, and double Delta fpo/Delta frh mutants are completely unable to use this substrate. These data suggest that the preferred electron transport chain involves production of hydrogen gas in the cytoplasm, which then diffuses out of the cell, where it is reoxidized with transfer of electrons into the energy-conserving electron transport chain. This hydrogen-cycling metabolism leads directly to production of a proton motive force that can be used by the cell for ATP synthesis. Nevertheless, M. barkeri does have the flexibility to use the Fpo-dependent electron transport chain when needed, as shown by the poor growth of the Delta frh mutant. Our data suggest that the rapid enzymatic turnover of hydrogenases may allow a competitive advantage via faster growth rates in this freshwater organism. The mutant analysis also confirms the proposed role of Frh in growth on hydrogen/carbon dioxide and suggests that either Frh or Fpo is needed for aceticlastic growth of M. barkeri.
Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains
Sabater, Carlos; Untiedt, Carlos; van Ruitenbeek, Jan M
2015-01-01
This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a ‘Berry force’. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high volta...
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
International Nuclear Information System (INIS)
Denschlag, H.O.; Braun, H.; Wolfsberg, K.
1979-01-01
The fission product yields of the members of the decay chains 132 to 137, 99, and 102 in 235 U(n/sub th/,f) were measured at various kinetic energies and ionic charge states of the fragments using the mass separator for unslowed fission products LOHENGRIN. The results are discussed with respect to four aspects: A preferential formation of neutron rich chain members found at high kinetic energy of the fragments is predominantly due to decreasing prompt neutron evaporation. A particularly large effect in chain 132 is attributed to the double shell closure in Sn-132. The persistence of an even-odd pairing effect in the yields throughout the range of kinetic energies studied leads to the conclusion that the high internal excitation energy of the fragments is tied up mainly in the form of collective energy (e.g., deformation energy) rather than single particle excitation. Generally, the yield distribution at constant kinetic energy is invariant with respect to the ionic charge state of the isotopes separated. Deviations from this behavior found in chains 99, 102, 133, and 136 are interpreted as being due to Auger events following a converted transition in the decay of ns-isomers taking place in the vacuum of the separator. A pronounced variation of the independent formation ratio of single isomeric states with the kinetic energy of the fragments is providing direct information on the controversial topic of the change of angular momentum of fission fragments as a function of deformation (scission distance). 34 references
Bu, Dawei; Zhou, Yuwei; Tang, Jian; Jing, Fang; Zhang, Wei
2013-12-01
Abnormal brain natriuretic peptide (BNP) secretion is regarded as the dominating mechanism of cerebral salt wasting syndrome (CSW), which results from a renal loss of sodium and water during intracranial disease leading to hyponatremia. Scale preparation of therapeutic single-chain variable fragment (scFv) that can neutralize elevated circulating BNP may have potential value for clinical use. In this report, we used a recently isolated humanized anti-BNP scFv fragment (3C1) as model antibody (Ab) to evaluate the potential of scale production of this therapeutic protein. The truncated gene encoding for scFv fragment cloned in pET22b (+) was mainly overexpressed as inclusion bodies in Escherichia coli (E. coli) Rosetta (DE3) pLysS cells. The insoluble fragment was solubilized and purified by Ni-NTA agarose resin under denaturation conditions, and recovered via an effective refolding buffer containing 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, 1 mM EDTA, 0.5 M arginine, 2 mM GSH, 1 mM GSSG, and 5% glycerol. The refolded scFv fragment was concentrated by PEG20000, and dialyzed in PBS (containing 5% glycerol, pH 7.4). The final yield was approximately 10.2 mg active scFv fragment per liter of culture (3.4 g wet weight cells). The scFv fragment was more than 95% pure assessed by SDS-PAGE assay. Recombinant scFv fragment with His tag displayed its immunoreactivity with anti-His tag Ab by western blotting. ELISA showed the scFv fragment specifically bound to BNP, and it displayed similar activity as the traditional anti-BNP monoclonal Ab (mAb). Thus, the current strategy allows convenient small-scale production of this therapeutic protein. Copyright © 2013 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Abbasi, Maisam; Sternberg, Henrik; Nilsson, Fredrik
2014-01-01
that impact the cost and time requirements from customers of logistics services are not yet a reality. Research limitations/implications (if applicable) This paper implies that LSP sustainability cannot be investigated in isolation if a company does not manage proprietary resources. Practical implications (if......Purpose The purpose of this article is to explore the environmental impact of Logistics Service Provider (LSP) activities in the light of increased customer attention and fragmentation of the industry. It also explores to what extent the LSPs can actually monitor the environmental impact...... of logistics activities in the supply chain? Design/methodology/approach The methodology of this paper is a literature review, a qualitative interview survey, and three case studies. A framework on sustainability challenges in supply chains derived from the literature is used to structure and analyze...
Joosten, V.; Roelofs, M.S.; Dries, N. van den; Goosen, T.; Verrips, C.T.; Hondel, C.A.M.J.J. van den; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5′- or 3′-terminal ends of the gene encoding llama variable heavy chain antibody fragment VHH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong
2015-08-01
Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Directory of Open Access Journals (Sweden)
Barth Stefan
2005-01-01
Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.
International Nuclear Information System (INIS)
Teoule, R.; Duplaa, A.M.
1987-01-01
Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)
International Nuclear Information System (INIS)
Botet, R.
1996-01-01
A new kinetic fragmentation model, the Fragmentation - Inactivation -Binary (FIB) model is described where a dissipative process stops randomly the sequential, conservative and off-equilibrium fragmentation process. (K.A.)
Joosten, V.; Roelofs, M.S.; Dries, van den N.; Goosen, T.; Verrips, C.T.; Hondel, van den C.A.M.J.J.; Lokman, B.C.
2005-01-01
The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5'- or 3'-terminal ends of the gene encoding llama variable heavy chain antibody fragment V-HH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain
DEFF Research Database (Denmark)
Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey
2006-01-01
The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...
Criscitiello, Michael F; Ohta, Yuko; Graham, Matthew D; Eubanks, Jeannine O; Chen, Patricia L; Flajnik, Martin F
2012-03-01
The invariant chain (Ii) is the critical third chain required for the MHC class II heterodimer to be properly guided through the cell, loaded with peptide, and expressed on the surface of antigen presenting cells. Here, we report the isolation of the nurse shark Ii gene, and the comparative analysis of Ii splice variants, expression, genomic organization, predicted structure, and function throughout vertebrate evolution. Alternative splicing to yield Ii with and without the putative protease-protective, thyroglobulin-like domain is as ancient as the MHC-based adaptive immune system, as our analyses in shark and lizard further show conservation of this mechanism in all vertebrate classes except bony fish. Remarkable coordinate expression of Ii and class II was found in shark tissues. Conserved Ii residues and cathepsin L orthologs suggest their long co-evolution in the antigen presentation pathway, and genomic analyses suggest 450 million years of conserved Ii exon/intron structure. Other than an extended linker preceding the thyroglobulin-like domain in cartilaginous fish, the Ii gene and protein are predicted to have largely similar physiology from shark to man. Duplicated Ii genes found only in teleosts appear to have become sub-functionalized, as one form is predicted to play the same role as that mediated by Ii mRNA alternative splicing in all other vertebrate classes. No Ii homologs or potential ancestors of any of the functional Ii domains were found in the jawless fish or lower chordates. Copyright © 2011 Elsevier Ltd. All rights reserved.
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.
2000-01-01
Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Directory of Open Access Journals (Sweden)
Casparus J. Crous
2015-08-01
Full Text Available In South Africa, much of the forest biome is vulnerable to human-induced disturbance. The forest-dwelling butterfly Charaxes xiphares occidentalis is naturally confined to a small forest region in the south-western Cape, South Africa. Most of the remaining habitat of this species is within a fragmented agricultural matrix. Furthermore, this geographical area is also heavily invaded by alien plants, especially Acacia mearnsii. We investigated how C. x. occidentalis behaviourally responds to different habitat conditions in the landscape. We were particularly interested in touring, patrolling and settling behaviour as a conservation proxy for preference of a certain habitat configuration in this agricultural matrix. Remnant forest patches in the agricultural matrix showed fewer behavioural incidents than in a reference protected area. Moreover, dense stands of A. mearnsii negatively influenced the incidence and settling pattern of this butterfly across the landscape, with fewer tree settlings associated with more heavily invaded forest patches. This settling pattern was predominantly seen in female butterflies. We also identified specific trees that were settled upon for longer periods by C. x. occidentalis. Distance to a neighbouring patch and patch size influenced behavioural incidences, suggesting that further patch degradation and isolation could be detrimental to this butterfly. Conservation implications: We highlight the importance of clearing invasive tree species from vulnerable forest ecosystems and identify key tree species to consider in habitat conservation and rehabilitation programmes for this butterfly. We also suggest retaining as much intact natural forest as possible. This information should be integrated in local biodiversity management plans.
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Fragmentation kinetics of a Morse oscillator chain under tension
International Nuclear Information System (INIS)
Stember, Joseph N.; Ezra, Gregory S.
2007-01-01
The bond dissociation kinetics of tethered atomic (Morse potential) chains under tensile stress is studied. Both RRKM (fully anharmonic, Monte Carlo) and RRK (harmonic appproximation) theory are applied to predict bond dissociation rate constants as a function of energy and tensile force. For chains with N ≥ 3 atoms a hybrid statistical theory is used involving a harmonic approximation for motion in the transition state for bond dissociation. For chains with N = 2-5 atoms, while the RRK approximation significantly overestimates the dissociation rate constant, the fully anharmonic RRKM rate is quite close to simulation results. For the N = 2 chain, a novel approach to the extraction of decay rate constants based on the classical spectral theorem is implemented. Good agreement between the RRKM and dynamical rate constants is obtained for N = 2 despite the fact that the reactant phase space contains a significant fraction of relatively short-lived trajectories
Traveling waves and conservation laws for highly nonlinear wave equations modeling Hertz chains
Przedborski, Michelle; Anco, Stephen C.
2017-09-01
A highly nonlinear, fourth-order wave equation that models the continuum theory of long wavelength pulses in weakly compressed, homogeneous, discrete chains with a general power-law contact interaction is studied. For this wave equation, all solitary wave solutions and all nonlinear periodic wave solutions, along with all conservation laws, are derived. The solutions are explicitly parameterized in terms of the asymptotic value of the wave amplitude in the case of solitary waves and the peak of the wave amplitude in the case of nonlinear periodic waves. All cases in which the solution expressions can be stated in an explicit analytic form using elementary functions are worked out. In these cases, explicit expressions for the total energy and total momentum for all solutions are obtained as well. The derivation of the solutions uses the conservation laws combined with an energy analysis argument to reduce the wave equation directly to a separable first-order differential equation that determines the wave amplitude in terms of the traveling wave variable. This method can be applied more generally to other highly nonlinear wave equations.
Takeuchi, Yayoi; Soda, Ryoji; Diway, Bibian; Kuda, Tinjan Ak; Nakagawa, Michiko; Nagamasu, Hidetoshi; Nakashizuka, Tohru
2017-01-01
This study explored the conservation values of communally reserved forests (CRFs), which local indigenous communities deliberately preserve within their area of shifting cultivation. In the current landscape of rural Borneo, CRFs are the only option for conservation because other forested areas have already been logged or transformed into plantations. By analyzing their alpha and beta diversity, we investigated how these forests can contribute to restore regional biodiversity. Although CRFs were fragmented and some had been disturbed in the past, their tree species diversity was high and equivalent to that of primary forests. The species composition of intact forests and forests disturbed in the past did not differ clearly, which indicates that past logging was not intensive. All CRFs contained unique and endangered species, which are on the IUCN Red List, Sarawak protected plants, or both. On the other hand, the forest size structure differed between disturbed and intact CRFs, with the disturbed CRFs consisting of relatively smaller trees. Although the beta diversity among CRFs was also high, we found a high contribution of species replacement (turnover), but not of richness difference, in the total beta diversity. This suggests that all CRFs have a conservation value for restoring the overall regional biodiversity. Therefore, for maintaining the regional species diversity and endangered species, it would be suitable to design a conservation target into all CRFs.
Fast local fragment chaining using sum-of-pair gap costs
DEFF Research Database (Denmark)
Otto, Christian; Hoffmann, Steve; Gorodkin, Jan
2011-01-01
, and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Directory of Open Access Journals (Sweden)
Tanya L Poshusta
Full Text Available BACKGROUND: The amyloidoses are protein misfolding diseases characterized by the deposition of amyloid that leads to cell death and tissue degeneration. In immunoglobulin light chain amyloidosis (AL, each patient has a unique monoclonal immunoglobulin light chain (LC that forms amyloid deposits. Somatic mutations in AL LCs make these proteins less thermodynamically stable than their non-amyloidogenic counterparts, leading to misfolding and ultimately the formation of amyloid fibrils. We hypothesize that location rather than number of non-conservative mutations determines the amyloidogenicity of light chains. METHODOLOGY/PRINCIPAL FINDINGS: We performed sequence alignments on the variable domain of 50 kappa and 91 lambda AL light chains and calculated the number of non-conservative mutations over total number of patients for each secondary structure element in order to identify regions that accumulate non-conservative mutations. Among patients with AL, the levels of circulating immunoglobulin free light chain varies greatly, but even patients with very low levels can have very advanced amyloid deposition. CONCLUSIONS: Our results show that in specific secondary structure elements, there are significant differences in the number of non-conservative mutations between normal and AL sequences. AL sequences from patients with different levels of secreted light chain have distinct differences in the location of non-conservative mutations, suggesting that for patients with very low levels of light chains and advanced amyloid deposition, the location of non-conservative mutations rather than the amount of free light chain in circulation may determine the amyloidogenic propensity of light chains.
Roy, Sudeshna; Spilling, Christopher D
2010-11-19
A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.
International Nuclear Information System (INIS)
Gilani, S.A.; Watanabe, K.N.; Fujii, Y.; Shinwari, Z.K.
2011-01-01
Justicia adhatoda from Kohat Plateau was selected for genetic diversity studies, due to its fragmented habitat, importance in traditional and pharmaceutical medicine and a lack of population structure studies. We had two hypotheses: that habitat loss posed a greater threat to populations than loss of genetic diversity, and that chemical diversity would be higher among different populations than within populations. Genetic diversity within and among populations was evaluated using PBA (P450 based analogue) markers. AMOVA analysis revealed that there was higher genetic diversity within populations (90%) than among populations (10%). No genetic drift was observed, i.e., genetic diversity within populations was maintained despite fewer numbers of individuals in fragmented populations. Surveys of J. adhatoda populations revealed that they were growing in harsh conditions and were imperiled due to extensive harvesting for commercial and domestic purposes. Chemical diversity was evaluated by GC-MS (Gas Chromatograph-Mass Spectrometry) analysis of 90% methanol and 1:2 chloroform:methanol extracts. GC-MS analysis of both the extracts showed nine and 18 chemical compounds, respectively, with higher chemical variations among populations. It is therefore recommended that efforts for the conservation of severely fragmented populations of J. adhatoda must be carried out along with sustainable harvesting. (author)
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.
Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B
2016-11-25
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
The Buccaneer software for automated model building. 1. Tracing protein chains.
Cowtan, Kevin
2006-09-01
A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.
Who wants to conserve remaining forest fragments in the ...
African Journals Online (AJOL)
For exam- ple, a small forest that is surrounded by agricultural fields and that is still partly .... 75. 43. 21. Forest fragments [% of forest in village territory]. 5. 20. 100. 100. Market proximity ..... Cas de Manompana – Nord-Est de. Madagascar.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Spatial and temporal dimensions of landscape fragmentation across the Brazilian Amazon.
Rosa, Isabel M D; Gabriel, Cristina; Carreiras, Joāo M B
2017-01-01
The Brazilian Amazon in the past decades has been suffering severe landscape alteration, mainly due to anthropogenic activities, such as road building and land clearing for agriculture. Using a high-resolution time series of land cover maps (classified as mature forest, non-forest, secondary forest) spanning from 1984 through 2011, and four uncorrelated fragmentation metrics (edge density, clumpiness index, area-weighted mean patch size and shape index), we examined the temporal and spatial dynamics of forest fragmentation in three study areas across the Brazilian Amazon (Manaus, Santarém and Machadinho d'Oeste), inside and outside conservation units. Moreover, we compared the impacts on the landscape of: (1) different land uses (e.g. cattle ranching, crop production), (2) occupation processes (spontaneous vs. planned settlements) and (3) implementation of conservation units. By 2010/2011, municipalities located along the Arc of Deforestation had more than 55% of the remaining mature forest strictly confined to conservation units. Further, the planned settlement showed a higher rate of forest loss, a more persistent increase in deforested areas and a higher relative incidence of deforestation inside conservation units. Distinct agricultural activities did not lead to significantly different landscape structures; the accessibility of the municipality showed greater influence in the degree of degradation of the landscapes. Even with a high proportion of the landscapes covered by conservation units, which showed a strong inhibitory effect on forest fragmentation, we show that dynamic agriculturally driven economic activities, in municipalities with extensive road development, led to more regularly shaped, heavily fragmented landscapes, with higher densities of forest edge.
The Technology Introduction of Chain Boiler Energy Conservation Transformation
Li, Henan; Liu, Xiwen; Yuan, Hong; Lin, Jiadai; Zhang, Yu
2017-12-01
Introduced the present status of chain boiler efficiency is low, the system analysis of the chain boiler optimization and upgrading of technology, for the whole progress of chain boiler to provide some ideas and reference.
Energy Technology Data Exchange (ETDEWEB)
Liming, C.; Fengjun, L.; Xiaohong, L.
2016-07-01
The purpose of this paper investigates the subject behavior of Energy conservation and emission reduction (ECER) based on structured classification of the organization types of FLF supply chain, and explores reasonable behavior incentive mechanism for ECER of FLF supply chain in China. Design/methodology/approach: This paper classifies the organization subjects of FLF supply chain, and different characteristics of organization subjects are compared in detail. ECER behavior incentive mechanism modeling of FLF supply chain is explored by taking advantage of principal-agent model in view of asymmetry information. Incentives issue of different operating subjects is discussed as enlightenment of the model. Findings: Three types of the organization subjects of FLF supply chain in China have been identified as: loose organization, semi-compact organization and compact organization.Subjects of different types have different abilities to conduct ECER work. Government needs to propose differentiation polices of incentive compensation for different operating subjects, widen the gap of differentiated subsidies/rewards for different investment levels on ECER conducted by different operating subjects of FLF supply chain. Research limitations/implications: It will take long-term unremitting efforts to achieve the target of ECER work for FLF supply chain in China, the dynamic issues and simulation modeling on behavior incentive mechanism of ECER should be developed in future research. Practical implications: Clear understanding of structured classification of the organization subject types of FLF supply chain and the behavior incentive mechanism for ECER, will help government to improve the ECER work in an efficient and effective way... (Author)
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis
Directory of Open Access Journals (Sweden)
Chi-Hsin Lee
2017-10-01
Full Text Available Russell’s vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs containing 3.4 × 107 and 5.5 × 107 transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis.
Lee, Chi-Hsin; Lee, Yu-Ching; Lee, Yueh-Lun; Leu, Sy-Jye; Lin, Liang-Tzung; Chen, Chi-Ching; Chiang, Jen-Ron; Mwale, Pharaoh Fellow; Tsai, Bor-Yu; Hung, Ching-Sheng; Yang, Yi-Yuan
2017-10-27
Russell's vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY) antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs) containing 3.4 × 10⁷ and 5.5 × 10⁷ transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.
Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome
International Nuclear Information System (INIS)
Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie
2008-01-01
Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus
Directory of Open Access Journals (Sweden)
Christiane Y Ozaki
Full Text Available Diarrhea is a prevalent pathological condition frequently associated to the colonization of the small intestine by enterotoxigenic Escherichia coli (ETEC strains, known to be endemic in developing countries. These strains can produce two enterotoxins associated with the manifestation of clinical symptoms that can be used to detect these pathogens. Although several detection tests have been developed, minimally equipped laboratories are still in need of simple and cost-effective methods. With the aim to contribute to the development of such diagnostic approaches, we describe here two mouse hybridoma-derived single chain fragment variable (scFv that were produced in E. coli against enterotoxins of ETEC strains.Recombinant scFv were developed against ETEC heat-labile toxin (LT and heat-stable toxin (ST, from previously isolated hybridoma clones. This work reports their design, construction, molecular and functional characterization against LT and ST toxins. Both antibody fragments were able to recognize the cell-interacting toxins by immunofluorescence, the purified toxins by ELISA and also LT-, ST- and LT/ST-producing ETEC strains.The developed recombinant scFvs against LT and ST constitute promising starting point for simple and cost-effective ETEC diagnosis.
Stability of llama heavy chain antibody fragments under extreme conditions
Dolk, E.
2004-01-01
Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Ji, Xiaonan; Shen, Yanli; Sun, Hao; Gao, Xiangdong
2016-08-01
Human hepatocellular carcinoma (HCC) has a high rate of tumor recurrence and metastasis, resulting in shortened survival time. The function of alpha-fetoprotein (AFP) as a regulatory factor in the growth of HCC cells has been well defined. The aim of this study was to investigate the use of a novel AFP-specific single-chain variable fragment that blocked AFP and inhibited HCC cell growth. The results indicated that the anti-AFP single-chain variable fragment (scFv) induced growth inhibition of AFP-expressing HCC cell lines in vitro through induction of G1 cell cycle arrest and apoptosis. The mechanism of apoptosis probably involved with blocking AFP internalization and regulation of the PTEN/PI3K/Akt signaling network. Moreover, the anti-AFP-scFv also effectively sensitized the HepG2 cells to paclitaxel (PTX) at a lower concentration. The combination effect of PTX and anti-AFP-scFv displayed a synergistic effect on HepG2 cells both in vitro and in vivo. Our results demonstrated that targeting AFP by specific antibodies has potential immunotherapeutic efficacy in human HCC.
Directory of Open Access Journals (Sweden)
Santiago Marfà
Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.
Cloning and expression of cell wall acid invertase gene fragment ...
African Journals Online (AJOL)
A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...
Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek
2018-01-01
Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.
Responses of bats to forest fragmentation at Pozuzo, Peru
Directory of Open Access Journals (Sweden)
José Luis Mena
2011-05-01
Full Text Available Forest fragmentation and deforestation are among the major threats to Peruvian bats conservation. Unfortunately,information about the effects of these threats above 500 m elevation is lacking. In this study, I assessedbat responses to fragmentation in Pozuzo (Pasco at a landscape scale approach. I evaluate two hypothesesregarding the role of bats as indicators of habitat disturbance. The first prediction says that landscapes highlydisturbed will show higher abundances of habitat generalist species such as frugivorous bats belonging to thesubfamilies Stenodermatinae and Carollinae. The second prediction regards that landscapes with greater forestcover will show higher abundance of habitat specialist species such as animalivorous bat species belongingto the subfamily Phyllostominae, a guild sensitive to forest disturbance. I found evidence supporting the animalivoroushypothesis but it was partial to the frugivorous hypothesis. This study highlights the importance offorest fragments to bat conservation in human-modified landscapes.
The lund Monte Carlo for jet fragmentation
International Nuclear Information System (INIS)
Sjoestrand, T.
1982-03-01
We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)
Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge
2015-12-01
Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.
Veiga, Puri; Rubal, Marcos; Cacabelos, Eva; Moreira, Juan; Sousa-Pinto, Isabel
2013-10-01
The crustose calcareous red macroalgae Lithophyllum byssoides (Lamarck) Foslie is a common ecosystem engineer along the Atlantic and Mediterranean coast of the Iberian Peninsula. This species is threatened by several anthropogenic impacts acting at different spatial scales, such as pollution or global warming. The aim of this study is to identify scales of spatial variation in the abundance and fragmentation patterns of L. byssoides along the Atlantic coast of the Iberian Peninsula. For this aim we used a hierarchical sampling design considering four spatial scales (from metres to 100s of kilometres). Results of the present study indicated no significant variability among regions investigated whereas significant variability was found at the scales of shore and site in spatial patterns of abundance and fragmentation of L. byssoides. Variance components were higher at the spatial scale of shore for abundance and fragmentation of L. byssoides with the only exception of percentage cover and thus, processes acting at the scale of 10s of kilometres seem to be more relevant in shaping the spatial variability both in abundance and fragmentation of L. byssoides. These results provided quantitative estimates of abundance and fragmentation of L. byssoides at the Atlantic coast of the Iberian Peninsula establishing the observational basis for future assessment, monitoring and experimental investigations to identify the processes and anthropogenic impacts affecting L. byssoides populations. Finally we have also identified percentage cover and patch density as the best variables for long-term monitoring programs aimed to detect future anthropogenic impacts on L. byssoides. Therefore, our results have important implications for conservation and management of this valuable ecosystem engineer along the Atlantic coast of the Iberian Peninsula.
Roy, Sudeshna; Spilling, Christopher D.
2010-01-01
A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791
The bioenergy potential of conservation areas and roadsides for biogas in an urbanized region
International Nuclear Information System (INIS)
Van Meerbeek, Koenraad; Ottoy, Sam; De Meyer, Annelies; Van Schaeybroeck, Tom; Van Orshoven, Jos; Muys, Bart; Hermy, Martin
2015-01-01
Highlights: • We assessed the bioenergy potential of conservation areas and roadsides in Flanders. • An area of 31,055 ha produces 203 kton DM of herbaceous biomass annually. • The associated biomass supply chain was optimized with OPTIMASS in four scenarios. • The net energy balance of the studied systems was 7 GJ ha −1 in the 2020 scenarios. • We show that this biomass can play a role to meet the increased biomass demand in 2020. - Abstract: In many urbanized areas the roadside and nature conservation management offers a biomass-for-bioenergy resource potential which is barely valorized, because of the fragmented biomass production sites and the scarcity of accurate data on the spatial availability of the biomass. In this study, a GIS based assessment was performed to determine the regional non-woody biomass-for-bioenergy potential for biogas from conservation areas and roadsides in Flanders, Belgium. These systems, with an area of 31,055 ha, have an annual herbaceous biomass production of 203 kton dry matter. The full associated biomass-to-bioenergy supply chain was optimized in four scenarios to maximize the net energy output and the profit. The scenario analysis was performed with OPTIMASS, a recently developed GIS based strategic decision support system. The analysis showed that the energetic valorization of conservation and roadside biomass through anaerobic digestion had a positive net energy balance, although there is still much room for improvements. Economically, however, it is a less interesting biomass resource. Most likely, the economic picture would change when other ecosystem services delivered by the protected biodiversity would be taken into account. Future technical advances and governmental incentives, like green energy certificates, will be necessary to incorporate the biomass into the energy chain. By tackling the existing barriers and providing a detailed methodology for biomass potential assessments, this study tries to
International Nuclear Information System (INIS)
Floriani, Elena; Lima, Ricardo; Ourrad, Ouerdia; Spinelli, Lionel
2016-01-01
Highlights: • The flux through a Markov chain of a conserved quantity (mass) is studied. • Mass is supplied by an external source and ends in the absorbing states of the chain. • Meaningful for modeling open systems whose dynamics has a Markov property. • The analytical expression of mass distribution is given for a constant source. • The expression of mass distribution is given for periodic or random sources. - Abstract: In this paper we study the flux through a finite Markov chain of a quantity, that we will call mass, which moves through the states of the chain according to the Markov transition probabilities. Mass is supplied by an external source and accumulates in the absorbing states of the chain. We believe that studying how this conserved quantity evolves through the transient (non-absorbing) states of the chain could be useful for the modelization of open systems whose dynamics has a Markov property.
Directory of Open Access Journals (Sweden)
Liming Chen
2016-02-01
Full Text Available Purpose: The purpose of this paper investigates the subject behavior of Energy conservation and emission reduction (ECER based on structured classification of the organization types of FLF supply chain, and explores reasonable behavior incentive mechanism for ECER of FLF supply chain in China. Design/methodology/approach: This paper classifies the organization subjects of FLF supply chain, and different characteristics of organization subjects are compared in detail. ECER behavior incentive mechanism modeling of FLF supply chain is explored by taking advantage of principal-agent model in view of asymmetry information. Incentives issue of different operating subjects is discussed as enlightenment of the model. Findings: Three types of the organization subjects of FLF supply chain in China have been identified as: loose organization, semi-compact organization and compact organization.Subjects of different types have different abilities to conduct ECER work. Government needs to propose differentiation polices of incentive compensation for different operating subjects, widen the gap of differentiated subsidies/rewards for different investment levels on ECER conducted by different operating subjects of FLF supply chain. Research limitations/implications: It will take long-term unremitting efforts to achieve the target of ECER work for FLF supply chain in China, the dynamic issues and simulation modeling on behavior incentive mechanism of ECER should be developed in future research. Practical implications: Clear understanding of structured classification of the organization subject types of FLF supply chain and the behavior incentive mechanism for ECER, will help government to improve the ECER work in an efficient and effective way. Originality/value: Research to behavior incentive mechanism of ECER has important theoretical value and practical significance. This paper contributes to distinguish three types of operating subjects of FLF supply chain in
Some comments on jet fragmentation models and sup(α)s determinations
International Nuclear Information System (INIS)
Sjoestrand, T.
1984-03-01
A number of interrelated topics on jet properties in e + e - annihilation is discussed. The need for different αsub(s) values in different fragmentation models is explained, with particular emphasis on the sensitivity to the choice of momentum conservation scheme in independent fragmentation models. Also other factors leading to a broad range of experimental αsub(s) values are discussed. Old and new methods to distinguish different fragmentation models are presented, with particular emphasis on gluon jet fragmentation properties. (orig.)
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
Energy Technology Data Exchange (ETDEWEB)
Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)
2017-03-23
Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.
Shigemori, Suguru; Ihara, Masaki; Sato, Takashi; Yamamoto, Yoshinari; Nigar, Shireen; Ogita, Tasuku; Shimosato, Takeshi
2017-01-01
Interleukin 6 (IL-6) is an important pathogenic factor in development of various inflammatory and autoimmune diseases and cancer. Blocking antibodies against molecules associated with IL-6/IL-6 receptor signaling are an attractive candidate for the prevention or therapy of these diseases. In this study, we developed a genetically modified strain of Lactococcus lactis secreting a single-chain variable fragment antibody against mouse IL-6 (IL6scFv). An IL6scFv-secretion vector was constructed by cloning an IL6scFv gene fragment into a lactococcal secretion plasmid and was electroporated into L. lactis NZ9000 (NZ-IL6scFv). Secretion of recombinant IL6scFv (rIL6scFv) by nisin-induced NZ-IL6scFv was confirmed by western blotting and was optimized by tuning culture conditions. We found that rIL6scFv could bind to commercial recombinant mouse IL-6. This result clearly demonstrated the immunoreactivity of rIL6scFv. This is the first study to engineer a genetically modified strain of lactic acid bacteria (gmLAB) that produces a functional anti-cytokine scFv. Numerous previous studies suggested that mucosal delivery of biomedical proteins using gmLAB is an effective and low-cost way to treat various disorders. Therefore, NZ-IL6scFv may be an attractive tool for the research and development of new IL-6 targeting agents for various inflammatory and autoimmune diseases as well as for cancer.
Directory of Open Access Journals (Sweden)
Nenad Micic
2014-01-01
Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...
African Journals Online (AJOL)
Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains.
Sabater, Carlos; Untiedt, Carlos; van Ruitenbeek, Jan M
2015-01-01
This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a 'Berry force'. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high voltage appears to behave as expected for regular break down by thermal excitation due to Joule heating. However, there is a low-voltage breaking mode that has characteristics expected for the mechanism of current-induced forces. Although a full comparison would require more detailed information on the individual atomic configurations, the systems we consider are very similar to those considered in recent model calculations and the comparison between experiment and theory is very encouraging for the interpretation we propose.
Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains
Directory of Open Access Journals (Sweden)
Carlos Sabater
2015-12-01
Full Text Available This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a ‘Berry force’. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high voltage appears to behave as expected for regular break down by thermal excitation due to Joule heating. However, there is a low-voltage breaking mode that has characteristics expected for the mechanism of current-induced forces. Although a full comparison would require more detailed information on the individual atomic configurations, the systems we consider are very similar to those considered in recent model calculations and the comparison between experiment and theory is very encouraging for the interpretation we propose.
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin
2010-07-22
Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.
Edge-effect interactions in fragmented and patchy landscapes.
Porensky, Lauren M; Young, Truman P
2013-06-01
Ecological edges are increasingly recognized as drivers of landscape patterns and ecosystem processes. In fragmented and patchy landscapes (e.g., a fragmented forest or a savanna with scattered termite mounds), edges can become so numerous that their effects pervade the entire landscape. Results of recent studies in such landscapes show that edge effects can be altered by the presence or proximity of other nearby edges. We considered the theoretical significance of edge-effect interactions, illustrated various landscape configurations that support them and reviewed existing research on this topic. Results of studies from a variety of locations and ecosystem types show that edge-effect interactions can have significant consequences for ecosystems and conservation, including higher tree mortality rates in tropical rainforest fragments, reduced bird densities in grassland fragments, and bush encroachment and reduced wildlife densities in a tropical savanna. To clarify this underappreciated concept and synthesize existing work, we devised a conceptual framework for edge-effect interactions. We first worked to reduce terminological confusion by clarifying differences among terms such as edge intersection and edge interaction. For cases in which nearby edge effects interact, we proposed three possible forms of interaction: strengthening (presence of a second edge causes stronger edge effects), weakening (presence of a second edge causes weaker edge effects), and emergent (edge effects change completely in the presence of a second edge). By clarifying terms and concepts, this framework enables more precise descriptions of edge-effect interactions and facilitates comparisons of results among disparate study systems and response variables. A better understanding of edge-effect interactions will pave the way for more appropriate modeling, conservation, and management in complex landscapes. © 2013 Society for Conservation Biology.
Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin
2018-04-01
Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7 CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.
Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin
2009-01-01
Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.
Neutralisation and binding of VHS virus by monovalent antibody fragments
DEFF Research Database (Denmark)
Cupit, P.M.; Lorenzen, Niels; Strachan, G.
2001-01-01
We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...
Culture impact in construction supply chain management
Tzortzatou, E. P.
2008-01-01
Awareness of cultural differences in construction supply chains is of fundamental importance because only through a thorough understanding of the manifestations of culture can fragmented supply chains be appropriately integrated into cohesive and collaborating teams which enhance project performance Hence the concept of cultural alignment with the project supply chain is introduced in order for long-term collaborative relationships based on trust, co ordination and mutual benefit to be establ...
Selective disulfide reduction for labeling and enhancement of Fab antibody fragments
International Nuclear Information System (INIS)
Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.
2016-01-01
Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying
Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties
Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.
2003-12-01
A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.
International Nuclear Information System (INIS)
Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.
1990-01-01
The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome
Rocha, Ricardo; Ovaskainen, Otso; López-Baucells, Adrià; Farneda, Fábio Z; Sampaio, Erica M; Bobrowiec, Paulo E D; Cabeza, Mar; Palmeirim, Jorge M; Meyer, Christoph F J
2018-02-28
Tropical forest loss and fragmentation are due to increase in coming decades. Understanding how matrix dynamics, especially secondary forest regrowth, can lessen fragmentation impacts is key to understanding species persistence in modified landscapes. Here, we use a whole-ecosystem fragmentation experiment to investigate how bat assemblages are influenced by the regeneration of the secondary forest matrix. We surveyed bats in continuous forest, forest fragments and secondary forest matrix habitats, ~15 and ~30 years after forest clearance, to investigate temporal changes in the occupancy and abundance of old-growth specialist and habitat generalist species. The regeneration of the second growth matrix had overall positive effects on the occupancy and abundance of specialists across all sampled habitats. Conversely, effects on generalist species were negligible for forest fragments and negative for secondary forest. Our results show that the conservation potential of secondary forests for reverting faunal declines in fragmented tropical landscapes increases with secondary forest age and that old-growth specialists, which are often of most conservation concern, are the greatest beneficiaries of secondary forest maturation. Our findings emphasize that the transposition of patterns of biodiversity persistence in island ecosystems to fragmented terrestrial settings can be hampered by the dynamic nature of human-dominated landscapes.
Deborah A. Rudnick; Sadie J. Ryan; Paul Beier; Samuel A. Cushman; Fred Dieffenbach; Clinton W. Epps; Leah R. Gerber; Joel Hartter; Jeff S. Jenness; Julia Kintsch; Adina M. Merenlender; Ryan M. Perkl; Damian V. Preziosi; Stephen C. Trombulak
2012-01-01
Landscape connectivity, the extent to which a landscape facilitates the movements of organisms and their genes, faces critical threats from both fragmentation and habitat loss. Many conservation efforts focus on protecting and enhancing connectivity to offset the impacts of habitat loss and fragmentation on biodiversity conservation, and to increase the resilience of...
Rypul, K; Chmielewski, R; Smielewska-Loś, E; Klimentowski, S
2002-04-01
Biological material was taken from dogs with diarrhoea. Faecal samples were taken from within live animals and intestinal tract fragments (i.e. small intestine, and stomach) were taken from dead animals. In total, 18 specimens were investigated from dogs housed alone or in large groups. To test for the presence of the virus, latex (On Site Biotech, Uppsala, Sweden) and direct immunofluorescence tests were performed. At the same time, polymerase chain reaction (PCR) with primers complementary to a conservative region of VP1/VP2 was carried out. The products of amplification were analysed on 2% agarose gel. The purified products were cloned with the Template Generation System (Finnzymes, Espoo, Finland) using a transposition reaction and positive clones were searched using the 'colony screening by PCR' method. The sequencing gave 12 sequences of VP1/VP2 gene fragments that were of high similarity. Among the 12 analysed sequences, six exhibited 88% similarity, four exhibited 100% similarity and two exhibited 71% similarity.
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Habitat fragmentation and its lasting impact on Earth’s ecosystems
Haddad, Nick M.; Brudvig, Lars A.; Clobert, Jean; Davies, Kendi F.; Gonzalez, Andrew; Holt, Robert D.; Lovejoy, Thomas E.; Sexton, Joseph O.; Austin, Mike P.; Collins, Cathy D.; Cook, William M.; Damschen, Ellen I.; Ewers, Robert M.; Foster, Bryan L.; Jenkins, Clinton N.; King, Andrew J.; Laurance, William F.; Levey, Douglas J.; Margules, Chris R.; Melbourne, Brett A.; Nicholls, A. O.; Orrock, John L.; Song, Dan-Xia; Townshend, John R.
2015-01-01
We conducted an analysis of global forest cover to reveal that 70% of remaining forest is within 1 km of the forest’s edge, subject to the degrading effects of fragmentation. A synthesis of fragmentation experiments spanning multiple biomes and scales, five continents, and 35 years demonstrates that habitat fragmentation reduces biodiversity by 13 to 75% and impairs key ecosystem functions by decreasing biomass and altering nutrient cycles. Effects are greatest in the smallest and most isolated fragments, and they magnify with the passage of time. These findings indicate an urgent need for conservation and restoration measures to improve landscape connectivity, which will reduce extinction rates and help maintain ecosystem services. PMID:26601154
Regularity and mass conservation for discrete coagulation–fragmentation equations with diffusion
Cañ izo, J.A.; Desvillettes, L.; Fellner, K.
2010-01-01
We present a new a priori estimate for discrete coagulation-fragmentation systems with size-dependent diffusion within a bounded, regular domain confined by homogeneous Neumann boundary conditions. Following from a duality argument, this a priori
Goodness of isospin in neutron rich systems from the fission fragment distribution
Garg, Swati; Jain, Ashok Kumar
2017-09-01
We present the results of our calculations for the relative yields of neutron-rich fission fragments emitted in 208Pb (18O, fission) reaction by using the concept of the conservation of isospin and compare with the experimental data. We take into account a range of isospin values allowed by the isospin algebra and assume that the fission fragments are formed in isobaric analog states. We also take into account the neutron multiplicity data for various neutron-emission channels in each partition, and use them to obtain the weight factors in calculating the yields. We then calculate the relative yields of the fission fragments. Our calculated results are able to reproduce the experimental trends reasonably well. This is the first direct evidence of the isospin conservation in neutron-rich systems and may prove a very useful tool in their studies.
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
DEFF Research Database (Denmark)
Headlam, Henrietta A; Davies, Michael Jonathan
2002-01-01
Exposure of proteins to radicals in the presence of O(2) results in side-chain oxidation and backbone fragmentation; the interrelationship between these processes is not fully understood. Recently, initial attack on Ala side-chains was shown to give alpha-carbon radicals (and hence backbone cleav...
Packing motifs as predictors of the propensity of antibody fragments to crystallize
Edmundson, Allen B.; DeWitt, Christina R.; Goldsteen, Benjamin Z.; Ramsland, Paul A.
1999-01-01
A recurring theme in the crystallization of antibody fragments in our laboratory has been a packing pattern involving formation of intermolecular, antiparallel β-pleated sheets across two-fold axes. The most common motif is the antiparallel stacking of constant (C) domains of light (L) chain dimers or Fab molecules. Here, cross-molecule six-stranded sheets are produced by hydrogen-bonding interactions of three-residue polypeptide segments (triads), in the i, i+2 and i+4 positions of the final strands (designated 3-3) of the three-chain layers from two adjacent molecules. In the variable (V) domains the triads are supplied by the first strands (4-1) of the four-chain layers and the resulting cross-molecule sheets contain eight strands. The latter type of packing is more likely to be seen in crystals of Fv fragments (V domains only) than in those of L chain dimers or Fabs. Amongst the triads from either the V or C domains, there are on average four sets of backbone carbonyl and amide groups within hydrogen bonding distance (chain dimers, Fab and Fvs are likely to crystallize in these packing patterns.
Ten-Year Follow-Up of a Fragment Reattachment to an Anterior Tooth: A Conservative Approach.
Mendes, Luiz; Laxe, Laisa; Passos, Leandro
2017-01-01
This report describes the 10-year follow-up data of a patient who underwent fragment reattachment to the maxillary central incisor after coronal fracture with pulp exposure as well as the procedures followed for functional and esthetic adjustments. A 9-year-old female patient presented at the clinic of dentistry at the State University of Rio de Janeiro with a coronal fracture and pulp exposure of the right maxillary central incisor that had occurred immediately after an accident. The intact tooth fragment was recovered at the accident site and stored in milk. The treatment plan followed was to perform direct pulp capping and tooth fragment reattachment. When the patient was 14 years old, adhesion between fragment and remaining tooth was lost, and fragment reattachment was performed. Five years later, the same tooth presented clinical discoloration and absence of sensitivity during pulp vitality tests. Subsequently, a new treatment plan was formulated, which included endodontic treatment, followed by nonvital tooth bleaching and light-cured composite resin restoration. An esthetic and natural-looking restoration was achieved. Tooth fragment reattachment is not a temporary restorative technique and requires functional and esthetic adjustments over time to maintain the biomimetic characteristics of traumatized anterior teeth and predictable outcomes.
Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John
2015-10-01
Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.
Proctor, Michael F; McLellan, Bruce N; Strobeck, Curtis; Barclay, Robert M R
2005-11-22
Ecosystem conservation requires the presence of native carnivores, yet in North America, the distributions of many larger carnivores have contracted. Large carnivores live at low densities and require large areas to thrive at the population level. Therefore, if human-dominated landscapes fragment remaining carnivore populations, small and demographically vulnerable populations may result. Grizzly bear range contraction in the conterminous USA has left four fragmented populations, three of which remain along the Canada-USA border. A tenet of grizzly bear conservation is that the viability of these populations requires demographic linkage (i.e. inter-population movement of both sexes) to Canadian bears. Using individual-based genetic analysis, our results suggest this demographic connection has been severed across their entire range in southern Canada by a highway and associated settlements, limiting female and reducing male movement. Two resulting populations are vulnerably small (bear populations may be more threatened than previously thought and that conservation efforts must expand to include international connectivity management. They also demonstrate the ability of genetic analysis to detect gender-specific demographic population fragmentation in recently disturbed systems, a traditionally intractable yet increasingly important ecological measurement worldwide.
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
International Nuclear Information System (INIS)
Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya
2014-01-01
Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies
The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi
Joosten, V.; Lokman, C.; Hondel, C.A.M.J.J. van den; Punt, P.J.
2003-01-01
In this review we will focus on the current status and views concerning the production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi. We will focus on single-chain antibody fragment production (scFv and VHH) by these lower eukaryotes and the possible applications
Hisada, Hiromoto; Tsutsumi, Hiroko; Ishida, Hiroki; Hata, Yoji
2013-01-01
Llama variable heavy-chain antibody fragment (VHH) fused to four different reader proteins was produced and secreted in culture medium by Aspergillus oryzae. These fusion proteins consisted of N-terminal reader proteins, VHH, and a C-terminal his-tag sequence which facilitated purification using one-step his-tag affinity chromatography. SDS-PAGE analysis of the deglycosylated purified fusion proteins confirmed that the molecular weight of each corresponded to the expected sum of VHH and the respective reader proteins. The apparent high molecular weight reader protein glucoamylase (GlaB) was found to be suitable for efficient VHH production. The GlaB-VHH-His protein bound its antigen, human chorionic gonadotropin, and was detectable by a new ELISA-based method using a coupled assay with glucoamylase, glucose oxidase, peroxidase, maltose, and 3,3',5,5'-tetramethylbenzidine as substrates. Addition of potassium phosphate to the culture medium induced secretion of 0.61 mg GlaB-VHH-His protein/ml culture medium in 5 days.
The actual relevance of ecological corridors in nature conservation
Directory of Open Access Journals (Sweden)
Ćurčić Nina B.
2013-01-01
Full Text Available The paper considers theoretical and applied foundations of the concept of the ecological corridors in nature conservation. Their relevance comes from recent ecological phenomenon of habitat fragmentation which is rapidly increasing during last decades. Habitat fragmentation is one of the main threats to richness and diversity of wildlife. Ecological corridors can mitigate the loss and fragmentation of habitat. Corridors perform as “bridges” between habitats for species and they provide a flow of the natural or even anthropogenic caused disturbances. In this paper we will present the meaning and significance of ecological corridors in nature conservation, as well as types of ecological corridors and their ecological benefits. Methodological and practical approaches in nature protection system in Serbia are included. [Projekat Ministarstva nauke Republike Srbije, br. 47007 i br. 176008
Burbano- Girón, Jaime
2013-01-01
Abstract. Prioritizing landscape connectivity is a primary objective in the conservation planning of biodiversity, since it is assumed that there will be scenarios where the dispersal of species would be necessary due to habitat fragmentation and climate change. Atelines (Primates, Atelinae) include species of Spider Monkeys (Ateles spp.) and Woolly monkeys (Lagothrix spp.); primates with great importance for the tropical forest ecosystems where they inhabit because of their role as seed disp...
Molecular Tools For Biodiversity Conservation
Indian Academy of Sciences (India)
... habits that make them difficultstudy subjects when using conventional field techniques.Molecular tools can be used to decipher distributions andpopulation connectedness in fragmented habitats and identifypopulations of immediate conservation concern. We discussthese with case studies on some cat species in India.
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
High dispersal in a frog species suggests that it is vulnerable to habitat fragmentation
Funk, W. Chris; Greene, Allison E; Corn, Paul Stephen; Allendorf, Fred W
2005-01-01
Global losses of amphibian populations are a major conservation concern and their causes have generated substantial debate. Habitat fragmentation is considered one important cause of amphibian decline. However, if fragmentation is to be invoked as a mechanism of amphibian decline, it must first be established that dispersal is prevalent among contiguous amphibian populations using formal movement estimators. In contrast, if dispersal is naturally low in amphibians, fragmentation can be disreg...
Rates of species loss from Amazonian forest fragments
Ferraz, Gonçalo; Russell, Gareth J.; Stouffer, Philip C.; Bierregaard, Richard O.; Pimm, Stuart L.; Lovejoy, Thomas E.
2003-01-01
In the face of worldwide habitat fragmentation, managers need to devise a time frame for action. We ask how fast do understory bird species disappear from experimentally isolated plots in the Biological Dynamics of Forest Fragments Project, central Amazon, Brazil. Our data consist of mist-net records obtained over a period of 13 years in 11 sites of 1, 10, and 100 hectares. The numbers of captures per species per unit time, analyzed under different simplifying assumptions, reveal a set of species-loss curves. From those declining numbers, we derive a scaling rule for the time it takes to lose half the species in a fragment as a function of its area. A 10-fold decrease in the rate of species loss requires a 1,000-fold increase in area. Fragments of 100 hectares lose one half of their species in <15 years, too short a time for implementing conservation measures. PMID:14614134
Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki
2011-08-02
Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.
International Nuclear Information System (INIS)
He, Jia; Qin, Weichao; Zhang, Xujia; Wen, Yang; Su, Limin; Zhao, Yuanhui
2013-01-01
Prediction of the biodegradability of organic pollutants is an ecologically desirable and economically feasible tool for estimating the environmental fate of chemicals. In this paper, linear and nonlinear relationships between biological oxygen demand (BOD) and molecular descriptors/fragments have been investigated for 1130 organic chemicals. Significant relationships have been observed between the simple molecular descriptors and %BOD for some homologous compounds, but not for the whole set of compounds. Electronic parameters, such as E HOMO and E LUMO , are the dominant factors affecting the biodegradability for some homologous chemicals. However, other descriptors, such as molecular weight, acid dissociation constant and polarity still have a significant impact on the biodegradation. The best global model for %BOD prediction is that developed from a chain-based fragmentation scheme. At the same time, the theoretical relationship between %BOD and molecular descriptors/fragments has been investigated, based on a first-order kinetic process. The %BOD is nonlinearly, rather than linearly, related to the descriptors. The coefficients of determination can be significantly improved by using nonlinear models for the homologous compounds and the whole data set. After analysing 1130 ready and not ready biodegradable compounds using 23 simple descriptors and various fragmentation schemes, it was revealed that biodegradation could be well predicted from a chain-based fragmentation scheme, a decision tree and a %BOD model. The models were capable of separating NRB and RB with an overall accuracy of 87.2%, 83.0% and 82.5%, respectively. The best classification model developed was a chain-based model but it used 155 fragments. The simplest model was a decision tree which only used 10 structural fragments. The effect of structures on the biodegradation has been analysed and the biodegradation pathway and mechanisms have been discussed based on activating and inactivating
effect of habitat fragmentation on diversity and abundance of nesting
African Journals Online (AJOL)
cw
Department of Zoology and Wildlife Conservation, University of Dar es ... Keywords: fragmentation, nesting birds, thickets, campus of the University of Dar es ... 43(1), 2017 ..... Yale University Press, ... bird species in urban parks: Effects of park.
Diets of swift foxes (Vulpes velox) in continuous and fragmented prairie in Northwestern Texas
Kamler, J.F.; Ballard, W.B.; Wallace, M.C.; Gipson, P.S.
2007-01-01
Distribution of the swift fox (Vulpes velox) has declined dramatically since the 1800s, and suggested causes of this decline are habitat fragmentation and transformation due to agricultural expansion. However, impacts of fragmentation and human-altered habitats on swift foxes still are not well understood. To better understand what effects these factors have on diets of swift foxes, scats were collected in northwestern Texas at two study sites, one of continuous native prairie and one representing fragmented native prairie interspersed with agricultural and fields in the Conservation Reserve Program. Leporids, a potential food source, were surveyed seasonally on both sites. Diets of swift foxes differed between sites; insects were consumed more on continuous prairie, whereas mammals, birds, and crops were consumed more on fragmented prairie. Size of populations of leporids were 2-3 times higher on fragmented prairie, and swift foxes responded by consuming more leporids on fragmented (11.1% frequency occurrence) than continuous (3.8%) prairie. Dietary diversity was greater on fragmented prairie during both years of the study. Differences in diets between sites suggested that the swift fox is an adaptable and opportunistic feeder, able to exploit a variety of food resources, probably in relation to availability of food. We suggest that compared to continuous native prairie, fragmented prairie can offer swift foxes a more diverse prey base, at least within the mosaic of native prairie, agricultural, and fields that are in the Conservation Reserve Program.
Quantification of habitat fragmentation reveals extinction risk in terrestrial mammals
Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; King, Sarah R. B.; Rondinini, Carlo; Boitani, Luigi
2017-01-01
Although habitat fragmentation is often assumed to be a primary driver of extinction, global patterns of fragmentation and its relationship to extinction risk have not been consistently quantified for any major animal taxon. We developed high-resolution habitat fragmentation models and used phylogenetic comparative methods to quantify the effects of habitat fragmentation on the world’s terrestrial mammals, including 4,018 species across 26 taxonomic Orders. Results demonstrate that species with more fragmentation are at greater risk of extinction, even after accounting for the effects of key macroecological predictors, such as body size and geographic range size. Species with higher fragmentation had smaller ranges and a lower proportion of high-suitability habitat within their range, and most high-suitability habitat occurred outside of protected areas, further elevating extinction risk. Our models provide a quantitative evaluation of extinction risk assessments for species, allow for identification of emerging threats in species not classified as threatened, and provide maps of global hotspots of fragmentation for the world’s terrestrial mammals. Quantification of habitat fragmentation will help guide threat assessment and strategic priorities for global mammal conservation. PMID:28673992
Peñaloza-Ramírez, Juan Manuel; Aguilar-Amezquita, Bernardo; Núñez-Farfán, Juan; Pérez-Nasser, Nidia; Albarrán-Lara, Ana Luisa; Oyama, Ken
2016-01-01
Abstract: Chamaedorea alternans is a palm species that has suffered from selective extraction, and habitat loss. We collected 11 populations from fragmented and conserved forest. We assess genetic variation of C. alternans, genetic exchange, differentiation, bottlenecks, effective population size and signals of natural selection. Genetic diversity was higher in conserved than in fragmented forest but not significant. Fragmentation did not play a significant role in genetic diversity, possibly...
How conserved are the conserved 16S-rRNA regions?
Directory of Open Access Journals (Sweden)
Marcel Martinez-Porchas
2017-02-01
Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.
Directory of Open Access Journals (Sweden)
Laury Cullen
Full Text Available Jaguar (Panthera onca populations in the Upper Paraná River, in the Brazilian Atlantic Forest region, live in a landscape that includes highly fragmented areas as well as relatively intact ones. We developed a model of jaguar habitat suitability in this region, and based on this habitat model, we developed a spatially structured metapopulation model of the jaguar populations in this area to analyze their viability, the potential impact of road mortality on the populations' persistence, and the interaction between road mortality and habitat fragmentation. In more highly fragmented populations, density of jaguars per unit area is lower and density of roads per jaguar is higher. The populations with the most fragmented habitat were predicted to have much lower persistence in the next 100 years when the model included no dispersal, indicating that the persistence of these populations are dependent to a large extent on dispersal from other populations. This, in turn, indicates that the interaction between road mortality and habitat fragmentation may lead to source-sink dynamics, whereby populations with highly fragmented habitat are maintained only by dispersal from populations with less fragmented habitat. This study demonstrates the utility of linking habitat and demographic models in assessing impacts on species living in fragmented landscapes.
Cullen, Laury; Stanton, Jessica C; Lima, Fernando; Uezu, Alexandre; Perilli, Miriam L L; Akçakaya, H Reşit
2016-01-01
Jaguar (Panthera onca) populations in the Upper Paraná River, in the Brazilian Atlantic Forest region, live in a landscape that includes highly fragmented areas as well as relatively intact ones. We developed a model of jaguar habitat suitability in this region, and based on this habitat model, we developed a spatially structured metapopulation model of the jaguar populations in this area to analyze their viability, the potential impact of road mortality on the populations' persistence, and the interaction between road mortality and habitat fragmentation. In more highly fragmented populations, density of jaguars per unit area is lower and density of roads per jaguar is higher. The populations with the most fragmented habitat were predicted to have much lower persistence in the next 100 years when the model included no dispersal, indicating that the persistence of these populations are dependent to a large extent on dispersal from other populations. This, in turn, indicates that the interaction between road mortality and habitat fragmentation may lead to source-sink dynamics, whereby populations with highly fragmented habitat are maintained only by dispersal from populations with less fragmented habitat. This study demonstrates the utility of linking habitat and demographic models in assessing impacts on species living in fragmented landscapes.
Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies.
Qamsari, Elmira Safaie; Sharifzadeh, Zahra; Bagheri, Salman; Riazi-Rad, Farhad; Younesi, Vahid; Abolhassani, Mohsen; Ghaderi, Sepideh Safaei; Baradaran, Behzad; Somi, Mohammad Hossein; Yousefi, Mehdi
2017-12-01
The receptor tyrosine kinase (RTK) Met is the cell surface receptor for hepatocyte growth factor (HGF) involved in invasive growth programs during embryogenesis and tumorgenesis. There is compelling evidence suggesting important roles for c-Met in colorectal cancer proliferation, migration, invasion, angiogenesis, and survival. Hence, a molecular inhibitor of an extracellular domain of c-Met receptor that blocks c-Met-cell surface interactions could be of great thera-peutic importance. In an attempt to develop molecular inhibitors of c-Met, single chain variable fragment (scFv) phage display libraries Tomlinson I + J against a specific synthetic oligopeptide from the extracellular domain of c-Met receptor were screened; selected scFv were then characterized using various immune techniques. Three c-Met specific scFv (ES1, ES2, and ES3) were selected following five rounds of panning procedures. The scFv showed specific binding to c-Met receptor, and significantly inhibited proliferation responses of a human colorectal carcinoma cell line (HCT-116). Moreover, anti- apoptotic effects of selected scFv antibodies on the HCT-116 cell line were also evaluated using Annexin V/PI assays. The results demonstrated rates of apoptotic cell death of 46.0, 25.5, and 37.8% among these cells were induced by use of ES1, ES2, and ES3, respectively. The results demonstrated ability to successfully isolate/char-acterize specific c-Met scFv that could ultimately have a great therapeutic potential in immuno-therapies against (colorectal) cancers.
Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George
2003-05-01
Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
SCit: web tools for protein side chain conformation analysis
Gautier, R.; Camproux, A.-C.; Tufféry, P.
2004-01-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...
SCit: web tools for protein side chain conformation analysis.
Gautier, R; Camproux, A-C; Tufféry, P
2004-07-01
SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.
Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes
Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.
2005-01-01
The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated
International Nuclear Information System (INIS)
Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.
1990-01-01
Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment
Intermittency in 197Au fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.
1995-07-01
The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs
Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein
DEFF Research Database (Denmark)
Engvig, J P; Olsen, K E; Gislefoss, R E
1998-01-01
AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....
Properties, production and applications of camelid single-domain antibody fragments
Harmsen, M.M.; Haard, de H.J.
2007-01-01
Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANGYou-Yi; LINZhen-Quan; KEJian-Hon~
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the symmetric migration rate kernels K (k; j) = K′(k; j) =λkjv and the constant aggregation rates I1, I2 and fragmentation rates Jl, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions in several cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When Jl = 0 and J2 = O, the aggregate size distributions αk(t) and bk(t) obey the conventional scaling law, while when Jl > 0 and J2 > O, they obey the modified scaling law with an exponential scaling function. The total mass of either species remains conserved.
Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains
Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.
2017-06-01
Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.
Forest edge disturbance increases rattan abundance in tropical rain forest fragments.
Campbell, Mason J; Edwards, Will; Magrach, Ainhoa; Laurance, Susan G; Alamgir, Mohammed; Porolak, Gabriel; Laurance, William F
2017-07-20
Human-induced forest fragmentation poses one of the largest threats to global diversity yet its impact on rattans (climbing palms) has remained virtually unexplored. Rattan is arguably the world's most valuable non-timber forest product though current levels of harvesting and land-use change place wild populations at risk. To assess rattan response to fragmentation exclusive of harvesting impacts we examined rattan abundance, demography and ecology within the forests of northeastern, Australia. We assessed the community abundance of rattans, and component adult (>3 m) and juvenile (≤3 m) abundance in five intact forests and five fragments (23-58 ha) to determine their response to a range of environmental and ecological parameters. Fragmented forests supported higher abundances of rattans than intact forests. Fragment size and edge degradation significantly increased adult rattan abundance, with more in smaller fragments and near edges. Our findings suggest that rattan increase within fragments is due to canopy disturbance of forest edges resulting in preferential, high-light habitat. However, adult and juvenile rattans may respond inconsistently to fragmentation. In managed forest fragments, a rattan abundance increase may provide economic benefits through sustainable harvesting practices. However, rattan increases in protected area forest fragments could negatively impact conservation outcomes.
Meta-analysis of the effects of forest fragmentation on interspecific interactions.
Magrach, Ainhoa; Laurance, William F; Larrinaga, Asier R; Santamaria, Luis
2014-10-01
Forest fragmentation dramatically alters species persistence and distribution and affects many ecological interactions among species. Recent studies suggest that mutualisms, such as pollination and seed dispersal, are more sensitive to the negative effects of forest fragmentation than antagonisms, such as predation or herbivory. We applied meta-analytical techniques to evaluate this hypothesis and quantified the relative contributions of different components of the fragmentation process (decreases in fragment size, edge effects, increased isolation, and habitat degradation) to the overall effect. The effects of fragmentation on mutualisms were primarily driven by habitat degradation, edge effects, and fragment isolation, and, as predicted, they were consistently more negative on mutualisms than on antagonisms. For the most studied interaction type, seed dispersal, only certain components of fragmentation had significant (edge effects) or marginally significant (fragment size) effects. Seed size modulated the effect of fragmentation: species with large seeds showed stronger negative impacts of fragmentation via reduced dispersal rates. Our results reveal that different components of the habitat fragmentation process have varying impacts on key mutualisms. We also conclude that antagonistic interactions have been understudied in fragmented landscapes, most of the research has concentrated on particular types of mutualistic interactions such as seed dispersal, and that available studies of interspecific interactions have a strong geographical bias (arising mostly from studies carried out in Brazil, Chile, and the United States). © 2014 Society for Conservation Biology.
Charge distributions and correlations in fragmentation models for soft hadron collisions
International Nuclear Information System (INIS)
Wolf, E.A. de
1984-01-01
Data on charge distributions and charge correlations in pp and meson-proton interactions at PS and SPS energies are successfully compared with the Lund fragmentation model for low-psub(T) hadron collisions. It is argued that local conservation of quantum numbers and resonance production, as implemented in fragmentation models, are sufficient ingredients to explain most of the available experimental results at these energies. No necessity is found for dual-sheet contributions considered in DTU-based parton models. (orig.)
Charge distribution in the ternary fragmentation of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)
2017-08-15
We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)
Ricotta, Fernanda
2010-01-01
In this paper the extent of international fragmentation of production in Italian manufacturing industries for the years 1985, 1995 and 2000 is assessed with different indicators. The objective is to determine where fragmentation is most prevalent and to provide a description of the key characteristics of those sectors. The paper first presents a survey of global value chain indicators and how these have been used in the economic literature. The second part supplies empirical evidence on the g...
Plasmon-Polariton Properties in Metallic Nanosphere Chains
Directory of Open Access Journals (Sweden)
Witold Aleksander Jacak
2015-06-01
Full Text Available The propagation of collective wave type plasmonic excitations along infinite chains of metallic nanospheres has been analyzed, including near-, medium- and far-field contributions to the plasmon dipole interaction with all retardation effects taken into account. It is proven that there exist weakly-damped self-modes of plasmon-polaritons in the chain for which the propagation range is limited by relatively small Ohmic losses only. In this regime, the Lorentz friction irradiation losses on each nanosphere in the chain are ideally compensated by the energy income from the rest of the chain. The completely undamped collective waves were identified in the case of the presence of persistent external excitation of some fragment of the chain. The obtained characteristics of these excitations fit the experimental observations well.
Landscape responses of bats to habitat fragmentation in Atlantic forest of paraguay
Gorresen, P.M.; Willig, M.R.
2004-01-01
Understanding effects of habitat loss and fragmentation on populations or communities is critical to effective conservation and restoration. This is particularly important for bats because they provide vital services to ecosystems via pollination and seed dispersal, especially in tropical and subtropical habitats. Based on more than 1,000 h of survey during a 15-month period, we quantified species abundances and community structure of phyllostomid bats at 14 sites in a 3,000-km2 region of eastern Paraguay. Abundance was highest for Artibeus lituratus in deforested landscapes and for Chrotopterus auritus in forested habitats. In contrast, Artibeus fimbriatus, Carollia perspicillata, Glossophaga soricina, Platyrrhinus lineatus, Pygoderma bilabiatum, and Sturnira lilium attained highest abundance in moderately fragmented forest landscapes. Forest cover, patch size, and patch density frequently were associated with abundance of species. At the community level, species richness was highest in partly deforested landscapes, whereas evenness was greatest in forested habitat. In general, the highest diversity of bats occurred in landscapes comprising moderately fragmented forest habitat. This underscores the importance of remnant habitat patches to conservation strategies.
Santos, Alexandre Rosa Dos; Antonio Alvares Soares Ribeiro, Carlos; de Oliveira Peluzio, Telma Machado; Esteves Peluzio, João Batista; de Queiroz, Vagner Tebaldi; Figueira Branco, Elvis Ricardo; Lorenzon, Alexandre Simões; Domingues, Getulio Fonseca; Marcatti, Gustavo Eduardo; de Castro, Nero Lemos Martins; Teixeira, Thaisa Ribeiro; Dos Santos, Gleissy Mary Amaral Dino Alves; Santos Mota, Pedro Henrique; Ferreira da Silva, Samuel; Vargas, Rozimelia; de Carvalho, José Romário; Macedo, Leandro Levate; da Silva Araújo, Cintia; de Almeida, Samira Luns Hatum
2016-12-01
The Atlantic Forest biome is recognized for its biodiversity and is one of the most threatened biomes on the planet, with forest fragmentation increasing due to uncontrolled land use, land occupation, and population growth. The most serious aspect of the forest fragmentation process is the edge effect and the loss of biodiversity. In this context, the aim of this study was to evaluate the dynamics of forest fragmentation and select potential forest fragments with a higher degree of conservation for seed harvesting in the Itapemirim river basin, Espírito Santo State, Brazil. Image classification techniques, forest landscape ecology, and multi-criteria analysis were used to evaluate the evolution of forest fragmentation to develop the landscape metric indexes, and to select potential forest fragments for seed harvesting for the years 1985 and 2013. According to the results, there was a reduction of 2.55% of the occupancy of the fragments in the basin between the years 1985 and 2013. For the years 1985 and 2013, forest fragment units 2 and 3 were spatialized with a high potential for seed harvesting, representing 6.99% and 16.01% of the total fragments, respectively. The methodology used in this study has the potential to be used to support decisions for the selection of potential fragments for seed harvesting because selecting fragments in different environments by their spatial attributes provides a greater degree of conservation, contributing to the protection and conscious management of the forests. The proposed methodology can be adapted to other areas and different biomes of the world. Copyright © 2016 Elsevier Ltd. All rights reserved.
Importance of riparian remnants for frog species diversity in a highly fragmented rainforest.
Rodríguez-Mendoza, Clara; Pineda, Eduardo
2010-12-23
Tropical forests undergo continuous transformation to other land uses, resulting in landscapes typified by forest fragments surrounded by anthropogenic habitats. Small forest fragments, specifically strip-shaped remnants flanking streams (referred to as riparian remnants), can be particularly important for the maintenance and conservation of biodiversity within highly fragmented forests. We compared frog species diversity between riparian remnants, other forest fragments and cattle pastures in a tropical landscape in Los Tuxtlas, Mexico. We found similar species richness in the three habitats studied and a similar assemblage structure between riparian remnants and forest fragments, although species composition differed by 50 per cent. Frog abundance was halved in riparian remnants compared with forest fragments, but was twice that found in pastures. Our results suggest that riparian remnants play an important role in maintaining a portion of frog species diversity in a highly fragmented forest, particularly during environmentally stressful (hot and dry) periods. In this regard, however, the role of riparian remnants is complementary, rather than substitutive, with respect to the function of other forest fragments within the fragmented forest.
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Nieuwenhuizen, W.; Gravesen, M.
1981-01-01
Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and
Tumour targeting with monovalent fragments of anti-neuroblastoma antibody chCE7
International Nuclear Information System (INIS)
Carrel, F.; Novak-Hofer, I.; Ruch, C.; Zimmermann, K.; Amstutz, H.
1997-01-01
The in vitro and in vivo behaviour of the monovalent single chain (scFv) and Fab-fragments derived from anti-neuroblastoma antibody chCE7 is reported. When comparing tumour uptake and -retention of radioactivity of 67 Cu-labelled monovalent chCE7 with divalent chCE7 F(ab') 2 the advantage of the radiocopper label over the radioiodine label was more pronounced with the divalent (internalising) F(ab') 2 fragments. (author) 1 fig., 1 ref
The Fourier law in a momentum-conserving chain
Giardinà, C.; Kurchan, J.
2005-01-01
We introduce a family of models for heat conduction with and without momentum conservation. They are analytically solvable in the high temperature limit and can also be efficiently simulated. In all cases the Fourier law is verified in one dimension.
Plug and Play Firms in the TNCs' Virtual Value Chain
Directory of Open Access Journals (Sweden)
Teresa Pakulska
2016-04-01
Full Text Available Growing virtualisation of the value chain appears to be an expression of implementation of ICT solutions in international business represented by TNCs. This creates new opportunities for cooperation within the value chain and its composition. The growing importance in this area can be attributed to companies integrating the value chain, known as plug and play. Their integration into the value creation chain gives a new dimension to TNCs' strategic choices from the fragmentation of activity and its integration on an international scale point of view.
Global patterns of fragmentation and connectivity of mammalian carnivore habitat.
Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi
2011-09-27
Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.
Vanden Broeck, An; Maes, Dirk; Kelager, Andreas; Wynhoff, Irma; Wallis de Vries, Michiel; Nash, David R.; Oostermeijer, J.G.B.; Dyck, van Hans; Mergeay, Joachim
2017-01-01
Understanding connectivity among populations in fragmented landscapes is of paramount importance in species conservation because it determines their long-term viability and helps to identify and prioritize populations to conserve. Rare and sedentary species are particularly vulnerable to habitat
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
Energy Technology Data Exchange (ETDEWEB)
Zhao, Shuli [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Nanjing Affiliated First Hospital, Nanjing Medical University, Nanjing (China); Zhao, Guangfeng; Xie, Hao; Huang, Yahong [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Hou, Yayi [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing (China)
2012-01-27
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex){sub 1.3}(DOX){sub 20}. In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers.
A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth
International Nuclear Information System (INIS)
Zhao, Shuli; Zhao, Guangfeng; Xie, Hao; Huang, Yahong; Hou, Yayi
2012-01-01
Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex) 1.3 (DOX) 20 . In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers
Conservation implications when the next predators are known. Chapter 2
Frank R., III Thompson; Christine A. Ribic
2012-01-01
Conservation and management of passerines has largely focused on habitat manipulation or restoration because the natural communities on which these birds depend have been destroyed and fragmented. However, productivity is another important aspect of avian conservation, and nest predation can be a large source of nesting mortality for passerines. Recent studies using...
Li, Qing; Wang, Ze-yuan; Cao, Zhi-chao; Du, Rui-yang; Luo, Hao
2015-08-01
With the process of globalisation and the development of management models and information technology, enterprise cooperation and collaboration has developed from intra-enterprise integration, outsourcing and inter-enterprise integration, and supply chain management, to virtual enterprises and enterprise networks. Some midfielder enterprises begin to serve for different supply chains. Therefore, they combine related supply chains into a complex enterprise network. The main challenges for enterprise network's integration and collaboration are business process and data fragmentation beyond organisational boundaries. This paper reviews the requirements of enterprise network's integration and collaboration, as well as the development of new information technologies. Based on service-oriented architecture (SOA), collaboration modelling and collaboration agents are introduced to solve problems of collaborative management for service convergence under the condition of process and data fragmentation. A model-driven methodology is developed to design and deploy the integrating framework. An industrial experiment is designed and implemented to illustrate the usage of developed technologies in this paper.
Intermittency in {sup 197}Au fragmentation
Energy Technology Data Exchange (ETDEWEB)
Dabrowska, A; Holynski, R; Olszewski, A; Szarska, M; Wilczynska, B; Wolter, W; Wosiek, B [Institute of Nuclear Physics, Cracow (Poland); Cherry, M L; Deines-Jones, P; Jones, W V; Sengupta, K; Wefel, B [Louisiana State Univ., Baton Rouge, LA (United States). Dept. of Physics and Astronomy; Waddington, C J [Minnesota Univ., Minneapolis, MN (United States). School of Physics and Astronomy; Pozharova, E A; Skorodko, T Yu [Inst. of Theoretical and Experimental Physics, Moscow (Russian Federation); KLMM Collaboration
1995-07-01
The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs.
J chain in the nurse shark: implications for function in a lower vertebrate.
Hohman, Valerie S; Stewart, Sue E; Rumfelt, Lynn L; Greenberg, Andrew S; Avila, David W; Flajnik, Martin F; Steiner, Lisa A
2003-06-15
J chain is a small polypeptide covalently attached to polymeric IgA and IgM. In humans and mice, it plays a role in binding Ig to the polymeric Ig receptor for transport into secretions. The putative orthologue of mammalian J chain has been identified in the nurse shark by sequence analysis of cDNA and the polypeptide isolated from IgM. Conservation with J chains from other species is relatively poor, especially in the carboxyl-terminal portion, and, unlike other J chains, the shark protein is not acidic. The only highly conserved segment in all known J chains is a block of residues surrounding an N-linked glycosylation site. Of the eight half-cystine residues that are conserved in mammalian J chains, three are lacking in the nurse shark, including two in the carboxyl-terminal segment that have been reported to be required for binding of human J chain-containing IgA to secretory component. Taken together with these data, the relative abundance of J chain transcripts in the spleen and their absence in the spiral valve (intestine) suggest that J chain in nurse sharks may not have a role in Ig secretion. Analysis of J chain sequences in diverse species is in agreement with accepted phylogenetic relationships, with the exception of the earthworm, suggesting that the reported presence of J chain in invertebrates should be reassessed.
Yangian symmetry of long-range gl(N) integrable spin chains
International Nuclear Information System (INIS)
Beisert, Niklas; Erkal, Denis
2008-01-01
An interesting type of spin chain has appeared in the context of the planar AdS/CFT correspondence: it is based on an integrable nearest-neighbor spin chain, and it is perturbatively deformed by long-range interactions which apparently preserve the integrable structure. Similar models can be constructed by demanding the existence of merely one conserved local charge. Although the latter is not a sufficient integrability condition in general, the models often display convincing signs of full integrability. Here we consider a class of long-range spin chains with spins transforming in the fundamental representation of gl(N). For the most general such model with one conserved local charge we construct a conserved Yangian generator and show that it obeys the Serre relations. We thus provide a formal proof of integrability for this class of models
Keddie, Daniel J
2014-01-21
The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.
Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P
2013-08-01
Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.
Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah
2016-07-29
A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.
Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H
1998-02-01
A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.
Yan, Guiping; Smiley, Richard W
2010-03-01
The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
International Nuclear Information System (INIS)
Grennan, Kathleen; Strachan, Gillian; Porter, Andrew J.; Killard, Anthony J.; Smyth, Malcolm R.
2003-01-01
This work describes the development of an electrochemical immunosensor for the analysis of atrazine using recombinant single-chain antibody (scAb) fragments. The sensors are based on carbon paste screen-printed electrodes incorporating the conducting polymer polyaniline (PANI)/poly(vinylsulphonic acid) (PVSA), which enables direct mediatorless coupling to take place between the redox centres of antigen-labelled horseradish peroxidase (HRP) and the electrode surface. Competitive immunoassays can be performed in real-time using this separation-free system. Analytical measurements based on the pseudo-linear relationship between the slope of a real-time amperometric signal and the concentration of analyte, yield a novel immunosensor set-up capable of regenerationless amperometric analysis. Multiple, sequential measurements of standards and samples can be performed on a single scAb-modified surface in a matter of minutes. No separation of bound and unbound species was necessary prior to detection. The system is capable of measuring atrazine to a detection limit of 0.1 ppb (0.1 μg l -1 ). This system offers the potential for rapid, cost-effective immunosensing for the analysis of samples of environmental, medical and pharmaceutical significance
Riemann solvers and undercompressive shocks of convex FPU chains
International Nuclear Information System (INIS)
Herrmann, Michael; Rademacher, Jens D M
2010-01-01
We consider FPU-type atomic chains with general convex potentials. The naive continuum limit in the hyperbolic space–time scaling is the p-system of mass and momentum conservation. We systematically compare Riemann solutions to the p-system with numerical solutions to discrete Riemann problems in FPU chains, and argue that the latter can be described by modified p-system Riemann solvers. We allow the flux to have a turning point, and observe a third type of elementary wave (conservative shocks) in the atomistic simulations. These waves are heteroclinic travelling waves and correspond to non-classical, undercompressive shocks of the p-system. We analyse such shocks for fluxes with one or more turning points. Depending on the convexity properties of the flux we propose FPU-Riemann solvers. Our numerical simulations confirm that Lax shocks are replaced by so-called dispersive shocks. For convex–concave flux we provide numerical evidence that convex FPU chains follow the p-system in generating conservative shocks that are supersonic. For concave–convex flux, however, the conservative shocks of the p-system are subsonic and do not appear in FPU-Riemann solutions
The relative effects of habitat loss, fragmentation, and degradation on population extinction
The most prominent conservation concerns are typically habitat loss and habitat fragmentation. The role of habitat degradation has received comparatively little attention. But research has shown that the quality of habitat patches can significantly influence wildlife population d...
Tapia-Armijos, María Fernanda; Homeier, Jürgen; Espinosa, Carlos Iván; Leuschner, Christoph; de la Cruz, Marcelino
2015-01-01
Deforestation and fragmentation are major components of global change; both are contributing to the rapid loss of tropical forest area with important implications for ecosystem functioning and biodiversity conservation. The forests of South Ecuador are a biological 'hotspot' due to their high diversity and endemism levels. We examined the deforestation and fragmentation patterns in this area of high conservation value using aerial photographs and Aster satellite scenes. The registered annual deforestation rates of 0.75% (1976-1989) and 2.86% (1989-2008) for two consecutive survey periods, the decreasing mean patch size and the increasing isolation of the forest fragments show that the area is under severe threat. Approximately 46% of South Ecuador's original forest cover had been converted by 2008 into pastures and other anthropogenic land cover types. We found that deforestation is more intense at lower elevations (premontane evergreen forest and shrubland) and that the deforestation front currently moves in upslope direction. Improved awareness of the spatial extent, dynamics and patterns of deforestation and forest fragmentation is urgently needed in biologically diverse areas like South Ecuador.
Angular correlations and fragmentation in intermediate energy heavy ion collisions
International Nuclear Information System (INIS)
Kristiansson, Anders.
1990-05-01
Intermediate energy heavy-ion collisions have been studied from 35 A MeV up to 94 A MeV at various accelerators. Angular correlations between light particles and detection of projectile- and target-fragments have been used to investigate the reaction mechanisms in this transition region between low- and high energy. An excess of correlations is observed in the particle-particle elastic scattering plane. This excess increases with particle mass and can be understood in terms of momentum conservation. The fragmentation measurements gives an indication that both energy and momentum transfer to the spectator volumes does occur. (author)
Kailemia, Muchena J; Patel, Anish B; Johnson, Dane T; Li, Lingyun; Linhardt, Robert J; Amster, I Jonathan
2015-01-01
The stereochemistry of the hexuronic acid residues of the structure of glycosaminoglycans (GAGs) is a key feature that affects their interactions with proteins and other biological functions. Electron based tandem mass spectrometry methods, in particular electron detachment dissociation (EDD), have been able to distinguish glucuronic acid (GlcA) from iduronic acid (IdoA) residues in some heparan sulfate tetrasaccharides by producing epimer-specific fragments. Similarly, the relative abundance of glycosidic fragment ions produced by collision-induced dissociation (CID) or EDD has been shown to correlate with the type of hexuronic acid present in chondroitin sulfate GAGs. The present work examines the effect of charge state and degree of sodium cationization on the CID fragmentation products that can be used to distinguish GlcA and IdoA containing chondroitin sulfate A and dermatan sulfate chains. The cross-ring fragments (2,4)A(n) and (0,2)X(n) formed within the hexuronic acid residues are highly preferential for chains containing GlcA, distinguishing it from IdoA. The diagnostic capability of the fragments requires the selection of a molecular ion and fragment ions with specific ionization characteristics, namely charge state and number of ionizable protons. The ions with the appropriate characteristics display diagnostic properties for all the chondroitin sulfate and dermatan sulfate chains (degree of polymerization of 4-10) studied.
Resilient networks of ant-plant mutualists in Amazonian forest fragments.
Passmore, Heather A; Bruna, Emilio M; Heredia, Sylvia M; Vasconcelos, Heraldo L
2012-01-01
The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions. We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments. We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.
Resilient networks of ant-plant mutualists in Amazonian forest fragments.
Directory of Open Access Journals (Sweden)
Heather A Passmore
Full Text Available The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions.We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments.We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.
Jet mass dependence of fragmentation in positron-proton collisions
Energy Technology Data Exchange (ETDEWEB)
Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)
2017-02-15
We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)
International Nuclear Information System (INIS)
Pacifico, M.D.; Pearl, R.A.; Kupsch, J.M.
2006-01-01
Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 1 25I odine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells
Directory of Open Access Journals (Sweden)
Zhao Jianjun
2011-02-01
Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.
DEFF Research Database (Denmark)
Uhlenbrock, Franziska Katharina; van Andel, Esther; Andresen, Lars
2015-01-01
that the NKG2D ligand ULBP2 traffics over an invariant chain (Ii)-dependent pathway to the cell surface. This study set out to elucidate how Ii regulates ULBP2 cell-surface transport: We discovered conserved tryptophan (Trp) residues in the primary protein sequence of ULBP1-6 but not in the related MICA....../B. Substitution of Trp to alanine resulted in cell-surface inhibition of ULBP2 in different cancer cell lines. Moreover, the mutated ULBP2 constructs were retained and not degraded inside the cell, indicating a crucial role of this conserved Trp-motif in trafficking. Finally, overexpression of Ii increased...... surface expression of wt ULBP2 while Trp-mutants could not be expressed, proposing that this Trp-motif is required for an Ii-dependent cell-surface transport of ULBP2. Aberrant soluble ULBP2 is immunosuppressive. Thus, targeting a distinct protein module on the ULBP2 sequence could counteract...
Are Plant Species’ Richness and Diversity Influenced by Fragmentation at a Microscale?
Directory of Open Access Journals (Sweden)
Jesús Aguirre-Gutiérrez
2014-01-01
Full Text Available It is argued that forest fragmentation has negative effects on biodiversity at the short and long term; however, these effects might be dependent on the specific vegetation of the study area and its intrinsic characteristics. The processes leading to fragmentation are very diverse and many of them have anthropogenic causes as logging actions and clearings for agricultural fields. Furthermore, it is thought that scale plays an important role in the expected effects of fragmentation on biodiversity. In this study the effect of forest fragmentation and its impact on the woody plants species, richness and diversity are analysed considering three vegetation types in a poorly studied and difficult access biodiversity hotspot in northern Mexico. The results show that the effects of fragmentation are dependent on the vegetation type and that these are not strongly related to the species richness, and diversity in a microscale (100 m2. Fragmentation effects on biodiversity must be analysed in a broad scale, considering the fragment as a whole. Furthermore, conservation priority should be given to the larger fragments, which could potentially maintain a higher portion of biodiversity. Management should also be focused on increasing the connectivity between these big and medium size forest patches.
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Effects of forest fragmentation on nocturnal Asian birds: A case study from Xishuangbanna, China
DAYANANDA, Salindra K.; GOODALE, Eben; LEE, Myung-bok; LIU, Jia-Jia; MAMMIDES, Christos; PASION, Bonifacio O.; QUAN, Rui-Chang; SLIK, J. W. Ferry; SREEKAR, Rachakonda; TOMLINSON, Kyle W.; YASUDA, Mika
2016-01-01
Owls have the potential to be keystone species for conservation in fragmented landscapes, as the absence of these predators could profoundly change community structure. Yet few studies have examined how whole communities of owls respond to fragmentation, especially in the tropics. When evaluating the effect of factors related to fragmentation, such as fragment area and distance to the edge, on these birds, it is also important in heterogeneous landscapes to ask how ‘location factors’ such as the topography, vegetation and soil of the fragment predict their persistence. In Xishuangbanna, southwest China, we established 43 transects (200 m×60 m) within 20 forest fragments to sample nocturnal birds, both visually and aurally. We used a multimodel inference approach to identify the factors that influence owl species richness, and generalized linear mixed models to predict the occurrence probabilities of each species. We found that fragmentation factors dominated location factors, with larger fragments having more species, and four of eight species were significantly more likely to occur in large fragments. Given the potential importance of these birds on regulating small mammal and other animal populations, and thus indirectly affecting seed dispersal, we suggest further protection of large fragments and programs to increase their connectivity to the remaining smaller fragments. PMID:27265653
Effects of forest fragmentation on nocturnal Asian birds: A case study from Xishuangbanna, China
Directory of Open Access Journals (Sweden)
Salindra K. DAYANANDA
2016-05-01
Full Text Available Owls have the potential to be keystone species for conservation in fragmented landscapes, as the absence of these predators could profoundly change community structure. Yet few studies have examined how whole communities of owls respond to fragmentation, especially in the tropics. When evaluating the effect of factors related to fragmentation, such as fragment area and distance to the edge, on these birds, it is also important in heterogeneous landscapes to ask how ‘location factors’ such as the topography, vegetation and soil of the fragment predict their persistence. In Xishuangbanna, southwest China, we established 43 transects (200 m×60 m within 20 forest fragments to sample nocturnal birds, both visually and aurally. We used a multimodel inference approach to identify the factors that influence owl species richness, and generalized linear mixed models to predict the occurrence probabilities of each species. We found that fragmentation factors dominated location factors, with larger fragments having more species, and four of eight species were significantly more likely to occur in large fragments. Given the potential importance of these birds on regulating small mammal and other animal populations, and thus indirectly affecting seed dispersal, we suggest further protection of large fragments and programs to increase their connectivity to the remaining smaller fragments.
Recombinant fragment of an antibody tailored for direct radioiodination
Czech Academy of Sciences Publication Activity Database
Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína
2012-01-01
Roč. 55, č. 1 (2012), s. 52-56 ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012
Developing sustainable food supply chains.
Smith, B Gail
2008-02-27
This paper reviews the opportunities available for food businesses to encourage consumers to eat healthier and more nutritious diets, to invest in more sustainable manufacturing and distribution systems and to develop procurement systems based on more sustainable forms of agriculture. The important factors in developing more sustainable supply chains are identified as the type of supply chain involved and the individual business attitude to extending responsibility for product quality into social and environmental performance within their own supply chains. Interpersonal trust and working to standards are both important to build more sustainable local and many conserved food supply chains, but inadequate to transform mainstream agriculture and raw material supplies to the manufactured and commodity food markets. Cooperation among food manufacturers, retailers, NGOs, governmental and farmers' organizations is vital in order to raise standards for some supply chains and to enable farmers to adopt more sustainable agricultural practices.
DEFF Research Database (Denmark)
Duan, Zhi; Siegumfeldt, Henrik
2010-01-01
We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....
Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge
2012-01-01
Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.
Targeted habitat restoration can reduce extinction rates in fragmented forests.
Newmark, William D; Jenkins, Clinton N; Pimm, Stuart L; McNeally, Phoebe B; Halley, John M
2017-09-05
The Eastern Arc Mountains of Tanzania and the Atlantic Forest of Brazil are two of the most fragmented biodiversity hotspots. Species-area relationships predict that their habitat fragments will experience a substantial loss of species. Most of these extinctions will occur over an extended time, and therefore, reconnecting fragments could prevent species losses and allow locally extinct species to recolonize former habitats. An empirical relaxation half-life vs. area relationship for tropical bird communities estimates the time that it takes to lose one-half of all species that will be eventually lost. We use it to estimate the increase in species persistence by regenerating a forest connection 1 km in width among the largest and closest fragments at 11 locations. In the Eastern Arc Mountains, regenerating 8,134 ha of forest would create >316,000 ha in total of restored contiguous forest. More importantly, it would increase the persistence time for species by a factor of 6.8 per location or ∼2,272 years, on average, relative to individual fragments. In the Atlantic Forest, regenerating 6,452 ha of forest would create >251,000 ha in total of restored contiguous forest and enhance species persistence by a factor of 13.0 per location or ∼5,102 years, on average, relative to individual fragments. Rapidly regenerating forest among fragments is important, because mean time to the first determined extinction across all fragments is 7 years. We estimate the cost of forest regeneration at $21-$49 million dollars. It could provide one of the highest returns on investment for biodiversity conservation worldwide.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
DEFF Research Database (Denmark)
Refslund, Bjarke
Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...
Threshold Switching Induced by Controllable Fragmentation in Silver Nanowire Networks.
Wan, Tao; Pan, Ying; Du, Haiwei; Qu, Bo; Yi, Jiabao; Chu, Dewei
2018-01-24
Silver nanowire (Ag NW) networks have been widely studied because of a great potential in various electronic devices. However, nanowires usually undergo a fragmentation process at elevated temperatures due to the Rayleigh instability that is a result of reduction of surface/interface energy. In this case, the nanowires become completely insulating due to the formation of randomly distributed Ag particles with a large distance and further applications are hindered. Herein, we demonstrate a novel concept based on the combination of ultraviolet/ozone irradiation and a low-temperature annealing process to effectively utilize and control the fragmentation behavior to realize the resistive switching performances. In contrast to the conventional fragmentation, the designed Ag/AgO x interface facilitates a unique morphology of short nanorod-like segments or chains of tiny Ag nanoparticles with a very small spacing distance, providing conduction paths for achieving the tunneling process between the isolated fragments under the electric field. On the basis of this specific morphology, the Ag NW network has a tunable resistance and shows volatile threshold switching characteristics with a high selectivity, which is the ON/OFF current ratio in selector devices. Our concept exploits a new function of Ag NW network, i.e., resistive switching, which can be developed by designing a controllable fragmentation.
Yang, Lulu; Chen, Jianjun; Hu, Weiming; Yang, Tianshun; Zhang, Yanjun; Yukiyoshi, Tamura; Zhou, Yanyang; Wang, Ying
2016-01-01
Habitat fragmentation, water resources and biological characteristics are important factors that shape the genetic structure and geographical distribution of desert plants. Analysis of the relationships between these factors and population genetic variation should help to determine the evolutionary potential and conservation strategies for genetic resources for desert plant populations. As a traditional Chinese herb, Glycyrrhiza inflata B. (Fabaceae) is restricted to the fragmented desert habitat in China and has undergone a dramatic decline due to long-term over-excavation. Determining the genetic structure of the G. inflata population and identifying a core collection could help with the development of strategies to conserve this species. We investigated the genetic variation of 25 G. inflata populations based on microsatellite markers. A high level of population genetic divergence (FST = 0.257), population bottlenecks, reduced gene flow and moderate genetic variation (HE = 0.383) were detected. The genetic distances between the populations significantly correlated with the geographical distances, and this suggests that habitat fragmentation has driven a special genetic structure of G. inflata in China through isolation by distance. STRUCTURE analysis showed that G. inflata populations were structured into three clusters and that the populations belonged to multiple water systems, which suggests that water resources were related to the genetic structure of G. inflata. In addition, the biological characteristics of the perennial species G. inflata, such as its long-lived seeds, asexual reproduction, and oasis ecology, may be related to its resistance to habitat fragmentation. A core collection of G. inflata, that included 57 accessions was further identified, which captured the main allelic diversity of G. inflata. Recent habitat fragmentation has accelerated genetic divergence. The population genetic structure of G. inflata has been shaped by habitat
Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique
2015-01-01
In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.
Structure of antigenetic determinants in the amino-terminal region of bovine fibrinogen Aα chain
International Nuclear Information System (INIS)
Tanswell, P.; Reiter, H.; Timpl, R.
1978-01-01
A radioimmunoassay was developed for peptide F-CB1α from the amino of bovine fibrinogen Aα chain, isolated after reduction and carboxymethylation of the multichain disulfide-linked cyanogen bromide peptide F-CB1. Seven out of twelve different rabbit antisera produced against fibrinogen, peptide F-CB1 or Aα chain showed distinct binding to 125 I-labelled F-CB1α. Thrombin cleavage of F-CB1α yielded two fragments: fibrinopeptide A (residues 1-19) and the carboxy-terminal fragment Th2 (residues 20-54). Antisera could be classified into three groups according to whether they recognized antigenic determinants on fibrinopeptide A, on peptide Th2 or as they showed diminished reactions with both fragments. Only little or no cross-reaction was observed with the amino-terminal cyanogen bromide peptides of Bβ and γ chain. Proteolytic fragments of fibrinopeptide A were isolated and tested for inhibitory activity with two antisera. One antiserum contained anitbodies binding selectively to the amino-terminal sequence (residues 4-11) and did not cross-react with human fibrinopeptide A. Another antiserum showed a specific binding restricted to the carboxy-terminal sequence (residues 11-18) and cross-reacted completely with human fibrinopeptide A. These results correlate well with the primary structures of the two fibrinopeptides. The antigenic activity of the peptide fragment Th2 was localized on a 15-residue tryptic peptide derived from the central portion of the sequence. These and further data indicate that at least six different antigenic determinants are present in peptide F-CB1α. (orig.) 891 AJ [de
The status of conservation of urban forests in eastern Amazonia
Directory of Open Access Journals (Sweden)
DD Amaral
Full Text Available This study aims to identify the remnant tree flora in six forest fragments in the metropolitan area of Belém and to analyze these fragments in terms of biological conservation, species richness and diversity in the local urban landscape. The fragments and their respective sampling areas were as follows: Amafrutas reserve (15 ha, Trambioca Is. reserve (2 ha, Bosque Rodrigues Alves city park (15 ha, Combu Is. reserve (10 ha, Gunma Park reserve (10 ha and Mocambo reserve (5 ha. Inventories were built from lineal plots of 250 m² and included trees with DBH equal to or greater than 10 cm at a height of 1.3 m above ground. Sixty-nine families and 759 species, of which eight were officially listed as endangered (Brazilian National Flora: Ministry of Environment, Normative Instruction of September, 2008; Pará State Flora: Decree Nº. 802 of February 2008 were recorded. These endangered species are: Aspidosperma desmanthum Benth. ex Müll. Arg. (Apocynaceae, Cedrela odorata L. (Meliaceae, Eschweilera piresii S.A Mori (Lecythidaceae, Euxylophora paraensis Huber (Rutaceae, Hymenolobium excelsum Ducke (Leguminosae, Manilkara huberi (Ducke Chevalier (Sapotaceae, Tabebuia impetiginosa (Mart. ex DC. Standl. (Bignoniaceae, Mezilaurus itauba (Meisn. Taub. ex Mez (Lauraceae and Qualea coerulea Aubl. (Vochysiaceae. Emergency actions such as implementing management plans for already existing Conservation Units, the creation of new such units in areas of primary forest fragments (as in the case of the Amafrutas reserve, as well as the intensification of actions of surveillance and monitoring, should be undertaken by Federal, State, and Municipal environmental agencies so as to ensure the conservation of these last primary forest remnants in the metropolitan area of Belém.
Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains
Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.
2008-01-01
The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a
Rueda, Marta; Moreno Saiz, Juan Carlos; Morales-Castilla, Ignacio; Albuquerque, Fabio S; Ferrero, Mila; Rodríguez, Miguel Á
2015-01-01
Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist) varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although forest amount is of
Directory of Open Access Journals (Sweden)
Marta Rueda
Full Text Available Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although
Gong, Minghao; Guan, Tianpei; Hou, Meng; Liu, Gang; Zhou, Tianyuan
2017-01-01
One way that climate change will impact animal distributions is by altering habitat suitability and habitat fragmentation. Understanding the impacts of climate change on currently threatened species is of immediate importance because complex conservation planning will be required. Here, we mapped changes to the distribution, suitability, and fragmentation of giant panda habitat under climate change and quantified the direction and elevation of habitat shift and fragmentation patterns. These data were used to develop a series of new conservation strategies for the giant panda. Qinling Mountains, Shaanxi, China. Data from the most recent giant panda census, habitat factors, anthropogenic disturbance, climate variables, and climate predictions for the year 2050 (averaged across four general circulation models) were used to project giant panda habitat in Maxent. Differences in habitat patches were compared between now and 2050. While climate change will cause a 9.1% increase in suitable habitat and 9% reduction in subsuitable habitat by 2050, no significant net variation in the proportion of suitable and subsuitable habitat was found. However, a distinct climate change-induced habitat shift of 11 km eastward by 2050 is predicted firstly. Climate change will reduce the fragmentation of suitable habitat at high elevations and exacerbate the fragmentation of subsuitable habitat below 1,900 m above sea level. Reduced fragmentation at higher elevations and worsening fragmentation at lower elevations have the potential to cause overcrowding of giant pandas at higher altitudes, further exacerbating habitat shortage in the central Qinling Mountains. The habitat shift to the east due to climate change may provide new areas for giant pandas but poses severe challenges for future conservation.
Mapping absorption processes onto a Markov chain, conserving the mean first passage time
International Nuclear Information System (INIS)
Biswas, Katja
2013-01-01
The dynamics of a multidimensional system is projected onto a discrete state master equation using the transition rates W(k → k′; t, t + dt) between a set of states {k} represented by the regions {ζ k } in phase or discrete state space. Depending on the dynamics Γ i (t) of the original process and the choice of ζ k , the discretized process can be Markovian or non-Markovian. For absorption processes, it is shown that irrespective of these properties of the projection, a master equation with time-independent transition rates W-bar (k→k ' ) can be obtained, which conserves the total occupation time of the partitions of the phase or discrete state space of the original process. An expression for the transition probabilities p-bar (k ' |k) is derived based on either time-discrete measurements {t i } with variable time stepping Δ (i+1)i = t i+1 − t i or the theoretical knowledge at continuous times t. This allows computational methods of absorbing Markov chains to be used to obtain the mean first passage time (MFPT) of the system. To illustrate this approach, the procedure is applied to obtain the MFPT for the overdamped Brownian motion of particles subject to a system with dichotomous noise and the escape from an entropic barrier. The high accuracy of the simulation results confirms with the theory. (paper)
Directory of Open Access Journals (Sweden)
M.M. Ojoyi
2016-11-01
Full Text Available Habitat fragmentation is a threat to conservation of biodiversity hotspots in the Morogoro region, Tanzania. However, on-going research on fragmentation has not kept pace with temporal lapses and how individual species respond to habitat transformation and heterogeneity. This study sought to model spatial and temporal fragmentation patterns. Cloud free multi-temporal Landsat imagery with similar spectral resolution were acquired in the same season in 1975, 1995 and 2012. The images were used to characterize the biophysical landscape characteristics and a range of metrics used to quantify the magnitude of fragmentation. Patches and classes in the landscape were assessed using Fragstats, a spatial statistics program useful in computing landscape metrics. Results show that patch number was higher in dense forest and woodland than in less dense forest and grassland in 1975, 1995 and 2012 while the interspersion Juxtaposition Index (IJI ranged between 0 (for clumped patches and 100 (for grassland. In 1975 and 1995, the grassland habitat had the highest IJI while in 2012 less dense forest had the highest IJI. The Games-Howell test showed a significant fragmentation trend in less dense forests class (p≤0.05. Generally, the study indicates a high fragmentation pattern in the vulnerable tropical eastern arc mountain region of East Africa. This finding demonstrates the value of remotely sensed data in understanding the impact of anthropogenic processes on natural landscape transformation. Furthermore, the study provides a basis for informed conservation policy design and implementation in the region.
Tapia-Armijos, María Fernanda; Homeier, Jürgen; Espinosa, Carlos Iván; Leuschner, Christoph; de la Cruz, Marcelino
2015-01-01
Deforestation and fragmentation are major components of global change; both are contributing to the rapid loss of tropical forest area with important implications for ecosystem functioning and biodiversity conservation. The forests of South Ecuador are a biological ‘hotspot’ due to their high diversity and endemism levels. We examined the deforestation and fragmentation patterns in this area of high conservation value using aerial photographs and Aster satellite scenes. The registered annual deforestation rates of 0.75% (1976–1989) and 2.86% (1989–2008) for two consecutive survey periods, the decreasing mean patch size and the increasing isolation of the forest fragments show that the area is under severe threat. Approximately 46% of South Ecuador’s original forest cover had been converted by 2008 into pastures and other anthropogenic land cover types. We found that deforestation is more intense at lower elevations (premontane evergreen forest and shrubland) and that the deforestation front currently moves in upslope direction. Improved awareness of the spatial extent, dynamics and patterns of deforestation and forest fragmentation is urgently needed in biologically diverse areas like South Ecuador. PMID:26332681
Martins, Ana Paula Barbosa; Feitosa, Leonardo Manir; Lessa, Rosangela Paula; Almeida, Zafira Silva; Heupel, Michelle; Silva, Wagner Macedo; Tchaicka, Ligia; Nunes, Jorge Luiz Silva
2018-01-01
Increasing fishing effort has caused declines in shark populations worldwide. Understanding biological and ecological characteristics of sharks is essential to effectively implement management measures, but to fully understand drivers of fishing pressure social factors must be considered through multidisciplinary and integrated approaches. The present study aimed to use fisher and trader knowledge to describe the shark catch and product supply chain in Northeastern Brazil, and evaluate perceptions regarding the regional conservation status of shark species. Non-systematic observations and structured individual interviews were conducted with experienced fishers and traders. The demand and economic value of shark fins has reportedly decreased over the last 10 years while the shark meat trade has increased slightly, including a small increase in the average price per kilogram of meat. Several threatened shark species were reportedly often captured off shore and traded at local markets. This reported and observed harvest breaches current Brazilian environmental laws. Fishing communities are aware of population declines of several shark species, but rarely take action to avoid capture of sharks. The continuing capture of sharks is mainly due to a lack of knowledge of environmental laws, lack of enforcement by responsible authorities, and difficulties encountered by fishers in finding alternative income streams. National and regional conservation measures are immediately required to reduce overfishing on shark populations in Northeastern Brazil. Social and economic improvements for poor fishing communities must also be implemented to achieve sustainable fisheries.
Almeida, Zafira Silva; Heupel, Michelle; Silva, Wagner Macedo; Tchaicka, Ligia
2018-01-01
Increasing fishing effort has caused declines in shark populations worldwide. Understanding biological and ecological characteristics of sharks is essential to effectively implement management measures, but to fully understand drivers of fishing pressure social factors must be considered through multidisciplinary and integrated approaches. The present study aimed to use fisher and trader knowledge to describe the shark catch and product supply chain in Northeastern Brazil, and evaluate perceptions regarding the regional conservation status of shark species. Non-systematic observations and structured individual interviews were conducted with experienced fishers and traders. The demand and economic value of shark fins has reportedly decreased over the last 10 years while the shark meat trade has increased slightly, including a small increase in the average price per kilogram of meat. Several threatened shark species were reportedly often captured off shore and traded at local markets. This reported and observed harvest breaches current Brazilian environmental laws. Fishing communities are aware of population declines of several shark species, but rarely take action to avoid capture of sharks. The continuing capture of sharks is mainly due to a lack of knowledge of environmental laws, lack of enforcement by responsible authorities, and difficulties encountered by fishers in finding alternative income streams. National and regional conservation measures are immediately required to reduce overfishing on shark populations in Northeastern Brazil. Social and economic improvements for poor fishing communities must also be implemented to achieve sustainable fisheries. PMID:29534100
International Nuclear Information System (INIS)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji
1991-01-01
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C H 1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides 1 H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2'-H and Tyr C3',5'-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed
Management of small fragment wounds in war: current research.
Bowyer, G W; Cooper, G J; Rice, P
1995-03-01
The majority of war wounds are caused by antipersonnel fragments from munitions such as mortars and bomblets. Modern munitions aim to incapacitate soldiers with multiple wounds from very small fragments of low available kinetic energy. Many of these fragments may be stopped by helmets and body armour and this has led to a predominance of multiple wounds to limbs in those casualties requiring surgery. The development of an appropriate management strategy for these multiple wounds requires knowledge of the contamination and extent of soft tissue injury; conservative management may be appropriate. The extent of skin and muscle damage associated with a small fragment wound, the way in which these wounds may progress without intervention and their colonisation by bacteria has been determined in an experimental animal model. Results from 12 animals are presented. There was a very small (approximately 1 mm) margin of nonviable skin around the entrance wound. The amount of devitalised muscle in the wound tract was a few hundred milligrams. Some muscles peripheral to the wound track also showed signs of damage 1 h after wounding, but this improved over 24 h; the proportion of fragmented muscle fibres in the tissue around the track decreased as time went on. There was no clinical sign or bacteriological evidence of the track becoming infected up to 24 h after wounding. This preliminary work suggests that, in the absence of infection, the amount of muscle damage caused by small fragment wounds begins to resolve in the first 24 h after injury, even without surgical intervention.
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANG You-Yi; LIN Zhen-Quan; KE Jian-Hong
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the sym-metric migration rate kernels K(k;j) = K'(k;j) = λkjv and the constant aggregation rates I1, I2 and fragmentationrates J1, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions inseveral cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When J1 = 0 and J2 = 0, the aggregate sizedistributions ak(t) and bk(t) obey the conventional scaling law, while when J1 > 0 and J2 > 0, they obey the modifiedscaling law with an exponential scaling function. The total mass of either species remains conserved.
Modelling antibody side chain conformations using heuristic database search.
Ritchie, D W; Kemp, G J
1997-01-01
We have developed a knowledge-based system which models the side chain conformations of residues in the variable domains of antibody Fv fragments. The system is written in Prolog and uses an object-oriented database of aligned antibody structures in conjunction with a side chain rotamer library. The antibody database provides 3-dimensional clusters of side chain conformations which can be copied en masse into the model structure. The object-oriented database architecture facilitates a navigational style of database access, necessary to assemble side chains clusters. Around 60% of the model is built using side chain clusters and this eliminates much of the combinatorial complexity associated with many other side chain placement algorithms. Construction and placement of side chain clusters is guided by a heuristic cost function based on a simple model of side chain packing interactions. Even with a simple model, we find that a large proportion of side chain conformations are modelled accurately. We expect our approach could be used with other homologous protein families, in addition to antibodies, both to improve the quality of model structures and to give a "smart start" to the side chain placement problem.
International Nuclear Information System (INIS)
Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi
2015-01-01
Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Formation of amyloid fibers by monomeric light chain variable domains.
Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S
2014-10-03
Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Antiretroviral procurement and supply chain management.
Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril
2014-01-01
Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.
A probabilistic fragment-based protein structure prediction algorithm.
Directory of Open Access Journals (Sweden)
David Simoncini
Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Directory of Open Access Journals (Sweden)
Renata Pardini
Full Text Available Ecological systems are vulnerable to irreversible change when key system properties are pushed over thresholds, resulting in the loss of resilience and the precipitation of a regime shift. Perhaps the most important of such properties in human-modified landscapes is the total amount of remnant native vegetation. In a seminal study Andrén proposed the existence of a fragmentation threshold in the total amount of remnant vegetation, below which landscape-scale connectivity is eroded and local species richness and abundance become dependent on patch size. Despite the fact that species patch-area effects have been a mainstay of conservation science there has yet to be a robust empirical evaluation of this hypothesis. Here we present and test a new conceptual model describing the mechanisms and consequences of biodiversity change in fragmented landscapes, identifying the fragmentation threshold as a first step in a positive feedback mechanism that has the capacity to impair ecological resilience, and drive a regime shift in biodiversity. The model considers that local extinction risk is defined by patch size, and immigration rates by landscape vegetation cover, and that the recovery from local species losses depends upon the landscape species pool. Using a unique dataset on the distribution of non-volant small mammals across replicate landscapes in the Atlantic forest of Brazil, we found strong evidence for our model predictions--that patch-area effects are evident only at intermediate levels of total forest cover, where landscape diversity is still high and opportunities for enhancing biodiversity through local management are greatest. Furthermore, high levels of forest loss can push native biota through an extinction filter, and result in the abrupt, landscape-wide loss of forest-specialist taxa, ecological resilience and management effectiveness. The proposed model links hitherto distinct theoretical approaches within a single framework
Dupré, Mathieu; Cantel, Sonia; Martinez, Jean; Enjalbal, Christine
2012-02-01
By screening a data set of 392 synthetic peptides MS/MS spectra, we found that a known C-terminal rearrangement was unexpectedly frequently occurring from monoprotonated molecular ions in both ESI and MALDI tandem mass spectrometry upon low and high energy collision activated dissociations with QqTOF and TOF/TOF mass analyzer configuration, respectively. Any residue localized at the C-terminal carboxylic acid end, even a basic one, was lost, provided that a basic amino acid such arginine and to a lesser extent histidine and lysine was present in the sequence leading to a fragment ion, usually depicted as (bn-1 + H2O) ion, corresponding to a shortened non-scrambled peptide chain. Far from being an epiphenomenon, such a residue exclusion from the peptide chain C-terminal extremity gave a fragment ion that was the base peak of the MS/MS spectrum in certain cases. Within the frame of the mobile proton model, the ionizing proton being sequestered onto the basic amino acid side chain, it is known that the charge directed fragmentation mechanism involved the C-terminal carboxylic acid function forming an anhydride intermediate structure. The same mechanism was also demonstrated from cationized peptides. To confirm such assessment, we have prepared some of the peptides that displayed such C-terminal residue exclusion as a C-terminal backbone amide. As expected in this peptide amide series, the production of truncated chains was completely suppressed. Besides, multiply charged molecular ions of all peptides recorded in ESI mass spectrometry did not undergo such fragmentation validating that any mobile ionizing proton will prevent such a competitive C-terminal backbone rearrangement. Among all well-known nondirect sequence fragment ions issued from non specific loss of neutral molecules (mainly H2O and NH3) and multiple backbone amide ruptures (b-type internal ions), the described C-terminal residue exclusion is highly identifiable giving raise to a single fragment ion in
Conservation of diverse old wooden objects by impregnation and radiation curing
International Nuclear Information System (INIS)
Schaudy, R.; Slais, E.; Eibner, C.
1983-12-01
The conservation by impregnation with radiation-curable impregnating agents and subsequent curing with gamma radiation of an medieval wooden window-frame, several gold-coated frame fragments, a primitive flail and a poppy mallet as well as fragments of a painted mail-box and of a border is described and the results are discussed. The process is especially suited for the consolidation of heavily decayed porous objects, e.g. archaeologic findings. (Author) [de
[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].
Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan
2017-03-01
Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji (Univ. of Tokyo (Japan))
1991-03-19
The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C{sub H}1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides {sup 1}H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2{prime}-H and Tyr C3{prime},5{prime}-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed.
Directory of Open Access Journals (Sweden)
Santos Carlos A.F.
2002-01-01
Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.
On low frequency dynamics of CuO finite chains in YBa2Cu3O7-δ type high-tc superconductors
International Nuclear Information System (INIS)
Stasyuk, I.V.; Kotsur, S.S.; Ivankiv, A.L.; Dublenich, Yu.I.
1992-01-01
A problem of vibration spectrum of a crystal, featuring availability of sublattices with sufficient anharmonicity of single-ion potential is considered. Dynamics of Cu (1) O (1) finite chains in YBa 2 Cu 3 O 7-δ type crystals is studies on the basis of pseudo-spin model. Dependences of chains vibration spectra with small number of fragments on theory parameters are obtained. It is shown that in low-energy spectrum part there is a transition (from the main state), which energy decreases with increase of chain fragments number. Intensities of vibration transitions between the levels are calculated
Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin
2011-01-01
In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Lemur species-specific metapopulation responses to habitat loss and fragmentation.
Directory of Open Access Journals (Sweden)
Travis S Steffens
Full Text Available Determining what factors affect species occurrence is vital to the study of primate biogeography. We investigated the metapopulation dynamics of a lemur community consisting of eight species (Avahi occidentalis, Propithecus coquereli, Microcebus murinus, Microcebus ravelobensis, Lepilemur edwardsi, Cheirogaleus medius, Eulemur mongoz, and Eulemur fulvus within fragmented tropical dry deciduous forest habitat in Ankarafantsika National Park, Madagascar. We measured fragment size and isolation of 42 fragments of forest ranging in size from 0.23 to 117.7 ha adjacent to continuous forest. Between June and November 2011, we conducted 1218 surveys and observed six of eight lemur species (M. murinus, M. ravelobensis, C. medius, E. fulvus, P. coquereli, and L. edwardsi in the 42 fragments. We applied among patch incidence function models (IFMs with various measures of dispersal and a mainland-island IFM to lemur species occurrence, with the aim of answering the following questions: 1 Do lemur species in dry deciduous forest fragments form metapopulations? 2 What are the separate effects of area (extinction risk and connectivity/isolation (colonization potential within a lemur metapopulation? 3 Within simulated metapopulations over time, how do area and connectivity/isolation affect occurrence? and 4 What are the conservation implications of our findings? We found that M. murinus formed either a mainland-island or an among patch metapopulation, M. ravelobensis formed a mainland-island metapopulation, C. medius and E. fulvus formed among patch metapopulations, and neither P. coquereli or L. edwardsi formed a metapopulation. Metapopulation dynamics and simulations suggest that area was a more consistent positive factor determining lemur species occurrence than fragment isolation and is crucial to the maintenance of lemur populations within this fragmented landscape. Using a metapopulation approach to lemur biogeography is critical for understanding how
Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen
Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.
2005-01-01
In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains
Finite size effects in the intermittency analysis of the fragment-size correlations
International Nuclear Information System (INIS)
Bozek, P.; Ploszajczak, M.; Tucholski, A.
1991-01-01
An influence of the finite size effect on the fragment-size correlations in the nuclear multifragmentation is studied using the method of scaled factorial moments for a 1 - dim percolation model and for a statistical model of the fragmentation process, which for a certain value of a tuning parameter yields the power-law behaviour of the fragment-size distribution. It is shown that the statistical models of this type contain only repulsive correlations due to the conservation laws. The comparison of the results with those obtained in the non-critical 1 - dim percolation and in the 3 - dim percolation at around the critical point is presented. Correlations in the 1 - dim percolation model are analysed analytically and the mechanism of the attractive correlations in 1 - dim and 3 - dim is identified. (author) 30 refs., 7 figs
Senet, P; Aparicio, F
2007-04-14
By using the exact density functional theory, one demonstrates that the value of the local electronic softness of a molecular fragment is directly related to the polarization charge (Coulomb hole) induced by a test electron removed (or added) from (at) the fragment. Our finding generalizes to a chemical group a formal relation between these molecular descriptors recently obtained for an atom in a molecule using an approximate atomistic model [P. Senet and M. Yang, J. Chem. Sci. 117, 411 (2005)]. In addition, a practical ab initio computational scheme of the Coulomb hole and related local descriptors of reactivity of a molecular family having in common a similar fragment is presented. As a blind test, the method is applied to the lateral chains of the 20 isolated amino acids. One demonstrates that the local softness of the lateral chain is a quantitative measure of the similarity of the amino acids. It predicts the separation of amino acids in different biochemical groups (aliphatic, basic, acidic, sulfur contained, and aromatic). The present approach may find applications in quantitative structure activity relationship methodology.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening
Energy Technology Data Exchange (ETDEWEB)
Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.; Hewitt, Stephen N.; Rychel, Amanda L.; Myler, Peter J.; Van Voorhis, Wesley C.; Staker, Bart L.; Stewart, Lance J. (Emerald)
2014-10-02
Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting a fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.
Hadley, Adam S; Betts, Matthew G
2012-08-01
Animal-mediated pollination is essential for both ecosystem services and conservation of global biodiversity, but a growing body of work reveals that it is negatively affected by anthropogenic disturbance. Landscape-scale disturbance results in two often inter-related processes: (1) habitat loss, (2) disruptions of habitat configuration (i.e. fragmentation). Understanding the relative effects of such processes is critical in designing effective management strategies to limit pollination and pollinator decline. We reviewed existing published work from 1989 to 2009 and found that only six of 303 studies considering the influence of landscape context on pollination separated the effects of habitat loss from fragmentation. We provide a synthesis of the current landscape, behavioural, and pollination ecology literature in order to present preliminary multiple working hypotheses explaining how these two landscape processes might independently influence pollination dynamics. Landscape disturbance primarily influences three components of pollination interactions: pollinator density, movement, and plant demography. We argue that effects of habitat loss on each of these components are likely to differ substantially from the effects of fragmentation, which is likely to be more complex and may influence each pollination component in contrasting ways. The interdependency between plants and animals inherent to pollination systems also has the possibility to drive cumulative effects of fragmentation, initiating negative feedback loops between animals and the plants they pollinate. Alternatively, due to their asymmetrical structure, pollination networks may be relatively robust to fragmentation. Despite the potential importance of independent effects of habitat fragmentation, its effects on pollination remain largely untested. We postulate that variation across studies in the effects of 'fragmentation' owes much to artifacts of the sampling regimes adopted, particularly (1
Expression, production and renaturation of a functional single-chain ...
African Journals Online (AJOL)
The single-chain variable antibody fragment (scFv) against human intercellular adhesion molecule-1 (ICAM-1) was expressed at a high level in Escherichia coli as inclusion bodies. We attempted to refold the scFv by ion-exchange chromatography (IEC), dialysis and dilution. The results show that the column ...
Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.
Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas
2014-12-01
The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Henning Steinicke
2018-04-01
Full Text Available Habitat destruction and fragmentation alter the quality of habitats and put populations under the risk of extinction. Changes in population parameters can provide early warning signs of negative impacts. In tropical forests, where habitat loss and fragmentation are vast, such indicators are of high relevance for directing conservation efforts before effects are irreversible. Most of our knowledge from tropical ecosystems originates from community level surveys, whereas our understanding of the influence of habitat conversion on vital rates of species is limited. This study focused on the influence of anthropogenic habitat fragmentation on the survival probability and abundance of three leaf-litter frog species (Rhinella ornata, Ischnocnema guentheri and I. parva in forest patches of the Atlantic rainforest of South-east Brazil compared to a continuous forest. The species differ in their matrix tolerance: high for R. ornata and low for I. guentheri and I. parva and, thus, we examined whether their survival and abundance correspond to this classification. Ischnocnema guentheri showed highest abundances in all study sites and low mortality in the forest patches compared to the continuous forest; I. parva was encountered only in isolated fragments, with very low mortality in one isolated fragment; and the matrix tolerant species had generally low abundance and showed no clear pattern in terms of mortality in the different sites. Our counter-intuitive results show that even matrix sensitive amphibian species may show high abundance and low mortality in small forest patches. Therefore, these patches can be of high value for amphibian conservation regardless of their degree of matrix aversion. Landscape level conservation planning should not abandon small habitat patches, especially in highly fragmented tropical environments.
A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food
International Nuclear Information System (INIS)
Jones, J.L.; Bulford, B.B.
1990-07-01
The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)
Simultaneous measurement of neutrons and fission fragments of thermal neutron fission of U-233
International Nuclear Information System (INIS)
Itsuro Kimura; Katsuhisa Nishio; Yoshihiro Nakagome
2000-01-01
The multiplicity and the energy of prompt neutrons from the fragments for 233 U(n th , f) were measured as functions of fragment mass and total kinetic energy. Average neutron energy against the fragment mass showed a nearly symmetric distribution about the half mass division with two valleys at 98 and 145 u. The slope of the neutron multiplicity with total kinetic energy depended on the fragment mass and showed the minimum at about 130 u. The obtained neutron data were applied to determine the total excitation energy of the system, and the resulting value in the typical asymmetric fission lied between 22 and 25 MeV. The excitation energy agreed with that determined by subtracting the total kinetic energy from the Q-value within 1 MeV, thus satisfied the energy conservation. In the symmetric fission, where the mass yield was drastically suppresses, the total excitation energy is significantly large and reaches to about 40 MeV, suggesting that fragment pairs are preferentially formed in a compact configuration at the scission point [ru
Spatial- and Time-Correlated Detection of Fission Fragments
Directory of Open Access Journals (Sweden)
Platkevic M.
2012-02-01
Full Text Available With the goal to measure angular correlations of fission fragments in rare fission decay (e.g. ternary and quaternary fission, a multi-detector coincidence system based on two and up to four position sensitive pixel detectors Timepix has been built. In addition to the high granularity, wide dynamic range and per pixel signal threshold, these devices are equipped with per pixel energy and time sensitivity providing more information (position, energy, time, enhances particle-type identification and selectivity of event-by-event detection. Operation of the device with the integrated USB 2.0 based readout interface FITPix and the control and data acquisition software tool Pixelman enables online visualization and flexible/adjustable operation for a different type of experiments. Spatially correlated fission fragments can be thus registered in coincidence. Similarly triggered measurements are performed using an integrated spectrometric module with analogue signal chain electronics. The current status of development together with demonstration of the technique with a 252Cf source is presented.
OECD Skills Outlook 2017: Skills and Global Value Chains
OECD Publishing, 2017
2017-01-01
Since the 1990s, the world has entered a new phase of globalisation. Information and communication technology, trade liberalisation and lower transport costs have enabled firms and countries to fragment the production process into global value chains (GVCs). Many products are now designed in one country and assembled in another country from parts…
Diverse Effects of a Seven-Year Experimental Grassland Fragmentation on Major Invertebrate Groups.
Braschler, Brigitte; Baur, Bruno
2016-01-01
Habitat fragmentation is a major driver of biodiversity loss, but observed effects vary and may depend on the group examined. Time since fragmentation may explain some differences between taxonomical groups, as some species and thus species composition respond with a delay to changes in their environment. Impacts of drivers of global change may thus be underestimated in short-term studies. In our study we experimentally fragmented nutrient-poor dry calcareous grasslands and studied the response of species richness, individual density and species composition of various groups of invertebrates (gastropods, ants, ground beetles, rove beetles, orthoptera, spiders, woodlice) in 12 small (1.5 m * 1.5 m) and 12 large (4.5 m * 4.5 m) fragments and their corresponding control plots after 7 years. We further examined responses to fragmentation in relation to body size and habitat preferences. Responses to fragmentation varied between taxonomical groups. While spider species richness and individual density were lower in fragments, the opposite was true for an orthopteran species and woodlice. Species composition and β-diversity differed between fragments and control plots for some groups. However, the interaction treatment*plot size was rarely significant. Species with high occupancy rates in undisturbed control plots responded more negatively to the fragmentation, while species with large body size were relatively more abundant in fragments in some groups. No effect of the fragmentation was found for ants, which may have the longest lag times because of long-lived colonies. However, relationships between abundance and the species' preferences for environmental factors affected by edge effects indicate that ant diversity too may be affected in the longer-term. Our results show the importance of considering different groups in conservation management in times of widespread fragmentation of landscapes. While species richness may respond slowly, changes in abundance related to
Monoclonal antibody fragment removal mediated by mixed mode resins.
O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William
2017-05-26
Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities
Energy Technology Data Exchange (ETDEWEB)
Harris, T.J.R.; Dunn, J.J.; Wimmer, E.
1978-11-01
The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.
Liang, Yuxue; Neta, Pedatsur; Yang, Xiaoyu; Stein, Stephen E
2018-03-01
High-accuracy MS/MS spectra of deprotonated ions of 390 dipeptides and 137 peptides with three to six residues are studied. Many amino acid residues undergo neutral losses from their side chains. The most abundant is the loss of acetaldehyde from threonine. The abundance of losses from the side chains of other amino acids is estimated relative to that of threonine. While some amino acids lose the whole side chain, others lose only part of it, and some exhibit two or more different losses. Side-chain neutral losses are less abundant in the spectra of protonated peptides, being significant mainly for methionine and arginine. In addition to the neutral losses, many amino acid residues in deprotonated peptides produce specific negative ions after peptide bond cleavage. An expanded list of fragment ions from protonated peptides is also presented and compared with those of deprotonated peptides. Fragment ions are mostly different for these two cases. These lists of fragments are used to annotate peptide mass spectral libraries and to aid in the confirmation of specific amino acids in peptides. Graphical Abstract ᅟ.
Integrating population genetics and conservation biology in the era of genomics.
Ouborg, N Joop
2010-02-23
As one of the final activities of the ESF-CONGEN Networking programme, a conference entitled 'Integrating Population Genetics and Conservation Biology' was held at Trondheim, Norway, from 23 to 26 May 2009. Conference speakers and poster presenters gave a display of the state-of-the-art developments in the field of conservation genetics. Over the five-year running period of the successful ESF-CONGEN Networking programme, much progress has been made in theoretical approaches, basic research on inbreeding depression and other genetic processes associated with habitat fragmentation and conservation issues, and with applying principles of conservation genetics in the conservation of many species. Future perspectives were also discussed in the conference, and it was concluded that conservation genetics is evolving into conservation genomics, while at the same time basic and applied research on threatened species and populations from a population genetic point of view continues to be emphasized.
Athira, K; Reddy, C Sudhakar; Saranya, K R L; Joseph, Shijo; Jaishanker, R
2017-06-01
Spatially explicit approach is essential to prioritise the ecosystems for biodiversity conservation. In the present study, the conservation status of 20 protected areas of the Western Ghats of Kerala, India, was analysed based on long-term changes in forests (1975-1985-1995-2005-2013), landscape level changes in fragmentation and forest fires (2005-2015). This study has shown that a significant forest loss occurred in protected areas before declaration. Idukki is one of the major protected areas which showed a drastic reduction (18.83%) in its forest cover. During 1985-1995, Periyar tiger reserve had lost 24.19 km 2 core 3 forest area followed by Peppara (18.54 km 2 ), Parambikulam (17.93 km 2 ), Chimmony (17.71 km 2 ), Peechi-Vazhani (12.31 km 2 ) and Neyyar (11.67 km 2 ). An area of 71.33 km 2 of the protected area was affected by fires in 2014. Overall protected area-wise decadal analysis indicates Periyar has the highest number of fire incidences followed by Wayanad, Kurinjimala, Silent Valley and Eravikulam. Disturbances in the form of fires and fragmentation still exist and may have significant conservation threat to flora and fauna. Among protected areas, many are having a probability to go under threat or dynamic stage. Chinnar, Thattekkad and Kurinjimala sanctuaries are representing high levels of vulnerability, or they are near to decline stage. Habitat level monitoring of the anthropogenic disturbances can be efficiently useful for the strategic conservation planning. The present study has provided geospatial database on spatial patterns of deforestation, fragmentation and forest fires in protected areas of Kerala. Conservation prioritization approach based on these parameters will be useful for the strategic planning in the state of Kerala.
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.
1989-07-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
International Nuclear Information System (INIS)
Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.
1990-01-01
Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)
Barbara, D J; Morton, A; Spence, N J; Miller, A
1995-09-01
Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.
Roberts, James J; Fausch, Kurt D; Peterson, Douglas P; Hooten, Mevin B
2013-05-01
Impending changes in climate will interact with other stressors to threaten aquatic ecosystems and their biota. Native Colorado River cutthroat trout (CRCT; Oncorhynchus clarkii pleuriticus) are now relegated to 309 isolated high-elevation (>1700 m) headwater stream fragments in the Upper Colorado River Basin, owing to past nonnative trout invasions and habitat loss. Predicted changes in climate (i.e., temperature and precipitation) and resulting changes in stochastic physical disturbances (i.e., wildfire, debris flow, and channel drying and freezing) could further threaten the remaining CRCT populations. We developed an empirical model to predict stream temperatures at the fragment scale from downscaled climate projections along with geomorphic and landscape variables. We coupled these spatially explicit predictions of stream temperature with a Bayesian Network (BN) model that integrates stochastic risks from fragmentation to project persistence of CRCT populations across the upper Colorado River basin to 2040 and 2080. Overall, none of the populations are at risk from acute mortality resulting from high temperatures during the warmest summer period. In contrast, only 37% of populations have a ≥90% chance of persistence for 70 years (similar to the typical benchmark for conservation), primarily owing to fragmentation. Populations in short stream fragments <7 km long, and those at the lowest elevations, are at the highest risk of extirpation. Therefore, interactions of stochastic disturbances with fragmentation are projected to be greater threats than warming for CRCT populations. The reason for this paradox is that past nonnative trout invasions and habitat loss have restricted most CRCT populations to high-elevation stream fragments that are buffered from the potential consequences of warming, but at risk of extirpation from stochastic events. The greatest conservation need is for management to increase fragment lengths to forestall these risks. © 2013
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Acyl-CoA binding proteins; structural and functional conservation over 2000 MYA
DEFF Research Database (Denmark)
Faergeman, Nils J; Wadum, Majken; Feddersen, Søren
2007-01-01
-CoA binding protein, ACBP, has been proposed to play a pivotal role in the intracellular trafficking and utilization of long-chain fatty acyl-CoA esters. Depletion of acyl-CoA binding protein in yeast results in aberrant organelle morphology incl. fragmented vacuoles, multi-layered plasma membranes...... and accumulation of vesicles of variable sizes. In contrast to synthesis and turn-over of glycerolipids, the levels of very-long-chain fatty acids, long-chain bases and ceramide are severely affected by Acb1p depletion, suggesting that Acb1p, rather than playing a general role, serves specific roles in cellular...
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
González, Ezequiel; Salvo, Adriana; Valladares, Graciela
2015-02-01
Loss and fragmentation of natural ecosystems are widely recognized as the most important threats to biodiversity conservation, with Neotropical dry forests among the most endangered ecosystems. Area and edge effects are major factors in fragmented landscapes. Here, we examine area and edge effects and their interaction, on ensembles of arthropods associated to native vegetation in a fragmented Chaco Serrano forest. We analyzed family richness and community composition of herbivores, predators, and parasitoids on three native plant species in 12 fragments of varying size and at edge/interior positions. We also looked for indicator families by using Indicator Species Analysis. Loss of family richness with the reduction of forest fragment area was observed for the three functional groups, with similar magnitude. Herbivores were richer at the edges without interaction between edge and area effects, whereas predators were not affected by edge/interior position and parasitoid richness showed an interaction between area and position, with a steeper area slope at the edges. Family composition of herbivore, predator, and parasitoid assemblages was also affected by forest area and/or edge/interior situation. We found three indicator families for large remnants and five for edges. Our results support the key role of forest area for conservation of arthropods taxonomic and functional diversity in a highly threatened region, and emphasize the need to understand the interactions between area and edge effects on such diversity. © 2014 Institute of Zoology, Chinese Academy of Sciences.
International Nuclear Information System (INIS)
Light, K.J.; Loo, J.A.; Edmonds, C.G.; Smith, R.D.
1991-06-01
Electrospray ionization mass spectroscopy (ESI-MS) is rapidly becoming a practical biochemical tool for peptide and protein sequence analysis. The utility of ESI-MS is through use of Collisionally Activated Dissociation (ESI-CAD-MS). Human hemoglobin (Hb, ∼62 kDa) consists of four polypeptide chains and a prosthetic heme group. There are over 400 Hb variants, characterized by amino acid substitutions in either the alpha or beta polypeptide chains. We investigated ESI-CAD-MS as a tool for rapidly analyzing amino acid substitutions, using eight Hb beta chain variants. The approximate location of the modification can be deduced from comparison of the CAD mass spectra and observance of the mass shifts of the fragment ion containing the substitution. Fragmentation occurs preferentially at the amino terminus of proline residues. For most substitutions, differences in CAD mass spectra were not seen. 2 figs
Toprak, Umut H; Gillet, Ludovic C; Maiolica, Alessio; Navarro, Pedro; Leitner, Alexander; Aebersold, Ruedi
2014-08-01
Quantifying the similarity of spectra is an important task in various areas of spectroscopy, for example, to identify a compound by comparing sample spectra to those of reference standards. In mass spectrometry based discovery proteomics, spectral comparisons are used to infer the amino acid sequence of peptides. In targeted proteomics by selected reaction monitoring (SRM) or SWATH MS, predetermined sets of fragment ion signals integrated over chromatographic time are used to identify target peptides in complex samples. In both cases, confidence in peptide identification is directly related to the quality of spectral matches. In this study, we used sets of simulated spectra of well-controlled dissimilarity to benchmark different spectral comparison measures and to develop a robust scoring scheme that quantifies the similarity of fragment ion spectra. We applied the normalized spectral contrast angle score to quantify the similarity of spectra to objectively assess fragment ion variability of tandem mass spectrometric datasets, to evaluate portability of peptide fragment ion spectra for targeted mass spectrometry across different types of mass spectrometers and to discriminate target assays from decoys in targeted proteomics. Altogether, this study validates the use of the normalized spectral contrast angle as a sensitive spectral similarity measure for targeted proteomics, and more generally provides a methodology to assess the performance of spectral comparisons and to support the rational selection of the most appropriate similarity measure. The algorithms used in this study are made publicly available as an open source toolset with a graphical user interface. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Nature of defects produced on thymine fragment by gamma irradiation of DNA
International Nuclear Information System (INIS)
Teoule, R.; Bonicel, A.
1975-01-01
A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions
Peñas, Julio; Benito, Blas; Lorite, Juan; Ballesteros, Miguel; Cañadas, Eva María; Martinez-Ortega, Montserrat
2011-07-01
Habitat fragmentation due to human activities is one of the most important causes of biodiversity loss. In Mediterranean areas the species have co-evolved with traditional farming, which has recently been replaced for more severe and aggressive practices. We use a methodological approach that enables the evaluation of the impact that agriculture and land use changes have for the conservation of sensitive species. As model species, we selected Linaria nigricans, a critically endangered plant from arid and semiarid ecosystems in south-eastern Spain. A chronosequence of the evolution of the suitable habitat for the species over more than 50 years has been reconstructed and several geometrical fragmentation indices have been calculated. A new index called fragmentation cadence (FC) is proposed to quantify the historical evolution of habitat fragmentation regardless of the habitat size. The application of this index has provided objective forecasting of the changes of each remnant population of L. nigricans. The results indicate that greenhouses and construction activities (mainly for tourist purposes) exert a strong impact on the populations of this endangered species. The habitat depletion showed peaks that constitute the destruction of 85% of the initial area in only 20 years for some populations of L. nigricans. According to the forecast established by the model, a rapid extinction could take place and some populations may disappear as early as the year 2030. Fragmentation-cadence analysis can help identify population units of primary concern for its conservation, by means of the adoption of improved management and regulatory measures.
Directory of Open Access Journals (Sweden)
Allison M Benscoter
Full Text Available The presence of multiple interacting threats to biodiversity and the increasing rate of species extinction make it critical to prioritize management efforts on species and communities that maximize conservation success. We implemented a multi-step approach that coupled vulnerability assessments evaluating threats to Florida taxa such as climate change, sea-level rise, and habitat fragmentation with in-depth literature surveys of taxon-specific ecological traits. The vulnerability, adaptive capacity, and ecological traits of 12 threatened and endangered subspecies were compared to non-listed subspecies of the same parent species. Overall, the threatened and endangered subspecies showed high vulnerability and low adaptive capacity, in particular to sea level rise and habitat fragmentation. They also exhibited larger home ranges and greater dispersal limitation compared to non-endangered subspecies, which may inhibit their ability to track changing climate in fragmented landscapes. There was evidence for lower reproductive capacity in some of the threatened or endangered taxa, but not for most. Taxa located in the Florida Keys or in other low coastal areas were most vulnerable to sea level rise, and also showed low levels of adaptive capacity, indicating they may have a lower probability of conservation success. Our analysis of at-risk subspecies and closely related non-endangered subspecies demonstrates that ecological traits help to explain observed differences in vulnerability and adaptive capacity. This study points to the importance of assessing the relative contributions of multiple threats and evaluating conservation value at the species (or subspecies level when resources are limited and several factors affect conservation success.
Harvey, David J
2005-01-01
Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.
Falling chains as variable-mass systems: theoretical model and experimental analysis
International Nuclear Information System (INIS)
De Sousa, Célia A; Costa, Pedro; Gordo, Paulo M
2012-01-01
In this paper, we revisit, theoretically and experimentally, the fall of a folded U-chain and of a pile-chain. The model calculation implies the division of the whole system into two subsystems of variable mass, allowing us to explore the role of tensional contact forces at the boundary of the subsystems. This justifies, for instance, that the folded U-chain falls faster than the acceleration due to the gravitational force. This result, which matches quite well with the experimental data independently of the type of chain, implies that the falling chain is well described by energy conservation. We verify that these conclusions are not observed for the pile-chain motion. (paper)
Response of the agile antechinus to habitat edge, configuration and condition in fragmented forest.
Directory of Open Access Journals (Sweden)
Christopher P Johnstone
Full Text Available Habitat fragmentation and degradation seriously threaten native animal communities. We studied the response of a small marsupial, the agile antechinus Antechinus agilis, to several environmental variables in anthropogenically fragmented Eucalyptus forest in south-east Australia. Agile antechinus were captured more in microhabitats dominated by woody debris than in other microhabitats. Relative abundances of both sexes were positively correlated with fragment core area. Male and female mass-size residuals were smaller in larger fragments. A health status indicator, haemoglobin-haematocrit residuals (HHR, did not vary as a function of any environmental variable in females, but male HHR indicated better health where sites' microhabitats were dominated by shrubs, woody debris and trees other than Eucalyptus. Females were trapped less often in edge than interior fragment habitat and their physiological stress level, indicated by the neutrophil/lymphocyte ratio in peripheral blood, was higher where fragments had a greater proportion of edge habitat. The latter trend was potentially due to lymphopoenia resulting from stress hormone-mediated leukocyte trafficking. Using multiple indicators of population condition and health status facilitates a comprehensive examination of the effects of anthropogenic disturbances, such as habitat fragmentation and degradation, on native vertebrates. Male agile antechinus' health responded negatively to habitat degradation, whilst females responded negatively to the proportion of edge habitat. The health and condition indicators used could be employed to identify conservation strategies that would make habitat fragments less stressful for this or similar native, small mammals.
Li, M.; Zhu, Z.; Vogelmann, James E.; Xu, D.; Wen, W.; Liu, A.
2011-01-01
Tropical and subtropical forests provide important ecosystem goods and services including carbon sequestration and biodiversity conservation. These forests are facing increasing socioeconomic pressures and are rapidly being degraded and fragmented. This analysis focuses on the rate of change and patterns of fragmentation in a collective forest area in Zhejiang province, China, during the time period 1988–2005. The research consisted of two parts. The first was the development of general land cover maps and the identification of land cover changes by interpreting Landsat Thematic Mapper (TM) and Enhanced Thematic Mapper Plus (ETM+) time series imagery. The second part involved the computation and analysis of forest fragmentation metrics. For this portion of the study, fragmentation statistics were analyzed, and images were developed to depict forest fragmentation patterns and trends. Results revealed that there was a net loss of 7.8% in forest coverage, dropping from 66.8% in 1988 to 59.0% in 2005, primarily caused by agricultural expansion and poor forest management practices. An acceleration of forest fragmentation was also witnessed during the time intervals, which was evidenced by a decreasing trend in interior forest (57.2% in 1988, 55.0% in 1996 and 54.8% in 2005 respectively) coupled with the scales of the selected geospatial metrics. Continued forest loss and fragmentation are closely correlated with the existing political, educational, institutional and economic processes of contemporary China. To unlock the developmental potentials of the collective forests and to effectively mitigate the rate of forest loss and fragmentation, reforms of forest tenure and ecological immigration practices are recognized as a prospective alternative. The produced fragmentation maps further illustrates the importance of assessing landscape change history, especially the spatiotemporal patterns of forest fragments, when developing landscape level plans for biodiversity
A bio-indicator for the evaluation of quality forestry and landscape fragmentation
Directory of Open Access Journals (Sweden)
Kappers EF
2013-11-01
Full Text Available A bio-indicator for the evaluation of quality forestry and landscape fragmentation. Intensive agricultural practices, as well as tourism development, summer fires, urbanization and air pollution represent a serious threat for many woodlands in Mediterranean Europe. Tawny owls, Strix aluco, is a valuable indicator of habitat quality and shows high sensitivity to wood fragmentation. Assessing the association between Tawny owls and their habitat may provide useful tools for conservation and management of forested habitats. Populations of woodland birds are influenced by forest characteristics, wood proportion being a key factor explaining breeding density and regularity in nest spacing. Populations of the Tawny Owl reach their highest densities in old deciduous forests. The distribution of territories remains almost constant for many years, and the period during which any particular wood maintains suitable conditions for nesting depends on factors like tree species and management, especially on the timing and extent of thinning. To assure the maintenance of good habitat quality in most woodlands, regulation of water diversion, prevention of summer fires, and a general reduction of human activities inside forests seem to be useful conservation tools.
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
Bodare, Sofia; Tsuda, Yoshiaki; Ravikanth, Gudasalamani; Uma Shaanker, Ramanan; Lascoux, Martin
2013-01-01
The impact of fragmentation by human activities on genetic diversity of forest trees is an important concern in forest conservation, especially in tropical forests. Dysoxylum malabaricum (white cedar) is an economically important tree species, endemic to the Western Ghats, India, one of the world's eight most important biodiversity hotspots. As D. malabaricum is under pressure of disturbance and fragmentation together with overharvesting, conservation efforts are required in this species. In ...
Directory of Open Access Journals (Sweden)
Tzu-Li Lu
2011-01-01
Full Text Available Type-2 ribosome-inactivating proteins, composed of a toxic A-chain and lectin-like B-chain, display various biological functions, including cytotoxicity and immunomodulation. We here cloned the lectin-like B-chain encoding fragment of a newly identified type-2 RIP gene, articulatin gene, from Viscum articulatum, into a bacterial expression vector to obtain nonglycosylated recombinant protein expressed in inclusion bodies. After purification and protein refolding, soluble refolded recombinant articulatin B-chain (rATB showed lectin activity specific toward galactoside moiety and was stably maintained while stored in low ionic strength solution. Despite lacking glycosylation, rATB actively bound leukocytes with preferential binding to monocytes and in vitro stimulated PBMCs to release cytokines without obvious cytotoxicity. These results implicated such a B-chain fragment as a potential immunomodulator.
Supramolecular Nanoparticles via Single-Chain Folding Driven by Ferrous Ions.
Wang, Fei; Pu, Hongting; Jin, Ming; Wan, Decheng
2016-02-01
Single-chain nanoparticles can be obtained via single-chain folding assisted by intramolecular crosslinking reversibly or irreversibly. Single-chain folding is also an efficient route to simulate biomacromolecules. In present study, poly(N-hydroxyethylacrylamide-co-4'-(propoxy urethane ethyl acrylate)-2,2':6',2''-terpyridine) (P(HEAm-co-EMA-Tpy)) is synthesized via reversible addition fragmentation chain transfer polymerization. Single-chain folding and intramolecular crosslinking of P(HEAm-co-EMA-Tpy) are achieved via metal coordination chemistry. The intramolecular interaction is characterized on ultraviolet/visible spectrophotometer (UV-vis spectroscopy), proton nuclear magnetic resonance ((1)H NMR), and differential scanning calorimetry (DSC). The supramolecular crosslinking mediated by Fe(2+) plays an important role in the intramolecular collapsing of the single-chain and the formation of the nanoparticles. The size and morphology of the nanoparticles can be controlled reversibly via metal coordination chemistry, which can be characterized by dynamic light scattering (DLS), transmission electron microscope (TEM), and atomic force microscope (AFM). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bird diversity along a gradient of fragmented habitats of the Cerrado.
Jesus, Shayana DE; Pedro, Wagner A; Bispo, Arthur A
2018-01-01
Understanding the factors that affect biodiversity is of central interest to ecology, and essential to species conservation and ecosystems management. We sampled bird communities in 17 forest fragments in the Cerrado biome, the Central-West region of Brazil. We aimed to know the communities structure pattern and the influence of geographical distance and environmental variables on them, along a gradient of fragmented habitats at both local and landscape scales. Eight structural variables of the fragments served as an environmental distance measurement at the local scale while five metrics served as an environmental distance measurement at the landscape scale. Species presence-absence data were used to calculate the dissimilarity index. Beta diversity was calculated using three indices (βsim, βnes and βsor), representing the spatial species turnover, nestedness and total beta diversity, respectively. Spatial species turnover was the predominant pattern in the structure of the communities. Variations in beta diversity were explained only by the environmental variables of the landscape with spatial configuration being more important than the composition. This fact indicates that, in Cerrado of Goiás avian communities structure, deterministic ecological processes associated to differences in species responses to landscape fragmentation are more important than stochastic processes driven by species dispersal.
International Nuclear Information System (INIS)
Kawata, Y.; Goto, Y.; Hamaguchi, K.; Hayashi, F.; Kobayashi, Y.; Kyogoku, Y.
1988-01-01
The constant fragment of the immunoglobulin light chain (type λ) has two trytophyl residues at positions 150 and 187. Trp-150 is buried in the interior, and Trp-187 lies on the surface of the molecule. The hydrogen-deuterium exchange kinetics of the indole NH proton Trp-150 were studied at various pH values at 25 0 C by 1 H nuclear magnetic resonance. Exchange rates were approximately first order in hydroxyl ion dependence above pH 8, were relatively independent of pH between pH 7 and 8, and decreased below pH 7. On the assumption that the exchange above pH 8 proceeds through local fluctuations of the protein molecule, the exchange rates between pH 7 and 8 through global unfolding were estimated. The exchange rate constant within this pH range at 25 0 C thus estimated was consistent with that of the global unfolding of the constant fragment under the same conditions as those reported previously. The activation energy for the exchange process at pH 7.8 was the same as that for the unfolding process by 2 M guanidine hydrochloride. The exchange rates of backbone NH protons were almost the same as that of the indole NH proton of Trp-150 at pH 7.l. These observations also indicated that the exchange between pH 7 and 8 occurs through global unfolding of the protein molecule and is rate-limited by the unfolding. At around pH 9, on the other hand, the activation energy for the exchange process of the indole NH proton of Trp-150 was smaller than that for the unfolding process, and the exchange rates differed according to the different signals of backbone NH protons. These findings together with the pH dependence of the rate constant indicated that exchange due to local fluctuations is predominant above pH 8
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
On the relationship between residue structural environment and sequence conservation in proteins.
Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao
2017-09-01
Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Comet assay as a cold chain control tool
International Nuclear Information System (INIS)
Duarte, Renato Cesar
2009-01-01
Bearing in mind an ever more demanding market regarding the quality of food, it has been necessary to develop processes that meet the demands of consumers. Within the existing processes the cold chain and irradiation stand out. The cold chain comprises all the stages of conserving food from production, cooling, freezing, storing and transportation to the final consumer. Irradiation, as a means of conserving food, prolongs the shelf life, inhibits budding and reduces pathogenic contamination among other benefits. Is very important the identification of food degradation in function of failure on the processes which they were subjected. The comet assay is a screening test widely studied, considerate fast and with low cost. By the fact of the test identify breaks on the DNA, may be possible use the comet test on the control of cold chain failures that degrade de food. The labels and stamp, do not consider the previous food situation and indicate failures from the moment where they be placed in contact with the product. With the comet assay is possible to check the degradation that has occurred in liver chicken samples until the moment of comet's test realization. (author)
Analysing global value chains using input-output economics : proceed with care
Nomaler, Z.O.; Verspagen, B.
2014-01-01
Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the
Analysing global value chains using input-output economics: Proceed with care
Nomaler, Ö.; Verspagen, B.
2014-01-01
Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the
Information transmission and control in a chaotically kicked spin chain
International Nuclear Information System (INIS)
Aubourg, Lucile; Viennot, David
2016-01-01
We study spin chains submitted to disturbed kick trains described by classical dynamical processes. The spin chains are coupled by Heisenberg and Ising-Z models. We consider chaotic processes by using the kick irregularity in the multipartite system (the spin chain). We show that both couplings transmit the chaos disorder differently along the spin chain but conserve the horizon of coherence (when the disorder into the kick bath is transmitted to the spin chain). An example of information transmission between the spins of the chain coupled by a Heisenberg interaction shows the interest of the horizon of coherence. The use of some chosen stationary kicks disturbed by a chaotic environment makes it possible to modify the information transmission between the spins and to perform a free control during the horizon of coherence. (paper)
Directory of Open Access Journals (Sweden)
Marcantonio M
2012-07-01
Full Text Available Forests are reckoned essentials as biodiversity reservoirs and carbon sinks. Current threats to forest ecosystems (e.g., climate changes, habitat loss and fragmentation, management changes call for monitoring their biodiversity and preserving their ecological functions. In this study, we characterized plants diversity of five beech forests located in central and north Apennines mountain chain, using results by a probabilistic sampling. In order to achieve our goals, we have considered species richness and abundance, taxonomic distinctness and species composition, using both old and new analytical approaches. Results have shown how: (1 the forest type dominated by Fagus sylvatica is characterized by high complexity, with marked compositional, structural and biodiversity differences; (2 beech forests of Pigelleto di Piancastagnaio and Valle della Corte show the highest plants diversity values. The ecological characteristics of these areas, which sustain high diversity values, are unique and of great conservation interest; (3 the use of species richness as the only diversity measure have not allowed an efficient differentiation between studied areas. Indeed, the use of different indexes and analytical methods is required to detect multiple characteristics of biological diversity, as well as to carry out efficient biodiversity surveys aimed to develop optimal conservation strategies. In the future, we plan to apply the sampling methodology and the analytical approach used in this paper to characterize plants diversity of similar forest types.
Feedbacks between conservation and social-ecological systems
Miller, Brian W.; Caplow, Susan C.; Leslie, Paul W.
2012-01-01
Robust ways to meet objectives of environmental conservation and social and economic development remain elusive. This struggle may in part be related to insufficient understanding of the feedbacks between conservation initiatives and social-ecological systems, specifically, the ways in which conservation initiatives result in social changes that have secondary effects on the environments targeted by conservation. To explore this idea we sampled peer-reviewed articles addressing the social and environmental dimensions of conservation and coded each paper according to its research focus and characterization of these feedbacks. The majority of articles in our sample focused either on the effect of conservation initiatives on people (e.g., relocation, employment) or the effect of people on the environment (e.g., fragmentation, conservation efficacy of traditional management systems). Few studies in our sample empirically addressed both the social dynamics resulting from conservation initiatives and subsequent environmental effects. In many cases, one was measured and the other was discussed anecdotally. Among the studies that describe feedbacks between social and environmental variables, there was more evidence of positive (amplifying) feedbacks between social and environmental outcomes (i.e., undesirable social outcomes yielded undesirable environmental effects, and desirable social outcomes yielded desirable environmental effects). The major themes within the sampled literature include conflict between humans and wild animals, social movements, adaptive comanagement, loss of traditional management systems, traditional ecological knowledge, human displacement and risks to livelihoods, and conservation and development. The narratives associated with each theme can serve as hypotheses for facilitating further discussion about conservation issues and for catalyzing future studies of the feedbacks between conservation and social-ecological systems. PMID:22443128
Directory of Open Access Journals (Sweden)
Sean M Murphy
Full Text Available Loss and fragmentation of natural habitats caused by human land uses have subdivided several formerly contiguous large carnivore populations into multiple small and often isolated subpopulations, which can reduce genetic variation and lead to precipitous population declines. Substantial habitat loss and fragmentation from urban development and agriculture expansion relegated the Highlands-Glades subpopulation (HGS of Florida, USA, black bears (Ursus americanus floridanus to prolonged isolation; increasing human land development is projected to cause ≥ 50% loss of remaining natural habitats occupied by the HGS in coming decades. We conducted a noninvasive genetic spatial capture-recapture study to quantitatively describe the degree of contemporary habitat fragmentation and investigate the consequences of habitat fragmentation on population density and genetics of the HGS. Remaining natural habitats sustaining the HGS were significantly more fragmented and patchier than those supporting Florida's largest black bear subpopulation. Genetic diversity was low (AR = 3.57; HE = 0.49 and effective population size was small (NE = 25 bears, both of which remained unchanged over a period spanning one bear generation despite evidence of some immigration. Subpopulation density (0.054 bear/km2 was among the lowest reported for black bears, was significantly female-biased, and corresponded to a subpopulation size of 98 bears in available habitat. Conserving remaining natural habitats in the area occupied by the small, genetically depauperate HGS, possibly through conservation easements and government land acquisition, is likely the most important immediate step to ensuring continued persistence of bears in this area. Our study also provides evidence that preferentially placing detectors (e.g., hair traps or cameras primarily in quality habitat across fragmented landscapes poses a challenge to estimating density-habitat covariate relationships using spatial
Diverse Effects of a Seven-Year Experimental Grassland Fragmentation on Major Invertebrate Groups.
Directory of Open Access Journals (Sweden)
Brigitte Braschler
Full Text Available Habitat fragmentation is a major driver of biodiversity loss, but observed effects vary and may depend on the group examined. Time since fragmentation may explain some differences between taxonomical groups, as some species and thus species composition respond with a delay to changes in their environment. Impacts of drivers of global change may thus be underestimated in short-term studies. In our study we experimentally fragmented nutrient-poor dry calcareous grasslands and studied the response of species richness, individual density and species composition of various groups of invertebrates (gastropods, ants, ground beetles, rove beetles, orthoptera, spiders, woodlice in 12 small (1.5 m * 1.5 m and 12 large (4.5 m * 4.5 m fragments and their corresponding control plots after 7 years. We further examined responses to fragmentation in relation to body size and habitat preferences. Responses to fragmentation varied between taxonomical groups. While spider species richness and individual density were lower in fragments, the opposite was true for an orthopteran species and woodlice. Species composition and β-diversity differed between fragments and control plots for some groups. However, the interaction treatment*plot size was rarely significant. Species with high occupancy rates in undisturbed control plots responded more negatively to the fragmentation, while species with large body size were relatively more abundant in fragments in some groups. No effect of the fragmentation was found for ants, which may have the longest lag times because of long-lived colonies. However, relationships between abundance and the species' preferences for environmental factors affected by edge effects indicate that ant diversity too may be affected in the longer-term. Our results show the importance of considering different groups in conservation management in times of widespread fragmentation of landscapes. While species richness may respond slowly, changes in
Cordingley, Justine E; Newton, Adrian C; Rose, Robert J; Clarke, Ralph T; Bullock, James M
2015-01-01
While habitat fragmentation represents a major threat to global biodiversity, its impacts on provision of ecosystem services are largely unknown. We analysed biodiversity value and provision of multiple ecosystem services in 110 fragments of lowland heathland ecosystems in southern England, in which vegetation dynamics have been monitored for over 30 years. Decreasing fragment size was found to be associated with a decrease in biodiversity and recreational values, but an increase in relative carbon storage, aesthetic value and timber value. The trade-off between either biodiversity or recreational values with the other ecosystem services therefore became more pronounced as heathland size decreased. This was attributed to a higher rate of woody succession in smaller heathland fragments over the past three decades, and contrasting values of different successional vegetation types for biodiversity and provision of ecosystem services. These results suggest that habitat fragmentation can reduce the potential for developing "win win" solutions that contribute to biodiversity conservation while also supporting socio-economic development. Approaches to multi-purpose management of fragmented landscapes should therefore consider the potential trade-offs in ecosystem services and biodiversity associated with fragmentation, in order to make an effective contribution to sustainable development.
Structural re-alignment in an immunologic surface region of ricin A chain
Energy Technology Data Exchange (ETDEWEB)
Zemla, A T; Zhou, C E
2007-07-24
We compared structure alignments generated by several protein structure comparison programs to determine whether existing methods would satisfactorily align residues at a highly conserved position within an immunogenic loop in ribosome inactivating proteins (RIPs). Using default settings, structure alignments generated by several programs (CE, DaliLite, FATCAT, LGA, MAMMOTH, MATRAS, SHEBA, SSM) failed to align the respective conserved residues, although LGA reported correct residue-residue (R-R) correspondences when the beta-carbon (Cb) position was used as the point of reference in the alignment calculations. Further tests using variable points of reference indicated that points distal from the beta carbon along a vector connecting the alpha and beta carbons yielded rigid structural alignments in which residues known to be highly conserved in RIPs were reported as corresponding residues in structural comparisons between ricin A chain, abrin-A, and other RIPs. Results suggest that approaches to structure alignment employing alternate point representations corresponding to side chain position may yield structure alignments that are more consistent with observed conservation of functional surface residues than do standard alignment programs, which apply uniform criteria for alignment (i.e., alpha carbon (Ca) as point of reference) along the entirety of the peptide chain. We present the results of tests that suggest the utility of allowing user-specified points of reference in generating alternate structural alignments, and we present a web server for automatically generating such alignments.
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
RAFT Miniemulsion Polymerization of MMA with Cumyl Dithiobenzoate as Chain Transfer Agent
Institute of Scientific and Technical Information of China (English)
Tian Ying GUO; Dong Lin TANG; Jing Wei ZHU; Mou Dao SONG; Bang Hua ZHANG
2006-01-01
Reversible addition-fragmentation transfer (RAFT) miniemulsion polymerizations for PMMA with cumyl dithiobenzoate (CDB) as a chain transfer agent (CTA) has been carried out.Higher temperature made the polymerization much faster and the PDI remained below 1.20, when the temperature was upon 70 ℃.
Directory of Open Access Journals (Sweden)
Li An
2015-09-01
Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.
Directory of Open Access Journals (Sweden)
Patrícia Carvalho de Sequeira
2005-11-01
Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.
Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T
A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell
A new ChainMail approach for real-time soft tissue simulation.
Zhang, Jinao; Zhong, Yongmin; Smith, Julian; Gu, Chengfan
2016-07-03
This paper presents a new ChainMail method for real-time soft tissue simulation. This method enables the use of different material properties for chain elements to accommodate various materials. Based on the ChainMail bounding region, a new time-saving scheme is developed to improve computational efficiency for isotropic materials. The proposed method also conserves volume and strain energy. Experimental results demonstrate that the proposed ChainMail method can not only accommodate isotropic, anisotropic and heterogeneous materials but also model incompressibility and relaxation behaviors of soft tissues. Further, the proposed method can achieve real-time computational performance.
Strong and nonlinear effects of fragmentation on ecosystem service provision at multiple scales
Mitchell, Matthew G. E.; Bennett, Elena M.; Gonzalez, Andrew
2015-09-01
Human actions, such as converting natural land cover to agricultural or urban land, result in the loss and fragmentation of natural habitat, with important consequences for the provision of ecosystem services. Such habitat loss is especially important for services that are supplied by fragments of natural land cover and that depend on flows of organisms, matter, or people across the landscape to produce benefits, such as pollination, pest regulation, recreation and cultural services. However, our quantitative knowledge about precisely how different patterns of landscape fragmentation might affect the provision of these types of services is limited. We used a simple, spatially explicit model to evaluate the potential impact of natural land cover loss and fragmentation on the provision of hypothetical ecosystem services. Based on current literature, we assumed that fragments of natural land cover provide ecosystem services to the area surrounding them in a distance-dependent manner such that ecosystem service flow depended on proximity to fragments. We modeled seven different patterns of natural land cover loss across landscapes that varied in the overall level of landscape fragmentation. Our model predicts that natural land cover loss will have strong and unimodal effects on ecosystem service provision, with clear thresholds indicating rapid loss of service provision beyond critical levels of natural land cover loss. It also predicts the presence of a tradeoff between maximizing ecosystem service provision and conserving natural land cover, and a mismatch between ecosystem service provision at landscape versus finer spatial scales. Importantly, the pattern of landscape fragmentation mitigated or intensified these tradeoffs and mismatches. Our model suggests that managing patterns of natural land cover loss and fragmentation could help influence the provision of multiple ecosystem services and manage tradeoffs and synergies between services across different human
Boyle, Sarah A; Kennedy, Christina M; Torres, Julio; Colman, Karen; Pérez-Estigarribia, Pastor E; de la Sancha, Noé U
2014-01-01
Technological advances and increasing availability of high-resolution satellite imagery offer the potential for more accurate land cover classifications and pattern analyses, which could greatly improve the detection and quantification of land cover change for conservation. Such remotely-sensed products, however, are often expensive and difficult to acquire, which prohibits or reduces their use. We tested whether imagery of high spatial resolution (≤5 m) differs from lower-resolution imagery (≥30 m) in performance and extent of use for conservation applications. To assess performance, we classified land cover in a heterogeneous region of Interior Atlantic Forest in Paraguay, which has undergone recent and dramatic human-induced habitat loss and fragmentation. We used 4 m multispectral IKONOS and 30 m multispectral Landsat imagery and determined the extent to which resolution influenced the delineation of land cover classes and patch-level metrics. Higher-resolution imagery more accurately delineated cover classes, identified smaller patches, retained patch shape, and detected narrower, linear patches. To assess extent of use, we surveyed three conservation journals (Biological Conservation, Biotropica, Conservation Biology) and found limited application of high-resolution imagery in research, with only 26.8% of land cover studies analyzing satellite imagery, and of these studies only 10.4% used imagery ≤5 m resolution. Our results suggest that high-resolution imagery is warranted yet under-utilized in conservation research, but is needed to adequately monitor and evaluate forest loss and conversion, and to delineate potentially important stepping-stone fragments that may serve as corridors in a human-modified landscape. Greater access to low-cost, multiband, high-resolution satellite imagery would therefore greatly facilitate conservation management and decision-making.
Hill, Jane K; Gray, Michael A; Khen, Chey Vun; Benedick, Suzan; Tawatao, Noel; Hamer, Keith C
2011-11-27
Large areas of tropical forest now exist as remnants scattered across agricultural landscapes, and so understanding the impacts of forest fragmentation is important for biodiversity conservation. We examined species richness and nestedness among tropical forest remnants in birds (meta-analysis of published studies) and insects (field data for fruit-feeding Lepidoptera (butterflies and moths) and ants). Species-area relationships were evident in all four taxa, and avian and insect assemblages in remnants typically were nested subsets of those in larger areas. Avian carnivores and nectarivores and predatory ants were more nested than other guilds, implying that the sequential loss of species was more predictable in these groups, and that fragmentation alters the trophic organization of communities. For butterflies, the ordering of fragments to achieve maximum nestedness was by fragment area, suggesting that differences among fragments were driven mainly by extinction. In contrast for moths, maximum nestedness was achieved by ordering species by wing length; species with longer wings (implying better dispersal) were more likely to occur at all sites, including low diversity sites, suggesting that differences among fragments were driven more strongly by colonization. Although all four taxa exhibited high levels of nestedness, patterns of species turnover were also idiosyncratic, and thus even species-poor sites contributed to landscape-scale biodiversity, particularly for insects.
Application of the chain saw machine for underground quarry
Energy Technology Data Exchange (ETDEWEB)
Lim, Han-Uk; Baek, Hwan-Jo [Kangwon National University, Chuncheon(Korea); Kim, Chi-Hwan [Woosuk University, Wonju(Korea); Kim, Tae-Soo [Sungshin Mining Co., Jungseun(Korea)
2001-10-31
Many regulatory activities for preservation of the environment make it recently difficult for the stone industry in our country. To reduce environmental hazards and to conserve original surface and woods, some effective underground methods must be adopted. Some new techniques such as chain saw machine, diamond wire saw and water jet cutting can be considered. But application of chain saw machine for underground quarry is proposed in this study. Some technical adoptions with chain saw were carried out at Jungseun marble mine. It is proved that this machine can be effectively adopted to cut dimension stone. With chain saw and diamond wire saw, it can be expected to achieve more effectively cutting the dimension stone. (author). 6 refs., 3 tabs., 6 figs.
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
DIFFUSIVE PROPAGATION OF ENERGY IN A NON-ACOUSTIC CHAIN
Komorowski , Tomasz; Olla , Stefano
2017-01-01
International audience; We consider a non acoustic chain of harmonic oscil-lators with the dynamics perturbed by a random local exchange of momentum, such that energy and momentum are conserved. The macroscopic limits of the energy density, momentum and the curvature (or bending) of the chain satisfy a system of evolution equations. We prove that, in a diffusive space-time scaling, the curvature and momentum evolve following a linear system that corresponds to a damped Euler-Bernoulli beam eq...
Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F
1999-03-09
The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.
Kooyman, R M; Zanne, A E; Gallagher, R V; Cornwell, W; Rossetto, M; O'Connor, P; Parkes, E A; Catterall, C F; Laffan, S W; Lusk, C H
2013-12-01
The conservation implications of large-scale rainforest clearing and fragmentation on the persistence of functional and taxonomic diversity remain poorly understood. If traits represent adaptive strategies of plant species to particular circumstances, the expectation is that the effect of forest clearing and fragmentation will be affected by species functional traits, particularly those related to dispersal. We used species occurrence data for woody plants in 46 rainforest patches across 75,000 ha largely cleared of forest by the early 1900s to determine the combined effects of area reduction, fragmentation, and patch size on the taxonomic structure and functional diversity of subtropical rainforest. We compiled species trait values for leaf area, seed dry mass, wood density, and maximum height and calculated species niche breadths. Taxonomic structure, trait values (means, ranges), and the functional diversity of assemblages of climbing and free-standing plants in remnant patches were quantified. Larger rainforest patches had higher species richness. Species in smaller patches were taxonomically less related than species in larger patches. Free-standing plants had a high percentage of frugivore dispersed seeds; climbers had a high proportion of small wind-dispersed seeds. Connections between the patchy spatial distribution of free-standing species, larger seed sizes, and dispersal syndrome were weak. Assemblages of free-standing plants in patches showed more taxonomic and spatial structuring than climbing plants. Smaller isolated patches retained relatively high functional diversity and similar taxonomic structure to larger tracts of forest despite lower species richness. The response of woody plants to clearing and fragmentation of subtropical rainforest differed between climbers and slow-growing mature-phase forest trees but not between climbers and pioneer trees. Quantifying taxonomic structure and functional diversity provides an improved basis for
Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.
Ong, E K; Knox, R B; Singh, M B
1995-03-01
The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.
Aging: fruit flies break the chain to a longer life.
Linford, Nancy J; Pletcher, Scott D
2009-10-13
Mitochondria have long had an enigmatic role in the biology of aging. New research in Drosophila reveals an evolutionarily conserved function for the mitochondrial electron transport chain in the modulation of animal lifespan.
Using occupancy models of forest breeding birds to prioritize conservation planning
De Wan, A. A.; Sullivan, P.J.; Lembo, A.J.; Smith, C.R.; Maerz, J.C.; Lassoie, J.P.; Richmond, M.E.
2009-01-01
As urban development continues to encroach on the natural and rural landscape, land-use planners struggle to identify high priority conservation areas for protection. Although knowing where urban-sensitive species may be occurring on the landscape would facilitate conservation planning, research efforts are often not sufficiently designed to make quality predictions at unknown locations. Recent advances in occupancy modeling allow for more precise estimates of occupancy by accounting for differences in detectability. We applied these techniques to produce robust estimates of habitat occupancy for a subset of forest breeding birds, a group that has been shown to be sensitive to urbanization, in a rapidly urbanizing yet biological diverse region of New York State. We found that detection probability ranged widely across species, from 0.05 to 0.8. Our models suggest that detection probability declined with increasing forest fragmentation. We also found that the probability of occupancy of forest breeding birds is negatively influenced by increasing perimeter-area ratio of forest fragments and urbanization in the surrounding habitat matrix. We capitalized on our random sampling design to produce spatially explicit models that predict high priority conservation areas across the entire region, where interior-species were most likely to occur. Finally, we use our predictive maps to demonstrate how a strict sampling design coupled with occupancy modeling can be a valuable tool for prioritizing biodiversity conservation in land-use planning. ?? 2009 Elsevier Ltd.
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.
2018-03-01
Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Uhlenbrock, Franziska; van Andel, Esther; Andresen, Lars; Skov, Søren
2015-08-01
Malignant cells expressing NKG2D ligands on their cell surface can be directly sensed and killed by NKG2D-bearing lymphocytes. To ensure this immune recognition, accumulating evidence suggests that NKG2D ligands are trafficed via alternative pathways to the cell surface. We have previously shown that the NKG2D ligand ULBP2 traffics over an invariant chain (Ii)-dependent pathway to the cell surface. This study set out to elucidate how Ii regulates ULBP2 cell-surface transport: We discovered conserved tryptophan (Trp) residues in the primary protein sequence of ULBP1-6 but not in the related MICA/B. Substitution of Trp to alanine resulted in cell-surface inhibition of ULBP2 in different cancer cell lines. Moreover, the mutated ULBP2 constructs were retained and not degraded inside the cell, indicating a crucial role of this conserved Trp-motif in trafficking. Finally, overexpression of Ii increased surface expression of wt ULBP2 while Trp-mutants could not be expressed, proposing that this Trp-motif is required for an Ii-dependent cell-surface transport of ULBP2. Aberrant soluble ULBP2 is immunosuppressive. Thus, targeting a distinct protein module on the ULBP2 sequence could counteract this abnormal expression of ULBP2. Copyright © 2015 Elsevier Ltd. All rights reserved.
Faunal Communities Are Invariant to Fragmentation in Experimental Seagrass Landscapes.
Directory of Open Access Journals (Sweden)
Jonathan S Lefcheck
Full Text Available Human-driven habitat fragmentation is cited as one of the most pressing threats facing many coastal ecosystems today. Many experiments have explored the consequences of fragmentation on fauna in one foundational habitat, seagrass beds, but have either surveyed along a gradient of existing patchiness, used artificial materials to mimic a natural bed, or sampled over short timescales. Here, we describe faunal responses to constructed fragmented landscapes varying from 4-400 m2 in two transplant garden experiments incorporating live eelgrass (Zostera marina L.. In experiments replicated within two subestuaries of the Chesapeake Bay, USA across multiple seasons and non-consecutive years, we comprehensively censused mesopredators and epifaunal communities using complementary quantitative methods. We found that community properties, including abundance, species richness, Simpson and functional diversity, and composition were generally unaffected by the number of patches and the size of the landscape, or the intensity of sampling. Additionally, an index of competition based on species co-occurrences revealed no trends with increasing patch size, contrary to theoretical predictions. We extend conclusions concerning the invariance of animal communities to habitat fragmentation from small-scale observational surveys and artificial experiments to experiments conducted with actual living plants and at more realistic scales. Our findings are likely a consequence of the rapid life histories and high mobility of the organisms common to eelgrass beds, and have implications for both conservation and restoration, suggesting that even small patches can rapidly promote abundant and diverse faunal communities.
Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli
2015-04-30
Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Incorporating agroforestry approaches into commodity value chains.
Millard, Edward
2011-08-01
The productivity of tropical agricultural commodities is affected by the health of the ecosystem. Shade tolerant crops such as coffee and cocoa benefit from environmental services provided by forested landscapes, enabling landscape design that meets biodiversity conservation and economic needs. What can motivate farmers to apply and maintain such landscape approaches? Rather than rely on a proliferation of externally funded projects new opportunities are emerging through the international market that buys these commodities. As part of their growing commitment to sustainable supply chains, major companies are supporting agroforestry approaches and requiring producers and traders to demonstrate that the source of their commodities complies with a set of principles that conserves forested landscapes and improves local livelihoods. The paper presents examples of international companies that are moving in this direction, analyzes why and how they are doing it and discusses the impact that has been measured in coffee and cocoa communities in Latin America and Africa. It particularly considers the role of standards and certification systems as a driver of this commitment to promote profitable operations, environmental conservation and social responsibility throughout the coffee and cocoa value chains. Such approaches are already being taken to scale and are no longer operating only in small niches of the market but the paper also considers the limitations to growth in this market-based approach.
Incorporating Agroforestry Approaches into Commodity Value Chains
Millard, Edward
2011-08-01
The productivity of tropical agricultural commodities is affected by the health of the ecosystem. Shade tolerant crops such as coffee and cocoa benefit from environmental services provided by forested landscapes, enabling landscape design that meets biodiversity conservation and economic needs. What can motivate farmers to apply and maintain such landscape approaches? Rather than rely on a proliferation of externally funded projects new opportunities are emerging through the international market that buys these commodities. As part of their growing commitment to sustainable supply chains, major companies are supporting agroforestry approaches and requiring producers and traders to demonstrate that the source of their commodities complies with a set of principles that conserves forested landscapes and improves local livelihoods. The paper presents examples of international companies that are moving in this direction, analyzes why and how they are doing it and discusses the impact that has been measured in coffee and cocoa communities in Latin America and Africa. It particularly considers the role of standards and certification systems as a driver of this commitment to promote profitable operations, environmental conservation and social responsibility throughout the coffee and cocoa value chains. Such approaches are already being taken to scale and are no longer operating only in small niches of the market but the paper also considers the limitations to growth in this market-based approach.
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A
2016-04-01
Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences
Would protecting tropical forest fragments provide carbon and biodiversity cobenefits under REDD+?
Magnago, Luiz Fernando S; Magrach, Ainhoa; Laurance, William F; Martins, Sebastião V; Meira-Neto, João Augusto A; Simonelli, Marcelo; Edwards, David P
2015-09-01
Tropical forests store vast amounts of carbon and are the most biodiverse terrestrial habitats, yet they are being converted and degraded at alarming rates. Given global shortfalls in the budgets required to prevent carbon and biodiversity loss, we need to seek solutions that simultaneously address both issues. Of particular interest are carbon-based payments under the Reducing Emissions from Deforestation and Forest Degradation (REDD+) mechanism to also conserve biodiversity at no additional cost. One potential is for REDD+ to protect forest fragments, especially within biomes where contiguous forest cover has diminished dramatically, but we require empirical tests of the strength of any carbon and biodiversity cobenefits in such fragmented systems. Using the globally threatened Atlantic Forest landscape, we measured above-ground carbon stocks within forest fragments spanning 13 to 23 442 ha in area and with different degrees of isolation. We related these stocks to tree community structure and to the richness and abundance of endemic and IUCN Red-listed species. We found that increasing fragment size has a positive relationship with above-ground carbon stock and with abundance of IUCN Red-listed species and tree community structure. We also found negative relationships between distance from large forest block and tree community structure, endemic species richness and abundance, and IUCN Red-listed species abundance. These resulted in positive congruence between carbon stocks and Red-listed species, and the abundance and richness of endemic species, demonstrating vital cobenefits. As such, protecting forest fragments in hotspots of biodiversity, particularly larger fragments and those closest to sources, offers important carbon and biodiversity cobenefits. More generally, our results suggest that macroscale models of cobenefits under REDD+ have likely overlooked key benefits at small scales, indicating the necessity to apply models that include finer
Isospin Conservation in Neutron Rich Systems of Heavy Nuclei
Jain, Ashok Kumar; Garg, Swati
2018-05-01
It is generally believed that isospin would diminish in its importance as we go towards heavy mass region due to isospin mixing caused by the growing Coulomb forces. However, it was realized quite early that isospin could become an important and useful quantum number for all nuclei including heavy nuclei due to neutron richness of the systems [1]. Lane and Soper [2] also showed in a theoretical calculation that isospin indeed remains quite good in heavy mass neutron rich systems. In this paper, we present isospin based calculations [3, 4] for the fission fragment distributions obtained from heavy-ion fusion fission reactions. We discuss in detail the procedure adopted to assign the isospin values and the role of neutron multiplicity data in obtaining the total fission fragment distributions. We show that the observed fragment distributions can be reproduced rather reasonably well by the calculations based on the idea of conservation of isospin. This is a direct experimental evidence of the validity of isospin in heavy nuclei, which arises largely due to the neutron-rich nature of heavy nuclei and their fragments. This result may eventually become useful for the theories of nuclear fission and also in other practical applications.
Carneiro, Magda Silva; Campos, Caroline Cambraia Furtado; Beijo, Luiz Alberto; Ramos, Flavio Nunes
2016-01-01
Species homogenization or floristic differentiation are two possible consequences of the fragmentation process in plant communities. Despite the few studies, it seems clear that fragments with low forest cover inserted in anthropogenic matrices are more likely to experience floristic homogenization. However, the homogenization process has two other components, genetic and functional, which have not been investigated. The purpose of this study was to verify whether there was homogenization of tree reproductive functions in a fragmented landscape and, if found, to determine how the process was influenced by landscape composition. The study was conducted in eight fragments in southwest Brazil. The study was conducted in eight fragments in southwestern Brazil. In each fragment, all individual trees were sampled that had a diameter at breast height ≥3 cm, in ten plots (0.2 ha) and, classified within 26 reproductive functional types (RFTs). The process of functional homogenization was evaluated using additive partitioning of diversity. Additionally, the effect of landscape composition on functional diversity and on the number of individuals within each RFT was evaluated using a generalized linear mixed model. appeared to be in a process of functional homogenization (dominance of RFTs, alpha diversity lower than expected by chance and and low beta diversity). More than 50% of the RFTs and the functional diversity were affected by the landscape parameters. In general, the percentage of forest cover has a positive effect on RFTs while the percentage of coffee matrix has a negative one. The process of functional homogenization has serious consequences for biodiversity conservation because some functions may disappear that, in the long term, would threaten the fragments. This study contributes to a better understanding of how landscape changes affect the functional diversity, abundance of individuals in RFTs and the process of functional homogenization, as well as how to
An efficient algorithm to perform local concerted movements of a chain molecule.
Directory of Open Access Journals (Sweden)
Stefano Zamuner
Full Text Available The devising of efficient concerted rotation moves that modify only selected local portions of chain molecules is a long studied problem. Possible applications range from speeding the uncorrelated sampling of polymeric dense systems to loop reconstruction and structure refinement in protein modeling. Here, we propose and validate, on a few pedagogical examples, a novel numerical strategy that generalizes the notion of concerted rotation. The usage of the Denavit-Hartenberg parameters for chain description allows all possible choices for the subset of degrees of freedom to be modified in the move. They can be arbitrarily distributed along the chain and can be distanced between consecutive monomers as well. The efficiency of the methodology capitalizes on the inherent geometrical structure of the manifold defined by all chain configurations compatible with the fixed degrees of freedom. The chain portion to be moved is first opened along a direction chosen in the tangent space to the manifold, and then closed in the orthogonal space. As a consequence, in Monte Carlo simulations detailed balance is easily enforced without the need of using Jacobian reweighting. Moreover, the relative fluctuations of the degrees of freedom involved in the move can be easily tuned. We show different applications: the manifold of possible configurations is explored in a very efficient way for a protein fragment and for a cyclic molecule; the "local backbone volume", related to the volume spanned by the manifold, reproduces the mobility profile of all-α helical proteins; the refinement of small protein fragments with different secondary structures is addressed. The presented results suggest our methodology as a valuable exploration and sampling tool in the context of bio-molecular simulations.
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
Landscape structure affects specialists but not generalists in naturally fragmented grasslands
Miller, Jesse E.D.; Damschen, Ellen Ingman; Harrison, Susan P.; Grace, James B.
2015-01-01
Understanding how biotic communities respond to landscape spatial structure is critically important for conservation management as natural landscapes become increasingly fragmented. However, empirical studies of the effects of spatial structure on plant species richness have found inconsistent results, suggesting that more comprehensive approaches are needed. In this study, we asked how landscape structure affects total plant species richness and the richness of a guild of specialized plants in a multivariate context. We sampled herbaceous plant communities at 56 dolomite glades (insular, fire-adapted grasslands) across the Missouri Ozarks, and used structural equation modeling (SEM) to analyze the relative importance of landscape structure, soil resource availability, and fire history for plant communities. We found that landscape spatial structure-defined as the area-weighted proximity of glade habitat surrounding study sites (proximity index)-had a significant effect on total plant species richness, but only after we controlled for environmental covariates. Richness of specialist species, but not generalists, was positively related to landscape spatial structure. Our results highlight that local environmental filters must be considered to understand the influence of landscape structure on communities, and that unique species guilds may respond differently to landscape structure than the community as a whole. These findings suggest that both local environment and landscape context should be considered when developing management strategies for species of conservation concern in fragmented habitats.
Magnetization processes in quantum spin chains with regularly alternating intersite interactions
International Nuclear Information System (INIS)
Derzhko, O.
2001-01-01
We consider the dependence of magnetization on field at zero temperature for spin-1/2 chains in which intersite interactions regularly vary from site to site with period p. In the limiting case, where the smallest value of the intersite interactions tends to zero, the chain splits into noninteracting identical fragments of p sites and the dependence of magnetization on field can be examined rigorously. We comment on the influence of an anisotropy in the inter spin interaction on the magnetization profiles. Finally, we show how the case of a nonzero smallest value of the intersite interactions can be considered
Directory of Open Access Journals (Sweden)
Silke Dornieden
Full Text Available Alzheimer's disease (AD is a progressive neurodegenerative disorder with devastating effects. Currently, therapeutic options are limited to symptomatic treatment. For more than a decade, research focused on immunotherapy for the causal treatment of AD. However, clinical trials with active immunization using Aβ encountered severe complications, for example meningoencephalitis. Consequently, attention focused on passive immunization using antibodies. As an alternative to large immunoglobulins (IgGs, Aβ binding single-chain variable fragments (scFvs were used for diagnostic and therapeutic research approaches. scFvs can be expressed in E. coli and may provide improved pharmacokinetic properties like increased blood-brain barrier permeability or reduced side-effects in vivo. In this study, we constructed an scFv from an Aβ binding IgG, designated IC16, which binds the N-terminal region of Aβ (Aβ(1-8. scFv-IC16 was expressed in E. coli, purified and characterized with respect to its interaction with different Aβ species and its influence on Aβ fibril formation. We were able to show that scFv-IC16 strongly influenced the aggregation behavior of Aβ and could be applied as an Aβ detection probe for plaque staining in the brains of transgenic AD model mice. The results indicate potential for therapy and diagnosis of AD.
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G
2011-08-28
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics
Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A; Motamedi-Shad, Neda; Irving, James A; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J; Miranda, Elena; Lomas, David A
2015-06-01
Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin. © FASEB.
Almeida, C S; Cristaldo, P F; Florencio, D F; Ribeiro, E J M; Cruz, N G; Silva, E A; Costa, D A; Araújo, A P A
2017-01-01
Habitat fragmentation is considered to be one of the biggest threats to tropical ecosystem functioning. In this region, termites perform an important ecological role as decomposers and ecosystem engineers. In the present study, we tested whether termite community is negatively affected by edge effects on three fragments of Brazilian Atlantic Rainforest. Termite abundance and vegetation structure were sampled in 10 transects (15 × 2 m), while termite richness, activity, and soil litter biomass were measured in 16 quadrants (5 × 2 m) at forest edge and interior of each fragment. Habitat structure (i.e. number of tree, diameter at breast height and soil litter biomass) did not differ between forest edge and interior of fragments. Termite richness, abundance and activity were not affected by edge effect. However, differences were observed in the β diversity between forest edge and interior as well as in the fragments sampled. The β diversity partitioning indicates that species turnover is the determinant process of termite community composition under edge effect. Our results suggest that conservation strategies should be based on the selection of several distinct sites instead of few rich sites (e.g. nesting).
Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji
2018-01-01
Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.
Quine, C P; Watts, K
2009-01-01
Habitat fragmentation is the focus of much conservation concern and associated research. In some countries, such as Britain, the main phase of fragmentation occurred centuries ago and the focus of conservation management is now on restoration and recovery. Scenario studies have suggested that spatial targeting is preferable if landscape scale restoration is to be achieved, and that this should bring greater benefits than site-focussed activities but this has rarely been tested in practice. In Britain, woodland expansion has been encouraged through a number of financial incentives, which have evolved from instruments that encouraged almost any addition to the potential woodland resource, to grant schemes that have set out to restore connectivity to remnant ancient woodland. This study assessed the degree of de-fragmentation achieved by woodland expansion on the Isle of Wight and in particular the success of spatial targeting of new woodland planting implemented through grant aid in the JIGSAW (Joining and Increasing Grant Scheme for Ancient Woodland) scheme. Five steps in the re-development of broad-leaved woodland were tested using eight indicators - six commonly used landscape metrics, and two ecologically scaled indicators derived from application of least-cost network evaluation. Only half of the measures indicated de-fragmentation over the whole sequence of five steps. However, the spatial targeting did appear successful, when compared to equivalent untargeted grant-aided woodland expansion, and resulted in positive change to six of the eight indicators. We discuss the utility of the indicators and ways in which future targeting could be supported by their application.
DEFF Research Database (Denmark)
Hviid, T V; Madsen, H O; Morling, N
1992-01-01
endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
Ali Saif, M.; Gade, Prashant M.
2009-03-01
Pareto law, which states that wealth distribution in societies has a power-law tail, has been the subject of intensive investigations in the statistical physics community. Several models have been employed to explain this behavior. However, most of the agent based models assume the conservation of number of agents and wealth. Both these assumptions are unrealistic. In this paper, we study the limiting wealth distribution when one or both of these assumptions are not valid. Given the universality of the law, we have tried to study the wealth distribution from the asset exchange models point of view. We consider models in which (a) new agents enter the market at a constant rate (b) richer agents fragment with higher probability introducing newer agents in the system (c) both fragmentation and entry of new agents is taking place. While models (a) and (c) do not conserve total wealth or number of agents, model (b) conserves total wealth. All these models lead to a power-law tail in the wealth distribution pointing to the possibility that more generalized asset exchange models could help us to explain the emergence of a power-law tail in wealth distribution.
Directory of Open Access Journals (Sweden)
Rodrigo B. Gonçalves
2014-01-01
Full Text Available An orchid bee inventory was carried out in Parque Estadual São Camilo, Palotina, Paraná (Brazil; conservation unit with about 400 hectares of Semidecidual Seasonal forest. Three bait traps were installed at the border of the fragment, each one containing the following fragrances: 1,8-cineole, eugenol, and vanilin. Sampling was carried out from 09am to 03pm, October 2011 to June 2012, summing up nine sampling days. A total of 186 specimens distributed among seven species were sampled. Eufriesea violacea with 140 specimens was the most common species, followed by Euglossa fimbriata (31, Euglossa annectans (9, Eulaema nigrita (4, Euglossa cordata (1, Euglossa pleosticta (1, and Exaerete smaragdina (1. According to qualitative and NMDS analysis, the orchid bee fauna of Parque Estadual São Camilo is representative of Semidecidual Seasonal forest, with richness comparable with other assemblages in the southern distribution of Euglossina. The sampled bee richness indicates that forest fragments, even small and isolated, are important in the conservation of this bees.
Mekonnen, Addisu; Fashing, Peter J; Bekele, Afework; Hernandez-Aguilar, R Adriana; Rueness, Eli K; Nguyen, Nga; Stenseth, Nils Chr
2017-07-01
Understanding the extent to which primates in forest fragments can adjust behaviorally and ecologically to changes caused by deforestation is essential to designing conservation management plans. During a 12-month period, we studied the effects of habitat loss and degradation on the Ethiopian endemic, bamboo specialist, Bale monkey (Chlorocebus djamdjamensis) by comparing its habitat quality, activity budget, ranging ecology and habitat use in continuous forest and two fragments. We found that habitat loss and fragmentation resulted in major differences in vegetation composition and structure between forest types. We also found that Bale monkeys in continuous forest spent more time feeding and traveling and less time resting and socializing than monkeys in fragments. Bale monkeys in continuous forest also had higher movement rates (m/hr) than monkeys in fragments. Bale monkeys in continuous forest used exclusively bamboo and mixed bamboo forest habitats while conspecifics in fragments used a greater variety of habitats including human use areas (i.e., matrix). Our findings suggest that Bale monkeys in fragments use an energy minimization strategy to cope with the lower availability of the species' primary food species, bamboo (Arundinaria alpina). We contend that Bale monkeys may retain some of the ancestral ecological flexibility assumed to be characteristic of the genus Chlorocebus, within which all extant species except Bale monkeys are regarded as ecological generalists. Our results suggest that, like other bamboo eating primates (e.g., the bamboo lemurs of Madagascar), Bale monkeys can cope with a certain threshold of habitat destruction. However, the long-term conservation prospects for Bale monkeys in fragments remain unclear and will require further monitoring to be properly evaluated. © 2017 Wiley Periodicals, Inc.
Plant diversity in hedgerows amidst Atlantic Forest fragments
Directory of Open Access Journals (Sweden)
Carolina C. C. Oliveira
2015-06-01
Full Text Available Hedgerows are linear structures found in agricultural landscapes that may facilitate dispersal of plants and animals and also serve as habitat. The aim of this study was to investigate the relationships among diversity and ecological traits of woody plants, hedgerow characteristics (size, age, and origin, and the structure of the surrounding Atlantic Forest landscape. Field data were collected from 14 hedgerows, and landscape metrics from 1000-m buffers surrounding hedgerows were recorded from a thematic map. In all sampled hedgerows, arboreal species were predominantly zoochoric and early-succession species, and hedgerow width was an important factor explaining the richness and abundance of this group of species. Connection with forest vegetation did not explain richness and abundance of animal-dispersed species, but richness of non-zoochoric species increased in more connected hedgerows. These results suggest that hedgerows are probably colonized by species arriving from nearby early-succession sites, forest fragment edges, and isolated trees in the matrix. Nonetheless, hedgerows provide resources for frugivorous animals and influence landscape connectivity, highlighting the importance of these elements in the conservation of biodiversity in fragmented and rural landscapes.
Alexander-Vaughn, Louise B.; Collazo, Jaime A.; Drew, C. Ashton
2014-01-01
The Eastern North Carolina/Southeastern Virginia Strategic Habitat Conservation Team (ENCSEVA) is a partnership among local federal agencies and programs with a mission to apply Strategic Habitat Conservation to accomplish priority landscape-level conservation within its geographic region. ENCSEVA seeks to further landscape-scale conservation through collaboration with local partners. To accomplish this mission, ENCSEVA is developing a comprehensive Strategic Habitat Conservation Plan (Plan) to provide guidance for its members, partners, and collaborators by establishing mutual conservation goals, objectives, strategies, and metrics to gauge the success of conservation efforts. Identifying common goals allows the ENCSEVA team to develop strategies that leverage joint resources and are more likely to achieve desired impacts across the landscape. The Plan will also provide an approach for ENCSEVA to meet applied research needs (identify knowledge gaps), foster adaptive management principles, identify conservation priorities, prioritize threats (including potential impacts of climate change), and identify the required capacity to implement strategies to create more resilient landscapes. ENCSEVA seeks to support the overarching goals of the South Atlantic Landscape Conservation Cooperative (SALCC) and to provide scientific and technical support for conservation at landscape scales as well as inform the management of natural resources in response to shifts in climate, habitat fragmentation and loss, and other landscape-level challenges (South Atlantic LCC 2012). The ENCSEVA ecoregion encompasses the northern third of the SALCC geography and offers a unique opportunity to apply landscape conservation at multiple scales through the guidance of local conservation and natural resource management efforts and by reporting metrics that reflect the effectiveness of those efforts (Figure 1). The Environmental Decision Analysis Team, housed within the North Carolina Cooperative
BstXI RFLP in the human inter-alpha-trypsin inhibitor light chain gene
Energy Technology Data Exchange (ETDEWEB)
Leveillard, T; Bourguignon, J; Sesbouee, R; Hanauer, A; Salier, J P; Diarra-Mehrpour, M; Martin, J P
1988-03-25
The 1.2 kb EcoRI/SmaI fragment of lambdaHuLITI2 was used as probe. lambdaHuLITI2 is a full length cDNA clone coding for human inter-alpha-trypsin inhibitor light chain isolated from immunochemical screening of a lambdagt11 library. Its sequence coding for HI-30 and alpha-1-microglobulin is in agreement. BstXI identifies five invariant bands at 5.0 kb, 2.3 kb, 1.5 kb, 1.1 kb, and 0.7 kb and a diallelic polymorphism with DNA fragments at 2.0 kb or 1.7 kb.
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Liu, Shiliang; Yin, Yijie; Cheng, Fangyan; Hou, Xiaoyun; Dong, Shikui; Wu, Xue
2017-01-01
Integrating biodiversity and ecosystem services (BES) has been viewed as an appropriate approach to identifying conservation priorities. Taking Xishuangbanna tropical region in Southwest China, different BESs (habitat quality [used as a proxy for biodiversity], carbon storage, and water yield) were quantified using the InVEST model and conservation hotspots from 1976, 1990, and 2010 were identified by overlapping and ranking the service layers. Results showed that BESs areas were unevenly distributed. High habitat quality and carbon storage areas located in the eastern part of the region were mainly occupied by broad-leaved forest, while high water yield areas were covered by grassland and tropical forests. Recognized hotspots were primarily composed of the broad-leaved forest and shrub grassland. However, these habitat types declined by nearly 50% from 1.25×105 ha to 0.63×105 ha and became more fragmented during the study period. We also found that the sub-watersheds which decreased in BES had fewer hotspots distributed and suffered greater landscape fragmentation. Our study further explored the impacts of land-use conversion on BES, and illustrated the necessity and feasibility of BESs in identifying potential conservation areas.
Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik
2017-01-01
Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.
Trienekens, J.H.; Petersen, B.; Wognum, P.M.; Brinkmann, D.
2009-01-01
In this book the results are presented of a comprehensive inventory of pork chains that has been conducted through expert interviews and in-depth case studies. The main focus of the book is on how well diverse and fragmented supply in the European pork sector matches differentiating demands for pork
Directory of Open Access Journals (Sweden)
Gaigysh Irina Sergeevna
2012-06-01
Full Text Available The main characteristics of epiphytic lichen cover on pine trunks depending on the area of natural pine forest in Kostomuksha (north Karelia were analysed. The town of Kostomuksha was built so that to provide the conservation of forest sites. 56 fragments with the area of 0.04 - 6.13 ha were studied. The average area of fragment is 0.62 ha, with 49 fragments (88% having the area less than 1 ha. Biodiversity and lichen cover were studied in the each fragment with using framework 10x20 cm. 1792 sample plots were made on 448 trees. The total lichens cover varies from 0 to 85%,averaging 10%. 25 species of lichens were found. The number of species in the sample plots varies from 0 to 9. Dominant species found are Hypogymnia physodes, Parmeliopsis ambigua, P. hyperopta, Imshaugia aleurites, Cladonia. Species Alectoria sarmentosa, Cladonia macilenta, Pseudevernia fufruraceae, Bryoria fremontii were less common. It was shown that the main parameters of lichen cover are closely related to the size of the area left in the city forest fragments. The maximum values of species diversity and cover of lichens were found in the fragments of more 1-2 hectares.
The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments.
Piatkov, Konstantin I; Brower, Christopher S; Varshavsky, Alexander
2012-07-03
In the course of apoptosis, activated caspases cleave ∼500 to ∼1,000 different proteins in a mammalian cell. The dynamics of apoptosis involve a number of previously identified, caspase-generated proapoptotic protein fragments, defined as those that increase the probability of apoptosis. In contrast to activated caspases, which can be counteracted by inhibitor of apoptosis proteins, there is little understanding of antiapoptotic responses to proapoptotic protein fragments. One possibility is the regulation of proapoptotic fragments through their selective degradation. The previously identified proapoptotic fragments Cys-RIPK1, Cys-TRAF1, Asp-BRCA1, Leu-LIMK1, Tyr-NEDD9, Arg-BID, Asp-BCL(XL), Arg-BIM(EL), Asp-EPHA4, and Tyr-MET bear destabilizing N-terminal residues. Tellingly, the destabilizing nature (but not necessarily the actual identity) of N-terminal residues of proapoptotic fragments was invariably conserved in evolution. Here, we show that these proapoptotic fragments are short-lived substrates of the Arg/N-end rule pathway. Metabolic stabilization of at least one such fragment, Cys-RIPK1, greatly augmented the activation of the apoptosis-inducing effector caspase-3. In agreement with this understanding, even a partial ablation of the Arg/N-end rule pathway in two specific N-end rule mutants is shown to sensitize cells to apoptosis. We also found that caspases can inactivate components of the Arg/N-end rule pathway, suggesting a mutual suppression between this pathway and proapoptotic signaling. Together, these results identify a mechanistically specific and functionally broad antiapoptotic role of the Arg/N-end rule pathway. In conjunction with other apoptosis-suppressing circuits, the Arg/N-end rule pathway contributes to thresholds that prevent a transient or otherwise weak proapoptotic signal from reaching the point of commitment to apoptosis.
Directory of Open Access Journals (Sweden)
John M Louis
Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.
Supply-chain trade and labor market outcomes : The case of the 2004 European Union enlargement
Kaplan, Lennart C.; Kohl, Tristan; Martínez-Zarzoso, Inmaculada
2018-01-01
The structure of international trade is increasingly characterized by fragmentation of production processes and trade policy. Yet, how trade policy affects supply-chain trade is largely unexplored territory. This paper shows how the accession of 10 Central and Eastern European Countries (CEECs) to
Network evolution model for supply chain with manufactures as the core
Jiang, Dali; Fang, Ling; Yang, Jian; Li, Wu; Zhao, Jing
2018-01-01
Building evolution model of supply chain networks could be helpful to understand its development law. However, specific characteristics and attributes of real supply chains are often neglected in existing evolution models. This work proposes a new evolution model of supply chain with manufactures as the core, based on external market demand and internal competition-cooperation. The evolution model assumes the external market environment is relatively stable, considers several factors, including specific topology of supply chain, external market demand, ecological growth and flow conservation. The simulation results suggest that the networks evolved by our model have similar structures as real supply chains. Meanwhile, the influences of external market demand and internal competition-cooperation to network evolution are analyzed. Additionally, 38 benchmark data sets are applied to validate the rationality of our evolution model, in which, nine manufacturing supply chains match the features of the networks constructed by our model. PMID:29370201
Network evolution model for supply chain with manufactures as the core.
Fang, Haiyang; Jiang, Dali; Yang, Tinghong; Fang, Ling; Yang, Jian; Li, Wu; Zhao, Jing
2018-01-01
Building evolution model of supply chain networks could be helpful to understand its development law. However, specific characteristics and attributes of real supply chains are often neglected in existing evolution models. This work proposes a new evolution model of supply chain with manufactures as the core, based on external market demand and internal competition-cooperation. The evolution model assumes the external market environment is relatively stable, considers several factors, including specific topology of supply chain, external market demand, ecological growth and flow conservation. The simulation results suggest that the networks evolved by our model have similar structures as real supply chains. Meanwhile, the influences of external market demand and internal competition-cooperation to network evolution are analyzed. Additionally, 38 benchmark data sets are applied to validate the rationality of our evolution model, in which, nine manufacturing supply chains match the features of the networks constructed by our model.
Network evolution model for supply chain with manufactures as the core.
Directory of Open Access Journals (Sweden)
Haiyang Fang
Full Text Available Building evolution model of supply chain networks could be helpful to understand its development law. However, specific characteristics and attributes of real supply chains are often neglected in existing evolution models. This work proposes a new evolution model of supply chain with manufactures as the core, based on external market demand and internal competition-cooperation. The evolution model assumes the external market environment is relatively stable, considers several factors, including specific topology of supply chain, external market demand, ecological growth and flow conservation. The simulation results suggest that the networks evolved by our model have similar structures as real supply chains. Meanwhile, the influences of external market demand and internal competition-cooperation to network evolution are analyzed. Additionally, 38 benchmark data sets are applied to validate the rationality of our evolution model, in which, nine manufacturing supply chains match the features of the networks constructed by our model.
Cukras, Catherine A; Jeliazkova, Iana; Nichols, Colin G
2002-06-01
All members of the inward rectifiier K(+) (Kir) channel family are activated by phosphoinositides and other amphiphilic lipids. To further elucidate the mechanistic basis, we examined the membrane association of Kir6.2 fragments of K(ATP) channels, and the effects of site-directed mutations of these fragments and full-length Kir6.2 on membrane association and K(ATP) channel activity, respectively. GFP-tagged Kir6.2 COOH terminus and GFP-tagged pleckstrin homology domain from phospholipase C delta1 both associate with isolated membranes, and association of each is specifically reduced by muscarinic m1 receptor-mediated phospholipid depletion. Kir COOH termini are predicted to contain multiple beta-strands and a conserved alpha-helix (residues approximately 306-311 in Kir6.2). Systematic mutagenesis of D307-F315 reveals a critical role of E308, I309, W311 and F315, consistent with residues lying on one side of a alpha-helix. Together with systematic mutation of conserved charges, the results define critical determinants of a conserved domain that underlies phospholipid interaction in Kir channels.
Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks
Directory of Open Access Journals (Sweden)
Jérémy Brassinne
2015-01-01
Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.
The transverse momentum dependence of quark fragmentation functions from cascade models
International Nuclear Information System (INIS)
Groot, E.H. de; Engels, J.
1979-01-01
A covariant generalization of the onedimensional cascade model for quark fragmentation functions is presented, so as to include the transverse momentum behaviour and the possibility to produce different particles at different vertices along the chain. In the scaling limit the exact solution is given, if the primordial function is of the type αZsup(α-1). T(pT). For the more general case of factorizing primordial functions an analytic expression for the seagull effect is derived, which turns out to be independent of the function T(pT). (orig.) [de
Thomas W. Bonnot; Frank R. Thompson; Joshua J. Millspaugh; D. Todd. Jones-Farland
2013-01-01
Efforts to conserve regional biodiversity in the face of global climate change, habitat loss and fragmentation will depend on approaches that consider population processes at multiple scales. By combining habitat and demographic modeling, landscape-based population viability models effectively relate small-scale habitat and landscape patterns to regional population...
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
Lack of Population Genetic Structuring in Ocelots (Leopardus pardalis in a Fragmented Landscape
Directory of Open Access Journals (Sweden)
Marina G. Figueiredo
2015-07-01
Full Text Available Habitat fragmentation can promote patches of small and isolated populations, gene flow disruption between those populations, and reduction of local and total genetic variation. As a consequence, these small populations may go extinct in the long-term. The ocelot (Leopardus pardalis, originally distributed from Texas to southern Brazil and northern Argentina, has been impacted by habitat fragmentation throughout much of its range. To test whether habitat fragmentation has already induced genetic differentiation in an area where this process has been documented for a larger felid (jaguars, we analyzed molecular variation in ocelots inhabiting two Atlantic Forest fragments, Morro do Diabo (MD and Iguaçu Region (IR. Analyses using nine microsatellites revealed mean observed and expected heterozygosity of 0.68 and 0.70, respectively. The MD sampled population showed evidence of a genetic bottleneck under two mutational models (TPM = 0.03711 and SMM = 0.04883. Estimates of genetic structure (FST = 0.027; best fit of k = 1 with STRUCTURE revealed no meaningful differentiation between these populations. Thus, our results indicate that the ocelot populations sampled in these fragments are still not significantly different genetically, a pattern that strongly contrasts with that previously observed in jaguars for the same comparisons. This observation is likely due to a combination of two factors: (i larger effective population size of ocelots (relative to jaguars in each fragment, implying a slower effect of drift-induced differentiation; and (ii potentially some remaining permeability of the anthropogenic matrix for ocelots, as opposed to the observed lack of permeability for jaguars. The persistence of ocelot gene flow between these areas must be prioritized in long-term conservation planning on behalf of these felids.
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Directory of Open Access Journals (Sweden)
Zu-Quan Hu
2012-06-01
Full Text Available Fusarium verticillioides is the primary causal agent of Fusarium ear and kernel rot in maize, producing fumonisin mycotoxins that are toxic to humans and domestic animals. Rapid detection and monitoring of fumonisin-producing fungi are pivotally important for the prevention of mycotoxins from entering into food/feed products. Chicken-derived single-chain variable fragments (scFvs against cell wall-bound proteins from F. verticillioides were isolated from an immunocompetent phage display library. Comparative phage enzyme-linked immunosorbant assays (ELISAs and sequencing analyses identified four different scFv antibodies with high sensitivity. Soluble antibody ELISAs identified two highly sensitive scFv antibodies, FvCA3 and FvCA4, with the latter being slightly more sensitive. Three-dimensional modeling revealed that the FvCA4 may hold a better overall structure with CDRH3, CDRL1 and CDRL3 centered in the core region of antibody surface compared with that of other scFvs. Immunofluorescence labeling revealed that the binding of FvCA4 antibody was localized to the cell walls of conidiospores and hyphae of F. verticillioides, confirming the specificity of this antibody for a surface target. This scFv antibody was able to detect the fungal mycelium as low as 10−2 μg/mL and contaminating mycelium at a quantity of 10−2 mg/g maize. This is the first report that scFv antibodies derived from phage display have a wide application for rapid and accurate detection and monitoring of fumonisin-producing pathogens in agricultural samples.
DEFF Research Database (Denmark)
Pless, Stephan Alexander; Elstone, Fisal D; Niciforovic, Ana P
2014-01-01
largely enigmatic. To this end, natural and unnatural side chain substitutions were made in the S2 hydrophobic core (HC), the extracellular negative charge cluster (ENC), and the intracellular negative charge cluster (INC) of the four VSDs of the skeletal muscle sodium channel isoform (NaV1......Voltage-gated sodium (NaV) channels mediate electrical excitability in animals. Despite strong sequence conservation among the voltage-sensor domains (VSDs) of closely related voltage-gated potassium (KV) and NaV channels, the functional contributions of individual side chains in Nav VSDs remain.......4). The results show that the highly conserved aromatic side chain constituting the S2 HC makes distinct functional contributions in each of the four NaV domains. No obvious cation-pi interaction exists with nearby S4 charges in any domain, and natural and unnatural mutations at these aromatic sites produce...
DEFF Research Database (Denmark)
Duan, Zhi; Brüggemann, Dagmar Adeline; Siegumfeldt, Henrik
2009-01-01
three small synthetic peptides of the alpha(s1)-casein sequence. These peptides traverse enzymatic cleavage sites of casein during cheese ripening. The specificity of the generated anti-peptide antibodies was determined by ELISA and Western blot. Finally, an immunofluorescent labeling protocol......A novel method to monitor in situ hydrolyzable casein fragments during cheese ripening by using immunofluorescent labeling and confocal laser scanning microscopy (CLSM) was developed. Monoclonal single chain variable fragments of antibody (scFvs) were generated by antibody phage display toward...
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D
2017-10-17
Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.
Structure of the conversion laws in quantum integrable spin chains with short range interactions
International Nuclear Information System (INIS)
Grabowski, M.P.; Mathieu, P.
1995-01-01
The authors present a detailed analysis of the structure of the conservation laws in quantum integrable chains of the XYZ-type and in the Hubbard model. The essential tool for the former class of models is the boost operator, which provides a recursive way of calculating the integrals of motion. With its help, they establish the general form of the XYZ conserved charges in terms of simple polynomials in spin variables and derive recursion relations for the relative coefficients of these polynomials. Although these relations are difficult to solve in general, a subset of the coefficients can be determined. Moreover, for two submodels of the XYZ chain, namely the XXX and XY cases, all the charges can be calculated in closed form. Using this approach, the authors rederive the known expressions for the XY charges in a novel way. For the XXX case. a simple description of conserved charges is found in terms of a Catalan tree. This construction is generalized for the su(M) invariant integrable chain. They also investigate the circumstances permitting the existence of a recursive (ladder) operator in general quantum integrable systems. They indicate that a quantum ladder operator can be traced back to the presence of a Hamiltonian mastersymmetry of degree one in the classical continuous version of the model. In this way, quantum chains endowed with a recursive structure can be identified from the properties of their classical relatives. The authors also show that in the quantum continuous limits of the XYZ model, the ladder property of the boost operator disappears. For the Hubbard model they demonstrate the nonexistence of a ladder operator. Nevertheless, the general structure of the conserved charges is indicated, and the expression for the terms linear in the model's free parameter for all charges is derived in closed form. 62 refs., 4 figs
Energy Technology Data Exchange (ETDEWEB)
Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)
2012-07-29
Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
Equilibrium simulations of proteins using molecular fragment replacement and NMR chemical shifts.
Boomsma, Wouter; Tian, Pengfei; Frellsen, Jes; Ferkinghoff-Borg, Jesper; Hamelryck, Thomas; Lindorff-Larsen, Kresten; Vendruscolo, Michele
2014-09-23
Methods of protein structure determination based on NMR chemical shifts are becoming increasingly common. The most widely used approaches adopt the molecular fragment replacement strategy, in which structural fragments are repeatedly reassembled into different complete conformations in molecular simulations. Although these approaches are effective in generating individual structures consistent with the chemical shift data, they do not enable the sampling of the conformational space of proteins with correct statistical weights. Here, we present a method of molecular fragment replacement that makes it possible to perform equilibrium simulations of proteins, and hence to determine their free energy landscapes. This strategy is based on the encoding of the chemical shift information in a probabilistic model in Markov chain Monte Carlo simulations. First, we demonstrate that with this approach it is possible to fold proteins to their native states starting from extended structures. Second, we show that the method satisfies the detailed balance condition and hence it can be used to carry out an equilibrium sampling from the Boltzmann distribution corresponding to the force field used in the simulations. Third, by comparing the results of simulations carried out with and without chemical shift restraints we describe quantitatively the effects that these restraints have on the free energy landscapes of proteins. Taken together, these results demonstrate that the molecular fragment replacement strategy can be used in combination with chemical shift information to characterize not only the native structures of proteins but also their conformational fluctuations.
Survival and Mortality of Pumas (Puma concolor in a Fragmented, Urbanizing Landscape.
Directory of Open Access Journals (Sweden)
T Winston Vickers
Full Text Available Wide-ranging large carnivores pose myriad challenges for conservation, especially in highly fragmented landscapes. Over a 13-year period, we combined monitoring of radio collared pumas (Puma concolor with complementary multi-generational genetic analyses to inform puma conservation in southern California, USA. Our goals were to generate survivorship estimates, determine causes of mortality, identify barriers to movement, and determine the genetic and demographic challenges to puma persistence among >20,000,000 people and extensive urban, suburban, and exurban development. Despite protection from hunting, annual survival for radio collared pumas was surprisingly low (55.8%, and humans caused the majority of puma deaths. The most common sources of mortality were vehicle collisions (28% of deaths, and mortalities resulting from depredation permits issued after pumas killed domestic animals (17% of deaths. Other human-caused mortalities included illegal shootings, public safety removals, and human-caused wildfire. An interstate highway (I-15 bisecting this study area, and associated development, have created a nearly impermeable barrier to puma movements, resulting in severe genetic restriction and demographic isolation of the small puma population (n ~ 17-27 adults in the Santa Ana Mountains west of I-15. Highways that bisect habitat or divide remaining "conserved" habitat, and associated ongoing development, threaten to further subdivide this already fragmented puma population and increase threats to survival. This study highlights the importance of combining demographic and genetic analyses, and illustrates that in the absence of effective measures to reduce mortality and enhance safe movement across highways, translocation of pumas, such as was done with the endangered Florida panther (P. c. coryi, may ultimately be necessary to prevent further genetic decline and ensure persistence of the Santa Ana Mountains population.
Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters
Energy Technology Data Exchange (ETDEWEB)
Santini, Simona; Boore, Jeffrey L.; Meyer, Axel
2003-12-31
Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.
The power to detect recent fragmentation events using genetic differentiation methods.
Directory of Open Access Journals (Sweden)
Michael W Lloyd
Full Text Available Habitat loss and fragmentation are imminent threats to biological diversity worldwide and thus are fundamental issues in conservation biology. Increased isolation alone has been implicated as a driver of negative impacts in populations associated with fragmented landscapes. Genetic monitoring and the use of measures of genetic divergence have been proposed as means to detect changes in landscape connectivity. Our goal was to evaluate the sensitivity of Wright's F st, Hedrick' G'st , Sherwin's MI, and Jost's D to recent fragmentation events across a range of population sizes and sampling regimes. We constructed an individual-based model, which used a factorial design to compare effects of varying population size, presence or absence of overlapping generations, and presence or absence of population sub-structuring. Increases in population size, overlapping generations, and population sub-structuring each reduced F st, G'st , MI, and D. The signal of fragmentation was detected within two generations for all metrics. However, the magnitude of the change in each was small in all cases, and when N e was >100 individuals it was extremely small. Multi-generational sampling and population estimates are required to differentiate the signal of background divergence from changes in Fst , G'st , MI, and D associated with fragmentation. Finally, the window during which rapid change in Fst , G'st , MI, and D between generations occurs can be small, and if missed would lead to inconclusive results. For these reasons, use of F st, G'st , MI, or D for detecting and monitoring changes in connectivity is likely to prove difficult in real-world scenarios. We advocate use of genetic monitoring only in conjunction with estimates of actual movement among patches such that one could compare current movement with the genetic signature of past movement to determine there has been a change.
An Amazonian rainforest and its fragments as a laboratory of global change.
Laurance, William F; Camargo, José L C; Fearnside, Philip M; Lovejoy, Thomas E; Williamson, G Bruce; Mesquita, Rita C G; Meyer, Christoph F J; Bobrowiec, Paulo E D; Laurance, Susan G W
2018-02-01
We synthesize findings from one of the world's largest and longest-running experimental investigations, the Biological Dynamics of Forest Fragments Project (BDFFP). Spanning an area of ∼1000 km 2 in central Amazonia, the BDFFP was initially designed to evaluate the effects of fragment area on rainforest biodiversity and ecological processes. However, over its 38-year history to date the project has far transcended its original mission, and now focuses more broadly on landscape dynamics, forest regeneration, regional- and global-change phenomena, and their potential interactions and implications for Amazonian forest conservation. The project has yielded a wealth of insights into the ecological and environmental changes in fragmented forests. For instance, many rainforest species are naturally rare and hence are either missing entirely from many fragments or so sparsely represented as to have little chance of long-term survival. Additionally, edge effects are a prominent driver of fragment dynamics, strongly affecting forest microclimate, tree mortality, carbon storage and a diversity of fauna. Even within our controlled study area, the landscape has been highly dynamic: for example, the matrix of vegetation surrounding fragments has changed markedly over time, succeeding from large cattle pastures or forest clearcuts to secondary regrowth forest. This, in turn, has influenced the dynamics of plant and animal communities and their trajectories of change over time. In general, fauna and flora have responded differently to fragmentation: the most locally extinction-prone animal species are those that have both large area requirements and low tolerance of the modified habitats surrounding fragments, whereas the most vulnerable plants are those that respond poorly to edge effects or chronic forest disturbances, and that rely on vulnerable animals for seed dispersal or pollination. Relative to intact forests, most fragments are hyperdynamic, with unstable or fluctuating
Vranckx, Guy; Jacquemyn, Hans; Muys, Bart; Honnay, Olivier
2012-04-01
Shrubs and trees are assumed less likely to lose genetic variation in response to habitat fragmentation because they have certain life-history characteristics such as long lifespans and extensive pollen flow. To test this assumption, we conducted a meta-analysis with data on 97 woody plant species derived from 98 studies of habitat fragmentation. We measured the weighted response of four different measures of population-level genetic diversity to habitat fragmentation with Hedge's d and Spearman rank correlation. We tested whether the genetic response to habitat fragmentation was mediated by life-history traits (longevity, pollination mode, and seed dispersal vector) and study characteristics (genetic marker and plant material used). For both tests of effect size habitat fragmentation was associated with a substantial decrease in expected heterozygosity, number of alleles, and percentage of polymorphic loci, whereas the population inbreeding coefficient was not associated with these measures. The largest proportion of variation among effect sizes was explained by pollination mechanism and by the age of the tissue (progeny or adult) that was genotyped. Our primary finding was that wind-pollinated trees and shrubs appeared to be as likely to lose genetic variation as insect-pollinated species, indicating that severe habitat fragmentation may lead to pollen limitation and limited gene flow. In comparison with results of previous meta-analyses on mainly herbaceous species, we found trees and shrubs were as likely to have negative genetic responses to habitat fragmentation as herbaceous species. We also found that the genetic variation in offspring was generally less than that of adult trees, which is evidence of a genetic extinction debt and probably reflects the genetic diversity of the historical, less-fragmented landscape. ©2011 Society for Conservation Biology.
Ma, Xin; Dagan, Shai; Somogyi, Árpád; Wysocki, Vicki H.; Scaraffia, Patricia Y.
2013-04-01
Glu, Gln, Pro, and Ala are the main amino acids involved in ammonia detoxification in mosquitoes. In order to develop a tandem mass spectrometry method (MS2) to monitor each carbon of the above isotopically-labeled 13C-amino acids for metabolic studies, the compositions and origins of atoms in fragments of the protonated amino acid should be first elucidated. Thus, various electrospray (ESI)-based MS2 tools were employed to study the fragmentation of these unlabeled and isotopically-labeled amino acids and better understand their dissociation pathways. A broad range of fragments, including previously-undescribed low m/z fragments was revealed. The formulae of the fragments (from m/z 130 down to m/z 27) were confirmed by their accurate masses. The structures and conformations of the larger fragments of Glu were also explored by ion mobility mass spectrometry (IM-MS) and gas-phase hydrogen/deuterium exchange (HDX) experiments. It was found that some low m/z fragments ( m/z 27-30) are common to Glu, Gln, Pro, and Ala. The origins of carbons in these small fragments are discussed and additional collision induced dissociation (CID) MS2 fragmentation pathways are proposed for them. It was also found that small fragments (≤ m/z 84) of protonated, methylated Glu, and methylated Gln are the same as those of the underivatized Glu and Gln. Taken together, the new approach of utilizing low m/z fragments can be applied to distinguish, identify, and quantify 13C-amino acids labeled at various positions, either in the backbone or side chain.
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
α-decay chain and associated cluster emission from neutron deficient 237Cf nucleus
International Nuclear Information System (INIS)
Jain, Deepika; Sharma, Manoj K.
2015-01-01
We have studied the α-decay chain of 237 Cf nucleus, which has been observed in the 3n evaporation channel when the semi-magic projectile 36 S strikes on 204 Pbv nucleus. The calculations are carried out by using preformed cluster model (PCM), with choices of spherical and quadruple deformation with in cold optimum orientation approach. The calculated half-lives of α-decay chain find relatively in nice agreement with experimental data for the deformed fragmentation approach. Along with α emission, the possibility of heavier clusters is also worked out and corresponding half-lives are predicted. (author)
Chain of care development in Sweden: results of a national study
Directory of Open Access Journals (Sweden)
Bengt Åhgren
2003-10-01
Full Text Available Chains of Care are today an important counterbalance to the ever-increasing fragmentation of Swedish health care, and the ongoing development work has high priority. Improved quality of care is the most important reason for developing Chains of Care. Despite support in the form of goals and activity plans, seven of ten county councils are uncertain whether they have been quite successful in the development work. Strong departmentalisation of responsibilities between different medical professions and departments, types of responsibilities and power still remaining in the vertical organisation structure, together with limited participation from the local authorities, are some of the most commonly mentioned reasons for the lack of success. Even though there is hesitation regarding the development work up to today, all county councils will continue developing Chains of Care. The main reason is, as was the case with Chain of Care development up to today, to improve quality of care. Although one of the main purposes is to make health care more patient-focused, patients in general seem to have limited impact on the development work. Therefore, the challenge is to design Chains of Care which regards patients as partners, and not objects.
Fragmentation processes in nuclear reactions
International Nuclear Information System (INIS)
Legrain, R.
1984-08-01
Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed
Evaluating population connectivity for species of conservation concern in the American Great Plains
Samuel A. Cushman; Erin L. Landguth; Curtis H. Flather
2013-01-01
Habitat loss and fragmentation are widely recognized as among the most important threats to global biodiversity. New analytical approaches are providing an improved ability to predict the effects of landscape change on population connectivity at vast spatial extents. This paper presents an analysis of population connectivity for three species of conservation concern [...
The sanitation value chain: its concept and new research collaboration project
Funamizu, N.
2017-03-01
Sanitation is essential for promoting health, preventing environment pollution, conserving ecosystem, and recovering and recycling resources. Therefore, it can be said that sanitation is closely related to such current global issues as poverty, urban slum, conservation of ecosystem, and resources management. Namely, the question, “How can we handle the waste from 10 billion people in future?” is a global environmental problem to be solved. In developing world, population is growing rapidly especially in urban slums and they have still high under 5 mortality and poverty issues. It also reported that 2.4 billion people are still using unimproved sanitation facilities, including 946 million people who are still practicing open defecation in 2015 (UN, 2015). On the other hand, depopulation and aging are progressing especially in rural area of developed world. Based on the above mentioned background, new research project on sanitation value chain has started. This is a collaboration project with LIPI, RIHN (Research Institute of Humanity and Nature, Kyoto) and HU (Hokkaido University). The concept of the sanitation value chain and the brief summary of the project are discussed in the keynote presentation. The concept of sanitation value chain proposed in the project : The project is proposing new concept, Sanitation Value Chain, which has the following basic policies: 1) Put values of people/and community in the centre of discussion, and prepare sanitation system to drive this value chain; 2) Design the sanitation system by focusing on incentive for individual users and community; 3) Recognize a sanitation system as an integrated system with social and technical systems; 4) Design the sanitation system by making a good matching between social characteristics and prerequisites of the technologies. The goals of the research are 1) To propose the Sanitation Value Chain as a common solution for both developing and developed countries, 2) To show the validity of the
Directory of Open Access Journals (Sweden)
Felipe M. Nuvoloni
2011-12-01
Full Text Available Mites associated to Xylopia aromatica (Lam. Mart. (Annonaceae in urban and rural fragments of semidecidual forest. Native plants can shelter a great diversity of mites. Notwithstanding, the conservation of the forest fragments where the plants are located can influence the structure of the mites community. Generally, in homogenous environments the diversity is lower due to the dominance of one or a few species. In this work, we studied the mite community on Xylopia aromatica (Lam. Mart. (Annonaceae in two fragments of semidecidual forest: one on rural and other on urban area. Seven individuals of X. aromatica were monthly sampled from April 2007 to March 2008, in each of these fragments. Descriptive indexes of diversity, dominance and evenness were applied to verify the ecological patterns of the mite community, besides the Student's t-test to compare the abundance between the fragments. We collected 27,365 mites of 37 species belonging to 11 families. Calacarus sp. (Eriophyidae was the most abundant species, representing 73% of the total sampled. The abundance was greater in the urban fragment (67.7%, with the diversity index reaching only 25% of the theoretical maximum expected. Probably, these values might have been influenced by the location of this fragment in the urban area, being more homogeneous and submitted directly to the presence of atmospheric pollution. In this manner, X. aromatica is able to shelter a higher diversity of mites when inserted in preserved ecosystems, since the highest diversity of available resources allows the establishment of richer and most diverse mite community.
Prospere, Kurt; McLaren, Kurt P; Wilson, Byron
2016-10-01
The last remaining Amazonian-type swamp forest fragments in Black River Lower Morass, Jamaica, have been subjected to a myriad of anthropogenic disturbances, compounded by the establishment and spread of several invasive plant species. We established 44 permanent sample plots (covering 3.92 ha) across 10 of these swamp forest fragments and sampled all non-woody plants and all trees ≥2 cm DBH found in the plots. These data were used to (1) identify thresholds of hybridity and novelty, (2) derive several diversity and structural descriptors used to characterize the swamp forest fragments and (3) identify possible indicators of anthropogenic degradation. These were incorporated into a framework and used to determine the status of the swamp forest fragments so that appropriate management and conservation measures can be implemented. We recorded 43 woody plant species (9 endemic, 28 native and 4 non-native) and 21 non-tree species. The composition and structure of all the patches differed significantly due to the impact of the herbaceous invasive plant Alpinia allughas, the presence and diversity of other non-native plants, and differing intensities of anthropogenic disturbance (e.g., burning, cutting and harvesting of non-timber forest products). We ranked forest patches along a continuum representing deviations from a historical proxy (least disturbed) swamp forest to those with dramatically altered structural and floristic attributes (=novel swamp forests). Only one fragment overrun with A. allughas was classified as novel. If effective conservation and management does not come to the BRLM, the remaining swamp forest fragments appear doomed to further degradation and will soon disappear altogether.
Campbell, Mason J; Edwards, Will; Magrach, Ainhoa; Alamgir, Mohammed; Porolak, Gabriel; Mohandass, D; Laurance, William F
2018-04-01
Closed-canopy forests are being rapidly fragmented across much of the tropical world. Determining the impacts of fragmentation on ecological processes enables better forest management and improves species-conservation outcomes. Lianas are an integral part of tropical forests but can have detrimental and potentially complex interactions with their host trees. These effects can include reduced tree growth and fecundity, elevated tree mortality, alterations in tree-species composition, degradation of forest succession, and a substantial decline in forest carbon storage. We examined the individual impacts of fragmentation and edge effects (0-100-m transect from edge to forest interior) on the liana community and liana-host tree interactions in rainforests of the Atherton Tableland in north Queensland, Australia. We compared the liana and tree community, the traits of liana-infested trees, and determinants of the rates of tree infestation within five forest fragments (23-58 ha in area) and five nearby intact-forest sites. Fragmented forests experienced considerable disturbance-induced degradation at their edges, resulting in a significant increase in liana abundance. This effect penetrated to significantly greater depths in forest fragments than in intact forests. The composition of the liana community in terms of climbing guilds was significantly different between fragmented and intact forests, likely because forest edges had more small-sized trees favoring particular liana guilds which preferentially use these for climbing trellises. Sites that had higher liana abundances also exhibited higher infestation rates of trees, as did sites with the largest lianas. However, large lianas were associated with low-disturbance forest sites. Our study shows that edge disturbance of forest fragments significantly altered the abundance and community composition of lianas and their ecological relationships with trees, with liana impacts on trees being elevated in fragments relative
Gao, Wei; Cai, Liting; Xu, Xudong; Fan, Juxiang; Xue, Xiulei; Yan, Xuejiao; Qu, Qinrong; Wang, Xihua; Zhang, Chen; Wu, Guoqiu
2014-01-01
Connective tissue growth factor (CTGF) contributes to airway smooth muscle (ASM) cell hyperplasia in asthma. Humanized single-chain variable fragment antibody (scFv) was well characterized as a CTGF antagonist in the differentiation of fibroblast into myofibroblast and pulmonary fibrosis in our previous studies. To further improve the bioactivity of scFv, we constructed a plasmid to express scFv-linker-matrilin-6×His fusion proteins that could self-assemble into the scFv dimers by disulfide bonds in matrilin under non-reducing conditions. An immunoreactivity assay demonstrated that the scFv dimer could highly bind to CTGF in a concentration-dependent manner. The MTT and EdU assay results revealed that CTGF (≥10 ng/mL) promoted the proliferation of ASM cells, and this effect was inhibited when the cells were treated with anti-CTGF scFv dimer. The western blot analysis results showed that increased phosphorylation of Akt and mTOR induced by CTGF could be suppressed by this scFv dimer. Based on these findings, anti-CTGF scFv dimer may be a potential agent for the prevention of airway remodeling in asthma.
Engineering electronic states of periodic and quasiperiodic chains by buckling
Mukherjee, Amrita; Nandy, Atanu; Chakrabarti, Arunava
2017-07-01
The spectrum of spinless, non-interacting electrons on a linear chain that is buckled in a non-uniform, quasiperiodic manner is investigated within a tight binding formalism. We have addressed two specific cases, viz., a perfectly periodic chain wrinkled in a quasiperiodic Fibonacci pattern, and a quasiperiodic Fibonacci chain, where the buckling also takes place in a Fibonacci pattern. The buckling brings distant neighbors in the parent chain to close proximity, which is simulated by a tunnel hopping amplitude. It is seen that, in the perfectly ordered case, increasing the strength of the tunnel hopping (that is, bending the segments more) absolutely continuous density of states is retained towards the edges of the band, while the central portion becomes fragmented and host subbands of narrowing widths containing extended, current carrying states, and multiple isolated bound states formed as a result of the bending. A switching ;on; and ;off; of the electronic transmission can thus be engineered by buckling. On the other hand, in the second example of a quasiperiodic Fibonacci chain, imparting a quasiperiodic buckling is found to generate continuous subband(s) destroying the usual multifractality of the energy spectrum. We present exact results based on a real space renormalization group analysis, that is corroborated by explicit calculation of the two terminal electronic transport.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Branched-chain amino acid catabolism is a conserved regulator of physiological ageing.
Mansfeld, Johannes; Urban, Nadine; Priebe, Steffen; Groth, Marco; Frahm, Christiane; Hartmann, Nils; Gebauer, Juliane; Ravichandran, Meenakshi; Dommaschk, Anne; Schmeisser, Sebastian; Kuhlow, Doreen; Monajembashi, Shamci; Bremer-Streck, Sibylle; Hemmerich, Peter; Kiehntopf, Michael; Zamboni, Nicola; Englert, Christoph; Guthke, Reinhard; Kaleta, Christoph; Platzer, Matthias; Sühnel, Jürgen; Witte, Otto W; Zarse, Kim; Ristow, Michael
2015-12-01
Ageing has been defined as a global decline in physiological function depending on both environmental and genetic factors. Here we identify gene transcripts that are similarly regulated during physiological ageing in nematodes, zebrafish and mice. We observe the strongest extension of lifespan when impairing expression of the branched-chain amino acid transferase-1 (bcat-1) gene in C. elegans, which leads to excessive levels of branched-chain amino acids (BCAAs). We further show that BCAAs reduce a LET-363/mTOR-dependent neuro-endocrine signal, which we identify as DAF-7/TGFβ, and that impacts lifespan depending on its related receptors, DAF-1 and DAF-4, as well as ultimately on DAF-16/FoxO and HSF-1 in a cell-non-autonomous manner. The transcription factor HLH-15 controls and epistatically synergizes with BCAT-1 to modulate physiological ageing. Lastly and consistent with previous findings in rodents, nutritional supplementation of BCAAs extends nematodal lifespan. Taken together, BCAAs act as periphery-derived metabokines that induce a central neuro-endocrine response, culminating in extended healthspan.
Analyzing the Pathway to Improve Tiger Conservation in India
Zareena Begum. I; Amanat K. Gill
2014-01-01
Despite substantial conservation investments by governments and international agencies, the existence of tigers in the wild is still threatened. The main threats to the survival of wild tigers are poaching, prey depletion, and habitat degradation and fragmentation. All international trade in tiger parts has been prohibited since 1975, with China introducing a domestic ban in 1993. The domestic trade ban in China was followed by the establishment of captive tiger breeding farms in East Asia. C...
Kilubi, I.; Haasis, H.-D.
2015-01-01
The present paper delivers a robust and systematic literature review (SLR) on supply chain risk management (SCRM) with the purpose to a) review and analyse the literature concerning definitions and research methodologies applied, to b) develop a classificatory framework which clusters existing enablers on SCRM, and to c) examine the linkage between SCRM and performance. The findings reveal that not only is SCRM loosely defined, but that there are various fragmented supply chain risks enablers...
Uezu, Alexandre; Metzger, Jean Paul
2016-01-01
There are few opportunities to evaluate the relative importance of landscape structure and dynamics upon biodiversity, especially in highly fragmented tropical landscapes. Conservation strategies and species risk evaluations often rely exclusively on current aspects of landscape structure, although such limited assumptions are known to be misleading when time-lag responses occur. By relating bird functional-group richness to forest patch size and isolation in ten-year intervals (1956, 1965, 1978, 1984, 1993 and 2003), we revealed that birds with different sensitivity to fragmentation display contrasting responses to landscape dynamics in the Brazilian Atlantic Forest. For non-sensitive groups, there was no time-lag in response: the recent degree of isolation best explains their variation in richness, which likely relates to these species' flexibility to adapt to changes in landscape structure. However, for sensitive bird groups, the 1978 patch area was the best explanatory variable, providing evidence for a 25-year time-lag in response to habitat reduction. Time-lag was more likely in landscapes that encompass large patches, which can support temporarily the presence of some sensitive species, even when habitat cover is relatively low. These landscapes potentially support the most threatened populations and should be priorities for restoration efforts to avoid further species loss. Although time-lags provide an opportunity to counteract the negative consequences of fragmentation, it also reinforces the urgency of restoration actions. Fragmented landscapes will be depleted of biodiversity if landscape structure is only maintained, and not improved. The urgency of restoration action may be even higher in landscapes where habitat loss and fragmentation history is older and where no large fragment remained to act temporarily as a refuge.
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
Primary structure of the hemoglobin alpha-chain of rose-ringed parakeet (Psittacula krameri).
Islam, A; Beg, O U; Persson, B; Zaidi, Z H; Jörnvall, H
1988-10-01
The structure of the hemoglobin alpha-chain of Rose-ringed Parakeet was determined by sequence degradations of the intact subunit, the CNBr fragments, and peptides obtained by digestion with staphylococcal Glu-specific protease and trypsin. Using this analysis, the complete alpha-chain structure of 21 avian species is known, permitting comparisons of the protein structure and of avian relationships. The structure exhibits differences from previously established avian alpha-chains at a total of 61 positions, five of which have residues unique to those of the parakeet (Ser-12, Gly-65, Ser-67, Ala-121, and Leu-134). The analysis defines hemoglobin variation within an additional avian order (Psittaciformes), demonstrates distant patterns for evaluation of relationships within other avian orders, and lends support to taxonomic conclusions from molecular data.
Medicinal chemistry inspired fragment-based drug discovery.
Lanter, James; Zhang, Xuqing; Sui, Zhihua
2011-01-01
Lead generation can be a very challenging phase of the drug discovery process. The two principal methods for this stage of research are blind screening and rational design. Among the rational or semirational design approaches, fragment-based drug discovery (FBDD) has emerged as a useful tool for the generation of lead structures. It is particularly powerful as a complement to high-throughput screening approaches when the latter failed to yield viable hits for further development. Engagement of medicinal chemists early in the process can accelerate the progression of FBDD efforts by incorporating drug-friendly properties in the earliest stages of the design process. Medium-chain acyl-CoA synthetase 2b and ketohexokinase are chosen as examples to illustrate the importance of close collaboration of medicinal chemists, crystallography, and modeling. Copyright © 2011 Elsevier Inc. All rights reserved.
Habitat-based conservation strategies cannot compensate for climate-change-induced range loss
Wessely, Johannes; Hülber, Karl; Gattringer, Andreas; Kuttner, Michael; Moser, Dietmar; Rabitsch, Wolfgang; Schindler, Stefan; Dullinger, Stefan; Essl, Franz
2017-11-01
Anthropogenic habitat fragmentation represents a major obstacle to species shifting their range in response to climate change. Conservation measures to increase the (meta-)population capacity and permeability of landscapes may help but the effectiveness of such measures in a warming climate has rarely been evaluated. Here, we simulate range dynamics of 51 species from three taxonomic groups (vascular plants, butterflies and grasshoppers) in Central Europe as driven by twenty-first-century climate scenarios and analyse how three habitat-based conservation strategies (establishing corridors, improving the landscape matrix, and protected area management) modify species' projected range size changes. These simulations suggest that the conservation strategies considered are unable to save species from regional extinction. For those persisting, they reduce the magnitude of range loss in lowland but not in alpine species. Protected area management and corridor establishment are more effective than matrix improvement. However, none of the conservation strategies evaluated could fully compensate the negative impact of climate change for vascular plants, butterflies or grasshoppers in central Europe.
Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli
International Nuclear Information System (INIS)
Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng
1995-06-01
MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)
A simple and robust approach to immobilization of antibody fragments.
Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J
2016-08-01
Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.
Modeling fragmentation with new high order finite element technology and node splitting
Directory of Open Access Journals (Sweden)
Olovsson Lars
2015-01-01
Full Text Available The modeling of fragmentation has historically been linked to the weapons industry where the main goal is to optimize a bomb or to design effective blast shields. Numerical modeling of fragmentation from dynamic loading has traditionally been modeled by legacy finite element solvers that rely on element erosion to model material failure. However this method results in the removal of too much material. This is not realistic as retaining the mass of the structure is critical to modeling the event correctly. We propose a new approach implemented in the IMPETUS AFEA SOLVER® based on the following: New High Order Finite Elements that can easily deal with very large deformations; Stochastic distribution of initial damage that allows for a non homogeneous distribution of fragments; and a Node Splitting Algorithm that allows for material fracture without element erosion that is mesh independent. The approach is evaluated for various materials and scenarios: -Titanium ring electromagnetic compression; Hard steel Taylor bar impact, Fused silica Taylor bar impact, Steel cylinder explosion, The results obtained from the simulations are representative of the failure mechanisms observed experimentally. The main benefit of this approach is good energy conservation (no loss of mass and numerical robustness even in complex situations.
Lintott, P.; Bunnefeld, N.; Fuentes-Montemayor, E.; Minderman, J.; Blackmore, L.; Goulson, D.; Park, K.
2014-01-01
Urban expansion threatens global biodiversity through the destruction of natural and semi-natural habitats and increased levels of disturbance. Whilst woodlands in urban areas may reduce the impact of urbanisation on biodiversity, they are often subject to under or over-management and consist of small, fragmented patches which may be isolated. Effective management strategies for urban woodland require an understanding of the\\ud ecology and habitat requirements of all relevant taxa. Yet, littl...
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio
2014-08-30
The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Buzan, E. V.; Bryja, Josef; Zemanová, Barbora; Kryštufek, B.
2013-01-01
Roč. 14, č. 2 (2013), s. 401-412 ISSN 1566-0621 Institutional support: RVO:68081766 Keywords : Rupicapra rupicapra * Microsatellites * Population structure * Fragmentation * Conservation management Subject RIV: EH - Ecology, Behaviour Impact factor: 1.846, year: 2013
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Directory of Open Access Journals (Sweden)
Holly E Copeland
Full Text Available Increasing energy and housing demands are impacting wildlife populations throughout western North America. Greater sage-grouse (Centrocercus urophasianus, a species known for its sensitivity to landscape-scale disturbance, inhabits the same low elevation sage-steppe in which much of this development is occurring. Wyoming has committed to maintain sage-grouse populations through conservation easements and policy changes that conserves high bird abundance "core" habitat and encourages development in less sensitive landscapes. In this study, we built new predictive models of oil and gas, wind, and residential development and applied build-out scenarios to simulate future development and measure the efficacy of conservation actions for maintaining sage-grouse populations. Our approach predicts sage-grouse population losses averted through conservation action and quantifies return on investment for different conservation strategies. We estimate that without conservation, sage-grouse populations in Wyoming will decrease under our long-term scenario by 14-29% (95% CI: 4-46%. However, a conservation strategy that includes the "core area" policy and $250 million in targeted easements could reduce these losses to 9-15% (95% CI: 3-32%, cutting anticipated losses by roughly half statewide and nearly two-thirds within sage-grouse core breeding areas. Core area policy is the single most important component, and targeted easements are complementary to the overall strategy. There is considerable uncertainty around the magnitude of our estimates; however, the relative benefit of different conservation scenarios remains comparable because potential biases and assumptions are consistently applied regardless of the strategy. There is early evidence based on a 40% reduction in leased hectares inside core areas that Wyoming policy is reducing potential for future fragmentation inside core areas. Our framework using build-out scenarios to anticipate species declines
Detection of secondary binding sites in proteins using fragment screening.
Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren
2015-12-29
Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.
Pulido Herrera, Karen; Ramos Montaño, Carolina
2016-12-01
The ecosystems fragmentation is one of the anthropic phenomena with highest impact at global level and the edge effect causes that only the fragments interior conserve their original biotic and abiotic characteristics. Lichens are organisms especially susceptible to environmental variability, what could be useful for bio-indication of edge effect. In this work, we evaluated the edge effect in two fragments of Polylepis quadrijuga in the Páramo de la Rusia (Boyacá-Colombia) to determine if there is an edge effect on distribution of lichens associated to P. quadrijuga and their chlorophyll content. We used three transects of 70 m across the matrix-edge-interior gradient in each fragment. We chose nine phorophytes per transect to measure the environmental variables: photosynthetically active radiation, relative humidity and air temperature, and the biological variables: richness and cover per species. Besides, we employed the species that were present in all the three zones of the gradient to quantify the content of chlorophylls a and b, and determine if there are changes in the ratio of chlorophylls a/b that could suggest physiological plasticity as a response to the edge effect. Our results showed that fragment 2 had a higher edge exposition because of its high relation perimeter/area, allowing to an environmental homogenization and lose of biodiversity in relation with fragment 1. Overall, we found 55 differentially distributed species in relation with the fragments and the matrix-edge-interior gradient. The interior of fragment 1 was the most conserved zone, harboring a composition different in more than 40 % to the composition of any other zone. We classified the lichens according with their habits: gelatinous, fruticose, crusty or foliose, but we did not find any relationship between the habit distribution and the edge effect. Six species of wide distribution showed changes in the chlorophyll content along the matrix-edge-interior gradient, what is an evidence
International Nuclear Information System (INIS)
Hozé, Nathanaël; Holcman, David
2012-01-01
We develop a coagulation–fragmentation model to study a system composed of a small number of stochastic objects moving in a confined domain, that can aggregate upon binding to form local clusters of arbitrary sizes. A cluster can also dissociate into two subclusters with a uniform probability. To study the statistics of clusters, we combine a Markov chain analysis with a partition number approach. Interestingly, we obtain explicit formulas for the size and the number of clusters in terms of hypergeometric functions. Finally, we apply our analysis to study the statistical physics of telomeres (ends of chromosomes) clustering in the yeast nucleus and show that the diffusion–coagulation–fragmentation process can predict the organization of telomeres. -- Highlights: ► We develop a coagulation–fragmentation model to study a system composed of a small number of stochastic particles. ► The stochastic objects are moving in a confined domain. ► We apply our analysis to study the statistical physics of telomeres (ends of chromosomes) clustering in the yeast nucleus. ► We show that the diffusion–coagulation–fragmentation process can predict the organization of telomeres in yeast.
Directory of Open Access Journals (Sweden)
Cesar Andres Diaz Arias
Full Text Available Abstract Antibodies and antibody fragments are nowadays among the most important biotechnological products, and Pichia pastoris is one of the most important vectors to produce them as well as other recombinant proteins. The conditions to effectively cultivate a P. pastoris strain previously genetically modified to produce the single-chain variable fragment anti low density lipoprotein (- under the control of the alcohol oxidase promoter have been investigated in this study. In particular, it was evaluated if, and eventually how, the carbon source (glucose or glycerol used in the preculture preceding cryopreservation in 20% glycerol influences both cell and antibody fragment productions either in flasks or in bioreactor. Although in flasks the volumetric productivity of the antibody fragment secreted by cells precultured, cryopreserved and reactivated in glycerol was 42.9% higher compared with cells precultured in glucose, the use of glycerol in bioreactor led to a remarkable shortening of the lag phase, thereby increasing it by no less than thrice compared to flasks. These results are quite promising in comparison with those reported in the literature for possible future industrial applications of this cultivation, taking into account that the overall process time was reduced by around 8 h.
Directory of Open Access Journals (Sweden)
Shibaguchi H
2017-08-01
Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
Directory of Open Access Journals (Sweden)
Nabalegwa Wambede Muhamud
2015-06-01
Full Text Available This study analysed the role of socio-economic factors in influencing farmers’ adoption to soil conservation technologies in Bugoye Sub-county, Rwenzori Mountain. A cross sectional household survey design was used in this study, using systematic sampling to obtain 150 household samples. Qualitative analysis and chi-square tests were used to analyze these data. Results indicated that only 54% of the sampled households have adopted soil conservation, and revealed that eight of the nine factors significantly influenced farmers’ adoption, which are slope, farm size, farm distance from home, education level, family income, training, membership to NGOs, and credit accessibility. Only family size was insignificant. Other constraints are labour demands, cost of conservation work, land fragmentation, crop pests, and the limited agricultural extension services. It is recommended to perform training for farmers on designing soil conservation structures. Policies for empowering farmers with extra income are crucial to increase the adoption of soil conservation efforts.
Fractal statistics of brittle fragmentation
Directory of Open Access Journals (Sweden)
M. Davydova
2013-04-01
Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.
FLORULA URBAN FRAGMENT OF TROPICAL DRY FOREST
Directory of Open Access Journals (Sweden)
Willington Barranco-Pérez
2016-01-01
Full Text Available The aim of this study was to record the composition of plant species in an urban fragment of tropical dry forest of secondary regeneration (bs-T to generate information that can be used in the planning and management of green spaces in the city of Santa Marta. Transects of 2 x 50 m were established equivalent to 0.1 ha and all species were counted >1.0 cm DBH (Diameter at Breast Height: 1.3m. 100 species of angiosperms were recorded of which 47% have herbaceous habit. The number of species recorded in this study represents 39.6% of the species reported for the hills of Santa Marta and 3.8% for the dry forests of Colombia. It is suggested to isolate this type of secondary formations of any intervention and contemplate the reintroduction of individuals and conservation strategies.
Herpetofauna of an urban fragment of Atlantic Forest in Paraíba State, Northeast Brazil
Directory of Open Access Journals (Sweden)
Yuri C. C. Lima
2008-03-01
Full Text Available The Herpetofauna of an urban fragment of Atlantic Forest was investigated in relation to species richness and habitat use. Fourteen species of amphibian anurans pertaining to the families Bufonidae, Brachycephalidae, Hylidae, Leptodactylidae, Leiuperidae, Microhylidae and Ranidae were recorded. The reptiles were represented by 37 species, distributed in the families Gekkonidae, Gymnophthalmidae, Polychrotidae, Scincidae, Teiidae, Tropiduridae, Amphisbaenidae, Boidae, Colubridae, Elapidae, Typhlopidae, Chelidae, Testudinidae and Alligatoridae. Most of the recorded species presented wide geographic distribution, although some of them had distributions that were restricted to the Atlantic Forest. The species richness of Mata do Buraquinho is relatively high for an urban fragment of Atlantic Forest, and the observed anthropogenic impacts show the urgent necessity of conservation in order to guarantee the viability of populations of amphibians and reptiles.
Higher charges in dynamical spin chains for SYM theory
International Nuclear Information System (INIS)
Agarwal, Abhishek; Ferretti, Gabriele
2005-01-01
We construct, to the first two non-trivial orders, the next conserved charge in the su(2|3) sector of N = 4 Super Yang-Mills theory. This represents a test of integrability in a sector where the interactions change the number of sites of the chain. The expression for the charge is completely determined by the algebra and can be written in a diagrammatic form in terms of the interactions already present in the hamiltonian. It appears likely that this diagrammatic expression remains valid in the full theory and can be generalized to higher loops and higher charges thus helping in establishing complete integrability for these dynamical chains
Directory of Open Access Journals (Sweden)
Liliane Baldan Zani
2012-11-01
Full Text Available This study aimed to evaluate the phytosociological structure of a remaining fragment of Atlantic Rainforest undergoing regeneration in the town of Aracruz-ES in a forest board with natural occurrence of Caesalpinia echinata Lam. We installed 10 sample units (plots of 10 x 50m, sampling all individuals with DBH≥5cm and <10cm. Altogether, we sampled 500 individuals distributed into 181 species. The richest families were Leguminosae (35, Sapotaceae (18, and Myrtaceae (14. The most important species were Caesalpinia echinata Lam., Eugenia tinguyensis Cambess., and Pterocarpus rohrii Vahl. The Shannon index (H’ was 4.89 and the equability (J’ was 0.94. This area is one of the last remaining fragments with brazil-wood from the state of Espirito Santo and the population of this species is well preserved at the site, it occurs very frequently, emphasizing the importance of preserving small forest fragments to conserve biodiversity.
Zhang, Z; Cavalier-Smith, T; Green, B R
2001-08-01
Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.
Energy Technology Data Exchange (ETDEWEB)
Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)
2014-02-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.
International Nuclear Information System (INIS)
Brax, Philippe; Upadhye, Amol
2014-01-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments
Rysavy, Steven J; Beck, David AC; Daggett, Valerie
2014-01-01
Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼25–75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. PMID:25142412
Rysavy, Steven J; Beck, David A C; Daggett, Valerie
2014-11-01
Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼ 25-75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. © 2014 The Protein Society.
Patel, Rekha; Andrien, Bruce A
2010-01-01
Monoclonal antibodies (mAbs) and antibody fragments have become an emerging class of therapeutics since 1986. Their versatility enables them to be engineered for optimal efficiency and decreased immunogenicity, and the path to market has been set by recent regulatory approvals. One of the initial criteria for success of any protein or antibody therapeutic is to understand its binding characteristics to the target antigen. Surface plasmon resonance (SPR) has been widely used and is an important tool for ligand-antigen binding characterization. In this work, the binding kinetics of a recombinant mAb and its single-chain antibody homolog, single-chain variable fragment (scFv), was analyzed by SPR. These two proteins target the same antigen. The binding kinetics of the mAb (bivalent antibody) and scFv (monovalent scFv) for this antigen was analyzed along with an assessment of the thermodynamics of the binding interactions. Alternative binding configurations were investigated to evaluate potential experimental bias because theoretically experimental binding configuration should have no impact on binding kinetics. Self-association binding kinetics in the proteins' respective formulation solutions and antigen epitope mapping were also evaluated. Functional characterization of monoclonal and single-chain antibodies has become just as important as structural characterization in the biotechnology field.
Supply chains in global production
Directory of Open Access Journals (Sweden)
Anatolii Mazaraki
2017-10-01
Full Text Available Introduction. Analyzing the current processes of global sales and sales interaction over the past two decades shows that the world’s system of exchanges has undergone significant changes that have been caused by a multitude of factors. The formation of a complex model of global production, determined by the peculiarities of the transformation of individual economies’ growth models, the specifics of their industrialization and the forms of development of their national production business, its institutional and market-wise restructuring and the degree of inclusion in the system of international division of labor. The change in the level and depth of the specialization of individual countries in the field of production and sale of products, in turn, has accelerated the overcoming of economic distance (which is measured by the cost of transport and information services. Based on the above, namely, within the framework of forming a new model of global production, the issue of studying the role and value of supply chains in this model is made relevant. Aim and tasks. The purpose of the article is to study the modern transformation of supply chains within the global production system. The findings will allow to determine what exactly needs to be done in the direction of further redeveloping the regulatory tools of global supply chain management. Research results. The article presents the results of studying the transformation of supply chains’ role in global production. It is determined that taking into account the existing specificity of industrialization and fragmentation of national production, as well as the rapid spread of the results of scientific and technological progress in the world economy, there is a need for a more thorough study of this change. As a result of analyzing open source statistical data, a conclusion was reached regarding the transition from the competition of individual business entities to the competition of global
International Nuclear Information System (INIS)
Mikhailov, I.D.; Zhuravskii, L.V.
1987-01-01
A method is proposed for calculating the vibrational-state density averaged over all configurations for a polymer chain with Markov disorder. The method is based on using a group of centrally symmetric gauge transformations that reduce the dynamic matrix for along polymer chain to renormalized dynamic matrices for short fragments. The short-range order is incorporated exactly in the averaging procedure, while the long-range order is incorporated in the self-consistent field approximation. Results are given for a simple skeletal model for a polymer containing tacticity deviations of Markov type
Prioritizing tiger conservation through landscape genetics and habitat linkages.
Yumnam, Bibek; Jhala, Yadvendradev V; Qureshi, Qamar; Maldonado, Jesus E; Gopal, Rajesh; Saini, Swati; Srinivas, Y; Fleischer, Robert C
2014-01-01
Even with global support for tiger (Panthera tigris) conservation their survival is threatened by poaching, habitat loss and isolation. Currently about 3,000 wild tigers persist in small fragmented populations within seven percent of their historic range. Identifying and securing habitat linkages that connect source populations for maintaining landscape-level gene flow is an important long-term conservation strategy for endangered carnivores. However, habitat corridors that link regional tiger populations are often lost to development projects due to lack of objective evidence on their importance. Here, we use individual based genetic analysis in combination with landscape permeability models to identify and prioritize movement corridors across seven tiger populations within the Central Indian Landscape. By using a panel of 11 microsatellites we identified 169 individual tigers from 587 scat and 17 tissue samples. We detected four genetic clusters within Central India with limited gene flow among three of them. Bayesian and likelihood analyses identified 17 tigers as having recent immigrant ancestry. Spatially explicit tiger occupancy obtained from extensive landscape-scale surveys across 76,913 km(2) of forest habitat was found to be only 21,290 km(2). After accounting for detection bias, the covariates that best explained tiger occupancy were large, remote, dense forest patches; large ungulate abundance, and low human footprint. We used tiger occupancy probability to parameterize habitat permeability for modeling habitat linkages using least-cost and circuit theory pathway analyses. Pairwise genetic differences (FST) between populations were better explained by modeled linkage costs (r>0.5, p<0.05) compared to Euclidean distances, which was in consonance with observed habitat fragmentation. The results of our study highlight that many corridors may still be functional as there is evidence of contemporary migration. Conservation efforts should provide legal status
Prioritizing tiger conservation through landscape genetics and habitat linkages.
Directory of Open Access Journals (Sweden)
Bibek Yumnam
Full Text Available Even with global support for tiger (Panthera tigris conservation their survival is threatened by poaching, habitat loss and isolation. Currently about 3,000 wild tigers persist in small fragmented populations within seven percent of their historic range. Identifying and securing habitat linkages that connect source populations for maintaining landscape-level gene flow is an important long-term conservation strategy for endangered carnivores. However, habitat corridors that link regional tiger populations are often lost to development projects due to lack of objective evidence on their importance. Here, we use individual based genetic analysis in combination with landscape permeability models to identify and prioritize movement corridors across seven tiger populations within the Central Indian Landscape. By using a panel of 11 microsatellites we identified 169 individual tigers from 587 scat and 17 tissue samples. We detected four genetic clusters within Central India with limited gene flow among three of them. Bayesian and likelihood analyses identified 17 tigers as having recent immigrant ancestry. Spatially explicit tiger occupancy obtained from extensive landscape-scale surveys across 76,913 km(2 of forest habitat was found to be only 21,290 km(2. After accounting for detection bias, the covariates that best explained tiger occupancy were large, remote, dense forest patches; large ungulate abundance, and low human footprint. We used tiger occupancy probability to parameterize habitat permeability for modeling habitat linkages using least-cost and circuit theory pathway analyses. Pairwise genetic differences (FST between populations were better explained by modeled linkage costs (r>0.5, p<0.05 compared to Euclidean distances, which was in consonance with observed habitat fragmentation. The results of our study highlight that many corridors may still be functional as there is evidence of contemporary migration. Conservation efforts should
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
International Nuclear Information System (INIS)
Crouch, E.A.C.
1976-01-01
Previously reported adjustments to the chain yields and independent yields for the thermal neutron induced fission of 233 U, 235 U, 239 Pu and 241 Pu, the fast neutron induced fission of 232 Th, 233 U, 235 U, 238 U, 239 Pu, 240 Pu and 241 Pu, and the 14 MeV neutron induced fission of 232 Th, 233 U, 235 U and 238 U, have been recalculated using the principle of least squares. The adjustments to the chain yields so found are much smaller than those previously reported. (author)
Multiple attractors and boundary crises in a tri-trophic food chain.
Boer, M.P.; Kooi, B.W.; Kooijman, S.A.L.M.
2001-01-01
The asymptotic behaviour of a model of a tri-trophic food chain in the chemostat is analysed in detail. The Monod growth model is used for all trophic levels, yielding a non-linear dynamical system of four ordinary differential equations. Mass conservation makes it possible to reduce the dimension
Universality of projectile fragmentation model
International Nuclear Information System (INIS)
Chaudhuri, G.; Mallik, S.; Das Gupta, S.
2012-01-01
Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation
Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.
2012-01-01
Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...
International Nuclear Information System (INIS)
Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August
1997-01-01
Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.
Robust Object Tracking Using Valid Fragments Selection.
Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang
Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.
Ripperger, Simon P; Kalko, Elisabeth K V; Rodríguez-Herrera, Bernal; Mayer, Frieder; Tschapka, Marco
2015-01-01
Anthropogenic changes in land use threaten biodiversity and ecosystem functioning by the conversion of natural habitat into agricultural mosaic landscapes, often with drastic consequences for the associated fauna. The first step in the development of efficient conservation plans is to understand movement of animals through complex habitat mosaics. Therefore, we studied ranging behavior and habitat use in Dermanura watsoni (Phyllostomidae), a frugivorous bat species that is a valuable seed disperser in degraded ecosystems. Radio-tracking of sixteen bats showed that the animals strongly rely on natural forest. Day roosts were exclusively located within mature forest fragments. Selection ratios showed that the bats foraged selectively within the available habitat and positively selected natural forest. However, larger daily ranges were associated with higher use of degraded habitats. Home range geometry and composition of focal foraging areas indicated that wider ranging bats performed directional foraging bouts from natural to degraded forest sites traversing the matrix over distances of up to three hundred meters. This behavior demonstrates the potential of frugivorous bats to functionally connect fragmented areas by providing ecosystem services between natural and degraded sites, and highlights the need for conservation of natural habitat patches within agricultural landscapes that meet the roosting requirements of bats.
Directory of Open Access Journals (Sweden)
Simon P Ripperger
Full Text Available Anthropogenic changes in land use threaten biodiversity and ecosystem functioning by the conversion of natural habitat into agricultural mosaic landscapes, often with drastic consequences for the associated fauna. The first step in the development of efficient conservation plans is to understand movement of animals through complex habitat mosaics. Therefore, we studied ranging behavior and habitat use in Dermanura watsoni (Phyllostomidae, a frugivorous bat species that is a valuable seed disperser in degraded ecosystems. Radio-tracking of sixteen bats showed that the animals strongly rely on natural forest. Day roosts were exclusively located within mature forest fragments. Selection ratios showed that the bats foraged selectively within the available habitat and positively selected natural forest. However, larger daily ranges were associated with higher use of degraded habitats. Home range geometry and composition of focal foraging areas indicated that wider ranging bats performed directional foraging bouts from natural to degraded forest sites traversing the matrix over distances of up to three hundred meters. This behavior demonstrates the potential of frugivorous bats to functionally connect fragmented areas by providing ecosystem services between natural and degraded sites, and highlights the need for conservation of natural habitat patches within agricultural landscapes that meet the roosting requirements of bats.
Distribution of rock fragments and their effects on hillslope soil erosion in purple soil, China
Wang, Xiaoyan
2017-04-01
influence of rock fragment cover on purple soil slope erosion process were carried on, under different conditions with two kind of rock fragment positions (resting on soil surface and embedded into top soil layer), varied rock fragment coverage (Rc, 0% 40%), two kind of soils with textural porosity or structural porosity, and three kind of rainfall intensities (I, 1 mm/min, 1.5 mm/min and 2 mm/min). Simulated rainfall experiments in situ plots in the field, combined with simulated rainfall experiments in soil pans indoor, were used. The main conclusions of this dissertation are as following: 1. The spatial distribution characteristics of rock fragments in purple soil slope and its effects on the soil physical properties were clarified basically. 2. The mechanism of influence of rock fragments within top soil layer on soil erosion processes was understood and a threshold of rock fragment content on the infiltration was figured out. 3. The relationships between surface rock fragment cover and hillslope soil erosion in purple soil under different conditions with varied rock fragment positions, soil structures and rainfall intensities were obtained and the soil and water conservation function of surface rock fragment cover on reducing soil loss was affirmed.
Self-organized criticality in fragmenting
DEFF Research Database (Denmark)
Oddershede, L.; Dimon, P.; Bohr, J.
1993-01-01
The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...
Energy production using fission fragment rockets
International Nuclear Information System (INIS)
Chapline, G.; Matsuda, Y.
1991-08-01
Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs
Medici, Emília Patrícia; Desbiez, Arnaud Leonard Jean
2012-12-01
A population viability analysis (PVA) was conducted of the lowland tapir populations in the Atlantic Forest of the Pontal do Paranapanema region, Brazil, including Morro do Diabo State Park (MDSP) and surrounding forest fragments. Results from the model projected that the population of 126 tapirs in MDSP is likely to persist over the next 100 years; however, 200 tapirs would be required to maintain a viable population. Sensitivity analysis showed that sub-adult mortality and adult mortality have the strongest influence on the dynamics of lowland tapir populations. High road-kill has a major impact on the MDSP tapir population and can lead to population extinction. Metapopulation modeling showed that dispersal of tapirs from MDSP to the surrounding fragments can be detrimental to the overall metapopulation, as fragments act as sinks. Nevertheless, the model showed that under certain conditions the maintenance of the metapopulation dynamics might be determinant for the persistence of tapirs in the region, particularly in the smaller fragments. The establishment of corridors connecting MDSP to the forest fragments models resulted in an increase in the stochastic growth rate, making tapirs more resilient to threats and catastrophes, but only if rates of mortality were not increased when using corridors. The PVA showed that the conservation of tapirs in the Pontal region depends on: the effective protection of MDSP; maintenance and, whenever possible, enhancement of the functional connectivity of the landscape, reducing mortality during dispersal and threats in the unprotected forest fragments; and neutralization of all threats affecting tapirs in the smaller forest fragments. © 2012 Wiley Publishing Asia Pty Ltd, ISZS and IOZ/CAS.
Directory of Open Access Journals (Sweden)
Shaik Hussain
Full Text Available BACKGROUND: Understanding changes in the host-parasite relationship due to habitat fragmentation is necessary for better management and conservation of endangered species in fragmented landscapes. Pathogens and parasites can pose severe threat to species in restricted environments such as forest fragments where there is increased contact of wildlife with human and livestock populations. Environmental stress and reduced nutritional level in forest fragments can influence parasite infection and intensity on the native species. In this study, we examine the impact of habitat fragmentation on the prevalence of gastrointestinal parasites in lion-tailed macaques in a fragmented rainforest in Western Ghats. METHODS: The prevalence of different gastrointestinal parasites was estimated from 91 fecal samples collected from 9 lion-tailed macaque groups in nine forest fragments. The parasites were identified up to genus level on the basis of the morphology and coloration of the egg, larva and cyst. The covariates included forest fragment area, group size and the presence/absence of human settlements and livestock in proximity. We used a linear regression model to identify the covariates that significantly influenced the prevalence of different parasite taxa. RESULTS: Nine gastrointestinal parasite taxa were detected in lion-tailed macaque groups. The groups near human settlements had greater prevalence and number of taxa, and these variables also had significant positive correlations with group size. We found that these parameters were also greater in groups near human settlements after controlling for group size. Livestock were present in all five fragments that had human settlements in proximity. CONCLUSION: The present study suggests that high prevalence and species richness of gastrointestinal parasites in lion-tailed macaque groups are directly related to habitat fragmentation, high anthropogenic activities and high host density. The parasite load
Fragmentation of relativistic nuclei
International Nuclear Information System (INIS)
Cork, B.
1975-06-01
Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)
Energy Technology Data Exchange (ETDEWEB)
Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de
Thermodynamics of the fuel fragmentation gas
International Nuclear Information System (INIS)
Perez, R.B.; Alsmiller, R.G. Jr.
1977-01-01
In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented
Directory of Open Access Journals (Sweden)
Akeela Fatima
2017-01-01
Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Directory of Open Access Journals (Sweden)
Cui Shang-jin
2010-05-01
Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Models of fragmentation with composite power laws
Tavassoli, Z.; Rodgers, G. J.
1999-06-01
Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.
Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji
2017-06-05
This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.
Kinetics of fragmentation-annihilation processes
Filipe, JAN; Rodgers, GJ
1996-01-01
We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...
Fission fragment spins and spectroscopy
International Nuclear Information System (INIS)
Durell, J.L.
1988-01-01
Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.
Directory of Open Access Journals (Sweden)
Kathleen Semple Delaney
2010-09-01
Full Text Available Urbanization is a major cause of habitat fragmentation worldwide. Ecological and conservation theory predicts many potential impacts of habitat fragmentation on natural populations, including genetic impacts. Habitat fragmentation by urbanization causes populations of animals and plants to be isolated in patches of suitable habitat that are surrounded by non-native vegetation or severely altered vegetation, asphalt, concrete, and human structures. This can lead to genetic divergence between patches and in turn to decreased genetic diversity within patches through genetic drift and inbreeding.We examined population genetic patterns using microsatellites in four common vertebrate species, three lizards and one bird, in highly fragmented urban southern California. Despite significant phylogenetic, ecological, and mobility differences between these species, all four showed similar and significant reductions in gene flow over relatively short geographic and temporal scales. For all four species, the greatest genetic divergence was found where development was oldest and most intensive. All four animals also showed significant reduction in gene flow associated with intervening roads and freeways, the degree of patch isolation, and the time since isolation.Despite wide acceptance of the idea in principle, evidence of significant population genetic changes associated with fragmentation at small spatial and temporal scales has been rare, even in smaller terrestrial vertebrates, and especially for birds. Given the striking pattern of similar and rapid effects across four common and widespread species, including a volant bird, intense urbanization may represent the most severe form of fragmentation, with minimal effective movement through the urban matrix.
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Kuglstatter, A; Stihle, M; Neumann, C; Müller, C; Schaefer, W; Klein, C; Benz, J
2017-09-01
An increasing number of bispecific therapeutic antibodies are progressing through clinical development. The Knob-into-Hole (KiH) technology uses complementary mutations in the CH3 region of the antibody Fc fragment to achieve heavy chain heterodimerization. Here we describe the X-ray crystal structures of glycosylated and disulfide-engineered heterodimeric KiH Fc fragment and its homodimeric Knob-Knob and Hole-Hole side products. The heterodimer structure confirms the KiH design principle and supports the hypothesis that glycosylation stabilizes a closed Fc conformation. Both homodimer structures show parallel Fc fragment architectures, in contrast to recently reported crystal structures of the corresponding aglycosylated Fc fragments which in the absence of disulfide mutations show an unexpected antiparallel arrangement. The glycosylated Knob-Knob Fc fragment is destabilized as indicated by variability in the relative orientation of its CH3 domains. The glycosylated Hole-Hole Fc fragment shows an unexpected intermolecular disulfide bond via the introduced Y349C Hole mutation which results in a large CH3 domain shift and a new CH3-CH3 interface. The crystal structures of glycosylated, disulfide-linked KiH Fc fragment and its Knob-Knob and Hole-Hole side products reported here will facilitate further design of highly efficient antibody heterodimerization strategies. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Electron transport chains in organohalide-respiring bacteria and bioremediation implications.
Wang, Shanquan; Qiu, Lan; Liu, Xiaowei; Xu, Guofang; Siegert, Michael; Lu, Qihong; Juneau, Philippe; Yu, Ling; Liang, Dawei; He, Zhili; Qiu, Rongliang
2018-04-06
In situ remediation employing organohalide-respiring bacteria represents a promising solution for cleanup of persistent organohalide pollutants. The organohalide-respiring bacteria conserve energy by utilizing H 2 or organic compounds as electron donors and organohalides as electron acceptors. Reductive dehalogenase (RDase), a terminal reductase of the electron transport chain in organohalide-respiring bacteria, is the key enzyme that catalyzes halogen removal. Accumulating experimental evidence thus far suggests that there are distinct models for respiratory electron transfer in organohalide-respirers of different lineages, e.g., Dehalococcoides, Dehalobacter, Desulfitobacterium and Sulfurospirillum. In this review, to connect the knowledge in organohalide-respiratory electron transport chains to bioremediation applications, we first comprehensively review molecular components and their organization, together with energetics of the organohalide-respiratory electron transport chains, as well as recent elucidation of intramolecular electron shuttling and halogen elimination mechanisms of RDases. We then highlight the implications of organohalide-respiratory electron transport chains in stimulated bioremediation. In addition, major challenges and further developments toward understanding the organohalide-respiratory electron transport chains and their bioremediation applications are identified and discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
Spatial Ecology of Estuarine Crocodile (Crocodylus porosus Nesting in a Fragmented Landscape
Directory of Open Access Journals (Sweden)
Luke J. Evans
2016-09-01
Full Text Available The role that oil palm plays in the Lower Kinabatangan region of Eastern Sabah is of considerable scientific and conservation interest, providing a model habitat for many tropical regions as they become increasingly fragmented. Crocodilians, as apex predators, widely distributed throughout the tropics, are ideal indicator species for ecosystem health. Drones (or unmanned aerial vehicles (UAVs were used to identify crocodile nests in a fragmented landscape. Flights were targeted through the use of fuzzy overlay models and nests located primarily in areas indicated as suitable habitat. Nests displayed a number of similarities in terms of habitat characteristics allowing for refined modelling of survey locations. As well as being more cost-effective compared to traditional methods of nesting survey, the use of drones also enabled a larger survey area to be completed albeit with a limited number of flights. The study provides a methodology for targeted nest surveying, as well as a low-cost repeatable flight methodology. This approach has potential for widespread applicability across a range of species and for a variety of study designs.
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Kurazono, Hisao; Mochida, Sumiko; Binz, Thomas; Eisel, Ulrich; Quanz, Martin; Grebenstein, Oliver; Wernars, Karel; Poulain, Bernard; Tauc, Ladislav; Niemann, Heiner
1992-01-01
To define conserved domains within the light (L) chains of clostridial neurotoxins, we determined the sequence of botulinum neurotoxin type B (BoNT/B) and aligned it with those of tetanus toxin (TeTx) and BoNT/A, BoNT/Cl, BoNT/D, and BoNT/E. The L chains of BoNT/B and TeTx share 51.6% identical
Carbon payments and low-cost conservation.
Crossman, Neville D; Bryan, Brett A; Summers, David M
2011-08-01
A price on carbon is expected to generate demand for carbon offset schemes. This demand could drive investment in tree-based monocultures that provide higher carbon yields than diverse plantings of native tree and shrub species, which sequester less carbon but provide greater variation in vegetation structure and composition. Economic instruments such as species conservation banking, the creation and trading of credits that represent biological-diversity values on private land, could close the financial gap between monocultures and more diverse plantings by providing payments to individuals who plant diverse species in locations that contribute to conservation and restoration goals. We studied a highly modified agricultural system in southern Australia that is typical of many temperate agriculture zones globally (i.e., has a high proportion of endangered species, high levels of habitat fragmentation, and presence of non-native species). We quantified the economic returns from agriculture and from carbon plantings (monoculture and mixed tree and shrubs) under six carbon-price scenarios. We also identified high-priority locations for restoration of cleared landscapes with mixed tree and shrub carbon plantings. Depending on the price of carbon, direct annual payments to landowners of AU$7/ha/year to $125/ha/year (US$6-120/ha/year) may be sufficient to augment economic returns from a carbon market and encourage tree plantings that contribute more to the restoration of natural systems and endangered species habitats than monocultures. Thus, areas of high priority for conservation and restoration may be restored relatively cheaply in the presence of a carbon market. Overall, however, less carbon is sequestered by mixed native tree and shrub plantings. © 2011 Society for Conservation Biology.