WorldWideScience

Sample records for conservative fragmentation chains

  1. Production of a phage-displayed single chain variable fragment ...

    African Journals Online (AJOL)

    Abstract. Purpose: To develop specific single chain variable fragments (scFv) against ... libraries. The binding ability of the selected scFv antibody fragments against the IBDV particles was ..... Hermelink H, Koscielniak E. A human recombinant.

  2. Olefin copolymerization via reversible addition-fragmentation chain transfer

    NARCIS (Netherlands)

    Venkatesh, R.; Staal, B.B.P.; Klumperman, B.

    2004-01-01

    Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished

  3. Production of a phage-displayed single chain variable fragment ...

    African Journals Online (AJOL)

    Purpose: To develop specific single chain variable fragments (scFv) against infectious bursal disease virus (IBDV) via phage display technology. Methods: Purified viruses were initially applied for iterative panning rounds of scFv phage display libraries. The binding ability of the selected scFv antibody fragments against the ...

  4. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

  5. Fenced and Fragmented: Conservation Value of Managed Metapopulations

    Science.gov (United States)

    Miller, Susan M.; Harper, Cindy K.; Bloomer, Paulette; Hofmeyr, Jennifer; Funston, Paul J.

    2015-01-01

    Population fragmentation is threatening biodiversity worldwide. Species that once roamed vast areas are increasingly being conserved in small, isolated areas. Modern management approaches must adapt to ensure the continued survival and conservation value of these populations. In South Africa, a managed metapopulation approach has been adopted for several large carnivore species, all protected in isolated, relatively small, reserves that are fenced. As far as possible these approaches are based on natural metapopulation structures. In this network, over the past 25 years, African lions (Panthera leo) were reintroduced into 44 fenced reserves with little attention given to maintaining genetic diversity. To examine the situation, we investigated the current genetic provenance and diversity of these lions. We found that overall genetic diversity was similar to that in a large national park, and included a mixture of four different southern African evolutionarily significant units (ESUs). This mixing of ESUs, while not ideal, provides a unique opportunity to study the impact of mixing ESUs over the long term. We propose a strategic managed metapopulation plan to ensure the maintenance of genetic diversity and improve the long-term conservation value of these lions. This managed metapopulation approach could be applied to other species under similar ecological constraints around the globe. PMID:26699333

  6. Expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori

    NARCIS (Netherlands)

    Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.

    2005-01-01

    We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA

  7. Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...

    African Journals Online (AJOL)

    Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.

  8. Stability of llama heavy chain antibody fragments under extreme conditions

    NARCIS (Netherlands)

    Dolk, E.

    2004-01-01

    Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The

  9. Improved production and function of llama heavy chain antibody fragments by molecular evolution

    NARCIS (Netherlands)

    Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.

    2000-01-01

    The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In

  10. Fragmentation kinetics of a Morse oscillator chain under tension

    International Nuclear Information System (INIS)

    Stember, Joseph N.; Ezra, Gregory S.

    2007-01-01

    The bond dissociation kinetics of tethered atomic (Morse potential) chains under tensile stress is studied. Both RRKM (fully anharmonic, Monte Carlo) and RRK (harmonic appproximation) theory are applied to predict bond dissociation rate constants as a function of energy and tensile force. For chains with N ≥ 3 atoms a hybrid statistical theory is used involving a harmonic approximation for motion in the transition state for bond dissociation. For chains with N = 2-5 atoms, while the RRK approximation significantly overestimates the dissociation rate constant, the fully anharmonic RRKM rate is quite close to simulation results. For the N = 2 chain, a novel approach to the extraction of decay rate constants based on the classical spectral theorem is implemented. Good agreement between the RRKM and dynamical rate constants is obtained for N = 2 despite the fact that the reactant phase space contains a significant fraction of relatively short-lived trajectories

  11. Who wants to conserve remaining forest fragments in the ...

    African Journals Online (AJOL)

    For exam- ple, a small forest that is surrounded by agricultural fields and that is still partly .... 75. 43. 21. Forest fragments [% of forest in village territory]. 5. 20. 100. 100. Market proximity ..... Cas de Manompana – Nord-Est de. Madagascar.

  12. On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain

    DEFF Research Database (Denmark)

    Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey

    2006-01-01

    The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...

  13. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  14. Fragments of the constant region of immunoglobulin light chains are constituents of AL-amyloid proteins

    DEFF Research Database (Denmark)

    Olsen, K E; Sletten, K; Westermark, Per

    1998-01-01

    Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin l...... light chain are a constituent of the AL-amyloid proteins of kappa type. A specific antiserum has identified these fragments in gel filtration fractions where the absorbance approached the base line after the main retarded peak. The fragments are small and have been overlooked previously......Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin...... in the purification process. The significance of the constant part in AL-proteins is unclear, but adds new aspects to the discussion of pre- or post-fibrillogenic cleavage of the immunoglobulin light chains....

  15.  Variable fragments of heavy chain antibodies (VHHs: a new magic bullet molecule of medicine?

    Directory of Open Access Journals (Sweden)

    Dorota Smolarek

    2012-06-01

    Full Text Available  Serum of animals belonging to the Camelidae family (camels and llamas contains fully active antibodies that are naturally devoid of light chains. Variable domains derived from heavy chain antibodies (hcAb called VHHs or nanobodies™ can bind antigens as effectively as full-length antibodies and are easy to clone and express. Because of their potential, VHHs are being intensively studied as potential therapeutic, diagnostic and imaging tools. The paper reviews the molecular background of heavy chain antibodies and describes methods of obtaining recombinant fragments of heavy chain antibodies as well as their therapeutic, diagnostic and other applications.

  16. Optimization of the crystallizability of a single-chain antibody fragment

    Czech Academy of Sciences Publication Activity Database

    Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína

    2014-01-01

    Roč. 70, č. 12 (2014), s. 1701-1706 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014

  17. Automated main-chain model building by template matching and iterative fragment extension

    International Nuclear Information System (INIS)

    Terwilliger, Thomas C.

    2003-01-01

    A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition

  18. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    Science.gov (United States)

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  19. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    Science.gov (United States)

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  20. Automated main-chain model building by template matching and iterative fragment extension.

    Science.gov (United States)

    Terwilliger, Thomas C

    2003-01-01

    An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.

  1. Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene

    OpenAIRE

    Pullan, Nikki; Liu, Max; Topham, Paul D.

    2013-01-01

    Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...

  2. A Strategy for Generating a Broad-Spectrum Monoclonal Antibody and Soluble Single-Chain Variable Fragments against Plant Potyviruses

    Science.gov (United States)

    Liu, Han-Lin; Lin, Wei-Fang; Hu, Wen-Chi; Lee, Yung-An

    2015-01-01

    Potyviruses are major pathogens that often cause mixed infection in calla lilies. To reduce the time and cost of virus indexing, a detection method for the simultaneous targeting of multiple potyviruses was developed by generating a broad-spectrum monoclonal antibody (MAb) for detecting the greatest possible number of potyviruses. The conserved 121-amino-acid core regions of the capsid proteins of Dasheen mosaic potyvirus (DsMV), Konjak mosaic potyvirus (KoMV), and Zantedeschia mild mosaic potyvirus (ZaMMV) were sequentially concatenated and expressed as a recombinant protein for immunization. After hybridoma cell fusion and selection, one stable cell line that secreted a group-specific antibody, named C4 MAb, was selected. In the reaction spectrum test, the C4 MAb detected at least 14 potyviruses by indirect enzyme-linked immunosorbent assay (I-ELISA) and Western blot analysis. Furthermore, the variable regions of the heavy (VH) and light (VL) chains of the C4 MAb were separately cloned and constructed as single-chain variable fragments (scFvs) for expression in Escherichia coli. Moreover, the pectate lyase E (PelE) signal peptide of Erwinia chrysanthemi S3-1 was added to promote the secretion of C4 scFvs into the medium. According to Western blot analysis and I-ELISA, the soluble C4 scFv (VL-VH) fragment showed a binding specificity similar to that of the C4 MAb. Our results demonstrate that a recombinant protein derived from fusion of the conserved regions of viral proteins has the potential to produce a broad-spectrum MAb against a large group of viruses and that the PelE signal peptide can improve the secretion of scFvs in E. coli. PMID:26209665

  3. Regularity and mass conservation for discrete coagulation–fragmentation equations with diffusion

    KAUST Repository

    Cañizo, J.A.

    2010-03-01

    We present a new a priori estimate for discrete coagulation-fragmentation systems with size-dependent diffusion within a bounded, regular domain confined by homogeneous Neumann boundary conditions. Following from a duality argument, this a priori estimate provides a global L2 bound on the mass density and was previously used, for instance, in the context of reaction-diffusion equations. In this paper we demonstrate two lines of applications for such an estimate: On the one hand, it enables to simplify parts of the known existence theory and allows to show existence of solutions for generalised models involving collision-induced, quadratic fragmentation terms for which the previous existence theory seems difficult to apply. On the other hand and most prominently, it proves mass conservation (and thus the absence of gelation) for almost all the coagulation coefficients for which mass conservation is known to hold true in the space homogeneous case. © 2009 Elsevier Masson SAS. All rights reserved.

  4. The Technology Introduction of Chain Boiler Energy Conservation Transformation

    Science.gov (United States)

    Li, Henan; Liu, Xiwen; Yuan, Hong; Lin, Jiadai; Zhang, Yu

    2017-12-01

    Introduced the present status of chain boiler efficiency is low, the system analysis of the chain boiler optimization and upgrading of technology, for the whole progress of chain boiler to provide some ideas and reference.

  5. Nicked apomyoglobin: a noncovalent complex of two polypeptide fragments comprising the entire protein chain.

    Science.gov (United States)

    Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo

    2004-05-25

    Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the

  6. Diverse responses of species to landscape fragmentation in a simple food chain.

    Science.gov (United States)

    Liao, Jinbao; Bearup, Daniel; Blasius, Bernd

    2017-09-01

    Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  7. Selecting a Conservation Surrogate Species for Small Fragmented Habitats Using Ecological Niche Modelling

    Directory of Open Access Journals (Sweden)

    K. Anne-Isola Nekaris

    2015-01-01

    Full Text Available Flagship species are traditionally large, charismatic animals used to rally conservation efforts. Accepted flagship definitions suggest they need only fulfil a strategic role, unlike umbrella species that are used to shelter cohabitant taxa. The criteria used to select both flagship and umbrella species may not stand up in the face of dramatic forest loss, where remaining fragments may only contain species that do not suit either set of criteria. The Cinderella species concept covers aesthetically pleasing and overlooked species that fulfil the criteria of flagships or umbrellas. Such species are also more likely to occur in fragmented habitats. We tested Cinderella criteria on mammals in the fragmented forests of the Sri Lankan Wet Zone. We selected taxa that fulfilled both strategic and ecological roles. We created a shortlist of ten species, and from a survey of local perceptions highlighted two finalists. We tested these for umbrella characteristics against the original shortlist, utilizing Maximum Entropy (MaxEnt modelling, and analysed distribution overlap using ArcGIS. The criteria highlighted Loris tardigradus tardigradus and Prionailurus viverrinus as finalists, with the former having highest flagship potential. We suggest Cinderella species can be effective conservation surrogates especially in habitats where traditional flagship species have been extirpated.

  8. Conservation value of a native forest fragment in a region of extensive agriculture.

    Science.gov (United States)

    Chiarello

    2000-05-01

    A survey of mammals and birds was carried out in a semi-deciduous forest fragment of 150 ha located in a zone of intensive agriculture in Ribeirão Preto, State of São Paulo, south-eastern Brazil. Line transect sampling was used to census mammals and birds during six days, totalling 27.8 km of trails and 27.8 hours of observation. Twenty mammal species were confirmed in the area (except bats and small mammals), including rare or endangered species, such as the mountain lion (Puma concolor), the maned wolf (Chrysocyon brachyurus), and the ocelot (Leopardus pardalis). The brown capuchin monkey (Cebus apella) and the black-tufted-ear marmoset (Callithrix penicillata) were found frequently, suggesting high population density in the fragment. Regarding the avifauna, 49 bird species were recorded, most of them typical of open areas or forest edges. Some confirmed species, however, are becoming increasingly rare in the region, as for example the muscovy duck (Cairina moschata) and the toco toucan (Ramphastos toco). The results demonstrate that forest fragment of this size are refuges for native fauna in a region dominated almost exclusively by sugar-cane plantations. Besides faunal aspects, the conservation of these fragments is of great importance for the establishment of studies related to species preservation in the long term, including reintroduction and translocation projects, as well as studies related to genetic health of isolated populations.

  9. Geospatial characterization of deforestation, fragmentation and forest fires in Telangana state, India: conservation perspective.

    Science.gov (United States)

    Sudhakar Reddy, C; Vazeed Pasha, S; Jha, C S; Dadhwal, V K

    2015-07-01

    Conservation of biodiversity has been put to the highest priority throughout the world. The process of identifying threatened ecosystems will search for different drivers related to biodiversity loss. The present study aimed to generate spatial information on deforestation and ecological degradation indicators of fragmentation and forest fires using systematic conceptual approach in Telangana state, India. Identification of ecosystems facing increasing vulnerability can help to safeguard the extinctions of species and useful for conservation planning. The technological advancement of satellite remote sensing and Geographical Information System has increased greatly in assessment and monitoring of ecosystem-level changes. The areas of threat were identified by creating grid cells (5 × 5 km) in Geographical Information System (GIS). Deforestation was assessed using multi-source data of 1930, 1960, 1975, 1985, 1995, 2005 and 2013. The forest cover of 40,746 km(2), 29,299 km(2), 18,652 km(2), 18,368 km(2), 18,006 km(2), 17,556 km(2) and 17,520 km(2) was estimated during 1930, 1960, 1975, 1985, 1995, 2005 and 2013, respectively. Historical evaluation of deforestation revealed that major changes had occurred in forests of Telangana and identified 1095 extinct, 397 critically endangered, 523 endangered and 311 vulnerable ecosystem grid cells. The fragmentation analysis has identified 307 ecosystem grid cells under critically endangered status. Forest burnt area information was extracted using AWiFS data of 2005 to 2014. Spatial analysis indicates total fire-affected forest in Telangana as 58.9% in a decadal period. Conservation status has been recorded depending upon values of threat for each grid, which forms the basis for conservation priority hotspots. Of existing forest, 2.1% grids had severe ecosystem collapse and had been included under the category of conservation priority hotspot-I, followed by 27.2% in conservation priority hotspot-II and 51.5% in conservation

  10. Combining measures of dispersal to identify conservation strategies in fragmented landscapes.

    Science.gov (United States)

    Leidner, Allison K; Haddad, Nick M

    2011-10-01

    Understanding the way in which habitat fragmentation disrupts animal dispersal is key to identifying effective and efficient conservation strategies. To differentiate the potential effectiveness of 2 frequently used strategies for increasing the connectivity of populations in fragmented landscapes-corridors and stepping stones-we combined 3 complimentary methods: behavioral studies at habitat edges, mark-recapture, and genetic analyses. Each of these methods addresses different steps in the dispersal process that a single intensive study could not address. We applied the 3 methods to the case study of Atrytonopsis new species 1, a rare butterfly endemic to a partially urbanized stretch of barrier islands in North Carolina (U.S.A.). Results of behavioral analyses showed the butterfly flew into urban and forested areas, but not over open beach; mark-recapture showed that the butterfly dispersed successfully through short stretches of urban areas (5 km) were a dispersal barrier, but shorter stretches of urban areas (≤5 km) were not. Although results from all 3 methods indicated natural features in the landscape, not urbanization, were barriers to dispersal, when we combined the results we could determine where barriers might arise: forests restricted dispersal for the butterfly only when there were long stretches with no habitat. Therefore, urban areas have the potential to become a dispersal barrier if their extent increases, a finding that may have gone unnoticed if we had used a single approach. Protection of stepping stones should be sufficient to maintain connectivity for Atrytonopsis new species 1 at current levels of urbanization. Our research highlights how the use of complementary approaches for studying animal dispersal in fragmented landscapes can help identify conservation strategies. ©2011 Society for Conservation Biology.

  11. Preparation of nanocomposites by reversible addition-fragmentation chain transfer polymerization from the surface of quantum dots in miniemulsion

    NARCIS (Netherlands)

    Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.

    2009-01-01

    Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a

  12. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  13. Habitat Re-Creation (Ecological Restoration) as a Strategy for Conserving Insect Communities in Highly Fragmented Landscapes.

    Science.gov (United States)

    Shuey, John A

    2013-12-05

    Because of their vast diversity, measured by both numbers of species as well as life history traits, insects defy comprehensive conservation planning. Thus, almost all insect conservation efforts target individual species. However, serious insect conservation requires goals that are set at the faunal level and conservation success requires strategies that conserve intact communities. This task is complicated in agricultural landscapes by high levels of habitat fragmentation and isolation. In many regions, once widespread insect communities are now functionally trapped on islands of ecosystem remnants and subject to a variety of stressors associated with isolation, small population sizes and artificial population fragmentation. In fragmented landscapes ecological restoration can be an effective strategy for reducing localized insect extinction rates, but insects are seldom included in restoration design criteria. It is possible to incorporate a few simple conservation criteria into restoration designs that enhance impacts to entire insect communities. Restoration can be used as a strategy to address fragmentation threats to isolated insect communities if insect communities are incorporated at the onset of restoration planning. Fully incorporating insect communities into restoration designs may increase the cost of restoration two- to three-fold, but the benefits to biodiversity conservation and the ecological services provided by intact insect communities justify the cost.

  14. The Fourier law in a momentum-conserving chain

    NARCIS (Netherlands)

    Giardinà, C.; Kurchan, J.

    2005-01-01

    We introduce a family of models for heat conduction with and without momentum conservation. They are analytically solvable in the high temperature limit and can also be efficiently simulated. In all cases the Fourier law is verified in one dimension.

  15. Generation of human antibody fragments against Streptococcus mutans using a phage display chain shuffling approach

    Directory of Open Access Journals (Sweden)

    Barth Stefan

    2005-01-01

    Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.

  16. Comparison of Drosophilidae (Diptera) assemblages from two highland Araucaria Forest fragments, with and without environmental conservation policies

    OpenAIRE

    Cavasini, R; Buschini, MLT; Machado, LPB; Mateus, RP

    2014-01-01

    Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA – Parque Municipal das Araucárias) and the...

  17. Conserving a geographically isolated Charaxes butterfly in response to habitat fragmentation and invasive alien plants

    Directory of Open Access Journals (Sweden)

    Casparus J. Crous

    2015-08-01

    Full Text Available In South Africa, much of the forest biome is vulnerable to human-induced disturbance. The forest-dwelling butterfly Charaxes xiphares occidentalis is naturally confined to a small forest region in the south-western Cape, South Africa. Most of the remaining habitat of this species is within a fragmented agricultural matrix. Furthermore, this geographical area is also heavily invaded by alien plants, especially Acacia mearnsii. We investigated how C. x. occidentalis behaviourally responds to different habitat conditions in the landscape. We were particularly interested in touring, patrolling and settling behaviour as a conservation proxy for preference of a certain habitat configuration in this agricultural matrix. Remnant forest patches in the agricultural matrix showed fewer behavioural incidents than in a reference protected area. Moreover, dense stands of A. mearnsii negatively influenced the incidence and settling pattern of this butterfly across the landscape, with fewer tree settlings associated with more heavily invaded forest patches. This settling pattern was predominantly seen in female butterflies. We also identified specific trees that were settled upon for longer periods by C. x. occidentalis. Distance to a neighbouring patch and patch size influenced behavioural incidences, suggesting that further patch degradation and isolation could be detrimental to this butterfly. Conservation implications: We highlight the importance of clearing invasive tree species from vulnerable forest ecosystems and identify key tree species to consider in habitat conservation and rehabilitation programmes for this butterfly. We also suggest retaining as much intact natural forest as possible. This information should be integrated in local biodiversity management plans.

  18. Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis

    Directory of Open Access Journals (Sweden)

    Chi-Hsin Lee

    2017-10-01

    Full Text Available Russell’s vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs containing 3.4 × 107 and 5.5 × 107 transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.

  19. Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis.

    Science.gov (United States)

    Lee, Chi-Hsin; Lee, Yu-Ching; Lee, Yueh-Lun; Leu, Sy-Jye; Lin, Liang-Tzung; Chen, Chi-Ching; Chiang, Jen-Ron; Mwale, Pharaoh Fellow; Tsai, Bor-Yu; Hung, Ching-Sheng; Yang, Yi-Yuan

    2017-10-27

    Russell's vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY) antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs) containing 3.4 × 10⁷ and 5.5 × 10⁷ transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.

  20. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    Science.gov (United States)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  1. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  2. Comparison of Drosophilidae (Diptera assemblages from two highland Araucaria Forest fragments, with and without environmental conservation policies

    Directory of Open Access Journals (Sweden)

    R Cavasini

    Full Text Available Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA – Parque Municipal das Araucárias and the other a private property without any conservational policy (FBL – Fazenda Brandalise, in space and time, using species abundances and richness, ecological indexes and Neotropical and exotic species proportions as parameters to establish the level of environmental quality of these fragments. Our results showed that the observed diversity in PMA (H′ = 2.221 was approximately 40% higher than in FBL (H′ = 1.592. This could be due to higher preservation quality and habitat diversity in PMA, indicating the importance of conservation units. However, richness were similar for these areas, with PMA (Dmg = 6.602 only 8% higher than FBL (Dmg = 6.128, which suggest that the larger distance from city limits and the larger size of FBL forested area could be compensating the higher disturbance caused by antrophic extractive exploitation of this fragment. This points out that, besides the quality of presevertion, the size and/or connection with other fragments should be considered for areas destined for biodiversity conservation. In general, both areas presented similar drosophilid assemblages, and the expressive abundance of both Neotropical species (mostly of the subgroup willistoni and the exotic species D. kikkawai suggests that these areas are in intermediate stages of conservation.

  3. Comparison of Drosophilidae (Diptera) assemblages from two highland Araucaria Forest fragments, with and without environmental conservation policies.

    Science.gov (United States)

    Cavasini, R; Buschini, M L T; Machado, L P B; Mateus, R P

    2014-11-01

    Flies from the Drosophilidae family are model organisms for biological studies and are often suggested as bioindicators of environmental quality. The Araucaria Forest, one of Atlantic Forest phyto-physiognomy, displays a highly fragmented distribution due to the expansion of agriculture and urbanization. Thus, this work aimed to evaluate and compare the drosophilid assemblages from two highland Araucaria Forest fragments, one a conservation unit (PMA - Parque Municipal das Araucárias) and the other a private property without any conservational policy (FBL - Fazenda Brandalise), in space and time, using species abundances and richness, ecological indexes and Neotropical and exotic species proportions as parameters to establish the level of environmental quality of these fragments. Our results showed that the observed diversity in PMA (H' = 2.221) was approximately 40% higher than in FBL (H' = 1.592). This could be due to higher preservation quality and habitat diversity in PMA, indicating the importance of conservation units. However, richness were similar for these areas, with PMA (Dmg = 6.602) only 8% higher than FBL (Dmg = 6.128), which suggest that the larger distance from city limits and the larger size of FBL forested area could be compensating the higher disturbance caused by antrophic extractive exploitation of this fragment. This points out that, besides the quality of presevertion, the size and/or connection with other fragments should be considered for areas destined for biodiversity conservation. In general, both areas presented similar drosophilid assemblages, and the expressive abundance of both Neotropical species (mostly of the subgroup willistoni) and the exotic species D. kikkawai suggests that these areas are in intermediate stages of conservation.

  4. Sustainable chains and energy conservation. Final report of the preliminary phase

    International Nuclear Information System (INIS)

    Bakker, C.; Bonekamp, L.

    2002-01-01

    An overview is given of the preparatory phase of the project on the title subject. Eleven pre-pilot projects (feasibility studies) are described of which 6 are elaborated in detail: energy conservation in the pig meat chain; Novel Protein Foods; dairy industry, in particular so-called cheese cows; dry matter content of potatoes for french fries; tare reduction of potatoes in the chain of pre-baked fries; and the export of tomatoes by maritime transport [nl

  5. Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties

    Science.gov (United States)

    Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.

    2003-12-01

    A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.

  6. Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies.

    Science.gov (United States)

    Qamsari, Elmira Safaie; Sharifzadeh, Zahra; Bagheri, Salman; Riazi-Rad, Farhad; Younesi, Vahid; Abolhassani, Mohsen; Ghaderi, Sepideh Safaei; Baradaran, Behzad; Somi, Mohammad Hossein; Yousefi, Mehdi

    2017-12-01

    The receptor tyrosine kinase (RTK) Met is the cell surface receptor for hepatocyte growth factor (HGF) involved in invasive growth programs during embryogenesis and tumorgenesis. There is compelling evidence suggesting important roles for c-Met in colorectal cancer proliferation, migration, invasion, angiogenesis, and survival. Hence, a molecular inhibitor of an extracellular domain of c-Met receptor that blocks c-Met-cell surface interactions could be of great thera-peutic importance. In an attempt to develop molecular inhibitors of c-Met, single chain variable fragment (scFv) phage display libraries Tomlinson I + J against a specific synthetic oligopeptide from the extracellular domain of c-Met receptor were screened; selected scFv were then characterized using various immune techniques. Three c-Met specific scFv (ES1, ES2, and ES3) were selected following five rounds of panning procedures. The scFv showed specific binding to c-Met receptor, and significantly inhibited proliferation responses of a human colorectal carcinoma cell line (HCT-116). Moreover, anti- apoptotic effects of selected scFv antibodies on the HCT-116 cell line were also evaluated using Annexin V/PI assays. The results demonstrated rates of apoptotic cell death of 46.0, 25.5, and 37.8% among these cells were induced by use of ES1, ES2, and ES3, respectively. The results demonstrated ability to successfully isolate/char-acterize specific c-Met scFv that could ultimately have a great therapeutic potential in immuno-therapies against (colorectal) cancers.

  7. Quasilocal conservation laws in XXZ spin-1/2 chains: Open, periodic and twisted boundary conditions

    Directory of Open Access Journals (Sweden)

    Tomaž Prosen

    2014-09-01

    Full Text Available A continuous family of quasilocal exact conservation laws is constructed in the anisotropic Heisenberg (XXZ spin-1/2 chain for periodic (or twisted boundary conditions and for a set of commensurate anisotropies densely covering the entire easy plane interaction regime. All local conserved operators follow from the standard (Hermitian transfer operator in fundamental representation (with auxiliary spin s=1/2, and are all even with respect to a spin flip operation. However, the quasilocal family is generated by differentiation of a non-Hermitian highest weight transfer operator with respect to a complex auxiliary spin representation parameter s and includes also operators of odd parity. For a finite chain with open boundaries the time derivatives of quasilocal operators are not strictly vanishing but result in operators localized near the boundaries of the chain. We show that a simple modification of the non-Hermitian transfer operator results in exactly conserved, but still quasilocal operators for periodic or generally twisted boundary conditions. As an application, we demonstrate that implementing the new exactly conserved operator family for estimating the high-temperature spin Drude weight results, in the thermodynamic limit, in exactly the same lower bound as for almost conserved family and open boundaries. Under the assumption that the bound is saturating (suggested by agreement with previous thermodynamic Bethe ansatz calculations we propose a simple explicit construction of infinite time averages of local operators such as the spin current.

  8. Grafting of Polystyrene Chains at the Edge of Graphene Nanolayers by "Grafting Through" Approach Using Reversible Addition-Fragmentation Chain Transfer Polymerization

    Directory of Open Access Journals (Sweden)

    Hossein Roghani-Mamaqani

    2017-09-01

    Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.

  9. Deforestation and fragmentation of natural forests in the upper Changhua watershed, Hainan, China: implications for biodiversity conservation.

    Science.gov (United States)

    Zhai, De-Li; Cannon, Charles H; Dai, Zhi-Cong; Zhang, Cui-Ping; Xu, Jian-Chu

    2015-01-01

    Hainan, the largest tropical island in China, belongs to the Indo-Burma biodiversity hotspot. The Changhua watershed is a center of endemism for plants and birds and the cradle of Hainan's main rivers. However, this area has experienced recent and ongoing deforestation and habitat fragmentation. To quantify habitat loss and fragmentation of natural forests, as well as the land-cover changes in the Changhua watershed, we analyzed Landsat images obtained in 1988, 1995, and 2005. Land-cover dynamics analysis showed that natural forests increased in area (97,909 to 104,023 ha) from 1988 to 1995 but decreased rapidly to 76,306 ha over the next decade. Rubber plantations increased steadily throughout the study period while pulp plantations rapidly expanded after 1995. Similar patterns of land cover change were observed in protected areas, indicating a lack of enforcement. Natural forests conversion to rubber and pulp plantations has a general negative effect on biodiversity, primarily through habitat fragmentation. The fragmentation analysis showed that natural forests area was reduced and patch number increased, while patch size and connectivity decreased. These land-cover changes threatened local biodiversity, especially island endemic species. Both natural forests losses and fragmentation should be stopped by strict enforcement to prevent further damage. Preserving the remaining natural forests and enforcing the status of protected areas should be a management priority to maximize the watershed's biodiversity conservation value.

  10. Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-09-08

    Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

  11. Regularity and mass conservation for discrete coagulation–fragmentation equations with diffusion

    KAUST Repository

    Cañ izo, J.A.; Desvillettes, L.; Fellner, K.

    2010-01-01

    We present a new a priori estimate for discrete coagulation-fragmentation systems with size-dependent diffusion within a bounded, regular domain confined by homogeneous Neumann boundary conditions. Following from a duality argument, this a priori

  12. SINGLE CHAIN VARIABLE FRAGMENTS OF ANTIBODIES AGAINST DIPHTHERIA TOXIN B-SUBUNIT ISOLATED FROM PHAGE DISPLAY HUMAN ANTIBODY LIBRARY

    Directory of Open Access Journals (Sweden)

    Oliinyk O. S.

    2014-02-01

    Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.

  13. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  14. A novel variable antibody fragment dimerized by leucine zippers with enhanced neutralizing potency against rabies virus G protein compared to its corresponding single-chain variable antibody fragment.

    Science.gov (United States)

    Li, Zhuang; Cheng, Yue; Xi, Hualong; Gu, Tiejun; Yuan, Ruosen; Chen, Xiaoxu; Jiang, Chunlai; Kong, Wei; Wu, Yongge

    2015-12-01

    Fatal rabies can be prevented effectively by post-exposure prophylactic (PEP) with rabies immunoglobulin (RIG). Single-chain variable fragments (scFv), which are composed of a variable heavy chain (VH) and a variable light chain (VL) connected by a peptide linker, can potentially be used to replace RIG. However, in our previous study, a scFv (scFV57S) specific for the rabies virus (RV) G protein showed a lower neutralizing potency than that of its parent IgG due to lower stability and altered peptide assembly pattern. In monoclonal antibodies, the VH and VL interact non-covalently, while in scFvs the VH is connected covalently with the VL by the artificial linker. In this study, we constructed and expressed two peptides 57VL-JUN-HIS and 57VH-FOS-HA in Escherichia coli. The well-known Fos and Jun leucine zippers were utilized to dimerize VH and VL similarly to the IgG counterpart. The two peptides assembled to form zipFv57S in vitro. Due to the greater similarity in structure with IgG, the zipFv57S protein showed a higher binding ability and affinity resulting in notable improvement of in vitro neutralizing activity over its corresponding scFv. The zipFv57S protein was also found to be more stable and showed similar protective rate as RIG in mice challenged with a lethal dose of RV. Our results not only indicated zipFv57S as an ideal alternative for RIG in PEP but also offered a novel and efficient hetero-dimerization pattern of VH and VL leading to enhanced neutralizing potency. Copyright © 2015. Published by Elsevier Ltd.

  15. Fast local fragment chaining using sum-of-pair gap costs

    DEFF Research Database (Denmark)

    Otto, Christian; Hoffmann, Steve; Gorodkin, Jan

    2011-01-01

    , and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....

  16. Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen

    NARCIS (Netherlands)

    Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.

    2005-01-01

    In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains

  17. Carprofen-imprinted monolith prepared by reversible addition-fragmentation chain transfer polymerization in room temperature ionic liquids.

    Science.gov (United States)

    Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng

    2013-10-01

    To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.

  18. Who controls the logistics emissions? Challenges in making fragmented supply chains environmentally sustainable from logistics service providers’ perspective

    DEFF Research Database (Denmark)

    Abbasi, Maisam; Sternberg, Henrik; Nilsson, Fredrik

    2014-01-01

    that impact the cost and time requirements from customers of logistics services are not yet a reality. Research limitations/implications (if applicable) This paper implies that LSP sustainability cannot be investigated in isolation if a company does not manage proprietary resources. Practical implications (if......Purpose The purpose of this article is to explore the environmental impact of Logistics Service Provider (LSP) activities in the light of increased customer attention and fragmentation of the industry. It also explores to what extent the LSPs can actually monitor the environmental impact...... of logistics activities in the supply chain? Design/methodology/approach The methodology of this paper is a literature review, a qualitative interview survey, and three case studies. A framework on sustainability challenges in supply chains derived from the literature is used to structure and analyze...

  19. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)

    2012-01-15

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  20. Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.

    2012-01-01

    Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

  1. Shark class II invariant chain reveals ancient conserved relationships with cathepsins and MHC class II.

    Science.gov (United States)

    Criscitiello, Michael F; Ohta, Yuko; Graham, Matthew D; Eubanks, Jeannine O; Chen, Patricia L; Flajnik, Martin F

    2012-03-01

    The invariant chain (Ii) is the critical third chain required for the MHC class II heterodimer to be properly guided through the cell, loaded with peptide, and expressed on the surface of antigen presenting cells. Here, we report the isolation of the nurse shark Ii gene, and the comparative analysis of Ii splice variants, expression, genomic organization, predicted structure, and function throughout vertebrate evolution. Alternative splicing to yield Ii with and without the putative protease-protective, thyroglobulin-like domain is as ancient as the MHC-based adaptive immune system, as our analyses in shark and lizard further show conservation of this mechanism in all vertebrate classes except bony fish. Remarkable coordinate expression of Ii and class II was found in shark tissues. Conserved Ii residues and cathepsin L orthologs suggest their long co-evolution in the antigen presentation pathway, and genomic analyses suggest 450 million years of conserved Ii exon/intron structure. Other than an extended linker preceding the thyroglobulin-like domain in cartilaginous fish, the Ii gene and protein are predicted to have largely similar physiology from shark to man. Duplicated Ii genes found only in teleosts appear to have become sub-functionalized, as one form is predicted to play the same role as that mediated by Ii mRNA alternative splicing in all other vertebrate classes. No Ii homologs or potential ancestors of any of the functional Ii domains were found in the jawless fish or lower chordates. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Biodiversity conservation values of fragmented communally reserved forests, managed by indigenous people, in a human-modified landscape in Borneo.

    Science.gov (United States)

    Takeuchi, Yayoi; Soda, Ryoji; Diway, Bibian; Kuda, Tinjan Ak; Nakagawa, Michiko; Nagamasu, Hidetoshi; Nakashizuka, Tohru

    2017-01-01

    This study explored the conservation values of communally reserved forests (CRFs), which local indigenous communities deliberately preserve within their area of shifting cultivation. In the current landscape of rural Borneo, CRFs are the only option for conservation because other forested areas have already been logged or transformed into plantations. By analyzing their alpha and beta diversity, we investigated how these forests can contribute to restore regional biodiversity. Although CRFs were fragmented and some had been disturbed in the past, their tree species diversity was high and equivalent to that of primary forests. The species composition of intact forests and forests disturbed in the past did not differ clearly, which indicates that past logging was not intensive. All CRFs contained unique and endangered species, which are on the IUCN Red List, Sarawak protected plants, or both. On the other hand, the forest size structure differed between disturbed and intact CRFs, with the disturbed CRFs consisting of relatively smaller trees. Although the beta diversity among CRFs was also high, we found a high contribution of species replacement (turnover), but not of richness difference, in the total beta diversity. This suggests that all CRFs have a conservation value for restoring the overall regional biodiversity. Therefore, for maintaining the regional species diversity and endangered species, it would be suitable to design a conservation target into all CRFs.

  3. Moth species richness, abundance and diversity in fragmented urban woodlands: implications for conservation and management strategies

    OpenAIRE

    Lintott, P.; Bunnefeld, N.; Fuentes-Montemayor, E.; Minderman, J.; Blackmore, L.; Goulson, D.; Park, K.

    2014-01-01

    Urban expansion threatens global biodiversity through the destruction of natural and semi-natural habitats and increased levels of disturbance. Whilst woodlands in urban areas may reduce the impact of urbanisation on biodiversity, they are often subject to under or over-management and consist of small, fragmented patches which may be isolated. Effective management strategies for urban woodland require an understanding of the\\ud ecology and habitat requirements of all relevant taxa. Yet, littl...

  4. Ecological consequences, genetic and chemical variations in fragmented populations of a medicinal plant, justicia adhatoda and implications for its conservation

    International Nuclear Information System (INIS)

    Gilani, S.A.; Watanabe, K.N.; Fujii, Y.; Shinwari, Z.K.

    2011-01-01

    Justicia adhatoda from Kohat Plateau was selected for genetic diversity studies, due to its fragmented habitat, importance in traditional and pharmaceutical medicine and a lack of population structure studies. We had two hypotheses: that habitat loss posed a greater threat to populations than loss of genetic diversity, and that chemical diversity would be higher among different populations than within populations. Genetic diversity within and among populations was evaluated using PBA (P450 based analogue) markers. AMOVA analysis revealed that there was higher genetic diversity within populations (90%) than among populations (10%). No genetic drift was observed, i.e., genetic diversity within populations was maintained despite fewer numbers of individuals in fragmented populations. Surveys of J. adhatoda populations revealed that they were growing in harsh conditions and were imperiled due to extensive harvesting for commercial and domestic purposes. Chemical diversity was evaluated by GC-MS (Gas Chromatograph-Mass Spectrometry) analysis of 90% methanol and 1:2 chloroform:methanol extracts. GC-MS analysis of both the extracts showed nine and 18 chemical compounds, respectively, with higher chemical variations among populations. It is therefore recommended that efforts for the conservation of severely fragmented populations of J. adhatoda must be carried out along with sustainable harvesting. (author)

  5. Hydrogen is a preferred intermediate in the energy-conserving electron transport chain of Methanosarcina barkeri.

    Science.gov (United States)

    Kulkarni, Gargi; Kridelbaugh, Donna M; Guss, Adam M; Metcalf, William W

    2009-09-15

    Methanogens use an unusual energy-conserving electron transport chain that involves reduction of a limited number of electron acceptors to methane gas. Previous biochemical studies suggested that the proton-pumping F(420)H(2) dehydrogenase (Fpo) plays a crucial role in this process during growth on methanol. However, Methanosarcina barkeri Delta fpo mutants constructed in this study display no measurable phenotype on this substrate, indicating that Fpo plays a minor role, if any. In contrast, Delta frh mutants lacking the cytoplasmic F(420)-reducing hydrogenase (Frh) are severely affected in their ability to grow and make methane from methanol, and double Delta fpo/Delta frh mutants are completely unable to use this substrate. These data suggest that the preferred electron transport chain involves production of hydrogen gas in the cytoplasm, which then diffuses out of the cell, where it is reoxidized with transfer of electrons into the energy-conserving electron transport chain. This hydrogen-cycling metabolism leads directly to production of a proton motive force that can be used by the cell for ATP synthesis. Nevertheless, M. barkeri does have the flexibility to use the Fpo-dependent electron transport chain when needed, as shown by the poor growth of the Delta frh mutant. Our data suggest that the rapid enzymatic turnover of hydrogenases may allow a competitive advantage via faster growth rates in this freshwater organism. The mutant analysis also confirms the proposed role of Frh in growth on hydrogen/carbon dioxide and suggests that either Frh or Fpo is needed for aceticlastic growth of M. barkeri.

  6. Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

    Science.gov (United States)

    Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

    2010-07-22

    Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

  7. Suppression of Aggrus/podoplanin-induced platelet aggregation and pulmonary metastasis by a single-chain antibody variable region fragment

    International Nuclear Information System (INIS)

    Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya

    2014-01-01

    Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies

  8. Early career: Templating of liquid crystal microstructures by reversible addition-fragmentation chain transfer polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Heinen, Jennifer M. (O' Donnell) [Iowa State Univ., Ames, IA (United States)

    2014-12-31

    This research has shown that the microstructure of self-assembled copolymers can be decoupled from the polymer chemistry. The simplest polymer architecture, linear block copolymers, is valuable for a broad range of applications, including adhesives and coatings, medical devices, electronics and energy storage, because these block copolymers reproducibly self-assemble into microphase separated nanoscale domains. Unfortunately, the self-assembled microstructure is tuned by polymer composition, thus limiting the potential to simultaneously optimize chemical, mechanical, and transport properties for desired applications. To this end, much work was been put into manipulating block copolymer self-assembly independently of polymer composition. These efforts have included the use of additives or solvents to alter polymer chain conformation, the addition of a third monomer to produce ABC triblock terpolymers, architectures with mixed blocks, such as tapered/gradient polymers, and the synthesis of other nonlinear molecular architectures. This work has shown that the microstructures formed by linear ABC terpolymers can be altered by controlling the architecture of the polymer molecules at a constant monomer composition, so that the microstructure is tuned independently from the chemical properties.

  9. Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

    International Nuclear Information System (INIS)

    Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun

    2009-01-01

    An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1

  10. Traveling waves and conservation laws for highly nonlinear wave equations modeling Hertz chains

    Science.gov (United States)

    Przedborski, Michelle; Anco, Stephen C.

    2017-09-01

    A highly nonlinear, fourth-order wave equation that models the continuum theory of long wavelength pulses in weakly compressed, homogeneous, discrete chains with a general power-law contact interaction is studied. For this wave equation, all solitary wave solutions and all nonlinear periodic wave solutions, along with all conservation laws, are derived. The solutions are explicitly parameterized in terms of the asymptotic value of the wave amplitude in the case of solitary waves and the peak of the wave amplitude in the case of nonlinear periodic waves. All cases in which the solution expressions can be stated in an explicit analytic form using elementary functions are worked out. In these cases, explicit expressions for the total energy and total momentum for all solutions are obtained as well. The derivation of the solutions uses the conservation laws combined with an energy analysis argument to reduce the wave equation directly to a separable first-order differential equation that determines the wave amplitude in terms of the traveling wave variable. This method can be applied more generally to other highly nonlinear wave equations.

  11. Secretion of an immunoreactive single-chain variable fragment antibody against mouse interleukin 6 by Lactococcus lactis.

    Science.gov (United States)

    Shigemori, Suguru; Ihara, Masaki; Sato, Takashi; Yamamoto, Yoshinari; Nigar, Shireen; Ogita, Tasuku; Shimosato, Takeshi

    2017-01-01

    Interleukin 6 (IL-6) is an important pathogenic factor in development of various inflammatory and autoimmune diseases and cancer. Blocking antibodies against molecules associated with IL-6/IL-6 receptor signaling are an attractive candidate for the prevention or therapy of these diseases. In this study, we developed a genetically modified strain of Lactococcus lactis secreting a single-chain variable fragment antibody against mouse IL-6 (IL6scFv). An IL6scFv-secretion vector was constructed by cloning an IL6scFv gene fragment into a lactococcal secretion plasmid and was electroporated into L. lactis NZ9000 (NZ-IL6scFv). Secretion of recombinant IL6scFv (rIL6scFv) by nisin-induced NZ-IL6scFv was confirmed by western blotting and was optimized by tuning culture conditions. We found that rIL6scFv could bind to commercial recombinant mouse IL-6. This result clearly demonstrated the immunoreactivity of rIL6scFv. This is the first study to engineer a genetically modified strain of lactic acid bacteria (gmLAB) that produces a functional anti-cytokine scFv. Numerous previous studies suggested that mucosal delivery of biomedical proteins using gmLAB is an effective and low-cost way to treat various disorders. Therefore, NZ-IL6scFv may be an attractive tool for the research and development of new IL-6 targeting agents for various inflammatory and autoimmune diseases as well as for cancer.

  12. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  13. Controlled radical copolymerization of styrene and maleic anhydride and the synthesis of novel polyolefin-based block copolymers by reversible addition-fragmentation chain-transfer (RAFT) polymerization

    NARCIS (Netherlands)

    Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.

    2000-01-01

    Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.

  14. Synthesis of butyl acrylate-styrene block copolymers in emulsion by reversible addition-fragmentation chain transfer : effect of surfactant migration upon film formation

    NARCIS (Netherlands)

    Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.

    2000-01-01

    The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio

  15. Production of bifunctional proteins by Aspergillus awamori: Llama variable heavy chain antibody fragment (V-HH) R9 coupled to Arthromyces ramosus peroxidase (ARP)

    NARCIS (Netherlands)

    Joosten, V.; Roelofs, M.S.; Dries, van den N.; Goosen, T.; Verrips, C.T.; Hondel, van den C.A.M.J.J.; Lokman, B.C.

    2005-01-01

    The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5'- or 3'-terminal ends of the gene encoding llama variable heavy chain antibody fragment V-HH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which

  16. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  17. Production of bifunctional proteins by Aspergillus awamori: Llama variable heavy chain antibody fragment (VHH) R9 coupled to Arthromyces ramosus peroxidase (ARP)

    NARCIS (Netherlands)

    Joosten, V.; Roelofs, M.S.; Dries, N. van den; Goosen, T.; Verrips, C.T.; Hondel, C.A.M.J.J. van den; Lokman, B.C.

    2005-01-01

    The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5′- or 3′-terminal ends of the gene encoding llama variable heavy chain antibody fragment VHH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which

  18. Development of single chain variable fragment (scFv) antibodies against Xylella fastidiosa subsp. pauca by phage display.

    Science.gov (United States)

    Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John

    2015-10-01

    Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. Published by Elsevier B.V.

  19. Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)

    2017-03-23

    Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.

  20. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  1. A guide to the synthesis of block copolymers using reversible-addition fragmentation chain transfer (RAFT) polymerization.

    Science.gov (United States)

    Keddie, Daniel J

    2014-01-21

    The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.

  2. Single chain variable fragment antibodies block aggregation and toxicity induced by familial ALS-linked mutant forms of SOD1.

    Science.gov (United States)

    Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P

    2013-08-01

    Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    Science.gov (United States)

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  4. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  5. Scale-up of the Reversible Addition-Fragmentation Chain Transfer (RAFT Polymerization Using Continuous Flow Processing

    Directory of Open Access Journals (Sweden)

    Nenad Micic

    2014-01-01

    Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.

  6. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  7. High production of llama variable heavy-chain antibody fragment (VHH) fused to various reader proteins by Aspergillus oryzae.

    Science.gov (United States)

    Hisada, Hiromoto; Tsutsumi, Hiroko; Ishida, Hiroki; Hata, Yoji

    2013-01-01

    Llama variable heavy-chain antibody fragment (VHH) fused to four different reader proteins was produced and secreted in culture medium by Aspergillus oryzae. These fusion proteins consisted of N-terminal reader proteins, VHH, and a C-terminal his-tag sequence which facilitated purification using one-step his-tag affinity chromatography. SDS-PAGE analysis of the deglycosylated purified fusion proteins confirmed that the molecular weight of each corresponded to the expected sum of VHH and the respective reader proteins. The apparent high molecular weight reader protein glucoamylase (GlaB) was found to be suitable for efficient VHH production. The GlaB-VHH-His protein bound its antigen, human chorionic gonadotropin, and was detectable by a new ELISA-based method using a coupled assay with glucoamylase, glucose oxidase, peroxidase, maltose, and 3,3',5,5'-tetramethylbenzidine as substrates. Addition of potassium phosphate to the culture medium induced secretion of 0.61 mg GlaB-VHH-His protein/ml culture medium in 5 days.

  8. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  9. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  10. A 19-kDa C-terminal tryptic fragment of the α chain of Na/K-ATPase is essential for occlusion and transport of cations

    International Nuclear Information System (INIS)

    Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.

    1990-01-01

    Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein

  11. A 19-kDa C-terminal tryptic fragment of the. alpha. chain of Na/K-ATPase is essential for occlusion and transport of cations

    Energy Technology Data Exchange (ETDEWEB)

    Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))

    1990-06-01

    Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.

  12. Expression and purification of a novel therapeutic single-chain variable fragment antibody against BNP from inclusion bodies of Escherichia coli.

    Science.gov (United States)

    Bu, Dawei; Zhou, Yuwei; Tang, Jian; Jing, Fang; Zhang, Wei

    2013-12-01

    Abnormal brain natriuretic peptide (BNP) secretion is regarded as the dominating mechanism of cerebral salt wasting syndrome (CSW), which results from a renal loss of sodium and water during intracranial disease leading to hyponatremia. Scale preparation of therapeutic single-chain variable fragment (scFv) that can neutralize elevated circulating BNP may have potential value for clinical use. In this report, we used a recently isolated humanized anti-BNP scFv fragment (3C1) as model antibody (Ab) to evaluate the potential of scale production of this therapeutic protein. The truncated gene encoding for scFv fragment cloned in pET22b (+) was mainly overexpressed as inclusion bodies in Escherichia coli (E. coli) Rosetta (DE3) pLysS cells. The insoluble fragment was solubilized and purified by Ni-NTA agarose resin under denaturation conditions, and recovered via an effective refolding buffer containing 50 mM Tris-HCl, pH 8.0, 0.15 M NaCl, 1 mM EDTA, 0.5 M arginine, 2 mM GSH, 1 mM GSSG, and 5% glycerol. The refolded scFv fragment was concentrated by PEG20000, and dialyzed in PBS (containing 5% glycerol, pH 7.4). The final yield was approximately 10.2 mg active scFv fragment per liter of culture (3.4 g wet weight cells). The scFv fragment was more than 95% pure assessed by SDS-PAGE assay. Recombinant scFv fragment with His tag displayed its immunoreactivity with anti-His tag Ab by western blotting. ELISA showed the scFv fragment specifically bound to BNP, and it displayed similar activity as the traditional anti-BNP monoclonal Ab (mAb). Thus, the current strategy allows convenient small-scale production of this therapeutic protein. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Mapping absorption processes onto a Markov chain, conserving the mean first passage time

    International Nuclear Information System (INIS)

    Biswas, Katja

    2013-01-01

    The dynamics of a multidimensional system is projected onto a discrete state master equation using the transition rates W(k → k′; t, t + dt) between a set of states {k} represented by the regions {ζ k } in phase or discrete state space. Depending on the dynamics Γ i (t) of the original process and the choice of ζ k , the discretized process can be Markovian or non-Markovian. For absorption processes, it is shown that irrespective of these properties of the projection, a master equation with time-independent transition rates W-bar (k→k ' ) can be obtained, which conserves the total occupation time of the partitions of the phase or discrete state space of the original process. An expression for the transition probabilities p-bar (k ' |k) is derived based on either time-discrete measurements {t i } with variable time stepping Δ (i+1)i = t i+1 − t i or the theoretical knowledge at continuous times t. This allows computational methods of absorbing Markov chains to be used to obtain the mean first passage time (MFPT) of the system. To illustrate this approach, the procedure is applied to obtain the MFPT for the overdamped Brownian motion of particles subject to a system with dichotomous noise and the escape from an entropic barrier. The high accuracy of the simulation results confirms with the theory. (paper)

  14. A single-chain variable fragment intrabody prevents intracellular polymerization of Z α1-antitrypsin while allowing its antiproteinase activity.

    Science.gov (United States)

    Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A; Motamedi-Shad, Neda; Irving, James A; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J; Miranda, Elena; Lomas, David A

    2015-06-01

    Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin. © FASEB.

  15. A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Shuli [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Nanjing Affiliated First Hospital, Nanjing Medical University, Nanjing (China); Zhao, Guangfeng; Xie, Hao; Huang, Yahong [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Hou, Yayi [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing (China)

    2012-01-27

    Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex){sub 1.3}(DOX){sub 20}. In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers.

  16. A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth

    International Nuclear Information System (INIS)

    Zhao, Shuli; Zhao, Guangfeng; Xie, Hao; Huang, Yahong; Hou, Yayi

    2012-01-01

    Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex) 1.3 (DOX) 20 . In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers

  17. Efficient heterologous expression and secretion in Aspergillus oryzae of a llama variable heavy-chain antibody fragment V(HH) against EGFR.

    Science.gov (United States)

    Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

    2012-10-01

    We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.

  18. Development of anti-bovine IgA single chain variable fragment and its application in diagnosis of foot-and-mouth disease

    Science.gov (United States)

    Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran

    2014-01-01

    Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404

  19. Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains

    OpenAIRE

    Sabater, Carlos; Untiedt, Carlos; van Ruitenbeek, Jan M

    2015-01-01

    This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a ‘Berry force’. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high volta...

  20. Modeling the dispersion of atelines (primates, atelinae) through scenarios of climate change and habitat fragmentation in Colombia. Conservation implications for the persistence of species into the future

    OpenAIRE

    Burbano- Girón, Jaime

    2013-01-01

    Abstract. Prioritizing landscape connectivity is a primary objective in the conservation planning of biodiversity, since it is assumed that there will be scenarios where the dispersal of species would be necessary due to habitat fragmentation and climate change. Atelines (Primates, Atelinae) include species of Spider Monkeys (Ateles spp.) and Woolly monkeys (Lagothrix spp.); primates with great importance for the tropical forest ecosystems where they inhabit because of their role as seed disp...

  1. Non-conserved magnetization operator and 'fire-and-ice' ground states in the Ising-Heisenberg diamond chain

    Science.gov (United States)

    Torrico, Jordana; Ohanyan, Vadim; Rojas, Onofre

    2018-05-01

    We consider the diamond chain with S = 1/2 XYZ vertical dimers which interact with the intermediate sites via the interaction of the Ising type. We also suppose all four spins form the diamond-shaped plaquette to have different g-factors. The non-uniform g-factors within the quantum spin dimer as well as the XY-anisotropy of the exchange interaction lead to the non-conserving magnetization for the chain. We analyze the effects of non-conserving magnetization as well as the effects of the appearance of negative g-factors among the spins from the unit cell. A number of unusual frustrated states for ferromagnetic couplings and g-factors with non-uniform signs are found out. These frustrated states generalize the "half-fire-half-ice" state introduced in reference Yin et al. (2015). The corresponding zero-temperature ground state phase diagrams are presented.

  2. Implications of Fine-Grained Habitat Fragmentation and Road Mortality for Jaguar Conservation in the Atlantic Forest, Brazil.

    Directory of Open Access Journals (Sweden)

    Laury Cullen

    Full Text Available Jaguar (Panthera onca populations in the Upper Paraná River, in the Brazilian Atlantic Forest region, live in a landscape that includes highly fragmented areas as well as relatively intact ones. We developed a model of jaguar habitat suitability in this region, and based on this habitat model, we developed a spatially structured metapopulation model of the jaguar populations in this area to analyze their viability, the potential impact of road mortality on the populations' persistence, and the interaction between road mortality and habitat fragmentation. In more highly fragmented populations, density of jaguars per unit area is lower and density of roads per jaguar is higher. The populations with the most fragmented habitat were predicted to have much lower persistence in the next 100 years when the model included no dispersal, indicating that the persistence of these populations are dependent to a large extent on dispersal from other populations. This, in turn, indicates that the interaction between road mortality and habitat fragmentation may lead to source-sink dynamics, whereby populations with highly fragmented habitat are maintained only by dispersal from populations with less fragmented habitat. This study demonstrates the utility of linking habitat and demographic models in assessing impacts on species living in fragmented landscapes.

  3. Implications of Fine-Grained Habitat Fragmentation and Road Mortality for Jaguar Conservation in the Atlantic Forest, Brazil.

    Science.gov (United States)

    Cullen, Laury; Stanton, Jessica C; Lima, Fernando; Uezu, Alexandre; Perilli, Miriam L L; Akçakaya, H Reşit

    2016-01-01

    Jaguar (Panthera onca) populations in the Upper Paraná River, in the Brazilian Atlantic Forest region, live in a landscape that includes highly fragmented areas as well as relatively intact ones. We developed a model of jaguar habitat suitability in this region, and based on this habitat model, we developed a spatially structured metapopulation model of the jaguar populations in this area to analyze their viability, the potential impact of road mortality on the populations' persistence, and the interaction between road mortality and habitat fragmentation. In more highly fragmented populations, density of jaguars per unit area is lower and density of roads per jaguar is higher. The populations with the most fragmented habitat were predicted to have much lower persistence in the next 100 years when the model included no dispersal, indicating that the persistence of these populations are dependent to a large extent on dispersal from other populations. This, in turn, indicates that the interaction between road mortality and habitat fragmentation may lead to source-sink dynamics, whereby populations with highly fragmented habitat are maintained only by dispersal from populations with less fragmented habitat. This study demonstrates the utility of linking habitat and demographic models in assessing impacts on species living in fragmented landscapes.

  4. Study of behavior incentive mechanism of energy conservation and emission reduction for China freshwater live fish supply chain

    Directory of Open Access Journals (Sweden)

    Liming Chen

    2016-02-01

    Full Text Available Purpose: The purpose of this paper investigates the subject behavior of Energy conservation and emission reduction (ECER based on structured classification of the organization types of FLF supply chain, and explores reasonable behavior incentive mechanism for ECER of FLF supply chain in China. Design/methodology/approach: This paper classifies the organization subjects of FLF supply chain, and different characteristics of organization subjects are compared in detail. ECER behavior incentive mechanism modeling of FLF supply chain is explored by taking advantage of principal-agent model in view of asymmetry information. Incentives issue of different operating subjects is discussed as enlightenment of the model. Findings: Three types of the organization subjects of FLF supply chain in China have been identified as: loose organization, semi-compact organization and compact organization.Subjects of different types have different abilities to conduct ECER work. Government needs to propose differentiation polices of incentive compensation for different operating subjects, widen the gap of differentiated subsidies/rewards for different investment levels on ECER conducted by different operating subjects of FLF supply chain. Research limitations/implications: It will take long-term unremitting efforts to achieve the target of ECER work for FLF supply chain in China, the dynamic issues and simulation modeling on behavior incentive mechanism of ECER should be developed in future research. Practical implications: Clear understanding of structured classification of the organization subject types of FLF supply chain and the behavior incentive mechanism for ECER, will help government to improve the ECER work in an efficient and effective way. Originality/value: Research to behavior incentive mechanism of ECER has important theoretical value and practical significance. This paper contributes to distinguish three types of operating subjects of FLF supply chain in

  5. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  6. Study of behavior incentive mechanism of energy conservation and emission reduction for China freshwater live fish supply chain

    Energy Technology Data Exchange (ETDEWEB)

    Liming, C.; Fengjun, L.; Xiaohong, L.

    2016-07-01

    The purpose of this paper investigates the subject behavior of Energy conservation and emission reduction (ECER) based on structured classification of the organization types of FLF supply chain, and explores reasonable behavior incentive mechanism for ECER of FLF supply chain in China. Design/methodology/approach: This paper classifies the organization subjects of FLF supply chain, and different characteristics of organization subjects are compared in detail. ECER behavior incentive mechanism modeling of FLF supply chain is explored by taking advantage of principal-agent model in view of asymmetry information. Incentives issue of different operating subjects is discussed as enlightenment of the model. Findings: Three types of the organization subjects of FLF supply chain in China have been identified as: loose organization, semi-compact organization and compact organization.Subjects of different types have different abilities to conduct ECER work. Government needs to propose differentiation polices of incentive compensation for different operating subjects, widen the gap of differentiated subsidies/rewards for different investment levels on ECER conducted by different operating subjects of FLF supply chain. Research limitations/implications: It will take long-term unremitting efforts to achieve the target of ECER work for FLF supply chain in China, the dynamic issues and simulation modeling on behavior incentive mechanism of ECER should be developed in future research. Practical implications: Clear understanding of structured classification of the organization subject types of FLF supply chain and the behavior incentive mechanism for ECER, will help government to improve the ECER work in an efficient and effective way... (Author)

  7. Ten-Year Follow-Up of a Fragment Reattachment to an Anterior Tooth: A Conservative Approach.

    Science.gov (United States)

    Mendes, Luiz; Laxe, Laisa; Passos, Leandro

    2017-01-01

    This report describes the 10-year follow-up data of a patient who underwent fragment reattachment to the maxillary central incisor after coronal fracture with pulp exposure as well as the procedures followed for functional and esthetic adjustments. A 9-year-old female patient presented at the clinic of dentistry at the State University of Rio de Janeiro with a coronal fracture and pulp exposure of the right maxillary central incisor that had occurred immediately after an accident. The intact tooth fragment was recovered at the accident site and stored in milk. The treatment plan followed was to perform direct pulp capping and tooth fragment reattachment. When the patient was 14 years old, adhesion between fragment and remaining tooth was lost, and fragment reattachment was performed. Five years later, the same tooth presented clinical discoloration and absence of sensitivity during pulp vitality tests. Subsequently, a new treatment plan was formulated, which included endodontic treatment, followed by nonvital tooth bleaching and light-cured composite resin restoration. An esthetic and natural-looking restoration was achieved. Tooth fragment reattachment is not a temporary restorative technique and requires functional and esthetic adjustments over time to maintain the biomimetic characteristics of traumatized anterior teeth and predictable outcomes.

  8. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  9. Conservation

    NARCIS (Netherlands)

    Noteboom, H.P.

    1985-01-01

    The IUCN/WWF Plants Conservation Programme 1984 — 1985. World Wildlife Fund chose plants to be the subject of their fund-raising campaign in the period 1984 — 1985. The objectives were to: 1. Use information techniques to achieve the conservation objectives of the Plants Programme – to save plants;

  10. Conservation.

    Science.gov (United States)

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  11. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  12. Untranslatable tospoviral NSs fragment coupled with L conserved region enhances transgenic resistance against the homologous virus and a serologically unrelated tospovirus.

    Science.gov (United States)

    Yazhisai, Uthaman; Rajagopalan, Prem Anand; Raja, Joseph A J; Chen, Tsung-Chi; Yeh, Shyi-Dong

    2015-08-01

    Tospoviruses cause severe damages to important crops worldwide. In this study, Nicotiana benthamiana transgenic lines carrying individual untranslatable constructs comprised of the conserved region of the L gene (denoted as L), the 5' half of NSs coding sequence (NSs) or the antisense fragment of whole N coding sequence (N) of Watermelon silver mottle virus (WSMoV), individually or in combination, were generated. A total of 15-17 transgenic N. benthamiana lines carrying individual transgenes were evaluated against WSMoV and the serologically unrelated Tomato spotted wilt virus (TSWV). Among lines carrying single or chimeric transgenes, the level of resistance ranged from susceptible to completely resistant against WSMoV. From the lines carrying individual transgenes and highly resistant to WSMoV (56-63% of lines assayed), 30% of the L lines (3/10 lines assayed) and 11% of NSs lines (1/9 lines assayed) were highly resistant against TSWV. The chimeric transgenes provided higher degrees of resistance against WSMoV (80-88%), and the NSs fragment showed an additive effect to enhance the resistance to TSWV. Particularly, the chimeric transgenes with the triple combination of fragments, namely L/NSs/N or HpL/NSs/N (a hairpin construct), provided a higher degree of resistance (both 50%, with 7/14 lines assayed) against TSWV. Our results indicate that the untranslatable NSs fragment is able to enhance the transgenic resistance conferred by the L conserved region. The better performance of L/NSs/N and HpL/NSs/N in transgenic N. benthamiana lines suggests their potential usefulness in generating high levels of enhanced transgenic resistance against serologically unrelated tospoviruses in agronomic crops.

  13. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  14. Abundance and fragmentation patterns of the ecosystem engineer Lithophyllum byssoides (Lamarck) Foslie along the Iberian Peninsula Atlantic coast. Conservation and management implications

    Science.gov (United States)

    Veiga, Puri; Rubal, Marcos; Cacabelos, Eva; Moreira, Juan; Sousa-Pinto, Isabel

    2013-10-01

    The crustose calcareous red macroalgae Lithophyllum byssoides (Lamarck) Foslie is a common ecosystem engineer along the Atlantic and Mediterranean coast of the Iberian Peninsula. This species is threatened by several anthropogenic impacts acting at different spatial scales, such as pollution or global warming. The aim of this study is to identify scales of spatial variation in the abundance and fragmentation patterns of L. byssoides along the Atlantic coast of the Iberian Peninsula. For this aim we used a hierarchical sampling design considering four spatial scales (from metres to 100s of kilometres). Results of the present study indicated no significant variability among regions investigated whereas significant variability was found at the scales of shore and site in spatial patterns of abundance and fragmentation of L. byssoides. Variance components were higher at the spatial scale of shore for abundance and fragmentation of L. byssoides with the only exception of percentage cover and thus, processes acting at the scale of 10s of kilometres seem to be more relevant in shaping the spatial variability both in abundance and fragmentation of L. byssoides. These results provided quantitative estimates of abundance and fragmentation of L. byssoides at the Atlantic coast of the Iberian Peninsula establishing the observational basis for future assessment, monitoring and experimental investigations to identify the processes and anthropogenic impacts affecting L. byssoides populations. Finally we have also identified percentage cover and patch density as the best variables for long-term monitoring programs aimed to detect future anthropogenic impacts on L. byssoides. Therefore, our results have important implications for conservation and management of this valuable ecosystem engineer along the Atlantic coast of the Iberian Peninsula.

  15. Chain and independent fission product yields adjusted to conform with physical conservation laws. Part 2

    International Nuclear Information System (INIS)

    Crouch, E.A.C.

    1976-01-01

    Previously reported adjustments to the chain yields and independent yields for the thermal neutron induced fission of 233 U, 235 U, 239 Pu and 241 Pu, the fast neutron induced fission of 232 Th, 233 U, 235 U, 238 U, 239 Pu, 240 Pu and 241 Pu, and the 14 MeV neutron induced fission of 232 Th, 233 U, 235 U and 238 U, have been recalculated using the principle of least squares. The adjustments to the chain yields so found are much smaller than those previously reported. (author)

  16. Gamma-irradiation of homodeoxyoligonucleotides 32P-labelled at one end: computer simulation of the chain length distribution of the radioactive fragments

    International Nuclear Information System (INIS)

    Teoule, R.; Duplaa, A.M.

    1987-01-01

    Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)

  17. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  18. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  19. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  20. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  1. Lack of a 5.9 kDa peptide C-terminal fragment of fibrinogen α chain precedes fibrosis progression in patients with liver disease.

    Directory of Open Access Journals (Sweden)

    Santiago Marfà

    Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.

  2. Conserved peptide fragmentation as a benchmarking tool for mass spectrometers and a discriminating feature for targeted proteomics.

    Science.gov (United States)

    Toprak, Umut H; Gillet, Ludovic C; Maiolica, Alessio; Navarro, Pedro; Leitner, Alexander; Aebersold, Ruedi

    2014-08-01

    Quantifying the similarity of spectra is an important task in various areas of spectroscopy, for example, to identify a compound by comparing sample spectra to those of reference standards. In mass spectrometry based discovery proteomics, spectral comparisons are used to infer the amino acid sequence of peptides. In targeted proteomics by selected reaction monitoring (SRM) or SWATH MS, predetermined sets of fragment ion signals integrated over chromatographic time are used to identify target peptides in complex samples. In both cases, confidence in peptide identification is directly related to the quality of spectral matches. In this study, we used sets of simulated spectra of well-controlled dissimilarity to benchmark different spectral comparison measures and to develop a robust scoring scheme that quantifies the similarity of fragment ion spectra. We applied the normalized spectral contrast angle score to quantify the similarity of spectra to objectively assess fragment ion variability of tandem mass spectrometric datasets, to evaluate portability of peptide fragment ion spectra for targeted mass spectrometry across different types of mass spectrometers and to discriminate target assays from decoys in targeted proteomics. Altogether, this study validates the use of the normalized spectral contrast angle as a sensitive spectral similarity measure for targeted proteomics, and more generally provides a methodology to assess the performance of spectral comparisons and to support the rational selection of the most appropriate similarity measure. The algorithms used in this study are made publicly available as an open source toolset with a graphical user interface. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The rediscovery of industrial dynamics: the contribution of system dynamics to supply chain management in a dynamic and fragmented world

    NARCIS (Netherlands)

    Akkermans, H.A.; Dellaert, N.P.

    2005-01-01

    The field of supply chain management (SCM) almost started with the publication of Forrester's Industrial Dynamics, but it seems that the relevance of this seminal publication for the field of system dynamics has never been so relevant for the field of SCM than today. In this introduction to the

  4. IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

    Science.gov (United States)

    Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

    2017-06-26

    IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino

  5. Population Genetic Patterns of Threatened European Mudminnow (Umbra krameri Walbaum, 1792 in a Fragmented Landscape: Implications for Conservation Management.

    Directory of Open Access Journals (Sweden)

    Péter Takács

    Full Text Available The European mudminnow (Umbra krameri is a Middle Danubian endemic fish species, which is characterised by isolated populations living mainly in artificial habitats in the centre of its range, in the Carpathian Basin. For their long term preservation, reliable information is needed about the structure of stocks and the level of isolation. The recent distribution pattern, and the population genetic structure within and among regions were investigated to designate the Evolutionary Significant, Conservation and Management Units (ESUs, CUs, MUs and to explore the conservation biological value of the shrinking populations. In total, eight microsatellite loci were studied in 404 specimens originating from eight regions. The results revealed a pronounced population structure, where strictly limited gene flow was detected among regions, as well as various strengths of connections within regions. Following the results of hierarchical structure analyses, two ESUs were supposed in the Carpathian Basin, corresponding to the Danube and Tisza catchments. Our results recommend designating the borders of CUs in an 80-90km range and 16 clusters should be set up as MUs for the 33 investigated populations. How these genetic findings can be used to better allocate conservation resources for the long term maintenance of the metapopulation structure of this threathened endemic fish is discussed.

  6. Branched-chain amino acid catabolism is a conserved regulator of physiological ageing.

    Science.gov (United States)

    Mansfeld, Johannes; Urban, Nadine; Priebe, Steffen; Groth, Marco; Frahm, Christiane; Hartmann, Nils; Gebauer, Juliane; Ravichandran, Meenakshi; Dommaschk, Anne; Schmeisser, Sebastian; Kuhlow, Doreen; Monajembashi, Shamci; Bremer-Streck, Sibylle; Hemmerich, Peter; Kiehntopf, Michael; Zamboni, Nicola; Englert, Christoph; Guthke, Reinhard; Kaleta, Christoph; Platzer, Matthias; Sühnel, Jürgen; Witte, Otto W; Zarse, Kim; Ristow, Michael

    2015-12-01

    Ageing has been defined as a global decline in physiological function depending on both environmental and genetic factors. Here we identify gene transcripts that are similarly regulated during physiological ageing in nematodes, zebrafish and mice. We observe the strongest extension of lifespan when impairing expression of the branched-chain amino acid transferase-1 (bcat-1) gene in C. elegans, which leads to excessive levels of branched-chain amino acids (BCAAs). We further show that BCAAs reduce a LET-363/mTOR-dependent neuro-endocrine signal, which we identify as DAF-7/TGFβ, and that impacts lifespan depending on its related receptors, DAF-1 and DAF-4, as well as ultimately on DAF-16/FoxO and HSF-1 in a cell-non-autonomous manner. The transcription factor HLH-15 controls and epistatically synergizes with BCAT-1 to modulate physiological ageing. Lastly and consistent with previous findings in rodents, nutritional supplementation of BCAAs extends nematodal lifespan. Taken together, BCAAs act as periphery-derived metabokines that induce a central neuro-endocrine response, culminating in extended healthspan.

  7. Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Patrícia Carvalho de Sequeira

    2005-11-01

    Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  8. Generation of high-affinity, internalizing anti-FGFR2 single-chain variable antibody fragment fused with Fc for targeting gastrointestinal cancers.

    Science.gov (United States)

    Borek, Aleksandra; Sokolowska-Wedzina, Aleksandra; Chodaczek, Grzegorz; Otlewski, Jacek

    2018-01-01

    Fibroblast growth factor receptors (FGFRs) are promising targets for antibody-based cancer therapies, as their substantial overexpression has been found in various tumor cells. Aberrant activation of FGF receptor 2 (FGFR2) signaling through overexpression of FGFR2 and/or its ligands, mutations, or receptor amplification has been reported in multiple cancer types, including gastric, colorectal, endometrial, ovarian, breast and lung cancer. In this paper, we describe application of the phage display technology to produce a panel of high affinity single chain variable antibody fragments (scFvs) against the extracellular ligand-binding domain of FGFR2 (ECD_FGFR2). The binders were selected from the human single chain variable fragment scFv phage display libraries Tomlinson I + J and showed high specificity and binding affinity towards human FGFR2 with nanomolar KD values. To improve the affinity of the best binder selected, scFvF7, we reformatted it to a bivalent diabody format, or fused it with the Fc region (scFvF7-Fc). The scFvF7-Fc antibody construct presented the highest affinity for FGFR2, with a KD of 0.76 nM, and was selectively internalized into cancer cells overexpressing FGFR2, Snu-16 and NCI-H716. Finally, we prepared a conjugate of scFvF7-Fc with the cytotoxic drug monomethyl-auristatin E (MMAE) and evaluated its cytotoxicity. The conjugate delivered MMAE selectively to FGFR2-positive tumor cells. These results indicate that scFvF7-Fc-vcMMAE is a highly potent molecule for the treatment of cancers with FGFR2 overexpression.

  9. Screening for single-chain variable fragment antibodies against multiple Cry1 toxins from an immunized mouse phage display antibody library.

    Science.gov (United States)

    Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin

    2018-04-01

    Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7  CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.

  10. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  11. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  12. Single Chain Variable Fragments Produced in Escherichia coli against Heat-Labile and Heat-Stable Toxins from Enterotoxigenic E. coli.

    Directory of Open Access Journals (Sweden)

    Christiane Y Ozaki

    Full Text Available Diarrhea is a prevalent pathological condition frequently associated to the colonization of the small intestine by enterotoxigenic Escherichia coli (ETEC strains, known to be endemic in developing countries. These strains can produce two enterotoxins associated with the manifestation of clinical symptoms that can be used to detect these pathogens. Although several detection tests have been developed, minimally equipped laboratories are still in need of simple and cost-effective methods. With the aim to contribute to the development of such diagnostic approaches, we describe here two mouse hybridoma-derived single chain fragment variable (scFv that were produced in E. coli against enterotoxins of ETEC strains.Recombinant scFv were developed against ETEC heat-labile toxin (LT and heat-stable toxin (ST, from previously isolated hybridoma clones. This work reports their design, construction, molecular and functional characterization against LT and ST toxins. Both antibody fragments were able to recognize the cell-interacting toxins by immunofluorescence, the purified toxins by ELISA and also LT-, ST- and LT/ST-producing ETEC strains.The developed recombinant scFvs against LT and ST constitute promising starting point for simple and cost-effective ETEC diagnosis.

  13. Distribution of nuclear charge and angular momentum in chains 132-137, 99, and 102 of thermal neutron fission of 235U at various kinetic energies and charge states of the fragments

    International Nuclear Information System (INIS)

    Denschlag, H.O.; Braun, H.; Wolfsberg, K.

    1979-01-01

    The fission product yields of the members of the decay chains 132 to 137, 99, and 102 in 235 U(n/sub th/,f) were measured at various kinetic energies and ionic charge states of the fragments using the mass separator for unslowed fission products LOHENGRIN. The results are discussed with respect to four aspects: A preferential formation of neutron rich chain members found at high kinetic energy of the fragments is predominantly due to decreasing prompt neutron evaporation. A particularly large effect in chain 132 is attributed to the double shell closure in Sn-132. The persistence of an even-odd pairing effect in the yields throughout the range of kinetic energies studied leads to the conclusion that the high internal excitation energy of the fragments is tied up mainly in the form of collective energy (e.g., deformation energy) rather than single particle excitation. Generally, the yield distribution at constant kinetic energy is invariant with respect to the ionic charge state of the isotopes separated. Deviations from this behavior found in chains 99, 102, 133, and 136 are interpreted as being due to Auger events following a converted transition in the decay of ns-isomers taking place in the vacuum of the separator. A pronounced variation of the independent formation ratio of single isomeric states with the kinetic energy of the fragments is providing direct information on the controversial topic of the change of angular momentum of fission fragments as a function of deformation (scission distance). 34 references

  14. Selection and Characterization of Single Chain Antibody Fragments Specific for Hsp90 as a Potential Cancer Targeting Molecule

    Directory of Open Access Journals (Sweden)

    Edyta Petters

    2015-08-01

    Full Text Available Heat shock proteins play an essential role in facilitating malignant transformation and they have been recognized as important factors in human cancers. One of the key elements of the molecular chaperones machinery is Hsp90 and it has recently become a target for anticancer therapeutic approaches. The potential and importance of Hsp90-directed agents becomes apparent when one realizes that disruption of Hsp90 function may influence over 200 oncogenic client proteins. Here, we described the selection and characterization of Hsp90-specific antibody fragments from commercially available Tomlinson I and J phage display libraries. The affinities of Hsp90-binding scFv variants were measured using SPR method. Then, based on the best clone selected, we performed the affinity maturation procedure and obtained valuable Hsp90-specific clones. The selected binders were expressed and applied for immunostaining, ELISA and SPR analysis using model cancer cell lines. All performed experiments confirmed the ability of selected antibodies to interact with the Hsp90. Therefore, the presented Hsp90-specific scFv, might be a starting point for the development of a novel antibody-based strategy targeting cancer.

  15. Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains.

    Science.gov (United States)

    Sabater, Carlos; Untiedt, Carlos; van Ruitenbeek, Jan M

    2015-01-01

    This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a 'Berry force'. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high voltage appears to behave as expected for regular break down by thermal excitation due to Joule heating. However, there is a low-voltage breaking mode that has characteristics expected for the mechanism of current-induced forces. Although a full comparison would require more detailed information on the individual atomic configurations, the systems we consider are very similar to those considered in recent model calculations and the comparison between experiment and theory is very encouraging for the interpretation we propose.

  16. Evidence for non-conservative current-induced forces in the breaking of Au and Pt atomic chains

    Directory of Open Access Journals (Sweden)

    Carlos Sabater

    2015-12-01

    Full Text Available This experimental work aims at probing current-induced forces at the atomic scale. Specifically it addresses predictions in recent work regarding the appearance of run-away modes as a result of a combined effect of the non-conservative wind force and a ‘Berry force’. The systems we consider here are atomic chains of Au and Pt atoms, for which we investigate the distribution of break down voltage values. We observe two distinct modes of breaking for Au atomic chains. The breaking at high voltage appears to behave as expected for regular break down by thermal excitation due to Joule heating. However, there is a low-voltage breaking mode that has characteristics expected for the mechanism of current-induced forces. Although a full comparison would require more detailed information on the individual atomic configurations, the systems we consider are very similar to those considered in recent model calculations and the comparison between experiment and theory is very encouraging for the interpretation we propose.

  17. Analysis of the supply chain and conservation status of sharks (Elasmobranchii: Superorder Selachimorpha) based on fisher knowledge.

    Science.gov (United States)

    Martins, Ana Paula Barbosa; Feitosa, Leonardo Manir; Lessa, Rosangela Paula; Almeida, Zafira Silva; Heupel, Michelle; Silva, Wagner Macedo; Tchaicka, Ligia; Nunes, Jorge Luiz Silva

    2018-01-01

    Increasing fishing effort has caused declines in shark populations worldwide. Understanding biological and ecological characteristics of sharks is essential to effectively implement management measures, but to fully understand drivers of fishing pressure social factors must be considered through multidisciplinary and integrated approaches. The present study aimed to use fisher and trader knowledge to describe the shark catch and product supply chain in Northeastern Brazil, and evaluate perceptions regarding the regional conservation status of shark species. Non-systematic observations and structured individual interviews were conducted with experienced fishers and traders. The demand and economic value of shark fins has reportedly decreased over the last 10 years while the shark meat trade has increased slightly, including a small increase in the average price per kilogram of meat. Several threatened shark species were reportedly often captured off shore and traded at local markets. This reported and observed harvest breaches current Brazilian environmental laws. Fishing communities are aware of population declines of several shark species, but rarely take action to avoid capture of sharks. The continuing capture of sharks is mainly due to a lack of knowledge of environmental laws, lack of enforcement by responsible authorities, and difficulties encountered by fishers in finding alternative income streams. National and regional conservation measures are immediately required to reduce overfishing on shark populations in Northeastern Brazil. Social and economic improvements for poor fishing communities must also be implemented to achieve sustainable fisheries.

  18. Analysis of the supply chain and conservation status of sharks (Elasmobranchii: Superorder Selachimorpha) based on fisher knowledge

    Science.gov (United States)

    Almeida, Zafira Silva; Heupel, Michelle; Silva, Wagner Macedo; Tchaicka, Ligia

    2018-01-01

    Increasing fishing effort has caused declines in shark populations worldwide. Understanding biological and ecological characteristics of sharks is essential to effectively implement management measures, but to fully understand drivers of fishing pressure social factors must be considered through multidisciplinary and integrated approaches. The present study aimed to use fisher and trader knowledge to describe the shark catch and product supply chain in Northeastern Brazil, and evaluate perceptions regarding the regional conservation status of shark species. Non-systematic observations and structured individual interviews were conducted with experienced fishers and traders. The demand and economic value of shark fins has reportedly decreased over the last 10 years while the shark meat trade has increased slightly, including a small increase in the average price per kilogram of meat. Several threatened shark species were reportedly often captured off shore and traded at local markets. This reported and observed harvest breaches current Brazilian environmental laws. Fishing communities are aware of population declines of several shark species, but rarely take action to avoid capture of sharks. The continuing capture of sharks is mainly due to a lack of knowledge of environmental laws, lack of enforcement by responsible authorities, and difficulties encountered by fishers in finding alternative income streams. National and regional conservation measures are immediately required to reduce overfishing on shark populations in Northeastern Brazil. Social and economic improvements for poor fishing communities must also be implemented to achieve sustainable fisheries. PMID:29534100

  19. The use of a cocktail of single chain Fv antibody fragments to improve the in vitro and in vivo targeting of melanoma

    International Nuclear Information System (INIS)

    Pacifico, M.D.; Pearl, R.A.; Kupsch, J.M.

    2006-01-01

    Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 1 25I odine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells

  20. Non-surface activity and micellization behavior of cationic amphiphilic block copolymer synthesized by reversible addition-fragmentation chain transfer process.

    Science.gov (United States)

    Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki

    2011-08-02

    Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.

  1. Falling chains

    OpenAIRE

    Wong, Chun Wa; Yasui, Kosuke

    2005-01-01

    The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is inco...

  2. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  3. Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

    2001-01-01

    A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

  4. Hydrogen-exchange kinetics of the indole NH proton of the buried tryptophan in the constant fragment of the immunoglobulin light chain

    International Nuclear Information System (INIS)

    Kawata, Y.; Goto, Y.; Hamaguchi, K.; Hayashi, F.; Kobayashi, Y.; Kyogoku, Y.

    1988-01-01

    The constant fragment of the immunoglobulin light chain (type λ) has two trytophyl residues at positions 150 and 187. Trp-150 is buried in the interior, and Trp-187 lies on the surface of the molecule. The hydrogen-deuterium exchange kinetics of the indole NH proton Trp-150 were studied at various pH values at 25 0 C by 1 H nuclear magnetic resonance. Exchange rates were approximately first order in hydroxyl ion dependence above pH 8, were relatively independent of pH between pH 7 and 8, and decreased below pH 7. On the assumption that the exchange above pH 8 proceeds through local fluctuations of the protein molecule, the exchange rates between pH 7 and 8 through global unfolding were estimated. The exchange rate constant within this pH range at 25 0 C thus estimated was consistent with that of the global unfolding of the constant fragment under the same conditions as those reported previously. The activation energy for the exchange process at pH 7.8 was the same as that for the unfolding process by 2 M guanidine hydrochloride. The exchange rates of backbone NH protons were almost the same as that of the indole NH proton of Trp-150 at pH 7.l. These observations also indicated that the exchange between pH 7 and 8 occurs through global unfolding of the protein molecule and is rate-limited by the unfolding. At around pH 9, on the other hand, the activation energy for the exchange process of the indole NH proton of Trp-150 was smaller than that for the unfolding process, and the exchange rates differed according to the different signals of backbone NH protons. These findings together with the pH dependence of the rate constant indicated that exchange due to local fluctuations is predominant above pH 8

  5. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  6. Thermally conductive, electrically insulating and melt-processable polystyrene/boron nitride nanocomposites prepared by in situ reversible addition fragmentation chain transfer polymerization

    International Nuclear Information System (INIS)

    Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi

    2015-01-01

    Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)

  7. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  8. Characterization of a single-chain variable fragment recognizing a linear epitope of aβ: a biotechnical tool for studies on Alzheimer's disease?

    Directory of Open Access Journals (Sweden)

    Silke Dornieden

    Full Text Available Alzheimer's disease (AD is a progressive neurodegenerative disorder with devastating effects. Currently, therapeutic options are limited to symptomatic treatment. For more than a decade, research focused on immunotherapy for the causal treatment of AD. However, clinical trials with active immunization using Aβ encountered severe complications, for example meningoencephalitis. Consequently, attention focused on passive immunization using antibodies. As an alternative to large immunoglobulins (IgGs, Aβ binding single-chain variable fragments (scFvs were used for diagnostic and therapeutic research approaches. scFvs can be expressed in E. coli and may provide improved pharmacokinetic properties like increased blood-brain barrier permeability or reduced side-effects in vivo. In this study, we constructed an scFv from an Aβ binding IgG, designated IC16, which binds the N-terminal region of Aβ (Aβ(1-8. scFv-IC16 was expressed in E. coli, purified and characterized with respect to its interaction with different Aβ species and its influence on Aβ fibril formation. We were able to show that scFv-IC16 strongly influenced the aggregation behavior of Aβ and could be applied as an Aβ detection probe for plaque staining in the brains of transgenic AD model mice. The results indicate potential for therapy and diagnosis of AD.

  9. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  10. Atrazine analysis using an amperometric immunosensor based on single-chain antibody fragments and regeneration-free multi-calibrant measurement

    International Nuclear Information System (INIS)

    Grennan, Kathleen; Strachan, Gillian; Porter, Andrew J.; Killard, Anthony J.; Smyth, Malcolm R.

    2003-01-01

    This work describes the development of an electrochemical immunosensor for the analysis of atrazine using recombinant single-chain antibody (scAb) fragments. The sensors are based on carbon paste screen-printed electrodes incorporating the conducting polymer polyaniline (PANI)/poly(vinylsulphonic acid) (PVSA), which enables direct mediatorless coupling to take place between the redox centres of antigen-labelled horseradish peroxidase (HRP) and the electrode surface. Competitive immunoassays can be performed in real-time using this separation-free system. Analytical measurements based on the pseudo-linear relationship between the slope of a real-time amperometric signal and the concentration of analyte, yield a novel immunosensor set-up capable of regenerationless amperometric analysis. Multiple, sequential measurements of standards and samples can be performed on a single scAb-modified surface in a matter of minutes. No separation of bound and unbound species was necessary prior to detection. The system is capable of measuring atrazine to a detection limit of 0.1 ppb (0.1 μg l -1 ). This system offers the potential for rapid, cost-effective immunosensing for the analysis of samples of environmental, medical and pharmaceutical significance

  11. Synthesis of Thermally Switchable Chromatographic Materials with Immobilized Ti4+ for Enrichment of Phosphopeptides by Reversible Addition Fragmentation Chain Transfer Polymerization

    Science.gov (United States)

    Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji

    2018-01-01

    Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.

  12. Development of a single-chain variable fragment-alkaline phosphatase fusion protein and a sensitive direct competitive chemiluminescent enzyme immunoassay for detection of ractopamine in pork

    Energy Technology Data Exchange (ETDEWEB)

    Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)

    2012-07-29

    Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between

  13. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  14. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  15. The Effect of Allylic Sulfide-Mediated IrreversibleAddition-Fragment Chain Transfer on the EmulsionPolymerization Kinetics of Styrene

    Directory of Open Access Journals (Sweden)

    Li An

    2015-09-01

    Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.

  16. Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Shibaguchi H

    2017-08-01

    Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy

  17. Generation of a Highly Reactive Chicken-Derived Single-Chain Variable Fragment against Fusarium verticillioides by Phage Display

    Directory of Open Access Journals (Sweden)

    Zu-Quan Hu

    2012-06-01

    Full Text Available Fusarium verticillioides is the primary causal agent of Fusarium ear and kernel rot in maize, producing fumonisin mycotoxins that are toxic to humans and domestic animals. Rapid detection and monitoring of fumonisin-producing fungi are pivotally important for the prevention of mycotoxins from entering into food/feed products. Chicken-derived single-chain variable fragments (scFvs against cell wall-bound proteins from F. verticillioides were isolated from an immunocompetent phage display library. Comparative phage enzyme-linked immunosorbant assays (ELISAs and sequencing analyses identified four different scFv antibodies with high sensitivity. Soluble antibody ELISAs identified two highly sensitive scFv antibodies, FvCA3 and FvCA4, with the latter being slightly more sensitive. Three-dimensional modeling revealed that the FvCA4 may hold a better overall structure with CDRH3, CDRL1 and CDRL3 centered in the core region of antibody surface compared with that of other scFvs. Immunofluorescence labeling revealed that the binding of FvCA4 antibody was localized to the cell walls of conidiospores and hyphae of F. verticillioides, confirming the specificity of this antibody for a surface target. This scFv antibody was able to detect the fungal mycelium as low as 10−2 μg/mL and contaminating mycelium at a quantity of 10−2 mg/g maize. This is the first report that scFv antibodies derived from phage display have a wide application for rapid and accurate detection and monitoring of fumonisin-producing pathogens in agricultural samples.

  18. Development of an Indirect Competitive Enzyme-Linked Immunosorbent Assay for Glycocholic Acid Based on Chicken Single-Chain Variable Fragment Antibodies.

    Science.gov (United States)

    Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D

    2017-10-17

    Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.

  19. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  20. Supply chain integration in the building industry : The emergence of integrated and repetitive strategies in a fragmented and project-driven industry

    NARCIS (Netherlands)

    Vrijhoef, R.

    2011-01-01

    The building industry is a fragmented and project-driven industry with specific characteristics, which can sometimes result in negative effects. Reference has often been made to other industries, particularly manufacturing, that would function more effectively and efficiently. Major differences

  1. Essentials of Conservation Biotechnology: A mini review

    Science.gov (United States)

    Merlyn Keziah, S.; Subathra Devi, C.

    2017-11-01

    Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

  2. A conserved WW domain-like motif regulates invariant chain-dependent cell-surface transport of the NKG2D ligand ULBP2

    DEFF Research Database (Denmark)

    Uhlenbrock, Franziska Katharina; van Andel, Esther; Andresen, Lars

    2015-01-01

    that the NKG2D ligand ULBP2 traffics over an invariant chain (Ii)-dependent pathway to the cell surface. This study set out to elucidate how Ii regulates ULBP2 cell-surface transport: We discovered conserved tryptophan (Trp) residues in the primary protein sequence of ULBP1-6 but not in the related MICA....../B. Substitution of Trp to alanine resulted in cell-surface inhibition of ULBP2 in different cancer cell lines. Moreover, the mutated ULBP2 constructs were retained and not degraded inside the cell, indicating a crucial role of this conserved Trp-motif in trafficking. Finally, overexpression of Ii increased...... surface expression of wt ULBP2 while Trp-mutants could not be expressed, proposing that this Trp-motif is required for an Ii-dependent cell-surface transport of ULBP2. Aberrant soluble ULBP2 is immunosuppressive. Thus, targeting a distinct protein module on the ULBP2 sequence could counteract...

  3. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  4. The catalytic chain of human complement subcomponent C1r. Purification and N-terminal amino acid sequences of the major cyanogen bromide-cleavage fragments.

    Science.gov (United States)

    Arlaud, G J; Gagnon, J; Porter, R R

    1982-01-01

    1. The a- and b-chains of reduced and alkylated human complement subcomponent C1r were separated by high-pressure gel-permeation chromatography and isolated in good yield and in pure form. 2. CNBr cleavage of C1r b-chain yielded eight major peptides, which were purified by gel filtration and high-pressure reversed-phase chromatography. As determined from the sum of their amino acid compositions, these peptides accounted for a minimum molecular weight of 28 000, close to the value 29 100 calculated from the whole b-chain. 3. N-Terminal sequence determinations of C1r b-chain and its CNBr-cleavage peptides allowed the identification of about two-thirds of the amino acids of C1r b-chain. From our results, and on the basis of homology with other serine proteinases, an alignment of the eight CNBr-cleavage peptides from C1r b-chain is proposed. 4. The residues forming the 'charge-relay' system of the active site of serine proteinases (His-57, Asp-102 and Ser-195 in the chymotrypsinogen numbering) are found in the corresponding regions of C1r b-chain, and the amino acid sequence around these residues has been determined. 5. The N-terminal sequence of C1r b-chain has been extended to residue 60 and reveals that C1r b-chain lacks the 'histidine loop', a disulphide bond that is present in all other known serine proteinases.

  5. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  6. Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

    Science.gov (United States)

    Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

    2015-01-01

    In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

  7. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  8. A novel anti-alpha-fetoprotein single-chain variable fragment displays anti-tumor effects in HepG2 cells as a single agent or in combination with paclitaxel.

    Science.gov (United States)

    Ji, Xiaonan; Shen, Yanli; Sun, Hao; Gao, Xiangdong

    2016-08-01

    Human hepatocellular carcinoma (HCC) has a high rate of tumor recurrence and metastasis, resulting in shortened survival time. The function of alpha-fetoprotein (AFP) as a regulatory factor in the growth of HCC cells has been well defined. The aim of this study was to investigate the use of a novel AFP-specific single-chain variable fragment that blocked AFP and inhibited HCC cell growth. The results indicated that the anti-AFP single-chain variable fragment (scFv) induced growth inhibition of AFP-expressing HCC cell lines in vitro through induction of G1 cell cycle arrest and apoptosis. The mechanism of apoptosis probably involved with blocking AFP internalization and regulation of the PTEN/PI3K/Akt signaling network. Moreover, the anti-AFP-scFv also effectively sensitized the HepG2 cells to paclitaxel (PTX) at a lower concentration. The combination effect of PTX and anti-AFP-scFv displayed a synergistic effect on HepG2 cells both in vitro and in vivo. Our results demonstrated that targeting AFP by specific antibodies has potential immunotherapeutic efficacy in human HCC.

  9. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  10. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  11. A conserved WW domain-like motif regulates invariant chain-dependent cell-surface transport of the NKG2D ligand ULBP2.

    Science.gov (United States)

    Uhlenbrock, Franziska; van Andel, Esther; Andresen, Lars; Skov, Søren

    2015-08-01

    Malignant cells expressing NKG2D ligands on their cell surface can be directly sensed and killed by NKG2D-bearing lymphocytes. To ensure this immune recognition, accumulating evidence suggests that NKG2D ligands are trafficed via alternative pathways to the cell surface. We have previously shown that the NKG2D ligand ULBP2 traffics over an invariant chain (Ii)-dependent pathway to the cell surface. This study set out to elucidate how Ii regulates ULBP2 cell-surface transport: We discovered conserved tryptophan (Trp) residues in the primary protein sequence of ULBP1-6 but not in the related MICA/B. Substitution of Trp to alanine resulted in cell-surface inhibition of ULBP2 in different cancer cell lines. Moreover, the mutated ULBP2 constructs were retained and not degraded inside the cell, indicating a crucial role of this conserved Trp-motif in trafficking. Finally, overexpression of Ii increased surface expression of wt ULBP2 while Trp-mutants could not be expressed, proposing that this Trp-motif is required for an Ii-dependent cell-surface transport of ULBP2. Aberrant soluble ULBP2 is immunosuppressive. Thus, targeting a distinct protein module on the ULBP2 sequence could counteract this abnormal expression of ULBP2. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Rapid assessment of Wreathed Hornbill Aceros undulates (Aves: Bucerotidae populations and conservation issues in fragmented lowland tropical forests of Arunachal Pradesh, India

    Directory of Open Access Journals (Sweden)

    C.M. Krishna

    2012-11-01

    Full Text Available A rapid assessment of Wreathed Hornbills, their distribution and abundance was carried out in fragmented lowland tropical forests of Lower Dibang Valley District, Arunachal Pradesh, northeastern India from October 2010 to April 2011 using the total count method. A total of 62km distance was covered on foot to survey four study sites: Horupahar, Delo, Koronu and Injunu. Nine flocks of 172 hornbills were sighted. Aceros undulatus flock size ranged from 8-38 individuals with a mean of about 19.1 plus or minus 2.6. Illegal logging, hunting for bushmeat and other body parts (feathers, beak etc. for decorating the head gear and house interiors by the local tribals were observed as the major threats to the species in the study areas.

  13. Combined hysteroscopy-laparoscopy approach for excision of pelvic nitinol fragment from Essure contraceptive device: Role of intraoperative fluoroscopy for uterine conservation.

    Science.gov (United States)

    Sills, E Scott; Palermo, Gianpiero D

    2016-07-01

    We describe the successful removal of a pelvic contraceptive coil in a symptomatic 46-year-old patient who had Essure devices for four years, using a combined hysteroscopy-laparoscopy-fluoroscopy approach. Following normal hysteroscopy, at laparoscopy the right Essure implant was disrupted and its outer nitinol coil had perforated the fallopian tube. However, the inner rod (containing polyethylene terephthalate) had migrated to an extrapelvic location, near the proximal colon. In contrast, the left implant was situated within the corresponding tube. Intraoperative fluoroscopy was used to confirm complete removal of the device, which was further verified by postoperative computed tomography. The patient's condition improved after surgery and she continues to do well. This is the first report to describe this technique in managing Essure complications remote from time of insertion. Our case highlights the value and limitations of preoperative and intraoperative imaging to map Essure fragment location before surgery.

  14. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  15. Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

    Science.gov (United States)

    Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

    2011-01-01

    In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic

  16. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  17. On the possibility of study the surface structure of small bio-objects, including fragments of nucleotide chains, by means of electron interference

    Energy Technology Data Exchange (ETDEWEB)

    Namiot, V.A., E-mail: vnamiot@gmail.co [Institute of Nuclear Physics, Moscow State University, Vorobyovy Gory, 119992 Moscow (Russian Federation)

    2009-07-20

    We propose a new method to study the surface of small bio-objects, including macromolecules and their complexes. This method is based on interference of low-energy electrons. Theoretically, this type of interference may allow to construct a hologram of the biological object, but, unlike an optical hologram, with the spatial resolution of the order of inter-atomic distances. The method provides a possibility to construct a series of such holograms at various levels of electron energies. In theory, obtaining such information would be enough to identify the types of molecular groups existing on the surface of the studied object. This method could also be used for 'fast reading' of nucleotide chains. It has been shown how to depose a long linear molecule as a straight line on a substrate before carrying out such 'reading'.

  18. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  19. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  20. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  1. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  2. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  3. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  4. Binding of HIV-1 gp41-directed neutralizing and non-neutralizing fragment antibody binding domain (Fab and single chain variable fragment (ScFv antibodies to the ectodomain of gp41 in the pre-hairpin and six-helix bundle conformations.

    Directory of Open Access Journals (Sweden)

    John M Louis

    Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.

  5. Anti-CTGF single-chain variable fragment dimers inhibit human airway smooth muscle (ASM) cell proliferation by down-regulating p-Akt and p-mTOR levels.

    Science.gov (United States)

    Gao, Wei; Cai, Liting; Xu, Xudong; Fan, Juxiang; Xue, Xiulei; Yan, Xuejiao; Qu, Qinrong; Wang, Xihua; Zhang, Chen; Wu, Guoqiu

    2014-01-01

    Connective tissue growth factor (CTGF) contributes to airway smooth muscle (ASM) cell hyperplasia in asthma. Humanized single-chain variable fragment antibody (scFv) was well characterized as a CTGF antagonist in the differentiation of fibroblast into myofibroblast and pulmonary fibrosis in our previous studies. To further improve the bioactivity of scFv, we constructed a plasmid to express scFv-linker-matrilin-6×His fusion proteins that could self-assemble into the scFv dimers by disulfide bonds in matrilin under non-reducing conditions. An immunoreactivity assay demonstrated that the scFv dimer could highly bind to CTGF in a concentration-dependent manner. The MTT and EdU assay results revealed that CTGF (≥10 ng/mL) promoted the proliferation of ASM cells, and this effect was inhibited when the cells were treated with anti-CTGF scFv dimer. The western blot analysis results showed that increased phosphorylation of Akt and mTOR induced by CTGF could be suppressed by this scFv dimer. Based on these findings, anti-CTGF scFv dimer may be a potential agent for the prevention of airway remodeling in asthma.

  6. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  7. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  8. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  9. Multiplicity distributions and multiplicity correlations in sequential, off-equilibrium fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.

    1996-01-01

    A new kinetic fragmentation model, the Fragmentation - Inactivation -Binary (FIB) model is described where a dissipative process stops randomly the sequential, conservative and off-equilibrium fragmentation process. (K.A.)

  10. Defining conservation priorities using fragmentation forecasts

    Science.gov (United States)

    David Wear; John Pye; Kurt H. Riitters

    2004-01-01

    Methods are developed for forecasting the effects of population and economic growth on the distribution of interior forest habitat. An application to the southeastern United States shows that models provide significant explanatory power with regard to the observed distribution of interior forest. Estimates for economic and biophysical variables are significant and...

  11. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  12. Generation of a rabbit single-chain fragment variable (scFv) antibody for specific detection of Bradyrhizobium sp. DOA9 in both free-living and bacteroid forms.

    Science.gov (United States)

    Vu, Nguyen Xuan; Pruksametanan, Natcha; Srila, Witsanu; Yuttavanichakul, Watcharin; Teamtisong, Kamonluck; Teaumroong, Neung; Boonkerd, Nantakorn; Tittabutr, Panlada; Yamabhai, Montarop

    2017-01-01

    A simple and reliable method for the detection of specific nitrogen-fixing bacteria in both free-living and bacteroid forms is essential for the development and application of biofertilizer. Traditionally, a polyclonal antibody generated from an immunized rabbit was used for detection. However, the disadvantages of using a polyclonal antibody include limited supply and cross-reactivity to related bacterial strains. This is the first report on the application of phage display technology for the generation of a rabbit recombinant monoclonal antibody for specific detection and monitoring of nitrogen-fixing bacteria in both free-living form and in plant nodules. Bradyrhizobium sp. DOA9, a broad host range soil bacteria, originally isolated from the root nodules of Aeschynomene americana in Thailand was used as a model in this study. A recombinant single-chain fragment variable (scFv) antibody library was constructed from the spleen of a rabbit immunized with DOA9. After three rounds of biopanning, one specific phage-displayed scFv antibody, designated bDOA9rb8, was identified. Specific binding of this antibody was confirmed by phage enzyme-linked immunosorbent assay (phage ELISA). The phage antibody could bind specifically to DOA9 in both free-living cells (pure culture) and bacteroids inside plant nodules. In addition to phage ELISA, specific and robust immunofluorescence staining of both free-living and bacteroid forms could also be observed by confocal-immunofluorescence imaging, without cross-reactivity with other tested bradyrhizobial strains. Moreover, specific binding of free scFv to DOA9 was also demonstrated by ELISA. This recombinant antibody can also be used for the study of the molecular mechanism of plant-microbe interactions in the future.

  13. Preparation of the Fv fragment from a short-chain mouse IgG2a anti-dansyl monoclonal antibody and use of selectively deuterated Fv analogues for two-dimensional 1H NMR analyses fo the antigen-antibody interactions

    International Nuclear Information System (INIS)

    Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji

    1991-01-01

    The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C H 1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides 1 H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2'-H and Tyr C3',5'-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed

  14. Preparation of the Fv fragment from a short-chain mouse IgG2a anti-dansyl monoclonal antibody and use of selectively deuterated Fv analogues for two-dimensional sup 1 H NMR analyses fo the antigen-antibody interactions

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji (Univ. of Tokyo (Japan))

    1991-03-19

    The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C{sub H}1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides {sup 1}H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2{prime}-H and Tyr C3{prime},5{prime}-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed.

  15. A rare disease-associated mutation in the medium-chain acyl-CoA dehydrogenase (MCAD) gene changes a conserved arginine, previously shown to be functionally essential in short-chain acyl-CoA dehydrogenase (SCAD)

    DEFF Research Database (Denmark)

    Andresen, B S; Bross, P; Jensen, T G

    1993-01-01

    157 mutation was verified in genomic DNA from the patient and her mother by a PCR-based assay. The mutation changes conserved arginine at position 28 (R28C) of the mature MCAD protein. The effect of the T157 mutation on MCAD protein was investigated by expression of mutant MCAD cDNA in COS-7 cells...

  16. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  17. An unusual cysteine VL87 affects the antibody fragment conformations without interfering with the disulfide bond formation.

    Science.gov (United States)

    Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E

    2017-10-01

    The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Altered specificity of single-chain antibody fragments bound to pandemic H1N1-2009 influenza virus after conversion of the phage-bound to the soluble form

    Directory of Open Access Journals (Sweden)

    Kaku Yoshihiro

    2012-09-01

    Full Text Available Abstract Background In 2009, a novel influenza A/H1N1 virus (H1N1pdm quickly spread worldwide and co-circulated with then-existing seasonal H1N1 virus (sH1N1. Distinguishing between these 2 viruses was necessary to better characterize the epidemiological properties of the emergent virus, including transmission patterns, pathogenesis, and anti-influenza drug resistance. This situation prompted us to develop a point-of-care virus differentiation system before entering the 2009–2010 influenza season. Aiming to establish H1N1pdm-specific detection tools rapidly, we employed phage display libraries to select H1N1pdm-specific single-chain variable fragments (scFvs. Findings Human single-fold scFv libraries (Tomlinson I + J underwent selection for the ability to bind H1N1pdm virus particles. Three rounds of panning brought 1152 phage-bound scFvs, of which 58 clones reacted with H1N1pdm specifically or preferentially over sH1N1 in an enzyme-linked immunosorbent assay (ELISA. After conversion of the scFvs to soluble form, 7 clones demonstrating high/stable expression were finally obtained. However, all the soluble scFvs except No. 29 were found to have lost their specificity/preference for H1N1pdm in ELISA. The specificity/preference of No. 29 was also confirmed by immunofluorescence assay and immunoprecipitation, and the viral nucleoprotein was identified by ELISA as its target protein. The change in specificity associated with scFv conversion from phage-bound to soluble form could be due to loss of phage scaffold pIII protein, which likely provides structural support for the scFv antigen-binding site. It is also possible that the similar antigenic properties of H1N1pdm and sH1N1 led to the observed alterations in scFv specificity. Discussion Using a phage display library, we obtained 7 soluble scFv clones reactive against H1N1pdm; however, only 1 showed specificity/preference toward H1N1pdm. Our results confirmed that using phage display

  19. Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

    Science.gov (United States)

    Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

    2018-04-01

    Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

  20. The lund Monte Carlo for jet fragmentation

    International Nuclear Information System (INIS)

    Sjoestrand, T.

    1982-03-01

    We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)

  1. Current fragmentation in deep inelastic scattering

    International Nuclear Information System (INIS)

    Hamer, C.J.

    1975-04-01

    It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

  2. Preservation of food by cold chains. Part 4. Brief history of the industrial food preservation; Conservering van voedingsmiddelen door koudeketens. Deel 4. Korte historie van de industriele voedingsmiddelenconservering

    Energy Technology Data Exchange (ETDEWEB)

    Van den Berg, C.; Berends, E.

    2011-10-01

    This is the fourth article in the series on cold chain food preservation, which describes the use of refrigeration in the food industry. Milestones were the building of cold chains for food distribution and new processes such as margarine and lager beer, and the scaling up of existing processes (e.g. for dairy, meat and fish products). By quick freezing, introduced by Clarence Birdseye in 1925, refrigeration can also be used for long term preservation of food products, as a powerful alternative for canning food. [Dutch] Dit vierde artikel in de reeks 'voedingsmiddelenconservering door koudeketens' completeert de beknopte historie van de voedingsmiddelenindustrie met een overzicht van het in gebruik nemen van de koelmachine. Mijlpalen zijn het ontstaan van koudeketens voor voedseldistributie en de nu mogelijk geworden nieuwe processen, de bereiding van pilsbier en margarine, de opschaling van bereidingsprocessen en het lange-afstandtransport van bederfelijke producten zoals zuivelproducten, vlees en vis. Door diepvriezen als methode aan te wenden, uitgevonden door Clarence Birdseye in 1925, kan koude ook worden gebruikt om voedingsmiddelen lang houdbaar te maken, een superieur alternatief voor inblikken van voedsel.

  3. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  4. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

    Science.gov (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

    2016-01-01

    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  5. effect of habitat fragmentation on diversity and abundance of nesting

    African Journals Online (AJOL)

    cw

    Department of Zoology and Wildlife Conservation, University of Dar es ... Keywords: fragmentation, nesting birds, thickets, campus of the University of Dar es ... 43(1), 2017 ..... Yale University Press, ... bird species in urban parks: Effects of park.

  6. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  7. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  8. Intermittency in 197Au fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs

  9. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  10. Flux through a Markov chain

    International Nuclear Information System (INIS)

    Floriani, Elena; Lima, Ricardo; Ourrad, Ouerdia; Spinelli, Lionel

    2016-01-01

    Highlights: • The flux through a Markov chain of a conserved quantity (mass) is studied. • Mass is supplied by an external source and ends in the absorbing states of the chain. • Meaningful for modeling open systems whose dynamics has a Markov property. • The analytical expression of mass distribution is given for a constant source. • The expression of mass distribution is given for periodic or random sources. - Abstract: In this paper we study the flux through a finite Markov chain of a quantity, that we will call mass, which moves through the states of the chain according to the Markov transition probabilities. Mass is supplied by an external source and accumulates in the absorbing states of the chain. We believe that studying how this conserved quantity evolves through the transient (non-absorbing) states of the chain could be useful for the modelization of open systems whose dynamics has a Markov property.

  11. Property-based design and synthesis of new chloroquine hybrids via simple incorporation of 2-imino-thiazolidine-4-one or 1h-pyrrol-2, 5-dione fragments on the 4-amino-7-chloroquinoline side chain

    International Nuclear Information System (INIS)

    Rojas, Fernando A.; Kouznetsov, Vladimir V.

    2011-01-01

    In the present work, the syntheses of new 4-amino-7-chloroquinoline N-derivatives were performed by selective modification of the side chain amino group of N-(7-chloroquinoline-4-yl) alkyldiamines, basis framework of chloroquine (CQ) drug through the incorporation of heterocyclic 2-imino-thiazolidine-4-one and 1 H-pyrrol-2,5-dione systems. These potential activity modulators were selected thanks to their characteristic properties, and evaluated by virtual screening employing the OSIRIS and Molinspirations platforms. Designed and synthesized quinolinic derivatives could increase the antimalarial activity of CQ analogues without affecting the lipophilicity as described in literature, suggesting them as candidates for further biological assessments. (author)

  12. Property-based design and synthesis of new chloroquine hybrids via simple incorporation of 2-imino-thiazolidine-4-one or 1h-pyrrol-2, 5-dione fragments on the 4-amino-7-chloroquinoline side chain

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, Fernando A; Kouznetsov, Vladimir V., E-mail: kouznet@uis.edu.co [Laboratorio de Quimica Organica y Biomolecular, Escuela de Quimica, Universidad Industrial de Santander, Bucaramanga (Colombia)

    2011-09-15

    In the present work, the syntheses of new 4-amino-7-chloroquinoline N-derivatives were performed by selective modification of the side chain amino group of N-(7-chloroquinoline-4-yl) alkyldiamines, basis framework of chloroquine (CQ) drug through the incorporation of heterocyclic 2-imino-thiazolidine-4-one and {sup 1}H-pyrrol-2,5-dione systems. These potential activity modulators were selected thanks to their characteristic properties, and evaluated by virtual screening employing the OSIRIS and Molinspirations platforms. Designed and synthesized quinolinic derivatives could increase the antimalarial activity of CQ analogues without affecting the lipophilicity as described in literature, suggesting them as candidates for further biological assessments. (author)

  13. SCEDS: protein fragments for molecular replacement in Phaser

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

    2013-11-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

  14. SCEDS: protein fragments for molecular replacement in Phaser

    International Nuclear Information System (INIS)

    McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

    2013-01-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

  15. A quantitative analysis of forest fragmentation in Los Tuxtlas, southeast Mexico: patterns and implications for conservation Un análisis cuantitativo de la fragmentación de la selva de Los Tuxtlas en el sudeste de México: patrones e implicaciones para la conservación

    Directory of Open Access Journals (Sweden)

    EDUARDO MENDOZA

    2005-09-01

    Full Text Available Habitat loss is a critical threat to tropical biodiversity and its quantification constitutes a central conservation issue. Typically, assessments have been based on deforestation rates statistics. However, this overlooks the effects brought about by the spatial reconfiguration of the remaining habitat: fragmentation. We present an analysis of fragmentation in a Neotropical site aimed at: (a devising a protocol for its quantification, (b using such protocol to provide insights on the ecological consequences of fragmentation, (c exploring its applicability to address the hypothesis that forest size-inequality decreases with elevation, an indicator of habitat accessibility. We applied the Gini coefficient (G and the Lorenz curve to analyze fragment-size variation using a satellite-generated map. We also estimated edge effect, fragment shape and isolation. Remaining forest includes 1,005 fragments, ranging from 0.5 to 9.356 ha (median = 0.89. Size inequality was very high (G = 0.928, producing a flattened Lorenz curve. Forty percent of the fragments did not maintain an area free of a 30-m edge effect, and larger fragments showed a marked deviation from ideal circular forms. Eighty-four percent of the fragments lay further than 500 m from the largest forest tract and their size decreased with distance. Fragment size distribution changed with altitude: the Gini coefficient was lowest and forest coverage was greatest at the highest altitude, but inequality peaked at an intermediate elevation. Given the current pace of habitat deterioration, application of similar analyses may improve global assessments of tropical ecosystems and their perspectives for biodiversity conservationLa destrucción del hábitat es la principal amenaza para la biodiversidad tropical, por lo que su cuantificación constituye un aspecto central para la biología de la conservación. Usualmente, esta cuantificación se basa en el cálculo de las tasas de deforestaci

  16. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  17. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  18. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  19. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  20. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  1. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  2. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  3. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  4. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  5. Molecular Tools For Biodiversity Conservation

    Indian Academy of Sciences (India)

    ... habits that make them difficultstudy subjects when using conventional field techniques.Molecular tools can be used to decipher distributions andpopulation connectedness in fragmented habitats and identifypopulations of immediate conservation concern. We discussthese with case studies on some cat species in India.

  6. Microbial platform technology for recombinant antibody fragment production: A review.

    Science.gov (United States)

    Gupta, Sanjeev Kumar; Shukla, Pratyoosh

    2017-02-01

    Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.

  7. Culture impact in construction supply chain management

    OpenAIRE

    Tzortzatou, E. P.

    2008-01-01

    Awareness of cultural differences in construction supply chains is of fundamental importance because only through a thorough understanding of the manifestations of culture can fragmented supply chains be appropriately integrated into cohesive and collaborating teams which enhance project performance Hence the concept of cultural alignment with the project supply chain is introduced in order for long-term collaborative relationships based on trust, co ordination and mutual benefit to be establ...

  8. Some comments on jet fragmentation models and sup(α)s determinations

    International Nuclear Information System (INIS)

    Sjoestrand, T.

    1984-03-01

    A number of interrelated topics on jet properties in e + e - annihilation is discussed. The need for different αsub(s) values in different fragmentation models is explained, with particular emphasis on the sensitivity to the choice of momentum conservation scheme in independent fragmentation models. Also other factors leading to a broad range of experimental αsub(s) values are discussed. Old and new methods to distinguish different fragmentation models are presented, with particular emphasis on gluon jet fragmentation properties. (orig.)

  9. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  10. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  11. Completion of autobuilt protein models using a database of protein fragments

    International Nuclear Information System (INIS)

    Cowtan, Kevin

    2012-01-01

    Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature

  12. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  13. Conservation Value

    OpenAIRE

    Tisdell, Clement A.

    2010-01-01

    This paper outlines the significance of the concept of conservation value and discusses ways in which it is determined paying attention to views stemming from utilitarian ethics and from deontological ethics. The importance of user costs in relation to economic decisions about the conservation and use of natural resources is emphasised. Particular attention is given to competing views about the importance of conserving natural resources in order to achieve economic sustainability. This then l...

  14. PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.

    2013-01-01

    An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target

  15. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  17. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  18. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  19. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  20. Phylogenetic similarity of the canine parvovirus wild-type isolates on the basis of VP1/VP2 gene fragment sequence analysis.

    Science.gov (United States)

    Rypul, K; Chmielewski, R; Smielewska-Loś, E; Klimentowski, S

    2002-04-01

    Biological material was taken from dogs with diarrhoea. Faecal samples were taken from within live animals and intestinal tract fragments (i.e. small intestine, and stomach) were taken from dead animals. In total, 18 specimens were investigated from dogs housed alone or in large groups. To test for the presence of the virus, latex (On Site Biotech, Uppsala, Sweden) and direct immunofluorescence tests were performed. At the same time, polymerase chain reaction (PCR) with primers complementary to a conservative region of VP1/VP2 was carried out. The products of amplification were analysed on 2% agarose gel. The purified products were cloned with the Template Generation System (Finnzymes, Espoo, Finland) using a transposition reaction and positive clones were searched using the 'colony screening by PCR' method. The sequencing gave 12 sequences of VP1/VP2 gene fragments that were of high similarity. Among the 12 analysed sequences, six exhibited 88% similarity, four exhibited 100% similarity and two exhibited 71% similarity.

  1. Developing sustainable food supply chains.

    Science.gov (United States)

    Smith, B Gail

    2008-02-27

    This paper reviews the opportunities available for food businesses to encourage consumers to eat healthier and more nutritious diets, to invest in more sustainable manufacturing and distribution systems and to develop procurement systems based on more sustainable forms of agriculture. The important factors in developing more sustainable supply chains are identified as the type of supply chain involved and the individual business attitude to extending responsibility for product quality into social and environmental performance within their own supply chains. Interpersonal trust and working to standards are both important to build more sustainable local and many conserved food supply chains, but inadequate to transform mainstream agriculture and raw material supplies to the manufactured and commodity food markets. Cooperation among food manufacturers, retailers, NGOs, governmental and farmers' organizations is vital in order to raise standards for some supply chains and to enable farmers to adopt more sustainable agricultural practices.

  2. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

  3. The bioenergy potential of conservation areas and roadsides for biogas in an urbanized region

    International Nuclear Information System (INIS)

    Van Meerbeek, Koenraad; Ottoy, Sam; De Meyer, Annelies; Van Schaeybroeck, Tom; Van Orshoven, Jos; Muys, Bart; Hermy, Martin

    2015-01-01

    Highlights: • We assessed the bioenergy potential of conservation areas and roadsides in Flanders. • An area of 31,055 ha produces 203 kton DM of herbaceous biomass annually. • The associated biomass supply chain was optimized with OPTIMASS in four scenarios. • The net energy balance of the studied systems was 7 GJ ha −1 in the 2020 scenarios. • We show that this biomass can play a role to meet the increased biomass demand in 2020. - Abstract: In many urbanized areas the roadside and nature conservation management offers a biomass-for-bioenergy resource potential which is barely valorized, because of the fragmented biomass production sites and the scarcity of accurate data on the spatial availability of the biomass. In this study, a GIS based assessment was performed to determine the regional non-woody biomass-for-bioenergy potential for biogas from conservation areas and roadsides in Flanders, Belgium. These systems, with an area of 31,055 ha, have an annual herbaceous biomass production of 203 kton dry matter. The full associated biomass-to-bioenergy supply chain was optimized in four scenarios to maximize the net energy output and the profit. The scenario analysis was performed with OPTIMASS, a recently developed GIS based strategic decision support system. The analysis showed that the energetic valorization of conservation and roadside biomass through anaerobic digestion had a positive net energy balance, although there is still much room for improvements. Economically, however, it is a less interesting biomass resource. Most likely, the economic picture would change when other ecosystem services delivered by the protected biodiversity would be taken into account. Future technical advances and governmental incentives, like green energy certificates, will be necessary to incorporate the biomass into the energy chain. By tackling the existing barriers and providing a detailed methodology for biomass potential assessments, this study tries to

  4. Fragmentation of atomic systems

    International Nuclear Information System (INIS)

    Bohn, J.L.; Fano, U.

    1996-01-01

    We report recent progress toward a nonperturbative formulation of many-body quantum dynamics that treats all constituent particles on an equal footing. This formulation is capable of detailing the evolution of a system toward the diverse fragments into which it can break up. We illustrate the general concept with the simple example of the simultaneous excitation of both electrons in a helium atom. copyright 1996 The American Physical Society

  5. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  6. Hot nuclei and fragmentation

    International Nuclear Information System (INIS)

    Guerreau, D.

    1993-01-01

    A review is made of the present status concerning the production of nuclei above 5 MeV temperature. Considerable progress has been made recently on the understanding of the formation and the fate of such hot nuclei. It appears that the nucleus seems more stable against temperature than predicted by static calculations. However, the occurrence of multifragment production at high excitation energies is now well established. The various experimental features of the fragmentation process are discussed. (author) 59 refs., 12 figs

  7. Excited nuclei fragmentation

    International Nuclear Information System (INIS)

    Ngo, C.

    1986-11-01

    Experimental indications leading to the thought of a very excited nucleus fragmentation are resumed. Theoretical approaches are briefly described; they are used to explain the phenomenon in showing off they are based on a minimum information principle. This model is based on time dependent Thomas-Fermi calculation which allows the mean field effect description, and with a site-bound percolation model which allows the fluctuation description [fr

  8. Society's choices: land use changes, forest fragmentation, and conservation.

    Science.gov (United States)

    Jonathan Thompson

    2006-01-01

    Changing patterns of land use are at the heart of many environmental concerns regarding U.S. forest lands. Of all the human impacts to forests, development is one of the most significant because of the severity and permanency of the change. Concern about the effects of development on America’s forests has risen sharply since the 1990s, when the conversion of forest...

  9. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  10. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  11. Charge distribution in the ternary fragmentation of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)

    2017-08-15

    We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)

  12. Quantification of habitat fragmentation reveals extinction risk in terrestrial mammals

    Science.gov (United States)

    Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; King, Sarah R. B.; Rondinini, Carlo; Boitani, Luigi

    2017-01-01

    Although habitat fragmentation is often assumed to be a primary driver of extinction, global patterns of fragmentation and its relationship to extinction risk have not been consistently quantified for any major animal taxon. We developed high-resolution habitat fragmentation models and used phylogenetic comparative methods to quantify the effects of habitat fragmentation on the world’s terrestrial mammals, including 4,018 species across 26 taxonomic Orders. Results demonstrate that species with more fragmentation are at greater risk of extinction, even after accounting for the effects of key macroecological predictors, such as body size and geographic range size. Species with higher fragmentation had smaller ranges and a lower proportion of high-suitability habitat within their range, and most high-suitability habitat occurred outside of protected areas, further elevating extinction risk. Our models provide a quantitative evaluation of extinction risk assessments for species, allow for identification of emerging threats in species not classified as threatened, and provide maps of global hotspots of fragmentation for the world’s terrestrial mammals. Quantification of habitat fragmentation will help guide threat assessment and strategic priorities for global mammal conservation. PMID:28673992

  13. CHAIN 2

    International Nuclear Information System (INIS)

    Bailey, D.

    1998-04-01

    The Second Processing Chain (CHAIN2) consists of a suite of ten programs which together provide a full local analysis of the bulk plasma physics within the JET Tokamak. In discussing these ten computational models this report is intended to fulfil two broad purposes. Firstly it is meant to be used as a reference source for any user of CHAIN2 data, and secondly it provides a basic User Manual sufficient to instruct anyone in running the CHAIN2 suite of codes. In the main report text each module is described in terms of its underlying physics and any associated assumptions or limitations, whilst deliberate emphasis is put on highlighting the physics and mathematics of the calculations required in deriving each individual datatype in the standard module PPF output. In fact each datatype of the CHAIN2 PPF output listed in Appendix D is cross referenced to the point in the main text where its evaluation is discussed. An effort is made not only to give the equation used to derive a particular data profile but also to explicitly define which external data sources are involved in the computational calculation

  14. A Cholera Conjugate Vaccine Containing O-specific Polysaccharide (OSP of V. cholerae O1 Inaba and Recombinant Fragment of Tetanus Toxin Heavy Chain (OSP:rTTHc Induces Serum, Memory and Lamina Proprial Responses against OSP and Is Protective in Mice.

    Directory of Open Access Journals (Sweden)

    Md Abu Sayeed

    Full Text Available Vibrio cholerae is the cause of cholera, a severe watery diarrhea. Protection against cholera is serogroup specific. Serogroup specificity is defined by the O-specific polysaccharide (OSP component of lipopolysaccharide (LPS.Here we describe a conjugate vaccine for cholera prepared via squaric acid chemistry from the OSP of V. cholerae O1 Inaba strain PIC018 and a recombinant heavy chain fragment of tetanus toxin (OSP:rTTHc. We assessed a range of vaccine doses based on the OSP content of the vaccine (10-50 μg, vaccine compositions varying by molar loading ratio of OSP to rTTHc (3:1, 5:1, 10:1, effect of an adjuvant, and route of immunization.Immunized mice developed prominent anti-OSP and anti-TT serum IgG responses, as well as vibriocidal antibody and memory B cell responses following intramuscular or intradermal vaccination. Mice did not develop anti-squarate responses. Intestinal lamina proprial IgA responses targeting OSP occurred following intradermal vaccination. In general, we found comparable immune responses in mice immunized with these variations, although memory B cell and vibriocidal responses were blunted in mice receiving the highest dose of vaccine (50 μg. We found no appreciable change in immune responses when the conjugate vaccine was administered in the presence or absence of immunoadjuvant alum. Administration of OSP:rTTHc resulted in 55% protective efficacy in a mouse survival cholera challenge model.We report development of an Inaba OSP:rTTHc conjugate vaccine that induces memory responses and protection against cholera in mice. Development of an effective cholera conjugate vaccine that induces high level and long-term immune responses against OSP would be beneficial, especially in young children who respond poorly to polysaccharide antigens.

  15. Surface-Confined Aqueous Reversible Addition-Fragmentation Chain Transfer (SCARAFT) Polymerization Method for Preparation of Coated Capillary Leads to over 10 000 Peptides Identified from 25 ng HeLa Digest by Using Capillary Zone Electrophoresis-Tandem Mass Spectrometry.

    Science.gov (United States)

    Zhang, Zhenbin; Peuchen, Elizabeth H; Dovichi, Norman J

    2017-06-20

    A surface-confined aqueous reversible addition-fragmentation chain transfer (SCARAFT) polymerization method was developed to coat capillaries for use in capillary zone electrophoresis (CZE). SCARAFT polymerization primarily takes place on the inner surface of the capillary instead of in solution, which greatly improves the homogeneity of the coating. Capillaries treated with this coating produced an electroosmotic mobility of 2.8 ± 0.2 × 10 -6 cm 2 ·V -1 ·s -1 (N = 3), which is roughly an order of magnitude lower than that of commercial linear polyacrylamide (LPA)-coated capillaries. Coated capillaries were evaluated for bottom-up proteomic analysis using CZE. The very low electroosmotic mobility results in a 200 min separation and improved single-shot analysis. An average of 977 protein groups and 5605 unique peptides were identified from 50 ng of an E. coli digest, and 2158 protein groups and 10 005 peptides were identified from 25 ng of a HeLa digest using single-shot analysis with a SCARAFT-acrylamide capillary coupled to a Q Exactive HF mass spectrometer. The coating is stable. A single capillary was used for over 200 h (8.4 days) of continuous operation. RSD in migration time was between 2 and 3% for selected ion electropherograms (SIEs) generated for six ions; median theoretical plate counts ranged from 240 000 to 600 000 for these SIEs. Various types of coatings could be prepared by simply changing the functional vinyl monomers in the polymerization mixture. Positively charged coatings using direct attachment and formation of a block copolymer were prepared and demonstrated for the separation of mixtures of intact proteins.

  16. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.

    2001-01-01

    We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

  17. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  18. An Archeology of Fragments

    Directory of Open Access Journals (Sweden)

    Gerald L. Bruns

    2014-10-01

    Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.

  19. Responses of bats to forest fragmentation at Pozuzo, Peru

    Directory of Open Access Journals (Sweden)

    José Luis Mena

    2011-05-01

    Full Text Available Forest fragmentation and deforestation are among the major threats to Peruvian bats conservation. Unfortunately,information about the effects of these threats above 500 m elevation is lacking. In this study, I assessedbat responses to fragmentation in Pozuzo (Pasco at a landscape scale approach. I evaluate two hypothesesregarding the role of bats as indicators of habitat disturbance. The first prediction says that landscapes highlydisturbed will show higher abundances of habitat generalist species such as frugivorous bats belonging to thesubfamilies Stenodermatinae and Carollinae. The second prediction regards that landscapes with greater forestcover will show higher abundance of habitat specialist species such as animalivorous bat species belongingto the subfamily Phyllostominae, a guild sensitive to forest disturbance. I found evidence supporting the animalivoroushypothesis but it was partial to the frugivorous hypothesis. This study highlights the importance offorest fragments to bat conservation in human-modified landscapes.

  20. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  1. The relative effects of habitat loss, fragmentation, and degradation on population extinction

    Science.gov (United States)

    The most prominent conservation concerns are typically habitat loss and habitat fragmentation. The role of habitat degradation has received comparatively little attention. But research has shown that the quality of habitat patches can significantly influence wildlife population d...

  2. Fragmentation of random trees

    International Nuclear Information System (INIS)

    Kalay, Z; Ben-Naim, E

    2015-01-01

    We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

  3. The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi

    NARCIS (Netherlands)

    Joosten, V.; Lokman, C.; Hondel, C.A.M.J.J. van den; Punt, P.J.

    2003-01-01

    In this review we will focus on the current status and views concerning the production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi. We will focus on single-chain antibody fragment production (scFv and VHH) by these lower eukaryotes and the possible applications

  4. Conservation endocrinology

    Science.gov (United States)

    McCormick, Stephen; Romero, L. Michael

    2017-01-01

    Endocrinologists can make significant contributions to conservation biology by helping to understand the mechanisms by which organisms cope with changing environments. Field endocrine techniques have advanced rapidly in recent years and can provide substantial information on the growth, stress, and reproductive status of individual animals, thereby providing insight into current and future responses of populations to changes in the environment. Environmental stressors and reproductive status can be detected nonlethally by measuring a number of endocrine-related endpoints, including steroids in plasma, living and nonliving tissue, urine, and feces. Information on the environmental or endocrine requirements of individual species for normal growth, development, and reproduction will provide critical information for species and ecosystem conservation. For many taxa, basic information on endocrinology is lacking, and advances in conservation endocrinology will require approaches that are both “basic” and “applied” and include integration of laboratory and field approaches.

  5. Rates of species loss from Amazonian forest fragments

    Science.gov (United States)

    Ferraz, Gonçalo; Russell, Gareth J.; Stouffer, Philip C.; Bierregaard, Richard O.; Pimm, Stuart L.; Lovejoy, Thomas E.

    2003-01-01

    In the face of worldwide habitat fragmentation, managers need to devise a time frame for action. We ask how fast do understory bird species disappear from experimentally isolated plots in the Biological Dynamics of Forest Fragments Project, central Amazon, Brazil. Our data consist of mist-net records obtained over a period of 13 years in 11 sites of 1, 10, and 100 hectares. The numbers of captures per species per unit time, analyzed under different simplifying assumptions, reveal a set of species-loss curves. From those declining numbers, we derive a scaling rule for the time it takes to lose half the species in a fragment as a function of its area. A 10-fold decrease in the rate of species loss requires a 1,000-fold increase in area. Fragments of 100 hectares lose one half of their species in <15 years, too short a time for implementing conservation measures. PMID:14614134

  6. Heavy Chain Diseases

    Science.gov (United States)

    ... of heavy chain produced: Alpha Gamma Mu Alpha Heavy Chain Disease Alpha heavy chain disease (IgA heavy ... the disease or lead to a remission. Gamma Heavy Chain Disease Gamma heavy chain disease (IgG heavy ...

  7. High dispersal in a frog species suggests that it is vulnerable to habitat fragmentation

    OpenAIRE

    Funk, W. Chris; Greene, Allison E; Corn, Paul Stephen; Allendorf, Fred W

    2005-01-01

    Global losses of amphibian populations are a major conservation concern and their causes have generated substantial debate. Habitat fragmentation is considered one important cause of amphibian decline. However, if fragmentation is to be invoked as a mechanism of amphibian decline, it must first be established that dispersal is prevalent among contiguous amphibian populations using formal movement estimators. In contrast, if dispersal is naturally low in amphibians, fragmentation can be disreg...

  8. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  9. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  10. Intermittency in {sup 197}Au fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Dabrowska, A; Holynski, R; Olszewski, A; Szarska, M; Wilczynska, B; Wolter, W; Wosiek, B [Institute of Nuclear Physics, Cracow (Poland); Cherry, M L; Deines-Jones, P; Jones, W V; Sengupta, K; Wefel, B [Louisiana State Univ., Baton Rouge, LA (United States). Dept. of Physics and Astronomy; Waddington, C J [Minnesota Univ., Minneapolis, MN (United States). School of Physics and Astronomy; Pozharova, E A; Skorodko, T Yu [Inst. of Theoretical and Experimental Physics, Moscow (Russian Federation); KLMM Collaboration

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs.

  11. Global patterns of fragmentation and connectivity of mammalian carnivore habitat.

    Science.gov (United States)

    Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi

    2011-09-27

    Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.

  12. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  13. [Conservation Units.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  14. Creative conservation

    NARCIS (Netherlands)

    Bentham, Roelof J.

    1968-01-01

    The increasing exploitation of our natural resources, the unlimited occupation of ever more new areas, and the intensification of land-use, make it necessary for us to expand the concept of conservation. But we also need to reconsider that concept itself. For the changing conditions in the

  15. Reshaping conservation

    DEFF Research Database (Denmark)

    Funder, Mikkel; Danielsen, Finn; Ngaga, Yonika

    2013-01-01

    members strengthen the monitoring practices to their advantage, and to some extent move them beyond the reach of government agencies and conservation and development practitioners. This has led to outcomes that are of greater social and strategic value to communities than the original 'planned' benefits...

  16. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  17. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  18. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  19. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  20. Conservation of Charge and Conservation of Current

    OpenAIRE

    Eisenberg, Bob

    2016-01-01

    Conservation of current and conservation of charge are nearly the same thing: when enough is known about charge movement, conservation of current can be derived from conservation of charge, in ideal dielectrics, for example. Conservation of current is enforced implicitly in ideal dielectrics by theories that conserve charge. But charge movement in real materials like semiconductors or ionic solutions is never ideal. We present an apparently universal derivation of conservation of current and ...

  1. Meta-analysis of the effects of forest fragmentation on interspecific interactions.

    Science.gov (United States)

    Magrach, Ainhoa; Laurance, William F; Larrinaga, Asier R; Santamaria, Luis

    2014-10-01

    Forest fragmentation dramatically alters species persistence and distribution and affects many ecological interactions among species. Recent studies suggest that mutualisms, such as pollination and seed dispersal, are more sensitive to the negative effects of forest fragmentation than antagonisms, such as predation or herbivory. We applied meta-analytical techniques to evaluate this hypothesis and quantified the relative contributions of different components of the fragmentation process (decreases in fragment size, edge effects, increased isolation, and habitat degradation) to the overall effect. The effects of fragmentation on mutualisms were primarily driven by habitat degradation, edge effects, and fragment isolation, and, as predicted, they were consistently more negative on mutualisms than on antagonisms. For the most studied interaction type, seed dispersal, only certain components of fragmentation had significant (edge effects) or marginally significant (fragment size) effects. Seed size modulated the effect of fragmentation: species with large seeds showed stronger negative impacts of fragmentation via reduced dispersal rates. Our results reveal that different components of the habitat fragmentation process have varying impacts on key mutualisms. We also conclude that antagonistic interactions have been understudied in fragmented landscapes, most of the research has concentrated on particular types of mutualistic interactions such as seed dispersal, and that available studies of interspecific interactions have a strong geographical bias (arising mostly from studies carried out in Brazil, Chile, and the United States). © 2014 Society for Conservation Biology.

  2. Blocking of proteolytic processing and deletion of glycosaminoglycan side chain of mouse DMP1 by substituting critical amino acid residues.

    Science.gov (United States)

    Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin

    2009-01-01

    Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.

  3. Thermodynamical string fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

    2017-01-31

    The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

  4. The role of landscape connectivity in planning and implementing conservation and restoration priorities

    Science.gov (United States)

    Deborah A. Rudnick; Sadie J. Ryan; Paul Beier; Samuel A. Cushman; Fred Dieffenbach; Clinton W. Epps; Leah R. Gerber; Joel Hartter; Jeff S. Jenness; Julia Kintsch; Adina M. Merenlender; Ryan M. Perkl; Damian V. Preziosi; Stephen C. Trombulak

    2012-01-01

    Landscape connectivity, the extent to which a landscape facilitates the movements of organisms and their genes, faces critical threats from both fragmentation and habitat loss. Many conservation efforts focus on protecting and enhancing connectivity to offset the impacts of habitat loss and fragmentation on biodiversity conservation, and to increase the resilience of...

  5. Angular correlations and fragmentation in intermediate energy heavy ion collisions

    International Nuclear Information System (INIS)

    Kristiansson, Anders.

    1990-05-01

    Intermediate energy heavy-ion collisions have been studied from 35 A MeV up to 94 A MeV at various accelerators. Angular correlations between light particles and detection of projectile- and target-fragments have been used to investigate the reaction mechanisms in this transition region between low- and high energy. An excess of correlations is observed in the particle-particle elastic scattering plane. This excess increases with particle mass and can be understood in terms of momentum conservation. The fragmentation measurements gives an indication that both energy and momentum transfer to the spectator volumes does occur. (author)

  6. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  7. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  8. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  9. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  10. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  11. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  12. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  13. Management of small fragment wounds in war: current research.

    Science.gov (United States)

    Bowyer, G W; Cooper, G J; Rice, P

    1995-03-01

    The majority of war wounds are caused by antipersonnel fragments from munitions such as mortars and bomblets. Modern munitions aim to incapacitate soldiers with multiple wounds from very small fragments of low available kinetic energy. Many of these fragments may be stopped by helmets and body armour and this has led to a predominance of multiple wounds to limbs in those casualties requiring surgery. The development of an appropriate management strategy for these multiple wounds requires knowledge of the contamination and extent of soft tissue injury; conservative management may be appropriate. The extent of skin and muscle damage associated with a small fragment wound, the way in which these wounds may progress without intervention and their colonisation by bacteria has been determined in an experimental animal model. Results from 12 animals are presented. There was a very small (approximately 1 mm) margin of nonviable skin around the entrance wound. The amount of devitalised muscle in the wound tract was a few hundred milligrams. Some muscles peripheral to the wound track also showed signs of damage 1 h after wounding, but this improved over 24 h; the proportion of fragmented muscle fibres in the tissue around the track decreased as time went on. There was no clinical sign or bacteriological evidence of the track becoming infected up to 24 h after wounding. This preliminary work suggests that, in the absence of infection, the amount of muscle damage caused by small fragment wounds begins to resolve in the first 24 h after injury, even without surgical intervention.

  14. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  15. SCit: web tools for protein side chain conformation analysis.

    Science.gov (United States)

    Gautier, R; Camproux, A-C; Tufféry, P

    2004-07-01

    SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.

  16. SCit: web tools for protein side chain conformation analysis

    OpenAIRE

    Gautier, R.; Camproux, A.-C.; Tufféry, P.

    2004-01-01

    SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...

  17. Conservation implications when the next predators are known. Chapter 2

    Science.gov (United States)

    Frank R., III Thompson; Christine A. Ribic

    2012-01-01

    Conservation and management of passerines has largely focused on habitat manipulation or restoration because the natural communities on which these birds depend have been destroyed and fragmented. However, productivity is another important aspect of avian conservation, and nest predation can be a large source of nesting mortality for passerines. Recent studies using...

  18. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  19. Effects of forest fragmentation on nocturnal Asian birds: A case study from Xishuangbanna, China

    Science.gov (United States)

    DAYANANDA, Salindra K.; GOODALE, Eben; LEE, Myung-bok; LIU, Jia-Jia; MAMMIDES, Christos; PASION, Bonifacio O.; QUAN, Rui-Chang; SLIK, J. W. Ferry; SREEKAR, Rachakonda; TOMLINSON, Kyle W.; YASUDA, Mika

    2016-01-01

    Owls have the potential to be keystone species for conservation in fragmented landscapes, as the absence of these predators could profoundly change community structure. Yet few studies have examined how whole communities of owls respond to fragmentation, especially in the tropics. When evaluating the effect of factors related to fragmentation, such as fragment area and distance to the edge, on these birds, it is also important in heterogeneous landscapes to ask how ‘location factors’ such as the topography, vegetation and soil of the fragment predict their persistence. In Xishuangbanna, southwest China, we established 43 transects (200 m×60 m) within 20 forest fragments to sample nocturnal birds, both visually and aurally. We used a multimodel inference approach to identify the factors that influence owl species richness, and generalized linear mixed models to predict the occurrence probabilities of each species. We found that fragmentation factors dominated location factors, with larger fragments having more species, and four of eight species were significantly more likely to occur in large fragments. Given the potential importance of these birds on regulating small mammal and other animal populations, and thus indirectly affecting seed dispersal, we suggest further protection of large fragments and programs to increase their connectivity to the remaining smaller fragments. PMID:27265653

  20. Effects of forest fragmentation on nocturnal Asian birds: A case study from Xishuangbanna, China

    Directory of Open Access Journals (Sweden)

    Salindra K. DAYANANDA

    2016-05-01

    Full Text Available Owls have the potential to be keystone species for conservation in fragmented landscapes, as the absence of these predators could profoundly change community structure. Yet few studies have examined how whole communities of owls respond to fragmentation, especially in the tropics. When evaluating the effect of factors related to fragmentation, such as fragment area and distance to the edge, on these birds, it is also important in heterogeneous landscapes to ask how ‘location factors’ such as the topography, vegetation and soil of the fragment predict their persistence. In Xishuangbanna, southwest China, we established 43 transects (200 m×60 m within 20 forest fragments to sample nocturnal birds, both visually and aurally. We used a multimodel inference approach to identify the factors that influence owl species richness, and generalized linear mixed models to predict the occurrence probabilities of each species. We found that fragmentation factors dominated location factors, with larger fragments having more species, and four of eight species were significantly more likely to occur in large fragments. Given the potential importance of these birds on regulating small mammal and other animal populations, and thus indirectly affecting seed dispersal, we suggest further protection of large fragments and programs to increase their connectivity to the remaining smaller fragments.

  1. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  2. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  3. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  4. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  5. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  6. Targeted habitat restoration can reduce extinction rates in fragmented forests.

    Science.gov (United States)

    Newmark, William D; Jenkins, Clinton N; Pimm, Stuart L; McNeally, Phoebe B; Halley, John M

    2017-09-05

    The Eastern Arc Mountains of Tanzania and the Atlantic Forest of Brazil are two of the most fragmented biodiversity hotspots. Species-area relationships predict that their habitat fragments will experience a substantial loss of species. Most of these extinctions will occur over an extended time, and therefore, reconnecting fragments could prevent species losses and allow locally extinct species to recolonize former habitats. An empirical relaxation half-life vs. area relationship for tropical bird communities estimates the time that it takes to lose one-half of all species that will be eventually lost. We use it to estimate the increase in species persistence by regenerating a forest connection 1 km in width among the largest and closest fragments at 11 locations. In the Eastern Arc Mountains, regenerating 8,134 ha of forest would create >316,000 ha in total of restored contiguous forest. More importantly, it would increase the persistence time for species by a factor of 6.8 per location or ∼2,272 years, on average, relative to individual fragments. In the Atlantic Forest, regenerating 6,452 ha of forest would create >251,000 ha in total of restored contiguous forest and enhance species persistence by a factor of 13.0 per location or ∼5,102 years, on average, relative to individual fragments. Rapidly regenerating forest among fragments is important, because mean time to the first determined extinction across all fragments is 7 years. We estimate the cost of forest regeneration at $21-$49 million dollars. It could provide one of the highest returns on investment for biodiversity conservation worldwide.

  7. FLORULA URBAN FRAGMENT OF TROPICAL DRY FOREST

    Directory of Open Access Journals (Sweden)

    Willington Barranco-Pérez

    2016-01-01

    Full Text Available The aim of this study was to record the composition of plant species in an urban fragment of tropical dry forest of secondary regeneration (bs-T to generate information that can be used in the planning and management of green spaces in the city of Santa Marta. Transects of 2 x 50 m were established equivalent to 0.1 ha and all species were counted >1.0 cm DBH (Diameter at Breast Height: 1.3m. 100 species of angiosperms were recorded of which 47% have herbaceous habit. The number of species recorded in this study represents 39.6% of the species reported for the hills of Santa Marta and 3.8% for the dry forests of Colombia. It is suggested to isolate this type of secondary formations of any intervention and contemplate the reintroduction of individuals and conservation strategies.

  8. Recombinant fragment of an antibody tailored for direct radioiodination

    Czech Academy of Sciences Publication Activity Database

    Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína

    2012-01-01

    Roč. 55, č. 1 (2012), s. 52-56 ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012

  9. Jet mass dependence of fragmentation in positron-proton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)

    2017-02-15

    We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)

  10. Kinetics of a Migration-Driven Aggregation-Fragmentation Process

    Institute of Scientific and Technical Information of China (English)

    ZHUANGYou-Yi; LINZhen-Quan; KEJian-Hon~

    2003-01-01

    We propose a reversible model of the migration-driven aggregation-fragmentation process with the symmetric migration rate kernels K (k; j) = K′(k; j) =λkjv and the constant aggregation rates I1, I2 and fragmentation rates Jl, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions in several cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When Jl = 0 and J2 = O, the aggregate size distributions αk(t) and bk(t) obey the conventional scaling law, while when Jl > 0 and J2 > O, they obey the modified scaling law with an exponential scaling function. The total mass of either species remains conserved.

  11. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  12. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  13. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  14. QGP and Modified Jet Fragmentation

    International Nuclear Information System (INIS)

    Wang, Xin-Nian

    2005-01-01

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

  15. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  16. Consequences of habitat fragmentation on genetic structure of Chamaedorea alternans (Arecaceae) palm populations in the tropical rain forests of Los Tuxtlas, Veracruz, Mexico

    OpenAIRE

    Peñaloza-Ramírez, Juan Manuel; Aguilar-Amezquita, Bernardo; Núñez-Farfán, Juan; Pérez-Nasser, Nidia; Albarrán-Lara, Ana Luisa; Oyama, Ken

    2016-01-01

    Abstract: Chamaedorea alternans is a palm species that has suffered from selective extraction, and habitat loss. We collected 11 populations from fragmented and conserved forest. We assess genetic variation of C. alternans, genetic exchange, differentiation, bottlenecks, effective population size and signals of natural selection. Genetic diversity was higher in conserved than in fragmented forest but not significant. Fragmentation did not play a significant role in genetic diversity, possibly...

  17. Synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F.

    Science.gov (United States)

    Roy, Sudeshna; Spilling, Christopher D

    2010-11-19

    A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.

  18. Synthesis of the C(18)–C(34) Fragment of Amphidinolide C and the C(18)–C(29) Fragment of Amphidinolide F

    Science.gov (United States)

    Roy, Sudeshna; Spilling, Christopher D.

    2010-01-01

    A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791

  19. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  20. Threshold Switching Induced by Controllable Fragmentation in Silver Nanowire Networks.

    Science.gov (United States)

    Wan, Tao; Pan, Ying; Du, Haiwei; Qu, Bo; Yi, Jiabao; Chu, Dewei

    2018-01-24

    Silver nanowire (Ag NW) networks have been widely studied because of a great potential in various electronic devices. However, nanowires usually undergo a fragmentation process at elevated temperatures due to the Rayleigh instability that is a result of reduction of surface/interface energy. In this case, the nanowires become completely insulating due to the formation of randomly distributed Ag particles with a large distance and further applications are hindered. Herein, we demonstrate a novel concept based on the combination of ultraviolet/ozone irradiation and a low-temperature annealing process to effectively utilize and control the fragmentation behavior to realize the resistive switching performances. In contrast to the conventional fragmentation, the designed Ag/AgO x interface facilitates a unique morphology of short nanorod-like segments or chains of tiny Ag nanoparticles with a very small spacing distance, providing conduction paths for achieving the tunneling process between the isolated fragments under the electric field. On the basis of this specific morphology, the Ag NW network has a tunable resistance and shows volatile threshold switching characteristics with a high selectivity, which is the ON/OFF current ratio in selector devices. Our concept exploits a new function of Ag NW network, i.e., resistive switching, which can be developed by designing a controllable fragmentation.

  1. Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen, produced by plasmin (fragments X)

    NARCIS (Netherlands)

    Nieuwenhuizen, W.; Gravesen, M.

    1981-01-01

    Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and

  2. Detecting fragmentation extinction thresholds for forest understory plant species in peninsular Spain.

    Science.gov (United States)

    Rueda, Marta; Moreno Saiz, Juan Carlos; Morales-Castilla, Ignacio; Albuquerque, Fabio S; Ferrero, Mila; Rodríguez, Miguel Á

    2015-01-01

    Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist) varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although forest amount is of

  3. Detecting fragmentation extinction thresholds for forest understory plant species in peninsular Spain.

    Directory of Open Access Journals (Sweden)

    Marta Rueda

    Full Text Available Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although

  4. Forest edge disturbance increases rattan abundance in tropical rain forest fragments.

    Science.gov (United States)

    Campbell, Mason J; Edwards, Will; Magrach, Ainhoa; Laurance, Susan G; Alamgir, Mohammed; Porolak, Gabriel; Laurance, William F

    2017-07-20

    Human-induced forest fragmentation poses one of the largest threats to global diversity yet its impact on rattans (climbing palms) has remained virtually unexplored. Rattan is arguably the world's most valuable non-timber forest product though current levels of harvesting and land-use change place wild populations at risk. To assess rattan response to fragmentation exclusive of harvesting impacts we examined rattan abundance, demography and ecology within the forests of northeastern, Australia. We assessed the community abundance of rattans, and component adult (>3 m) and juvenile (≤3 m) abundance in five intact forests and five fragments (23-58 ha) to determine their response to a range of environmental and ecological parameters. Fragmented forests supported higher abundances of rattans than intact forests. Fragment size and edge degradation significantly increased adult rattan abundance, with more in smaller fragments and near edges. Our findings suggest that rattan increase within fragments is due to canopy disturbance of forest edges resulting in preferential, high-light habitat. However, adult and juvenile rattans may respond inconsistently to fragmentation. In managed forest fragments, a rattan abundance increase may provide economic benefits through sustainable harvesting practices. However, rattan increases in protected area forest fragments could negatively impact conservation outcomes.

  5. Diets of swift foxes (Vulpes velox) in continuous and fragmented prairie in Northwestern Texas

    Science.gov (United States)

    Kamler, J.F.; Ballard, W.B.; Wallace, M.C.; Gipson, P.S.

    2007-01-01

    Distribution of the swift fox (Vulpes velox) has declined dramatically since the 1800s, and suggested causes of this decline are habitat fragmentation and transformation due to agricultural expansion. However, impacts of fragmentation and human-altered habitats on swift foxes still are not well understood. To better understand what effects these factors have on diets of swift foxes, scats were collected in northwestern Texas at two study sites, one of continuous native prairie and one representing fragmented native prairie interspersed with agricultural and fields in the Conservation Reserve Program. Leporids, a potential food source, were surveyed seasonally on both sites. Diets of swift foxes differed between sites; insects were consumed more on continuous prairie, whereas mammals, birds, and crops were consumed more on fragmented prairie. Size of populations of leporids were 2-3 times higher on fragmented prairie, and swift foxes responded by consuming more leporids on fragmented (11.1% frequency occurrence) than continuous (3.8%) prairie. Dietary diversity was greater on fragmented prairie during both years of the study. Differences in diets between sites suggested that the swift fox is an adaptable and opportunistic feeder, able to exploit a variety of food resources, probably in relation to availability of food. We suggest that compared to continuous native prairie, fragmented prairie can offer swift foxes a more diverse prey base, at least within the mosaic of native prairie, agricultural, and fields that are in the Conservation Reserve Program.

  6. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  7. Aging: fruit flies break the chain to a longer life.

    Science.gov (United States)

    Linford, Nancy J; Pletcher, Scott D

    2009-10-13

    Mitochondria have long had an enigmatic role in the biology of aging. New research in Drosophila reveals an evolutionarily conserved function for the mitochondrial electron transport chain in the modulation of animal lifespan.

  8. Memory effects in nuclear fragmentation?

    International Nuclear Information System (INIS)

    Colonna, M.; Di Toro, M.; Guarnera, A.

    1994-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

  9. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  10. An efficient method for isolating antibody fragments against small peptides by antibody phage display

    DEFF Research Database (Denmark)

    Duan, Zhi; Siegumfeldt, Henrik

    2010-01-01

    We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

  11. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  12. Edge-effect interactions in fragmented and patchy landscapes.

    Science.gov (United States)

    Porensky, Lauren M; Young, Truman P

    2013-06-01

    Ecological edges are increasingly recognized as drivers of landscape patterns and ecosystem processes. In fragmented and patchy landscapes (e.g., a fragmented forest or a savanna with scattered termite mounds), edges can become so numerous that their effects pervade the entire landscape. Results of recent studies in such landscapes show that edge effects can be altered by the presence or proximity of other nearby edges. We considered the theoretical significance of edge-effect interactions, illustrated various landscape configurations that support them and reviewed existing research on this topic. Results of studies from a variety of locations and ecosystem types show that edge-effect interactions can have significant consequences for ecosystems and conservation, including higher tree mortality rates in tropical rainforest fragments, reduced bird densities in grassland fragments, and bush encroachment and reduced wildlife densities in a tropical savanna. To clarify this underappreciated concept and synthesize existing work, we devised a conceptual framework for edge-effect interactions. We first worked to reduce terminological confusion by clarifying differences among terms such as edge intersection and edge interaction. For cases in which nearby edge effects interact, we proposed three possible forms of interaction: strengthening (presence of a second edge causes stronger edge effects), weakening (presence of a second edge causes weaker edge effects), and emergent (edge effects change completely in the presence of a second edge). By clarifying terms and concepts, this framework enables more precise descriptions of edge-effect interactions and facilitates comparisons of results among disparate study systems and response variables. A better understanding of edge-effect interactions will pave the way for more appropriate modeling, conservation, and management in complex landscapes. © 2013 Society for Conservation Biology.

  13. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  14. Refolding Technologies for Antibody Fragments

    Directory of Open Access Journals (Sweden)

    Tsutomu Arakawa

    2014-05-01

    Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.

  15. Plug and Play Firms in the TNCs' Virtual Value Chain

    Directory of Open Access Journals (Sweden)

    Teresa Pakulska

    2016-04-01

    Full Text Available Growing virtualisation of the value chain appears to be an expression of implementation of ICT solutions in international business represented by TNCs. This creates new opportunities for cooperation within the value chain and its composition. The growing importance in this area can be attributed to companies integrating the value chain, known as plug and play. Their integration into the value creation chain gives a new dimension to TNCs' strategic choices from the fragmentation of activity and its integration on an international scale point of view.

  16. CHAINS-PC, Decay Chain Atomic Densities

    International Nuclear Information System (INIS)

    1994-01-01

    1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain

  17. Fragmentation of atomic clusters: A theoretical study

    International Nuclear Information System (INIS)

    Lopez, M.J.; Jellinek, J.

    1994-01-01

    Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

  18. Charge distributions and correlations in fragmentation models for soft hadron collisions

    International Nuclear Information System (INIS)

    Wolf, E.A. de

    1984-01-01

    Data on charge distributions and charge correlations in pp and meson-proton interactions at PS and SPS energies are successfully compared with the Lund fragmentation model for low-psub(T) hadron collisions. It is argued that local conservation of quantum numbers and resonance production, as implemented in fragmentation models, are sufficient ingredients to explain most of the available experimental results at these energies. No necessity is found for dual-sheet contributions considered in DTU-based parton models. (orig.)

  19. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  20. Fission fragment driven neutron source

    Science.gov (United States)

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  1. Developments in SPR Fragment Screening.

    Science.gov (United States)

    Chavanieu, Alain; Pugnière, Martine

    2016-01-01

    Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

  2. Nuclear fragmentation by nucleation approach

    International Nuclear Information System (INIS)

    Chung, K.C.

    1992-01-01

    The nucleation model is used to simulate nuclear fragmentation processes. The critical value of the effective interaction radius is shown to vary linearly with the expansion factor α. The calculated mass and charge distributions are compared with some experimental data. (author)

  3. Neutron multiplicity of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)

    1995-10-01

    The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.

  4. Fragmented nature: consequences for biodiversity

    NARCIS (Netherlands)

    Olff, H.; Ritchie, M.E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  5. Fragmented nature : consequences for biodiversity

    NARCIS (Netherlands)

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  6. Research of nuclear fragmentation characteristics

    International Nuclear Information System (INIS)

    Richert, J.

    1989-01-01

    Motivations for the study of nuclear fragmentation are presented. Different models and methods which were developed in the past are reviewed, critically discussed and confronted in connection with the experimental information gathered over the past years. Specific aspects related to the onset of the process, its characteristics and the mechanism which governs it are discussed [fr

  7. FRAGMENTED IDENTITIES: THE CULTURAL COLLISION ...

    African Journals Online (AJOL)

    User

    Born in the former French and German colony of. Togo, Komla-Ebri ... of how cultural barriers not only lead to isolation and fragmented identities, but also ..... and, in recreating bits of Italy, in the form of music, cinema and food, absorbs parts of ...

  8. Phthalocyanides sensitized fragmentation of proteins

    Czech Academy of Sciences Publication Activity Database

    Klementová, S.; Tothová, D.; Revaková, R.; Kasková, M.; Wagnerová, Dana Marie

    2001-01-01

    Roč. 5, č. 1 (2001), s. 13-18 ISSN 0972-0626 R&D Projects: GA ČR GA203/96/1322 Institutional research plan: CEZ:AV0Z4032918 Keywords : phthalocyanides * photosensitied fragmentation of proteins Subject RIV: CA - Inorganic Chemistry

  9. Importance of riparian remnants for frog species diversity in a highly fragmented rainforest.

    Science.gov (United States)

    Rodríguez-Mendoza, Clara; Pineda, Eduardo

    2010-12-23

    Tropical forests undergo continuous transformation to other land uses, resulting in landscapes typified by forest fragments surrounded by anthropogenic habitats. Small forest fragments, specifically strip-shaped remnants flanking streams (referred to as riparian remnants), can be particularly important for the maintenance and conservation of biodiversity within highly fragmented forests. We compared frog species diversity between riparian remnants, other forest fragments and cattle pastures in a tropical landscape in Los Tuxtlas, Mexico. We found similar species richness in the three habitats studied and a similar assemblage structure between riparian remnants and forest fragments, although species composition differed by 50 per cent. Frog abundance was halved in riparian remnants compared with forest fragments, but was twice that found in pastures. Our results suggest that riparian remnants play an important role in maintaining a portion of frog species diversity in a highly fragmented forest, particularly during environmentally stressful (hot and dry) periods. In this regard, however, the role of riparian remnants is complementary, rather than substitutive, with respect to the function of other forest fragments within the fragmented forest.

  10. Monoclonal antibody fragment removal mediated by mixed mode resins.

    Science.gov (United States)

    O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William

    2017-05-26

    Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities

  11. A probabilistic fragment-based protein structure prediction algorithm.

    Directory of Open Access Journals (Sweden)

    David Simoncini

    Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].

  12. The VERDI fission fragment spectrometer

    Directory of Open Access Journals (Sweden)

    Frégeau M.O.

    2013-12-01

    Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

  13. Supply chains in global production

    Directory of Open Access Journals (Sweden)

    Anatolii Mazaraki

    2017-10-01

    Full Text Available Introduction. Analyzing the current processes of global sales and sales interaction over the past two decades shows that the world’s system of exchanges has undergone significant changes that have been caused by a multitude of factors. The formation of a complex model of global production, determined by the peculiarities of the transformation of individual economies’ growth models, the specifics of their industrialization and the forms of development of their national production business, its institutional and market-wise restructuring and the degree of inclusion in the system of international division of labor. The change in the level and depth of the specialization of individual countries in the field of production and sale of products, in turn, has accelerated the overcoming of economic distance (which is measured by the cost of transport and information services. Based on the above, namely, within the framework of forming a new model of global production, the issue of studying the role and value of supply chains in this model is made relevant. Aim and tasks. The purpose of the article is to study the modern transformation of supply chains within the global production system. The findings will allow to determine what exactly needs to be done in the direction of further redeveloping the regulatory tools of global supply chain management. Research results. The article presents the results of studying the transformation of supply chains’ role in global production. It is determined that taking into account the existing specificity of industrialization and fragmentation of national production, as well as the rapid spread of the results of scientific and technological progress in the world economy, there is a need for a more thorough study of this change. As a result of analyzing open source statistical data, a conclusion was reached regarding the transition from the competition of individual business entities to the competition of global

  14. Logistic chain modelling

    NARCIS (Netherlands)

    Slats, P.A.; Bhola, B.; Evers, J.J.M.; Dijkhuizen, G.

    1995-01-01

    Logistic chain modelling is very important in improving the overall performance of the total logistic chain. Logistic models provide support for a large range of applications, such as analysing bottlenecks, improving customer service, configuring new logistic chains and adapting existing chains to

  15. Secondary forest regeneration benefits old-growth specialist bats in a fragmented tropical landscape.

    Science.gov (United States)

    Rocha, Ricardo; Ovaskainen, Otso; López-Baucells, Adrià; Farneda, Fábio Z; Sampaio, Erica M; Bobrowiec, Paulo E D; Cabeza, Mar; Palmeirim, Jorge M; Meyer, Christoph F J

    2018-02-28

    Tropical forest loss and fragmentation are due to increase in coming decades. Understanding how matrix dynamics, especially secondary forest regrowth, can lessen fragmentation impacts is key to understanding species persistence in modified landscapes. Here, we use a whole-ecosystem fragmentation experiment to investigate how bat assemblages are influenced by the regeneration of the secondary forest matrix. We surveyed bats in continuous forest, forest fragments and secondary forest matrix habitats, ~15 and ~30 years after forest clearance, to investigate temporal changes in the occupancy and abundance of old-growth specialist and habitat generalist species. The regeneration of the second growth matrix had overall positive effects on the occupancy and abundance of specialists across all sampled habitats. Conversely, effects on generalist species were negligible for forest fragments and negative for secondary forest. Our results show that the conservation potential of secondary forests for reverting faunal declines in fragmented tropical landscapes increases with secondary forest age and that old-growth specialists, which are often of most conservation concern, are the greatest beneficiaries of secondary forest maturation. Our findings emphasize that the transposition of patterns of biodiversity persistence in island ecosystems to fragmented terrestrial settings can be hampered by the dynamic nature of human-dominated landscapes.

  16. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    International Nuclear Information System (INIS)

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  17. The Buccaneer software for automated model building. 1. Tracing protein chains.

    Science.gov (United States)

    Cowtan, Kevin

    2006-09-01

    A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.

  18. Beyond the fragmentation threshold hypothesis: regime shifts in biodiversity across fragmented landscapes.

    Directory of Open Access Journals (Sweden)

    Renata Pardini

    Full Text Available Ecological systems are vulnerable to irreversible change when key system properties are pushed over thresholds, resulting in the loss of resilience and the precipitation of a regime shift. Perhaps the most important of such properties in human-modified landscapes is the total amount of remnant native vegetation. In a seminal study Andrén proposed the existence of a fragmentation threshold in the total amount of remnant vegetation, below which landscape-scale connectivity is eroded and local species richness and abundance become dependent on patch size. Despite the fact that species patch-area effects have been a mainstay of conservation science there has yet to be a robust empirical evaluation of this hypothesis. Here we present and test a new conceptual model describing the mechanisms and consequences of biodiversity change in fragmented landscapes, identifying the fragmentation threshold as a first step in a positive feedback mechanism that has the capacity to impair ecological resilience, and drive a regime shift in biodiversity. The model considers that local extinction risk is defined by patch size, and immigration rates by landscape vegetation cover, and that the recovery from local species losses depends upon the landscape species pool. Using a unique dataset on the distribution of non-volant small mammals across replicate landscapes in the Atlantic forest of Brazil, we found strong evidence for our model predictions--that patch-area effects are evident only at intermediate levels of total forest cover, where landscape diversity is still high and opportunities for enhancing biodiversity through local management are greatest. Furthermore, high levels of forest loss can push native biota through an extinction filter, and result in the abrupt, landscape-wide loss of forest-specialist taxa, ecological resilience and management effectiveness. The proposed model links hitherto distinct theoretical approaches within a single framework

  19. Gene flow and effective population sizes of the butterfly Maculinea alcon in a highly fragmented, anthropogenic landscape

    NARCIS (Netherlands)

    Vanden Broeck, An; Maes, Dirk; Kelager, Andreas; Wynhoff, Irma; Wallis de Vries, Michiel; Nash, David R.; Oostermeijer, J.G.B.; Dyck, van Hans; Mergeay, Joachim

    2017-01-01

    Understanding connectivity among populations in fragmented landscapes is of paramount importance in species conservation because it determines their long-term viability and helps to identify and prioritize populations to conserve. Rare and sedentary species are particularly vulnerable to habitat

  20. How conserved are the conserved 16S-rRNA regions?

    Directory of Open Access Journals (Sweden)

    Marcel Martinez-Porchas

    2017-02-01

    Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.

  1. Fragments

    Science.gov (United States)

    Moreira, Claudio

    2008-01-01

    This performance autoethnography shows the author's struggle in finding his place, scholarship, voice, and body, into the academic setting. Mixing together memories of his lived experience with sugar cane workers, notes, and leftovers of different fieldworks, plus 6 years of life as grad student at the University of Illinois, the author looks for…

  2. Fragmentation

    Science.gov (United States)

    K.H. Riitters

    2009-01-01

    Effective resource management takes into account the administrative and biophysical settings within which natural resources occur. A setting may be described in many ways; for example, by forest land ownership, by reserved and roadless designation, or by the distribution of human populations in relation to forest (chapter 3). The physical arrangement of forest in a...

  3. Diverse Effects of a Seven-Year Experimental Grassland Fragmentation on Major Invertebrate Groups.

    Science.gov (United States)

    Braschler, Brigitte; Baur, Bruno

    2016-01-01

    Habitat fragmentation is a major driver of biodiversity loss, but observed effects vary and may depend on the group examined. Time since fragmentation may explain some differences between taxonomical groups, as some species and thus species composition respond with a delay to changes in their environment. Impacts of drivers of global change may thus be underestimated in short-term studies. In our study we experimentally fragmented nutrient-poor dry calcareous grasslands and studied the response of species richness, individual density and species composition of various groups of invertebrates (gastropods, ants, ground beetles, rove beetles, orthoptera, spiders, woodlice) in 12 small (1.5 m * 1.5 m) and 12 large (4.5 m * 4.5 m) fragments and their corresponding control plots after 7 years. We further examined responses to fragmentation in relation to body size and habitat preferences. Responses to fragmentation varied between taxonomical groups. While spider species richness and individual density were lower in fragments, the opposite was true for an orthopteran species and woodlice. Species composition and β-diversity differed between fragments and control plots for some groups. However, the interaction treatment*plot size was rarely significant. Species with high occupancy rates in undisturbed control plots responded more negatively to the fragmentation, while species with large body size were relatively more abundant in fragments in some groups. No effect of the fragmentation was found for ants, which may have the longest lag times because of long-lived colonies. However, relationships between abundance and the species' preferences for environmental factors affected by edge effects indicate that ant diversity too may be affected in the longer-term. Our results show the importance of considering different groups in conservation management in times of widespread fragmentation of landscapes. While species richness may respond slowly, changes in abundance related to

  4. Diverse Effects of a Seven-Year Experimental Grassland Fragmentation on Major Invertebrate Groups.

    Directory of Open Access Journals (Sweden)

    Brigitte Braschler

    Full Text Available Habitat fragmentation is a major driver of biodiversity loss, but observed effects vary and may depend on the group examined. Time since fragmentation may explain some differences between taxonomical groups, as some species and thus species composition respond with a delay to changes in their environment. Impacts of drivers of global change may thus be underestimated in short-term studies. In our study we experimentally fragmented nutrient-poor dry calcareous grasslands and studied the response of species richness, individual density and species composition of various groups of invertebrates (gastropods, ants, ground beetles, rove beetles, orthoptera, spiders, woodlice in 12 small (1.5 m * 1.5 m and 12 large (4.5 m * 4.5 m fragments and their corresponding control plots after 7 years. We further examined responses to fragmentation in relation to body size and habitat preferences. Responses to fragmentation varied between taxonomical groups. While spider species richness and individual density were lower in fragments, the opposite was true for an orthopteran species and woodlice. Species composition and β-diversity differed between fragments and control plots for some groups. However, the interaction treatment*plot size was rarely significant. Species with high occupancy rates in undisturbed control plots responded more negatively to the fragmentation, while species with large body size were relatively more abundant in fragments in some groups. No effect of the fragmentation was found for ants, which may have the longest lag times because of long-lived colonies. However, relationships between abundance and the species' preferences for environmental factors affected by edge effects indicate that ant diversity too may be affected in the longer-term. Our results show the importance of considering different groups in conservation management in times of widespread fragmentation of landscapes. While species richness may respond slowly, changes in

  5. Faunal Communities Are Invariant to Fragmentation in Experimental Seagrass Landscapes.

    Directory of Open Access Journals (Sweden)

    Jonathan S Lefcheck

    Full Text Available Human-driven habitat fragmentation is cited as one of the most pressing threats facing many coastal ecosystems today. Many experiments have explored the consequences of fragmentation on fauna in one foundational habitat, seagrass beds, but have either surveyed along a gradient of existing patchiness, used artificial materials to mimic a natural bed, or sampled over short timescales. Here, we describe faunal responses to constructed fragmented landscapes varying from 4-400 m2 in two transplant garden experiments incorporating live eelgrass (Zostera marina L.. In experiments replicated within two subestuaries of the Chesapeake Bay, USA across multiple seasons and non-consecutive years, we comprehensively censused mesopredators and epifaunal communities using complementary quantitative methods. We found that community properties, including abundance, species richness, Simpson and functional diversity, and composition were generally unaffected by the number of patches and the size of the landscape, or the intensity of sampling. Additionally, an index of competition based on species co-occurrences revealed no trends with increasing patch size, contrary to theoretical predictions. We extend conclusions concerning the invariance of animal communities to habitat fragmentation from small-scale observational surveys and artificial experiments to experiments conducted with actual living plants and at more realistic scales. Our findings are likely a consequence of the rapid life histories and high mobility of the organisms common to eelgrass beds, and have implications for both conservation and restoration, suggesting that even small patches can rapidly promote abundant and diverse faunal communities.

  6. Energy production using fission fragment rockets

    International Nuclear Information System (INIS)

    Chapline, G.; Matsuda, Y.

    1991-08-01

    Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

  7. Mutations in specific structural regions of immunoglobulin light chains are associated with free light chain levels in patients with AL amyloidosis.

    Directory of Open Access Journals (Sweden)

    Tanya L Poshusta

    Full Text Available BACKGROUND: The amyloidoses are protein misfolding diseases characterized by the deposition of amyloid that leads to cell death and tissue degeneration. In immunoglobulin light chain amyloidosis (AL, each patient has a unique monoclonal immunoglobulin light chain (LC that forms amyloid deposits. Somatic mutations in AL LCs make these proteins less thermodynamically stable than their non-amyloidogenic counterparts, leading to misfolding and ultimately the formation of amyloid fibrils. We hypothesize that location rather than number of non-conservative mutations determines the amyloidogenicity of light chains. METHODOLOGY/PRINCIPAL FINDINGS: We performed sequence alignments on the variable domain of 50 kappa and 91 lambda AL light chains and calculated the number of non-conservative mutations over total number of patients for each secondary structure element in order to identify regions that accumulate non-conservative mutations. Among patients with AL, the levels of circulating immunoglobulin free light chain varies greatly, but even patients with very low levels can have very advanced amyloid deposition. CONCLUSIONS: Our results show that in specific secondary structure elements, there are significant differences in the number of non-conservative mutations between normal and AL sequences. AL sequences from patients with different levels of secreted light chain have distinct differences in the location of non-conservative mutations, suggesting that for patients with very low levels of light chains and advanced amyloid deposition, the location of non-conservative mutations rather than the amount of free light chain in circulation may determine the amyloidogenic propensity of light chains.

  8. Fragmentation of suddenly heated liquids

    International Nuclear Information System (INIS)

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion

  9. Fragment separator momentum compression schemes

    Energy Technology Data Exchange (ETDEWEB)

    Bandura, Laura, E-mail: bandura@anl.gov [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Erdelyi, Bela [Argonne National Laboratory, Argonne, IL 60439 (United States); Northern Illinois University, DeKalb, IL 60115 (United States); Hausmann, Marc [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Kubo, Toshiyuki [RIKEN Nishina Center, RIKEN, Wako (Japan); Nolen, Jerry [Argonne National Laboratory, Argonne, IL 60439 (United States); Portillo, Mauricio [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Sherrill, Bradley M. [National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States)

    2011-07-21

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  10. Fragment separator momentum compression schemes

    International Nuclear Information System (INIS)

    Bandura, Laura; Erdelyi, Bela; Hausmann, Marc; Kubo, Toshiyuki; Nolen, Jerry; Portillo, Mauricio; Sherrill, Bradley M.

    2011-01-01

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  11. Asymmetry effects in fragment production

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet [Sri Guru Granth Sahib World University, Fatehgarh Sahib-140406, Punjab (India); Kaur, Varinderjit, E-mail: drvarinderjit@gmail.com [Mata Gujri College, Fatehgarh Sahib-140406, Punjab (India)

    2016-05-06

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping At{sub otal} fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of {sup 197}Au+{sup 27}Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  12. Fragmentation of percolation cluster perimeters

    Science.gov (United States)

    Debierre, Jean-Marc; Bradley, R. Mark

    1996-05-01

    We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

  13. Kinetics of a Migration-Driven Aggregation-Fragmentation Process

    Institute of Scientific and Technical Information of China (English)

    ZHUANG You-Yi; LIN Zhen-Quan; KE Jian-Hong

    2003-01-01

    We propose a reversible model of the migration-driven aggregation-fragmentation process with the sym-metric migration rate kernels K(k;j) = K'(k;j) = λkjv and the constant aggregation rates I1, I2 and fragmentationrates J1, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions inseveral cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When J1 = 0 and J2 = 0, the aggregate sizedistributions ak(t) and bk(t) obey the conventional scaling law, while when J1 > 0 and J2 > 0, they obey the modifiedscaling law with an exponential scaling function. The total mass of either species remains conserved.

  14. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  15. Fragmented nature: consequences for biodiversity

    OpenAIRE

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species with different size and mobility can be regulated by different processes at the same spatial scale, a principle that may contribute to diversity. Differences in species richness between local commu...

  16. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  17. Sustainable Supply Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy

    A significant conceptual and practical challenge is how to integrate triple bottom line (TBL; including economic, social and environmental) sustainability into global supply chains. Although this integration is necessary to slow down global resource depletion, understanding is limited of how...... to implement TBL goals across the supply chain. In supply chain design, the classic economic perspective still dominates, although the idea of the TBL is more widely disseminated. The purpose of this research is to add to the sustainable supply chain management literature (SSCM) research agenda...... by incorporating the physical chain, and the (information and financial) support chains into supply chain design. This manuscript tackles issues of what the chains are designed for and how they are designed structurally. Four sustainable businesses are used as illustrative case examples of innovative supply chain...

  18. Beta-scission of side-chain alkoxyl radicals on peptides and proteins results in the loss of side-chains as aldehydes and ketones

    DEFF Research Database (Denmark)

    Headlam, Henrietta A; Davies, Michael Jonathan

    2002-01-01

    Exposure of proteins to radicals in the presence of O(2) results in side-chain oxidation and backbone fragmentation; the interrelationship between these processes is not fully understood. Recently, initial attack on Ala side-chains was shown to give alpha-carbon radicals (and hence backbone cleav...

  19. Residual Fragments after Percutaneous Nephrolithotomy

    Directory of Open Access Journals (Sweden)

    Kaan Özdedeli

    2012-09-01

    Full Text Available Clinically insignificant residual fragments (CIRFs are described as asymptomatic, noninfectious and nonobstructive stone fragments (≤4 mm remaining in the urinary system after the last session of any intervention (ESWL, URS or PCNL for urinary stones. Their insignificance is questionable since CIRFs could eventually become significant, as their presence may result in recurrent stone growth and they may cause pain and infection due to urinary obstruction. They may become the source of persistent infections and a significant portion of the patients will have a stone-related event, requiring auxilliary interventions. CT seems to be the ultimate choice of assessment. Although there is no concensus about the timing, recent data suggests that it may be performed one month after the procedure. However, imaging can be done in the immediate postoperative period, if there are no tubes blurring the assessment. There is some evidence indicating that selective medical therapy may have an impact on decreasing stone formation rates. Retrograde intrarenal surgery, with its minimally invasive nature, seems to be the best way to deal with residual fragments.

  20. Fragmentation measurement using image processing

    Directory of Open Access Journals (Sweden)

    Farhang Sereshki

    2016-12-01

    Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

  1. Antiretroviral procurement and supply chain management.

    Science.gov (United States)

    Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril

    2014-01-01

    Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.

  2. The Nagoya Protocol: Fragmentation or Consolidation?

    Directory of Open Access Journals (Sweden)

    Carmen Richerzhagen

    2014-02-01

    Full Text Available In October, 2010, a protocol on access and benefit-sharing (ABS of genetic resources was adopted, the so-called Nagoya Protocol on Access to Genetic Resources and the Fair and Equitable Sharing of Benefits Arising from their Utilization to the Convention on Biological Diversity. Before the adoption of the Nagoya Protocol, the governance architecture of ABS was already characterized by a multifaceted institutional environment. The use of genetic resources is confronted with many issues (conservation, research and development, intellectual property rights, food security, health issues, climate change that are governed by different institutions and agreements. The Nagoya Protocol contributes to increased fragmentation. However, the question arises whether this new regulatory framework can help to advance the implementation of the ABS provisions of the Convention on Biological Diversity (CBD. This paper attempts to find an answer to that question by following three analytical steps. First, it analyzes the causes of change against the background of theories of institutional change. Second, it aims to assess the typology of the architecture in order to find out if this new set of rules will contribute to a more synergistic, cooperative or conflictive architecture of ABS governance. Third, the paper looks at the problem of “fit” and identifies criteria that can be used to assess the new ABS governance architecture with regard to its effectiveness.

  3. Geometrical scaling of jet fragmentation photons

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

    2016-12-15

    We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

  4. Conservation potential of agricultural water conservation subsidies

    Science.gov (United States)

    Huffaker, Ray

    2008-07-01

    A current policy subsidizes farmers to invest in improved on-farm irrigation efficiency, expecting water to be conserved off farm. Contrary to expectation, water has been increasingly depleted in some regions after such improvements. This paper investigates the policy's failure to conserve water consistently by (1) formulating an economic model of irrigated crop production to determine a profit-maximizing irrigator's range of responses to a subsidy and (2) embedding these responses into hypothetical streamflow diagrams to ascertain their potential to conserve water under various hydrologic regimes. Testable hypotheses are developed to predict the conservation potential of a subsidy in real-world application.

  5. Evolution equations for extended dihadron fragmentation functions

    International Nuclear Information System (INIS)

    Ceccopieri, F.A.; Bacchetta, A.

    2007-03-01

    We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

  6. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  7. Response of the agile antechinus to habitat edge, configuration and condition in fragmented forest.

    Directory of Open Access Journals (Sweden)

    Christopher P Johnstone

    Full Text Available Habitat fragmentation and degradation seriously threaten native animal communities. We studied the response of a small marsupial, the agile antechinus Antechinus agilis, to several environmental variables in anthropogenically fragmented Eucalyptus forest in south-east Australia. Agile antechinus were captured more in microhabitats dominated by woody debris than in other microhabitats. Relative abundances of both sexes were positively correlated with fragment core area. Male and female mass-size residuals were smaller in larger fragments. A health status indicator, haemoglobin-haematocrit residuals (HHR, did not vary as a function of any environmental variable in females, but male HHR indicated better health where sites' microhabitats were dominated by shrubs, woody debris and trees other than Eucalyptus. Females were trapped less often in edge than interior fragment habitat and their physiological stress level, indicated by the neutrophil/lymphocyte ratio in peripheral blood, was higher where fragments had a greater proportion of edge habitat. The latter trend was potentially due to lymphopoenia resulting from stress hormone-mediated leukocyte trafficking. Using multiple indicators of population condition and health status facilitates a comprehensive examination of the effects of anthropogenic disturbances, such as habitat fragmentation and degradation, on native vertebrates. Male agile antechinus' health responded negatively to habitat degradation, whilst females responded negatively to the proportion of edge habitat. The health and condition indicators used could be employed to identify conservation strategies that would make habitat fragments less stressful for this or similar native, small mammals.

  8. Are Plant Species’ Richness and Diversity Influenced by Fragmentation at a Microscale?

    Directory of Open Access Journals (Sweden)

    Jesús Aguirre-Gutiérrez

    2014-01-01

    Full Text Available It is argued that forest fragmentation has negative effects on biodiversity at the short and long term; however, these effects might be dependent on the specific vegetation of the study area and its intrinsic characteristics. The processes leading to fragmentation are very diverse and many of them have anthropogenic causes as logging actions and clearings for agricultural fields. Furthermore, it is thought that scale plays an important role in the expected effects of fragmentation on biodiversity. In this study the effect of forest fragmentation and its impact on the woody plants species, richness and diversity are analysed considering three vegetation types in a poorly studied and difficult access biodiversity hotspot in northern Mexico. The results show that the effects of fragmentation are dependent on the vegetation type and that these are not strongly related to the species richness, and diversity in a microscale (100 m2. Fragmentation effects on biodiversity must be analysed in a broad scale, considering the fragment as a whole. Furthermore, conservation priority should be given to the larger fragments, which could potentially maintain a higher portion of biodiversity. Management should also be focused on increasing the connectivity between these big and medium size forest patches.

  9. Causes of fragmented crystals in ignimbrites: a case study of the Cardones ignimbrite, Northern Chile

    Science.gov (United States)

    van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.

    2018-03-01

    Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can

  10. Properties, production and applications of camelid single-domain antibody fragments

    NARCIS (Netherlands)

    Harmsen, M.M.; Haard, de H.J.

    2007-01-01

    Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms

  11. International fragmentation af produktionen og vertikal disintegration af styringsformer i produktionskæderne

    DEFF Research Database (Denmark)

    Refslund, Bjarke

    Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...

  12. A recombinant, fully human monoclonal antibody with antitumor activity constructed from phage-displayed antibody fragments

    NARCIS (Netherlands)

    Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T

    A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell

  13. Photon-hadron fragmentation: theoretical situation

    International Nuclear Information System (INIS)

    Peschanski, R.

    1983-07-01

    Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

  14. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  15. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  16. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  17. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  18. Neighbouring charge fragmentations in low energy fission

    International Nuclear Information System (INIS)

    Montoya, M.

    1986-10-01

    Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

  19. Resilient networks of ant-plant mutualists in Amazonian forest fragments.

    Science.gov (United States)

    Passmore, Heather A; Bruna, Emilio M; Heredia, Sylvia M; Vasconcelos, Heraldo L

    2012-01-01

    The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions. We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments. We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.

  20. Resilient networks of ant-plant mutualists in Amazonian forest fragments.

    Directory of Open Access Journals (Sweden)

    Heather A Passmore

    Full Text Available The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions.We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments.We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.

  1. The Global Value Chain

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull

    The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool......The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool...

  2. Expression, production and renaturation of a functional single-chain ...

    African Journals Online (AJOL)

    The single-chain variable antibody fragment (scFv) against human intercellular adhesion molecule-1 (ICAM-1) was expressed at a high level in Escherichia coli as inclusion bodies. We attempted to refold the scFv by ion-exchange chromatography (IEC), dialysis and dilution. The results show that the column ...

  3. OECD Skills Outlook 2017: Skills and Global Value Chains

    Science.gov (United States)

    OECD Publishing, 2017

    2017-01-01

    Since the 1990s, the world has entered a new phase of globalisation. Information and communication technology, trade liberalisation and lower transport costs have enabled firms and countries to fragment the production process into global value chains (GVCs). Many products are now designed in one country and assembled in another country from parts…

  4. Fission fragment excited laser system

    Science.gov (United States)

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  5. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  6. Velocity distribution of fragments of catastrophic impacts

    Science.gov (United States)

    Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

    1992-01-01

    Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

  7. Goodness of isospin in neutron rich systems from the fission fragment distribution

    Science.gov (United States)

    Garg, Swati; Jain, Ashok Kumar

    2017-09-01

    We present the results of our calculations for the relative yields of neutron-rich fission fragments emitted in 208Pb (18O, fission) reaction by using the concept of the conservation of isospin and compare with the experimental data. We take into account a range of isospin values allowed by the isospin algebra and assume that the fission fragments are formed in isobaric analog states. We also take into account the neutron multiplicity data for various neutron-emission channels in each partition, and use them to obtain the weight factors in calculating the yields. We then calculate the relative yields of the fission fragments. Our calculated results are able to reproduce the experimental trends reasonably well. This is the first direct evidence of the isospin conservation in neutron-rich systems and may prove a very useful tool in their studies.

  8. Plant biodiversity of beech forests in central-northern Italy: a methodological approach for conservation purposes

    Directory of Open Access Journals (Sweden)

    Marcantonio M

    2012-07-01

    Full Text Available Forests are reckoned essentials as biodiversity reservoirs and carbon sinks. Current threats to forest ecosystems (e.g., climate changes, habitat loss and fragmentation, management changes call for monitoring their biodiversity and preserving their ecological functions. In this study, we characterized plants diversity of five beech forests located in central and north Apennines mountain chain, using results by a probabilistic sampling. In order to achieve our goals, we have considered species richness and abundance, taxonomic distinctness and species composition, using both old and new analytical approaches. Results have shown how: (1 the forest type dominated by Fagus sylvatica is characterized by high complexity, with marked compositional, structural and biodiversity differences; (2 beech forests of Pigelleto di Piancastagnaio and Valle della Corte show the highest plants diversity values. The ecological characteristics of these areas, which sustain high diversity values, are unique and of great conservation interest; (3 the use of species richness as the only diversity measure have not allowed an efficient differentiation between studied areas. Indeed, the use of different indexes and analytical methods is required to detect multiple characteristics of biological diversity, as well as to carry out efficient biodiversity surveys aimed to develop optimal conservation strategies. In the future, we plan to apply the sampling methodology and the analytical approach used in this paper to characterize plants diversity of similar forest types.

  9. Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

    International Nuclear Information System (INIS)

    Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

    2016-01-01

    Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

  10. Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

    Science.gov (United States)

    Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

    2016-11-25

    Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Models of fragmentation with composite power laws

    Science.gov (United States)

    Tavassoli, Z.; Rodgers, G. J.

    1999-06-01

    Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

  12. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

  13. The formation of planets by disc fragmentation

    Directory of Open Access Journals (Sweden)

    Stamatellos Dimitris

    2013-04-01

    Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

  14. Reframing landscape fragmentation's effects on ecosystem services.

    Science.gov (United States)

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Population genetics of chamois in the contact zone between the Alps and the Dinaric Mountains: uncovering the role of habitat fragmentation and past management

    Czech Academy of Sciences Publication Activity Database

    Buzan, E. V.; Bryja, Josef; Zemanová, Barbora; Kryštufek, B.

    2013-01-01

    Roč. 14, č. 2 (2013), s. 401-412 ISSN 1566-0621 Institutional support: RVO:68081766 Keywords : Rupicapra rupicapra * Microsatellites * Population structure * Fragmentation * Conservation management Subject RIV: EH - Ecology, Behaviour Impact factor: 1.846, year: 2013

  16. Chain transitivity in hyperspaces

    International Nuclear Information System (INIS)

    Fernández, Leobardo; Good, Chris; Puljiz, Mate; Ramírez, Ártico

    2015-01-01

    Given a non-empty compact metric space X and a continuous function f: X → X, we study the dynamics of the induced maps on the hyperspace of non-empty compact subsets of X and on various other invariant subspaces thereof, in particular symmetric products. We show how some important dynamical properties transfer across induced systems. These amongst others include, chain transitivity, chain (weakly) mixing, chain recurrence, exactness by chains. From our main theorem we derive an ε-chain version of Furstenberg’s celebrated 2 implies n Theorem. We also show the implications our results have for dynamics on continua.

  17. Decisive Markov Chains

    OpenAIRE

    Abdulla, Parosh Aziz; Henda, Noomene Ben; Mayr, Richard

    2007-01-01

    We consider qualitative and quantitative verification problems for infinite-state Markov chains. We call a Markov chain decisive w.r.t. a given set of target states F if it almost certainly eventually reaches either F or a state from which F can no longer be reached. While all finite Markov chains are trivially decisive (for every set F), this also holds for many classes of infinite Markov chains. Infinite Markov chains which contain a finite attractor are decisive w.r.t. every set F. In part...

  18. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    Science.gov (United States)

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

  19. Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

    Science.gov (United States)

    Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

    2016-01-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  20. Revisiting the Lund Fragmentation Model

    International Nuclear Information System (INIS)

    Andersson, B.; Nilsson, A.

    1992-10-01

    We present a new method to implement the Lund Model fragmentation distributions for multi-gluon situations. The method of Sjoestrand, implemented in the well-known Monte Carlo simulation program JETSET, is robust and direct and according to his findings there are no observable differences between different ways to implement his scheme. His method can be described as a space-time method because the breakup proper time plays a major role. The method described in this paper is built on energy-momentum space methods. We make use of the χ-curve, which is defined directly from the energy momentum vectors of the partons. We have shown that the χ-curve describes the breakup properties and the final state energy momentum distributions in the mean. We present a method to find the variations around the χ-curve, which also implements the basic Lund Model fragmentation distributions (the area-law and the corresponding iterative cascade). We find differences when comparing the corresponding Monte Carlo implementation REVJET to the JETSET distributions inside the gluon jets. (au)

  1. Process and data fragmentation-oriented enterprise network integration with collaboration modelling and collaboration agents

    Science.gov (United States)

    Li, Qing; Wang, Ze-yuan; Cao, Zhi-chao; Du, Rui-yang; Luo, Hao

    2015-08-01

    With the process of globalisation and the development of management models and information technology, enterprise cooperation and collaboration has developed from intra-enterprise integration, outsourcing and inter-enterprise integration, and supply chain management, to virtual enterprises and enterprise networks. Some midfielder enterprises begin to serve for different supply chains. Therefore, they combine related supply chains into a complex enterprise network. The main challenges for enterprise network's integration and collaboration are business process and data fragmentation beyond organisational boundaries. This paper reviews the requirements of enterprise network's integration and collaboration, as well as the development of new information technologies. Based on service-oriented architecture (SOA), collaboration modelling and collaboration agents are introduced to solve problems of collaborative management for service convergence under the condition of process and data fragmentation. A model-driven methodology is developed to design and deploy the integrating framework. An industrial experiment is designed and implemented to illustrate the usage of developed technologies in this paper.

  2. Gushing metal chain

    Science.gov (United States)

    Belyaev, Alexander; Sukhanov, Alexander; Tsvetkov, Alexander

    2016-03-01

    This article addresses the problem in which a chain falls from a glass from some height. This phenomenon demonstrates a paradoxical rise of the chain over the glass. To explain this effect, an initial hypothesis and an appropriate theory are proposed for calculating the steady fall parameters of the chain. For this purpose, the modified Cayley's problem of falling chain given its rise due to the centrifugal force of upward inertia is solved. Results show that the lift caused by an increase in linear density at the part of chain where it is being bent (the upper part) is due to the convergence of the chain balls to one another. The experiments confirm the obtained estimates of the lifting chain.

  3. Modelling antibody side chain conformations using heuristic database search.

    Science.gov (United States)

    Ritchie, D W; Kemp, G J

    1997-01-01

    We have developed a knowledge-based system which models the side chain conformations of residues in the variable domains of antibody Fv fragments. The system is written in Prolog and uses an object-oriented database of aligned antibody structures in conjunction with a side chain rotamer library. The antibody database provides 3-dimensional clusters of side chain conformations which can be copied en masse into the model structure. The object-oriented database architecture facilitates a navigational style of database access, necessary to assemble side chains clusters. Around 60% of the model is built using side chain clusters and this eliminates much of the combinatorial complexity associated with many other side chain placement algorithms. Construction and placement of side chain clusters is guided by a heuristic cost function based on a simple model of side chain packing interactions. Even with a simple model, we find that a large proportion of side chain conformations are modelled accurately. We expect our approach could be used with other homologous protein families, in addition to antibodies, both to improve the quality of model structures and to give a "smart start" to the side chain placement problem.

  4. Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes

    NARCIS (Netherlands)

    Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.

    2005-01-01

    The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated

  5. Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains

    NARCIS (Netherlands)

    Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.

    2008-01-01

    The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a

  6. Habitat fragmentation and its lasting impact on Earth’s ecosystems

    Science.gov (United States)

    Haddad, Nick M.; Brudvig, Lars A.; Clobert, Jean; Davies, Kendi F.; Gonzalez, Andrew; Holt, Robert D.; Lovejoy, Thomas E.; Sexton, Joseph O.; Austin, Mike P.; Collins, Cathy D.; Cook, William M.; Damschen, Ellen I.; Ewers, Robert M.; Foster, Bryan L.; Jenkins, Clinton N.; King, Andrew J.; Laurance, William F.; Levey, Douglas J.; Margules, Chris R.; Melbourne, Brett A.; Nicholls, A. O.; Orrock, John L.; Song, Dan-Xia; Townshend, John R.

    2015-01-01

    We conducted an analysis of global forest cover to reveal that 70% of remaining forest is within 1 km of the forest’s edge, subject to the degrading effects of fragmentation. A synthesis of fragmentation experiments spanning multiple biomes and scales, five continents, and 35 years demonstrates that habitat fragmentation reduces biodiversity by 13 to 75% and impairs key ecosystem functions by decreasing biomass and altering nutrient cycles. Effects are greatest in the smallest and most isolated fragments, and they magnify with the passage of time. These findings indicate an urgent need for conservation and restoration measures to improve landscape connectivity, which will reduce extinction rates and help maintain ecosystem services. PMID:26601154

  7. The actual relevance of ecological corridors in nature conservation

    Directory of Open Access Journals (Sweden)

    Ćurčić Nina B.

    2013-01-01

    Full Text Available The paper considers theoretical and applied foundations of the concept of the ecological corridors in nature conservation. Their relevance comes from recent ecological phenomenon of habitat fragmentation which is rapidly increasing during last decades. Habitat fragmentation is one of the main threats to richness and diversity of wildlife. Ecological corridors can mitigate the loss and fragmentation of habitat. Corridors perform as “bridges” between habitats for species and they provide a flow of the natural or even anthropogenic caused disturbances. In this paper we will present the meaning and significance of ecological corridors in nature conservation, as well as types of ecological corridors and their ecological benefits. Methodological and practical approaches in nature protection system in Serbia are included. [Projekat Ministarstva nauke Republike Srbije, br. 47007 i br. 176008

  8. Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.

    Science.gov (United States)

    Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas

    2014-12-01

    The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  10. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  11. Detection of secondary binding sites in proteins using fragment screening.

    Science.gov (United States)

    Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren

    2015-12-29

    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.

  12. Formation of amyloid fibers by monomeric light chain variable domains.

    Science.gov (United States)

    Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S

    2014-10-03

    Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Plasmon-Polariton Properties in Metallic Nanosphere Chains

    Directory of Open Access Journals (Sweden)

    Witold Aleksander Jacak

    2015-06-01

    Full Text Available The propagation of collective wave type plasmonic excitations along infinite chains of metallic nanospheres has been analyzed, including near-, medium- and far-field contributions to the plasmon dipole interaction with all retardation effects taken into account. It is proven that there exist weakly-damped self-modes of plasmon-polaritons in the chain for which the propagation range is limited by relatively small Ohmic losses only. In this regime, the Lorentz friction irradiation losses on each nanosphere in the chain are ideally compensated by the energy income from the rest of the chain. The completely undamped collective waves were identified in the case of the presence of persistent external excitation of some fragment of the chain. The obtained characteristics of these excitations fit the experimental observations well.

  14. Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains

    Science.gov (United States)

    Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.

    2017-06-01

    Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.

  15. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  16. Conservation: Toward firmer ground

    Science.gov (United States)

    1975-01-01

    The following aspects of energy conservation were reviewed in order to place the problems in proper perspective: history and goals, conservation accounting-criteria, and a method to overcome obstacles. The effect of changing prices and available supplies of energy sources and their causes on consumption levels during the last few decades were described. Some examples of attainable conservation goals were listed and justified. A number of specific criteria applicable to conservation accounting were given. Finally, a discussion was presented to relate together the following aspects of energy conservation: widespread impact, involvement of government, industry, politics, moral and ethical aspects, urgency and time element.

  17. Geotechnology and landscape ecology applied to the selection of potential forest fragments for seed harvesting.

    Science.gov (United States)

    Santos, Alexandre Rosa Dos; Antonio Alvares Soares Ribeiro, Carlos; de Oliveira Peluzio, Telma Machado; Esteves Peluzio, João Batista; de Queiroz, Vagner Tebaldi; Figueira Branco, Elvis Ricardo; Lorenzon, Alexandre Simões; Domingues, Getulio Fonseca; Marcatti, Gustavo Eduardo; de Castro, Nero Lemos Martins; Teixeira, Thaisa Ribeiro; Dos Santos, Gleissy Mary Amaral Dino Alves; Santos Mota, Pedro Henrique; Ferreira da Silva, Samuel; Vargas, Rozimelia; de Carvalho, José Romário; Macedo, Leandro Levate; da Silva Araújo, Cintia; de Almeida, Samira Luns Hatum

    2016-12-01

    The Atlantic Forest biome is recognized for its biodiversity and is one of the most threatened biomes on the planet, with forest fragmentation increasing due to uncontrolled land use, land occupation, and population growth. The most serious aspect of the forest fragmentation process is the edge effect and the loss of biodiversity. In this context, the aim of this study was to evaluate the dynamics of forest fragmentation and select potential forest fragments with a higher degree of conservation for seed harvesting in the Itapemirim river basin, Espírito Santo State, Brazil. Image classification techniques, forest landscape ecology, and multi-criteria analysis were used to evaluate the evolution of forest fragmentation to develop the landscape metric indexes, and to select potential forest fragments for seed harvesting for the years 1985 and 2013. According to the results, there was a reduction of 2.55% of the occupancy of the fragments in the basin between the years 1985 and 2013. For the years 1985 and 2013, forest fragment units 2 and 3 were spatialized with a high potential for seed harvesting, representing 6.99% and 16.01% of the total fragments, respectively. The methodology used in this study has the potential to be used to support decisions for the selection of potential fragments for seed harvesting because selecting fragments in different environments by their spatial attributes provides a greater degree of conservation, contributing to the protection and conscious management of the forests. The proposed methodology can be adapted to other areas and different biomes of the world. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  19. Impact failure and fragmentation properties of metals

    Energy Technology Data Exchange (ETDEWEB)

    Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  20. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  1. Gallstone fragmentation by control electrohydraulic lithotripsy

    International Nuclear Information System (INIS)

    Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

    1989-01-01

    The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

  2. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Dimitrios Aidonis

    2017-05-01

    Full Text Available This special issue has followed up the 3rd Olympus International Conference on Supply Chains held on Athens Metropolitan Expo, November 7 & 8 2015, Greece. The Conference was organized by the Department of Logistics Technological Educational Institute of Central Macedonia, in collaboration with the: a Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH, b Greek Association of Supply Chain Management (EEL of Northern Greece and the c Supply Chain & Logistics Journal. During the 2-Days Conference more than 60 research papers were presented covering the following thematic areas: (i Transportation, (ii Best Practices in Logistics, (iii Information and Communication Technologies in Supply Chain Management, (iv Food Logistics, (v New Trends in Business Logistics, and (vi Green Supply Chain Management. Three keynote invited speakers addressed interesting issues for the Operational Research, the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  3. Supply Chain Management og Supply Chain costing

    DEFF Research Database (Denmark)

    Nielsen, Steen; Mortensen, Ole

    2002-01-01

    Formålet med denne artikel er at belyse de muligheder som ligger i at integrere virksomhedens økonomiske styring med begrebet Supply Chain Management (SCM). Dette søges belyst ved først at beskrive den teoretiske ramme, hvori SCM indgår. Herefter analyseres begrebet Supply Chain Costing (SCC) som...... Århus. Et resultat er, at via begrebet Supply Chain Costing skabes der mulighed for at måle logistikkædens aktiviteter i kr./øre. Anvendelsen af denne information har også strategisk betydning for at kunne vælge kunde og leverandør. Ved hjælp af integrationen skabes der også helt nye mulighed...

  4. A simple and robust approach to immobilization of antibody fragments.

    Science.gov (United States)

    Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J

    2016-08-01

    Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Complex fragment emission from hot compound nuclei

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1986-03-01

    The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs

  6. Fragment Size Distribution of Blasted Rock Mass

    Science.gov (United States)

    Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

    2017-12-01

    Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

  7. Fragmentation of neck-like structures

    International Nuclear Information System (INIS)

    Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

    1994-01-01

    Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

  8. Supply chain components

    OpenAIRE

    Vieraşu, T.; Bălăşescu, M.

    2011-01-01

    In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  9. Supply chain components

    Directory of Open Access Journals (Sweden)

    Vieraşu, T.

    2011-01-01

    Full Text Available In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  10. Markov Tail Chains

    OpenAIRE

    janssen, Anja; Segers, Johan

    2013-01-01

    The extremes of a univariate Markov chain with regularly varying stationary marginal distribution and asymptotically linear behavior are known to exhibit a multiplicative random walk structure called the tail chain. In this paper we extend this fact to Markov chains with multivariate regularly varying marginal distributions in Rd. We analyze both the forward and the backward tail process and show that they mutually determine each other through a kind of adjoint relation. In ...

  11. Economy, market and chain

    OpenAIRE

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects focus specifically at consumer purchasing behaviour, product development, supply chain formation and minimising cost price. As a rule, this research takes place in close cooperation with chain actors

  12. Information transmission and control in a chaotically kicked spin chain

    International Nuclear Information System (INIS)

    Aubourg, Lucile; Viennot, David

    2016-01-01

    We study spin chains submitted to disturbed kick trains described by classical dynamical processes. The spin chains are coupled by Heisenberg and Ising-Z models. We consider chaotic processes by using the kick irregularity in the multipartite system (the spin chain). We show that both couplings transmit the chaos disorder differently along the spin chain but conserve the horizon of coherence (when the disorder into the kick bath is transmitted to the spin chain). An example of information transmission between the spins of the chain coupled by a Heisenberg interaction shows the interest of the horizon of coherence. The use of some chosen stationary kicks disturbed by a chaotic environment makes it possible to modify the information transmission between the spins and to perform a free control during the horizon of coherence. (paper)

  13. Fragment-based approaches to TB drugs.

    Science.gov (United States)

    Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

    2018-02-01

    Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

  14. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  15. Measuring the temperature of hot nuclear fragments

    International Nuclear Information System (INIS)

    Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

    2010-01-01

    A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

  16. Kinetics of fragmentation-annihilation processes

    OpenAIRE

    Filipe, JAN; Rodgers, GJ

    1996-01-01

    We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

  17. Supply chain planning classification

    Science.gov (United States)

    Hvolby, Hans-Henrik; Trienekens, Jacques; Bonde, Hans

    2001-10-01

    Industry experience a need to shift in focus from internal production planning towards planning in the supply network. In this respect customer oriented thinking becomes almost a common good amongst companies in the supply network. An increase in the use of information technology is needed to enable companies to better tune their production planning with customers and suppliers. Information technology opportunities and supply chain planning systems facilitate companies to monitor and control their supplier network. In spite if these developments, most links in today's supply chains make individual plans, because the real demand information is not available throughout the chain. The current systems and processes of the supply chains are not designed to meet the requirements now placed upon them. For long term relationships with suppliers and customers, an integrated decision-making process is needed in order to obtain a satisfactory result for all parties. Especially when customized production and short lead-time is in focus. An effective value chain makes inventory available and visible among the value chain members, minimizes response time and optimizes total inventory value held throughout the chain. In this paper a supply chain planning classification grid is presented based current manufacturing classifications and supply chain planning initiatives.

  18. The role of the matrix-edge dynamics of amphibian conservation in tropical montane fragmented landscapes La dinámica del borde-matriz en bosques mesófilos de montaña fragmentados y su papel en la conservación de los anfibios

    Directory of Open Access Journals (Sweden)

    Georgina Santos-Barrera

    2011-06-01

    Full Text Available Edge effects play a key role in forest dynamics in which the context of the anthropogenic matrix has a great influence on fragment connectivity and function. The study of the interaction between edge and matrix effects in nature is essential to understand and promote the colonization of some functional groups in managed ecosystems. We studied the dynamics of 7 species of frogs and salamanders occurring in 8 ecotones of tropical montane cloud forest (TMCF which interact with adjacent managed areas of coffee and corn plantations in Guerrero, southern Mexico. A survey effort of 196 man/hours along 72 transects detected 58 individuals of 7 amphibian species and 12 environmental and structural variables were measured. The diversity and abundance of amphibians in the forest mostly depended on the matrix context adjacent to the forest patches. The forest interior provided higher relative humidity, leaf litter cover, and canopy cover that determined the presence of some amphibian species. The use of shaded coffee plantations was preferred by the amphibians over the corn plots possibly due to the maintenance of native forest arboreal elements, low management rate and less intensity of disturbance in the coffee plantations than in the corn plots. Shaded coffee plantations reduce the edge effects in TMCF, improve the connectivity between TMCF fragments and increase habitat quality for the forest interior amphibian species. Future wildlife management research should take into account edge and matrix effects to understand species dynamics which move along anthropogenic-natural ecotones in managed ecosystems, thus prioritizing sites to buffer edge effects and increase habitat quality in remaining natural ecosystems.El efecto de borde es un evento clave en la dinámica de algunos bosques, la matriz que rodea a los fragmentos de bosque tiene una gran importancia en el funcionamiento y conectividad de estos fragmentos. El conocimiento de las interacciones entre

  19. Distribution of rock fragments and their effects on hillslope soil erosion in purple soil, China

    Science.gov (United States)

    Wang, Xiaoyan

    2017-04-01

    influence of rock fragment cover on purple soil slope erosion process were carried on, under different conditions with two kind of rock fragment positions (resting on soil surface and embedded into top soil layer), varied rock fragment coverage (Rc, 0% 40%), two kind of soils with textural porosity or structural porosity, and three kind of rainfall intensities (I, 1 mm/min, 1.5 mm/min and 2 mm/min). Simulated rainfall experiments in situ plots in the field, combined with simulated rainfall experiments in soil pans indoor, were used. The main conclusions of this dissertation are as following: 1. The spatial distribution characteristics of rock fragments in purple soil slope and its effects on the soil physical properties were clarified basically. 2. The mechanism of influence of rock fragments within top soil layer on soil erosion processes was understood and a threshold of rock fragment content on the infiltration was figured out. 3. The relationships between surface rock fragment cover and hillslope soil erosion in purple soil under different conditions with varied rock fragment positions, soil structures and rainfall intensities were obtained and the soil and water conservation function of surface rock fragment cover on reducing soil loss was affirmed.

  20. The influence of ionizing radiation on the structure of Ca-ATPase hydrophobic fragment of skeletal muscle sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.

    1990-01-01

    Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment

  1. Ethics of conservation triage

    Directory of Open Access Journals (Sweden)

    Kerrie A Wilson

    2016-09-01

    Full Text Available Conservation triage seems to be at a stalemate between those who accept triage based on utilitarian rationalization, and those that reject it based on a number of ethical principles. We argue that without considered attention to the ethics of conservation triage we risk further polarization in the field of conservation. We draw lessons from the medical sector, where triage is more intuitive and acceptable, and also from disaster planning, to help navigate the challenges that triage entails for conservation science, practice, and policy. We clarify the consequentialist, deontological, and virtue ethical stances that influence the level of acceptance of triage. We emphasize the ethical dimensions of conservation triage in principle and in practice, particularly in the context of stakeholder diversity, a wide range of possible objectives and actions, broader institutions, and significant uncertainties. A focus on a more diverse set of ethics, more considered choice of triage as a conservation tool, open communication of triage objectives and protocols, greater consideration of risk preferences, and regular review and adaptation of triage protocols is required for conservation triage to become more acceptable among diverse conservation practitioners, institutions, and the general public. Accepting conservation triage as fundamentally an ethical problem would foster more open dialogue and constructive debate about the role of conservation triage in a wider system of care.

  2. Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

    Science.gov (United States)

    Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

    2003-05-01

    Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

  3. Tumour targeting with monovalent fragments of anti-neuroblastoma antibody chCE7

    International Nuclear Information System (INIS)

    Carrel, F.; Novak-Hofer, I.; Ruch, C.; Zimmermann, K.; Amstutz, H.

    1997-01-01

    The in vitro and in vivo behaviour of the monovalent single chain (scFv) and Fab-fragments derived from anti-neuroblastoma antibody chCE7 is reported. When comparing tumour uptake and -retention of radioactivity of 67 Cu-labelled monovalent chCE7 with divalent chCE7 F(ab') 2 the advantage of the radiocopper label over the radioiodine label was more pronounced with the divalent (internalising) F(ab') 2 fragments. (author) 1 fig., 1 ref

  4. Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

    DEFF Research Database (Denmark)

    Kastern, W.; Dyrberg, T.; Scholler, J.

    1984-01-01

    DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

  5. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  6. Mechanisms Affecting Population Density in Fragmented Habitat

    Directory of Open Access Journals (Sweden)

    Lutz Tischendorf

    2005-06-01

    Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

  7. Strong and nonlinear effects of fragmentation on ecosystem service provision at multiple scales

    Science.gov (United States)

    Mitchell, Matthew G. E.; Bennett, Elena M.; Gonzalez, Andrew

    2015-09-01

    Human actions, such as converting natural land cover to agricultural or urban land, result in the loss and fragmentation of natural habitat, with important consequences for the provision of ecosystem services. Such habitat loss is especially important for services that are supplied by fragments of natural land cover and that depend on flows of organisms, matter, or people across the landscape to produce benefits, such as pollination, pest regulation, recreation and cultural services. However, our quantitative knowledge about precisely how different patterns of landscape fragmentation might affect the provision of these types of services is limited. We used a simple, spatially explicit model to evaluate the potential impact of natural land cover loss and fragmentation on the provision of hypothetical ecosystem services. Based on current literature, we assumed that fragments of natural land cover provide ecosystem services to the area surrounding them in a distance-dependent manner such that ecosystem service flow depended on proximity to fragments. We modeled seven different patterns of natural land cover loss across landscapes that varied in the overall level of landscape fragmentation. Our model predicts that natural land cover loss will have strong and unimodal effects on ecosystem service provision, with clear thresholds indicating rapid loss of service provision beyond critical levels of natural land cover loss. It also predicts the presence of a tradeoff between maximizing ecosystem service provision and conserving natural land cover, and a mismatch between ecosystem service provision at landscape versus finer spatial scales. Importantly, the pattern of landscape fragmentation mitigated or intensified these tradeoffs and mismatches. Our model suggests that managing patterns of natural land cover loss and fragmentation could help influence the provision of multiple ecosystem services and manage tradeoffs and synergies between services across different human

  8. Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory.

    Science.gov (United States)

    Isegawa, Miho; Gao, Jiali; Truhlar, Donald G

    2011-08-28

    Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics

  9. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  10. Conservation: Toward firmer ground

    Science.gov (United States)

    1975-01-01

    The following aspects of energy conservation were discussed: conservation history and goals, conservation modes, conservation accounting-criteria, and a method to overcome obstacles. The conservation modes tested fall into one of the following categories: reduced energy consumption, increased efficiency of energy utilization, or substitution of one or more forms of energy for another which is in shorter supply or in some sense thought to be of more value. The conservation accounting criteria include net energy reduction, economic, and technical criteria. A method to overcome obstacles includes (approaches such as: direct personal impact (life style, income, security, aspiration), an element of crisis, large scale involvement of environmental, safety, and health issues, connections to big government, big business, big politics, involvement of known and speculative science and technology, appeal to moral and ethical standards, the transient nature of opportunities to correct the system.

  11. Econometric modelling of conservation

    International Nuclear Information System (INIS)

    Parker, J.C.; Seal, D.J.

    1990-01-01

    The issue of energy conservation in general, and conservation in the natural gas markets in particular, has recently had a much lower profile than in the past, when energy prices were significantly higher and energy costs composed a much larger proportion of industrial operating costs than today. The recent downward trend in energy prices has diverted attention away from this issue. In the face of expected significant real price increases, increasing pressure from environmental groups, and directives on the part of regulator authorities, conservation is once again becoming a topic of consideration in the energy industry. From the point of view of gas demand forecasting, conservation has received too little attention. The intentions of this paper are to establish the need for forecasting conservation in the natural gas utility sector, and to construct a model of industrial demand which incorporates conservation and is appropriate for use as a forecasting tool

  12. Supply Chain Management

    DEFF Research Database (Denmark)

    Wieland, Andreas; Handfield, Robert B.

    Supply chain management has made great strides in becoming a discipline with a standalone body of theories. As part of this evolution, researchers have sought to embed and integrate observed supply chain management phenomena into theoretical statements. In our review, we explore where we have been...

  13. Critical Chain Exercises

    Science.gov (United States)

    Doyle, John Kevin

    2010-01-01

    Critical Chains project management focuses on holding buffers at the project level vs. task level, and managing buffers as a project resource. A number of studies have shown that Critical Chain project management can significantly improve organizational schedule fidelity (i.e., improve the proportion of projects delivered on time) and reduce…

  14. Value Chain Engineering

    DEFF Research Database (Denmark)

    Wæhrens, Brian Vejrum; Slepniov, Dmitrij

    2015-01-01

    This workbook is recommended for the attention of students of and managers in Danish small and medium sized enterprises (SMEs). Danish SMEs are currently facing a number of key challenges related to their position in global value chains. This book provides an insight into value chain management t...

  15. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  16. Parton fragmentation and string dynamics

    International Nuclear Information System (INIS)

    Andersson, B.; Gustafson, G.; Ingelman, G.; Sjoestrand, T.

    1983-01-01

    While much has been learned recently about quark and gluon interactions in the framework of perturbative Quantum Chromodynamics, the relation between calculated parton properties and observed hadron densities involves models where dynamics and jet empirical rules have to be combined. The purpose of this article is to describe a presently successful approach which is based on a cascade jet model using String dynamics. It can readily lead to Monte Carlo jet programmes of great use when analyzing data. Production processes in an iterative cascade approach, with tunneling in a constant force field, are reviewed. Expected differences between quark and gluon jets are discussed. Low transverse momentum phenomena are also reviewed with emphasis on hyperon polarization. In so far as this approach uses a fragmentation scheme based on String dynamics, it was deemed appropriate to also include under the same cover a special report on the Classical theory of relativistic Strings, seen as the classical limit of the Dual Resonance model. The Equations of motion and interaction among strings are presented. (orig.)

  17. DIFFUSIVE PROPAGATION OF ENERGY IN A NON-ACOUSTIC CHAIN

    OpenAIRE

    Komorowski , Tomasz; Olla , Stefano

    2017-01-01

    International audience; We consider a non acoustic chain of harmonic oscil-lators with the dynamics perturbed by a random local exchange of momentum, such that energy and momentum are conserved. The macroscopic limits of the energy density, momentum and the curvature (or bending) of the chain satisfy a system of evolution equations. We prove that, in a diffusive space-time scaling, the curvature and momentum evolve following a linear system that corresponds to a damped Euler-Bernoulli beam eq...

  18. An Amazonian rainforest and its fragments as a laboratory of global change.

    Science.gov (United States)

    Laurance, William F; Camargo, José L C; Fearnside, Philip M; Lovejoy, Thomas E; Williamson, G Bruce; Mesquita, Rita C G; Meyer, Christoph F J; Bobrowiec, Paulo E D; Laurance, Susan G W

    2018-02-01

    We synthesize findings from one of the world's largest and longest-running experimental investigations, the Biological Dynamics of Forest Fragments Project (BDFFP). Spanning an area of ∼1000 km 2 in central Amazonia, the BDFFP was initially designed to evaluate the effects of fragment area on rainforest biodiversity and ecological processes. However, over its 38-year history to date the project has far transcended its original mission, and now focuses more broadly on landscape dynamics, forest regeneration, regional- and global-change phenomena, and their potential interactions and implications for Amazonian forest conservation. The project has yielded a wealth of insights into the ecological and environmental changes in fragmented forests. For instance, many rainforest species are naturally rare and hence are either missing entirely from many fragments or so sparsely represented as to have little chance of long-term survival. Additionally, edge effects are a prominent driver of fragment dynamics, strongly affecting forest microclimate, tree mortality, carbon storage and a diversity of fauna. Even within our controlled study area, the landscape has been highly dynamic: for example, the matrix of vegetation surrounding fragments has changed markedly over time, succeeding from large cattle pastures or forest clearcuts to secondary regrowth forest. This, in turn, has influenced the dynamics of plant and animal communities and their trajectories of change over time. In general, fauna and flora have responded differently to fragmentation: the most locally extinction-prone animal species are those that have both large area requirements and low tolerance of the modified habitats surrounding fragments, whereas the most vulnerable plants are those that respond poorly to edge effects or chronic forest disturbances, and that rely on vulnerable animals for seed dispersal or pollination. Relative to intact forests, most fragments are hyperdynamic, with unstable or fluctuating

  19. Handbook on energy conservation

    International Nuclear Information System (INIS)

    1989-12-01

    This book shows energy situation in recent years, which includes reserves of energy resource in the world, crude oil production records in OPEC and non OPEC, supply and demand of energy in important developed countries, prospect of supply and demand of energy and current situation of energy conservation in developed countries. It also deals with energy situation in Korea reporting natural resources status, energy conservation policy, measurement for alternative energy, energy management of Korea, investment in equipment and public education for energy conservation.

  20. Designer genes. Recombinant antibody fragments for biological imaging

    Energy Technology Data Exchange (ETDEWEB)

    Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

    2000-09-01

    Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

  1. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Wu, A.M.; Yazaki, P.J.

    2000-01-01

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  2. John Tyndall's religion: a fragment

    Science.gov (United States)

    Cantor, Geoffrey

    2015-01-01

    Both contemporaries and historians have focused on the high-profile 1874 Belfast Address in which John Tyndall was widely perceived as promulgating atheism. Although some historians have instead interpreted him as a pantheist or an agnostic, it is clear that any such labels do not accurately capture Tyndall's religious position throughout his life. By contrast, this paper seeks to chart Tyndall's religious journey from 1840 (when he was in his late teens) to the autumn of 1848 when he commenced his scientific studies at Marburg. Although he had been imbued with his father's stern conservative Irish Protestantism and opposition to Catholicism, as a youth he seems for a time to have been attracted to Methodism. Later, however, he questioned and rejected his father's religious views and was increasingly drawn to the more spiritual outlook of Ralph Waldo Emerson and Thomas Carlyle, along with a more radical attitude to politics.

  3. Integrated supply chain risk management

    OpenAIRE

    Riaan Bredell; Jackie Walters

    2007-01-01

    Integrated supply chain risk management (ISCRM) has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly ...

  4. Fragmentation of eastern United States forest types

    Science.gov (United States)

    Kurt H. Riitters; John W. Coulston

    2013-01-01

    Fragmentation is a continuing threat to the sustainability of forests in the Eastern United States, where land use changes supporting a growing human population are the primary driver of forest fragmentation (Stein and others 2009). While once mostly forested, approximately 40 percent of the original forest area has been converted to other land uses, and most of the...

  5. Thermodynamics of the fuel fragmentation gas

    International Nuclear Information System (INIS)

    Perez, R.B.; Alsmiller, R.G. Jr.

    1977-01-01

    In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

  6. Momentum sum rules for fragmentation functions

    International Nuclear Information System (INIS)

    Meissner, S.; Metz, A.; Pitonyak, D.

    2010-01-01

    Momentum sum rules for fragmentation functions are considered. In particular, we give a general proof of the Schaefer-Teryaev sum rule for the transverse momentum dependent Collins function. We also argue that corresponding sum rules for related fragmentation functions do not exist. Our model-independent analysis is supplemented by calculations in a simple field-theoretical model.

  7. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Using the game approach to fragmentability, we give new and simpler proofs of the following known results: (a) If the Banach space admits an equivalent. Kadec norm, then its weak topology is fragmented by a metric which is stronger than the norm topology. (b) If the Banach space admits an equivalent rotund ...

  8. Temperatures of fragment kinetic energy spectra

    International Nuclear Information System (INIS)

    Bauer, W.

    1995-01-01

    Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework

  9. Pollen and gene flow in fragmented habitats

    NARCIS (Netherlands)

    Kwak, Manja M.; Velterop, Odilia; van Andel, Jelte

    . Habitat fragmentation affects both plants and pollinators. Habitat fragmentation leads to changes in species richness, population number and size, density, and shape, thus to changes in the spatial arrangement of flowers. These changes influence the amount of food for flower-visiting insects and

  10. Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

    Science.gov (United States)

    David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

    2010-01-01

    Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

  11. Global Value Chain Indicators: Application to the Italian Sectors - Gli indicatori della global value chain: un’applicazione ai settori italiani

    OpenAIRE

    Ricotta, Fernanda

    2010-01-01

    In this paper the extent of international fragmentation of production in Italian manufacturing industries for the years 1985, 1995 and 2000 is assessed with different indicators. The objective is to determine where fragmentation is most prevalent and to provide a description of the key characteristics of those sectors. The paper first presents a survey of global value chain indicators and how these have been used in the economic literature. The second part supplies empirical evidence on the g...

  12. Spatial and temporal dimensions of landscape fragmentation across the Brazilian Amazon.

    Science.gov (United States)

    Rosa, Isabel M D; Gabriel, Cristina; Carreiras, Joāo M B

    2017-01-01

    The Brazilian Amazon in the past decades has been suffering severe landscape alteration, mainly due to anthropogenic activities, such as road building and land clearing for agriculture. Using a high-resolution time series of land cover maps (classified as mature forest, non-forest, secondary forest) spanning from 1984 through 2011, and four uncorrelated fragmentation metrics (edge density, clumpiness index, area-weighted mean patch size and shape index), we examined the temporal and spatial dynamics of forest fragmentation in three study areas across the Brazilian Amazon (Manaus, Santarém and Machadinho d'Oeste), inside and outside conservation units. Moreover, we compared the impacts on the landscape of: (1) different land uses (e.g. cattle ranching, crop production), (2) occupation processes (spontaneous vs. planned settlements) and (3) implementation of conservation units. By 2010/2011, municipalities located along the Arc of Deforestation had more than 55% of the remaining mature forest strictly confined to conservation units. Further, the planned settlement showed a higher rate of forest loss, a more persistent increase in deforested areas and a higher relative incidence of deforestation inside conservation units. Distinct agricultural activities did not lead to significantly different landscape structures; the accessibility of the municipality showed greater influence in the degree of degradation of the landscapes. Even with a high proportion of the landscapes covered by conservation units, which showed a strong inhibitory effect on forest fragmentation, we show that dynamic agriculturally driven economic activities, in municipalities with extensive road development, led to more regularly shaped, heavily fragmented landscapes, with higher densities of forest edge.

  13. Supply Chain Connectivity: Enhancing Participation in the Global Supply Chain

    OpenAIRE

    Patalinghug, Epictetus E.

    2015-01-01

    Supply chain connectivity is vital for the efficient flow of trade among APEC economies. This paper reviews the literature and supply chain management, describes the barriers to enhancing participation in global supply chain, analyzes the various measures of supply chain performance, and suggests steps for the Philippines to fully reap the benefits of the global value chain.

  14. The politics of municipal fragmentation in Ghana

    Directory of Open Access Journals (Sweden)

    Abdulai Kuyini Mohammed

    2015-06-01

    Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

  15. Graph Theory. 1. Fragmentation of Structural Graphs

    Directory of Open Access Journals (Sweden)

    Lorentz JÄNTSCHI

    2002-12-01

    Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

  16. Identification of special fragments containing the 5' end of polivirus RNA after ribonuclease III digestion

    Energy Technology Data Exchange (ETDEWEB)

    Harris, T.J.R.; Dunn, J.J.; Wimmer, E.

    1978-11-01

    The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.

  17. Strategic conservation planning for the Eastern North Carolina/Southeastern Virginia Strategic Habitat Conservation Team

    Science.gov (United States)

    Alexander-Vaughn, Louise B.; Collazo, Jaime A.; Drew, C. Ashton

    2014-01-01

    The Eastern North Carolina/Southeastern Virginia Strategic Habitat Conservation Team (ENCSEVA) is a partnership among local federal agencies and programs with a mission to apply Strategic Habitat Conservation to accomplish priority landscape-level conservation within its geographic region. ENCSEVA seeks to further landscape-scale conservation through collaboration with local partners. To accomplish this mission, ENCSEVA is developing a comprehensive Strategic Habitat Conservation Plan (Plan) to provide guidance for its members, partners, and collaborators by establishing mutual conservation goals, objectives, strategies, and metrics to gauge the success of conservation efforts. Identifying common goals allows the ENCSEVA team to develop strategies that leverage joint resources and are more likely to achieve desired impacts across the landscape. The Plan will also provide an approach for ENCSEVA to meet applied research needs (identify knowledge gaps), foster adaptive management principles, identify conservation priorities, prioritize threats (including potential impacts of climate change), and identify the required capacity to implement strategies to create more resilient landscapes. ENCSEVA seeks to support the overarching goals of the South Atlantic Landscape Conservation Cooperative (SALCC) and to provide scientific and technical support for conservation at landscape scales as well as inform the management of natural resources in response to shifts in climate, habitat fragmentation and loss, and other landscape-level challenges (South Atlantic LCC 2012). The ENCSEVA ecoregion encompasses the northern third of the SALCC geography and offers a unique opportunity to apply landscape conservation at multiple scales through the guidance of local conservation and natural resource management efforts and by reporting metrics that reflect the effectiveness of those efforts (Figure 1). The Environmental Decision Analysis Team, housed within the North Carolina Cooperative

  18. Biodiversity Conservation and Conservation Biotechnology Tools

    Science.gov (United States)

    This special issue is dedicated to the in vitro tools and methods used to conserve the genetic diversity of rare and threatened species from around the world. Species that are on the brink of extinction, due to the rapid loss of genetic diversity and habitat, come mainly from resource poor areas the...

  19. Paradigms for parasite conservation.

    Science.gov (United States)

    Dougherty, Eric R; Carlson, Colin J; Bueno, Veronica M; Burgio, Kevin R; Cizauskas, Carrie A; Clements, Christopher F; Seidel, Dana P; Harris, Nyeema C

    2016-08-01

    Parasitic species, which depend directly on host species for their survival, represent a major regulatory force in ecosystems and a significant component of Earth's biodiversity. Yet the negative impacts of parasites observed at the host level have motivated a conservation paradigm of eradication, moving us farther from attainment of taxonomically unbiased conservation goals. Despite a growing body of literature highlighting the importance of parasite-inclusive conservation, most parasite species remain understudied, underfunded, and underappreciated. We argue the protection of parasitic biodiversity requires a paradigm shift in the perception and valuation of their role as consumer species, similar to that of apex predators in the mid-20th century. Beyond recognizing parasites as vital trophic regulators, existing tools available to conservation practitioners should explicitly account for the unique threats facing dependent species. We built upon concepts from epidemiology and economics (e.g., host-density threshold and cost-benefit analysis) to devise novel metrics of margin of error and minimum investment for parasite conservation. We define margin of error as the risk of accidental host extinction from misestimating equilibrium population sizes and predicted oscillations, while minimum investment represents the cost associated with conserving the additional hosts required to maintain viable parasite populations. This framework will aid in the identification of readily conserved parasites that present minimal health risks. To establish parasite conservation, we propose an extension of population viability analysis for host-parasite assemblages to assess extinction risk. In the direst cases, ex situ breeding programs for parasites should be evaluated to maximize success without undermining host protection. Though parasitic species pose a considerable conservation challenge, adaptations to conservation tools will help protect parasite biodiversity in the face of

  20. Evaluation of radioiodinated and radiocopper labeled monovalent fragments of monoclonal antibody chCE7 for targeting of neuroblastoma

    International Nuclear Information System (INIS)

    Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August

    1997-01-01

    Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake