WorldWideScience

Sample records for compounds impair human

  1. Do perfluoroalkyl compounds impair human semen quality?

    DEFF Research Database (Denmark)

    Joensen, Ulla Nordström; Bossi, Rossana; Leffers, Henrik

    2009-01-01

    BACKGROUND: Perfluoroalkyl acids (PFAAs) are found globally in wildlife and humans and are suspected to act as endocrine disruptors. There are no previous reports of PFAA levels in adult men from Denmark or of a possible association between semen quality and PFAA exposure. OBJECTIVES: We investig......BACKGROUND: Perfluoroalkyl acids (PFAAs) are found globally in wildlife and humans and are suspected to act as endocrine disruptors. There are no previous reports of PFAA levels in adult men from Denmark or of a possible association between semen quality and PFAA exposure. OBJECTIVES: We...... investigated possible associations between PFAAs and testicular function. We hypothesized that higher PFAA levels would be associated with lower semen quality and lower testosterone levels. METHODS: We analyzed serum samples for levels of 10 different PFAAs and reproductive hormones and assessed semen quality......-gonadal hormones among men with high PFOS-PFOA levels. CONCLUSION: High PFAA levels were associated with fewer normal sperm. Thus, high levels of PFAAs may contribute to the otherwise unexplained low semen quality often seen in young men. However, our findings need to be corroborated in larger studies....

  2. The effects of bioactive compounds on Alzheimer’s disease and Mild cognitive impairment

    Directory of Open Access Journals (Sweden)

    Brian McAnany

    2016-06-01

    Full Text Available As the prevalence and rate of Alzheimer’s disease are increasing around world, identifying effective treatments to manage cognitive impairment and neurodegeneration has become a global health priority. Decades of scientific research have led to a more comprehensive understanding of Alzheimer’s Disease and Mild Cognitive Impairment (MCI, a transitional stage of accelerated cognitive decline. This understanding has enabled researchers to envision and develop novel Alzheimer’s Disease therapies, including the use of bioactive compounds found in plants and animals. Within the past 15 years, a significant amount of clinical research has been published documenting the effects specific bioactive compounds have on patients with Alzheimer’s Disease and MCI. This article reviews the results of this research, along with relevant epidemiological studies, measures of cognition, and disease pathologies to discuss whether sufficient evidence exists to support the use of specific bioactive compounds by individuals diagnosed with Alzheimer’s Disease and MCI. The results of clinical trials within the last 15 years do not conclusively prove that the studied quantities of vitamin B, Omega-3 fatty acids, or bioactive compounds within Fortasyn Connect are beneficial for use in the management of Alzheimer’s Disease or MCI. Additionally, the documented effects of these bioactive compounds do not warrant development of a functional food product to help manage AD or MCI. Conclusion: The results of clinical trials within the last 15 years do not conclusively prove that the specified quantities of vitamin B, Omega-3 fatty acids, or bioactive compounds within Fortasyn Connect, are beneficial for use in the management of AD or MCI. Additionally, the documented effects of these bioactive compounds do not warrant development of a functional food product utilizing the previously specified quantities to help manage AD or MCI. The effects bioactive compound

  3. Selective cognitive impairments associated with NMDA receptor blockade in humans.

    Science.gov (United States)

    Rowland, Laura M; Astur, Robert S; Jung, Rex E; Bustillo, Juan R; Lauriello, John; Yeo, Ronald A

    2005-03-01

    Hypofunction of the N-methyl-D-aspartate receptor (NMDAR) may be involved in the pathophysiology of schizophrenia. NMDAR antagonists like ketamine induce schizophrenia-like features in humans. In rodent studies, NMDAR antagonism impairs learning by disrupting long-term potentiation (LTP) in the hippocampus. This study investigated the effects of ketamine on spatial learning (acquisition) vs retrieval in a virtual Morris water task in humans. Verbal fluency, working memory, and learning and memory of verbal information were also assessed. Healthy human subjects participated in this double-blinded, placebo-controlled study. On two separate occasions, ketamine/placebo was administered and cognitive tasks were assessed in association with behavioral ratings. Ketamine impaired learning of spatial and verbal information but retrieval of information learned prior to drug administration was preserved. Schizophrenia-like symptoms were significantly related to spatial and verbal learning performance. Ketamine did not significantly impair attention, verbal fluency, or verbal working memory task performance. Spatial working memory was slightly impaired. In conclusion, these results provide evidence for ketamine's differential impairment of verbal and spatial learning vs retrieval. By using the Morris water task, which is hippocampal-dependent, this study helps bridge the gap between nonhuman animal and human NMDAR antagonism research. Impaired cognition is a core feature of schizophrenia. A better understanding of NMDA antagonism, its physiological and cognitive consequences, may provide improved models of psychosis and cognitive therapeutics.

  4. Recycling Energy to Restore Impaired Ankle Function during Human Walking

    NARCIS (Netherlands)

    Collins, S.H.; Kuo, A.D.

    2010-01-01

    Background: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is

  5. Impaired mitochondrial function in chronically ischemic human heart

    DEFF Research Database (Denmark)

    Stride, Nis Ottesen; Larsen, Steen; Hey-Mogensen, Martin

    2013-01-01

    , and finally to assess myocardial antioxidant levels. Mitochondrial respiration in biopsies from ischemic and nonischemic regions from the left ventricle of the same heart was compared in nine human subjects. Maximal oxidative phosphorylation capacity in fresh muscle fibers was lower in ischemic compared.......05), and the levels of antioxidant protein expression was lower. Diminished mitochondrial respiration capacity and excessive ROS production demonstrate an impaired mitochondrial function in ischemic human heart muscle. No chronic ischemic preconditioning effect was found....

  6. A human fecal contamination index for ranking impaired ...

    Science.gov (United States)

    Human fecal pollution of surface water remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for recreational water quality risk management. The transition from a research subject to a management tool requires the integration of standardized water sampling, laboratory, and data analysis procedures. In this study, a standardized HF183/BacR287 qPCR method was combined with a water sampling strategy and Bayesian data algorithm to establish a human fecal contamination index that can be used to rank impaired recreational water sites polluted with human waste. Stability and bias of index predictions were investigated under various parameters including siteswith different pollution levels, sampling period time range (1-15 weeks), and number of qPCR replicates per sample (2-14 replicates). Sensitivity analyses were conducted with simulated data sets (100 iterations) seeded with HF183/BacR287 qPCR laboratory measurements from water samples collected from three Southern California sites (588 qPCR measurements). Findings suggest that site ranking is feasible and that all parameters tested influence stability and bias in human fecal contamination indexscoring. Trends identified by sensitivity analyses will provide managers with the information needed to design and conduct field studies to rank impaired recreational water sites based

  7. Insulin resistance in human subjects having impaired glucose regulation

    International Nuclear Information System (INIS)

    Khan, S.H.; Khan, F.A.; Ijaz, A.

    2007-01-01

    To determine insulin resistance in human subjects having impaired glucose regulation (IGR) by Homeostasis Model Assessment for Insulin Resistance (HOMA-IR). A total of 100 subjects with impaired glucose regulation were selected for evaluation of metabolic syndrome as per the criteria of National Cholesterol Education Program, Adult Treatment Panel III (NCEP, ATP III), along with 47 healthy age and gender-matched controls. Physical examination to determine blood pressure and waist circumference was carried out and so was sampling for plasma glucose, serum triglycerides, HDL-cholesterol and insulin. Insulin resistance was calculated by the HOMA-IR. Finally, subjects with and without metabolic syndrome were compared with controls (n=47), using one-way ANOVA for studying insulin resistance between groups, with Tukey's post-hoc comparison. The frequency of finding metabolic syndrome in cases of IGR remained 47%. The insulin resistance demonstrated stepwise worsening from control population (mean=1.54, 95 % CI: 1.77 - 2.37) to subjects suffering from only IGR (mean=2.07, 95 % CI: 1.77- 2.37) to metabolic syndrome (mean=2.67, 95 %, CI: 2.34 - 3.00) (p < 0.001). Patients with impaired glucose regulation may have significant insulin resistance. It is, thus, recommended that a vigorous search be made to measure insulin resistance in all cases diagnosed to have impaired glucose regulation. (author)

  8. Compound stimulus extinction reduces spontaneous recovery in humans

    OpenAIRE

    Coelho, Cesar A.O.; Dunsmoor, Joseph E.; Phelps, Elizabeth A.

    2015-01-01

    Fear-related behaviors are prone to relapse following extinction. We tested in humans a compound extinction design (“deepened extinction”) shown in animal studies to reduce post-extinction fear recovery. Adult subjects underwent fear conditioning to a visual and an auditory conditioned stimulus (CSA and CSB, respectively) separately paired with an electric shock. The target CS (CSA) was extinguished alone followed by compound presentations of the extinguished CSA and nonextinguished CSB. Reco...

  9. Adipose tissue macrophages impair preadipocyte differentiation in humans.

    Directory of Open Access Journals (Sweden)

    Li Fen Liu

    Full Text Available The physiologic mechanisms underlying the relationship between obesity and insulin resistance are not fully understood. Impaired adipocyte differentiation and localized inflammation characterize adipose tissue from obese, insulin-resistant humans. The directionality of this relationship is not known, however. The aim of the current study was to investigate whether adipose tissue inflammation is causally-related to impaired adipocyte differentiation.Abdominal subcutaneous(SAT and visceral(VAT adipose tissue was obtained from 20 human participants undergoing bariatric surgery. Preadipocytes were isolated, and cultured in the presence or absence of CD14+ macrophages obtained from the same adipose tissue sample. Adipocyte differentiation was quantified after 14 days via immunofluorescence, Oil-Red O, and adipogenic gene expression. Cytokine secretion by mature adipocytes cultured with or without CD14+macrophages was quantified.Adipocyte differentiation was significantly lower in VAT than SAT by all measures (p<0.001. With macrophage removal, SAT preadipocyte differentiation increased significantly as measured by immunofluorescence and gene expression, whereas VAT preadipocyte differentiation was unchanged. Adipocyte-secreted proinflammatory cytokines were higher and adiponectin lower in media from VAT vs SAT: macrophage removal reduced inflammatory cytokine and increased adiponectin secretion from both SAT and VAT adipocytes. Differentiation of preadipocytes from SAT but not VAT correlated inversely with systemic insulin resistance.The current results reveal that proinflammatory immune cells in human SAT are causally-related to impaired preadipocyte differentiation, which in turn is associated with systemic insulin resistance. In VAT, preadipocyte differentiation is poor even in the absence of tissue macrophages, pointing to inherent differences in fat storage potential between the two depots.

  10. Recycling energy to restore impaired ankle function during human walking.

    Directory of Open Access Journals (Sweden)

    Steven H Collins

    Full Text Available BACKGROUND: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is necessary for steady gait, in which mechanical energy is constant on average, external dissipation is negligible, and no net work is performed over a stride. However, dissipation and replacement by muscles might not be necessary if energy were instead captured and reused by an assistive device. METHODOLOGY/PRINCIPAL FINDINGS: We developed a microprocessor-controlled artificial foot that captures some of the energy that is normally dissipated by the leg and "recycles" it as positive ankle work. In tests on subjects walking with an artificially-impaired ankle, a conventional prosthesis reduced ankle push-off work and increased net metabolic energy expenditure by 23% compared to normal walking. Energy recycling restored ankle push-off to normal and reduced the net metabolic energy penalty to 14%. CONCLUSIONS/SIGNIFICANCE: These results suggest that reduced ankle push-off contributes to the increased metabolic energy expenditure accompanying ankle impairments, and demonstrate that energy recycling can be used to reduce such cost.

  11. Compound Stimulus Extinction Reduces Spontaneous Recovery in Humans

    Science.gov (United States)

    Coelho, Cesar A. O.; Dunsmoor, Joseph E.; Phelps, Elizabeth A.

    2015-01-01

    Fear-related behaviors are prone to relapse following extinction. We tested in humans a compound extinction design ("deepened extinction") shown in animal studies to reduce post-extinction fear recovery. Adult subjects underwent fear conditioning to a visual and an auditory conditioned stimulus (CSA and CSB, respectively) separately…

  12. Inorganic arsenic impairs differentiation and functions of human dendritic cells

    Energy Technology Data Exchange (ETDEWEB)

    Macoch, Mélinda; Morzadec, Claudie [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Fardel, Olivier [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Pôle Biologie, Centre Hospitalier Universitaire (CHU) Rennes, 2 rue Henri Le Guilloux, 35033 Rennes (France); Vernhet, Laurent, E-mail: laurent.vernhet@univ-rennes1.fr [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France)

    2013-01-15

    Experimental studies have demonstrated that the antileukemic trivalent inorganic arsenic prevents the development of severe pro-inflammatory diseases mediated by excessive Th1 and Th17 cell responses. Differentiation of Th1 and Th17 subsets is mainly regulated by interleukins (ILs) secreted from dendritic cells (DCs) and the ability of inorganic arsenic to impair interferon-γ and IL-17 secretion by interfering with the physiology of DCs is unknown. In the present study, we demonstrate that high concentrations of sodium arsenite (As(III), 1–2 μM) clinically achievable in plasma of arsenic-treated patients, block differentiation of human peripheral blood monocytes into immature DCs (iDCs) by inducing their necrosis. Differentiation of monocytes in the presence of non-cytotoxic concentrations of As(III) (0.1 to 0.5 μM) only slightly impacts endocytotic activity of iDCs or expression of co-stimulatory molecules in cells activated with lipopolysaccharide. However, this differentiation in the presence of As(III) strongly represses secretion of IL-12p70 and IL-23, two major regulators of Th1 and Th17 activities, from iDCs stimulated with different toll-like receptor (TLR) agonists in metalloid-free medium. Such As(III)-exposed DCs also exhibit reduced mRNA levels of IL12A and/or IL12B genes when activated with TLR agonists. Finally, differentiation of monocytes with non-cytotoxic concentrations of As(III) subsequently reduces the ability of activated DCs to stimulate the release of interferon-γ and IL-17 from Th cells. In conclusion, our results demonstrate that clinically relevant concentrations of inorganic arsenic markedly impair in vitro differentiation and functions of DCs, which may contribute to the putative beneficial effects of the metalloid towards inflammatory autoimmune diseases. Highlights: ► Inorganic arsenic impairs differentiation and functions of human dendritic cells (DCs) ► Arsenite (> 1 μM) blocks differentiation of dendritic cells by

  13. Inorganic arsenic impairs differentiation and functions of human dendritic cells

    International Nuclear Information System (INIS)

    Macoch, Mélinda; Morzadec, Claudie; Fardel, Olivier; Vernhet, Laurent

    2013-01-01

    Experimental studies have demonstrated that the antileukemic trivalent inorganic arsenic prevents the development of severe pro-inflammatory diseases mediated by excessive Th1 and Th17 cell responses. Differentiation of Th1 and Th17 subsets is mainly regulated by interleukins (ILs) secreted from dendritic cells (DCs) and the ability of inorganic arsenic to impair interferon-γ and IL-17 secretion by interfering with the physiology of DCs is unknown. In the present study, we demonstrate that high concentrations of sodium arsenite (As(III), 1–2 μM) clinically achievable in plasma of arsenic-treated patients, block differentiation of human peripheral blood monocytes into immature DCs (iDCs) by inducing their necrosis. Differentiation of monocytes in the presence of non-cytotoxic concentrations of As(III) (0.1 to 0.5 μM) only slightly impacts endocytotic activity of iDCs or expression of co-stimulatory molecules in cells activated with lipopolysaccharide. However, this differentiation in the presence of As(III) strongly represses secretion of IL-12p70 and IL-23, two major regulators of Th1 and Th17 activities, from iDCs stimulated with different toll-like receptor (TLR) agonists in metalloid-free medium. Such As(III)-exposed DCs also exhibit reduced mRNA levels of IL12A and/or IL12B genes when activated with TLR agonists. Finally, differentiation of monocytes with non-cytotoxic concentrations of As(III) subsequently reduces the ability of activated DCs to stimulate the release of interferon-γ and IL-17 from Th cells. In conclusion, our results demonstrate that clinically relevant concentrations of inorganic arsenic markedly impair in vitro differentiation and functions of DCs, which may contribute to the putative beneficial effects of the metalloid towards inflammatory autoimmune diseases. Highlights: ► Inorganic arsenic impairs differentiation and functions of human dendritic cells (DCs) ► Arsenite (> 1 μM) blocks differentiation of dendritic cells by

  14. Human immunodeficiency virus impairs reverse cholesterol transport from macrophages.

    Directory of Open Access Journals (Sweden)

    Zahedi Mujawar

    2006-10-01

    Full Text Available Several steps of HIV-1 replication critically depend on cholesterol. HIV infection is associated with profound changes in lipid and lipoprotein metabolism and an increased risk of coronary artery disease. Whereas numerous studies have investigated the role of anti-HIV drugs in lipodystrophy and dyslipidemia, the effects of HIV infection on cellular cholesterol metabolism remain uncharacterized. Here, we demonstrate that HIV-1 impairs ATP-binding cassette transporter A1 (ABCA1-dependent cholesterol efflux from human macrophages, a condition previously shown to be highly atherogenic. In HIV-1-infected cells, this effect was mediated by Nef. Transfection of murine macrophages with Nef impaired cholesterol efflux from these cells. At least two mechanisms were found to be responsible for this phenomenon: first, HIV infection and transfection with Nef induced post-transcriptional down-regulation of ABCA1; and second, Nef caused redistribution of ABCA1 to the plasma membrane and inhibited internalization of apolipoprotein A-I. Binding of Nef to ABCA1 was required for down-regulation and redistribution of ABCA1. HIV-infected and Nef-transfected macrophages accumulated substantial amounts of lipids, thus resembling foam cells. The contribution of HIV-infected macrophages to the pathogenesis of atherosclerosis was supported by the presence of HIV-positive foam cells in atherosclerotic plaques of HIV-infected patients. Stimulation of cholesterol efflux from macrophages significantly reduced infectivity of the virions produced by these cells, and this effect correlated with a decreased amount of virion-associated cholesterol, suggesting that impairment of cholesterol efflux is essential to ensure proper cholesterol content in nascent HIV particles. These results reveal a previously unrecognized dysregulation of intracellular lipid metabolism in HIV-infected macrophages and identify Nef and ABCA1 as the key players responsible for this effect. Our findings

  15. Developmental impairment of compound action potential in the optic nerve of myelin mutant taiep rats.

    Science.gov (United States)

    Roncagliolo, Manuel; Schlageter, Carol; León, Claudia; Couve, Eduardo; Bonansco, Christian; Eguibar, José R

    2006-01-05

    The taiep rat is a myelin mutant with an initial hypomyelination, followed by a progressive demyelination of the CNS. The neurological correlates start with tremor, followed by ataxia, immobility episodes, epilepsy and paralysis. The optic nerve, an easily-isolable central tract fully myelinated by oligodendrocytes, is a suitable preparation to evaluate the developmental impairment of central myelin. We examined the ontogenic development of optic nerve compound action potentials (CAP) throughout the first 6 months of life of control and taiep rats. Control optic nerves (ON) develop CAPs characterized by three waves. Along the first month, the CAPs of taiep rats showed a delayed maturation, with lower amplitudes and longer latencies than controls; at P30, the conduction velocity has only a third of the normal value. Later, as demyelination proceeds, the conduction velocity of taiep ONs begins to decrease and CAPs undergo a gradual temporal dispersion. CAPs of control and taiep showed differences in their pharmacological sensitivity to TEA and 4-AP, two voltage dependent K+ channel-blockers. As compared with TEA, 4-AP induced a significant increase of the amplitudes and a remarkable broadening of CAPs. After P20, unlike controls, the greater sensitivity to 4-AP exhibited by taiep ONs correlates with the detachment and retraction of paranodal loops suggesting that potassium conductances could regulate the excitability as demyelination of CNS axons progresses. It is concluded that the taiep rat, a long-lived mutant, provides a useful model to study the consequences of partial demyelination and the mechanisms by which glial cells regulate the molecular organization and excitability of axonal membranes during development and disease.

  16. Acute stress impairs the retrieval of extinction memory in humans

    Science.gov (United States)

    Raio, Candace M.; Brignoni-Perez, Edith; Goldman, Rachel; Phelps, Elizabeth A.

    2014-01-01

    Extinction training is a form of inhibitory learning that allows an organism to associate a previously aversive cue with a new, safe outcome. Extinction does not erase a fear association, but instead creates a competing association that may or may not be retrieved when a cue is subsequently encountered. Characterizing the conditions under which extinction learning is expressed is important to enhancing the treatment of anxiety disorders that rely on extinction-based exposure therapy as a primary treatment technique. The ventromedial prefrontal cortex, which plays an important role in the expression of extinction memory, has been shown to be functionally impaired after stress exposure. Further, recent research in rodents found that exposure to stress led to deficits in extinction retrieval, although this has yet to be tested in humans. To explore how stress might influence extinction retrieval in humans, participants underwent a differential aversive learning paradigm, in which one image was probabilistically paired with an aversive shock while the other image denoted safety. Extinction training directly followed, at which point reinforcement was omitted. A day later, participants returned to the lab and either completed an acute stress manipulation (i.e., cold pressor), or a control task, before undergoing an extinction retrieval test. Skin conductance responses and salivary cortisol concentrations were measured throughout each session as indices of fear arousal and neuroendocrine stress responses, respectively. The efficacy of our stress induction was established by observing significant increases in cortisol for the stress condition only. We examined extinction retrieval by comparing conditioned responses during the last trial of extinction (day 1) with that of the first trial of re-extinction (day 2). Groups did not differ on initial fear acquisition or extinction, however, one day later participants in the stress group (n = 27) demonstrated significantly less

  17. Human-health pharmaceutical compounds in Lake Mead, Nevada and Arizona, and Las Vegas Wash, Nevada, October 2000-August 2001

    Science.gov (United States)

    Boyd, Robert A.; Furlong, Edward T.

    2002-01-01

    The U.S. Geological Survey and the National Park Service conducted a reconnaissance study to investigate the occurrence of selected human-health pharmaceutical compounds in water samples collected from Lake Mead on the Colorado River and Las Vegas Wash, a waterway used to transport treated wastewater from the Las Vegas metropolitan area to Lake Mead. Current research indicates many of these compounds can bioaccumulate and may adversely affect aquatic organisms by disrupting physiological processes, impairing reproductive functions, increasing cancer rates, contributing to the development of antibiotic-resistant strains of bacteria, and acting in undesirable ways when mixed with other substances. These compounds may be present in effluent because a high percentage of prescription and non-prescription drugs used for human-health purposes are excreted from the body as a mixture of parent compounds and degraded metabolite compounds; also, they can be released to the environment when unused products are discarded by way of toilets, sinks, and trash in landfills. Thirteen of 33 targeted compounds were detected in at least one water sample collected between October 2000 and August 2001. All concentrations were less than or equal to 0.20 micrograms per liter. The most frequently detected compounds in samples from Las Vegas Wash were caffeine, carbamazepine (used to treat epilepsy), cotinine (a metabolite of nicotine), and dehydronifedipine (a metabolite of the antianginal Procardia). Less frequently detected compounds in samples collected from Las Vegas Wash were antibiotics (clarithromycin, erythromycin, sulfamethoxazole, and trimethoprim), acetaminophen (an analgesic and anti-inflammatory), cimetidine (used to treat ulcers), codeine (a narcotic and analgesic), diltiazem (an antihypertensive), and 1,7-dimethylxanthine (a metabolite of caffeine). Fewer compounds were detected in samples collected from Lake Mead than from Las Vegas Wash. Caffeine was detected in all samples

  18. Targeting MEK5 Enhances Radiosensitivity of Human Prostate Cancer and Impairs Tumor-Associated Angiogenesis

    Science.gov (United States)

    2016-09-01

    analysis of tumor necrosis factor - alpha resistant human breast cancer cells reveals a MEK5/Erk5-mediated epithelial-mesenchymal transition phenotype...AWARD NUMBER: W81XWH-15-1-0296 TITLE: Targeting MEK5 Enhances Radiosensitivity of Human Prostate Cancer and Impairs Tumor - Associated...Cancer and Impairs Tumor -Associated Angiogenesis 5b. GRANT NUMBER W81XWH-15-1-0296 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER

  19. Human Impairment from Living near Confined Animal (Hog) Feeding Operations

    International Nuclear Information System (INIS)

    Kilburn, K.H.; Kilburn, K.H.

    2012-01-01

    Problem. To determine whether neighbors around manure lagoons and massive hog confinement buildings who complained of offensive odors and symptoms had impaired brain and lung functions. Method. We compared near hog manure neighbors of lagoons to people living beyond 3 kilometers in Ohio and to unexposed people controls in a nearby state for neuro physiological, cognitive, recall and memory functions, and pulmonary performance. Results. The 25 exposed subjects averaged 4.3 neuro behavioral abnormalities, significantly different from 2.5 for local controls and 2.3 for Tennessee controls. Exposed subjects mean forced vital capacity and expiratory volume in 1 sec were reduced significantly compared to local and regional controls. Conclusions. Near neighbors of hog enclosures and manure lagoon gases had impaired neuro behavioral functions and pulmonary functions and these effects extended to nearby people thought to be controls. Hydrogen sulfide must be abated because people living near lagoons cannot avoid rotten egg gas.

  20. Contamination levels of human pharmaceutical compounds in French surface and drinking water.

    Science.gov (United States)

    Mompelat, S; Thomas, O; Le Bot, B

    2011-10-01

    The occurrence of 20 human pharmaceutical compounds and metabolites from 10 representative therapeutic classes was analysed from resource and drinking water in two catchment basins located in north-west France. 98 samples were analysed from 63 stations (surface water and drinking water produced from surface water). Of the 20 human pharmaceutical compounds selected, 16 were quantified in both the surface water and drinking water, with 22% of the values above the limit of quantification for surface water and 14% for drinking water). Psychostimulants, non-steroidal anti-inflammatory drugs, iodinated contrast media and anxiolytic drugs were the main therapeutic classes of human pharmaceutical compounds detected in the surface water and drinking water. The results for surface water were close to results from previous studies in spite of differences in prescription rates of human pharmaceutical compounds in different countries. The removal rate of human pharmaceutical compounds at 11 water treatment units was also determined. Only caffeine proved to be resistant to drinking water treatment processes (with a minimum rate of 5%). Other human pharmaceutical compounds seemed to be removed more efficiently (average elimination rate of over 50%) by adsorption onto activated carbon and oxidation/disinfection with ozone or chlorine (not taking account of the disinfection by-products). These results add to the increasing evidence of the occurrence of human pharmaceutical compounds in drinking water that may represent a threat to human beings exposed to a cocktail of human pharmaceutical compounds and related metabolites and by-products in drinking water.

  1. Reactive carbonyl compounds impair wound healing by vimentin collapse and loss of the primary cilium.

    Science.gov (United States)

    Rodríguez-Ribera, Lara; Slattery, Craig; Mc Morrow, Tara; Marcos, Ricard; Pastor, Susana

    2017-10-01

    In renal pathologies tubulo-interstitial fibrosis results from an aberrant wound-healing ability where the normal epithelial tissue is substituted for scar tissue caused by accumulation of extracellular matrix proteins (ECM). During the wound-healing process, epithelial cells may undergo epithelial-mesenchymal transition (EMT) acquiring a mesenchymal-like phenotype that allows cells to migrate and re-epithelialize the wound site. It has been reported that chronic inflammation and uremic milieu are involved in wound-healing and enhanced kidney damage in chronic kidney disease (CKD) patients. In this study we evaluated reactive carbonyl compounds (RCC) effects on renal wound healing. The compounds resulting from carbonyl stress evaluated in this study were glyoxal (GO), methylglyoxal (MGO), malondialdehyde (MDA) and 4-hydroxy-hexenal (HHE). Wound repair ability was evaluated by the wound healing assay using HK-2 cells. EMT was evaluated by morphological, protein and transcriptional changes using microscopy, western blot, zymography and RT-qPCR. Changes in the vimentin network and primary cilia were assessed by immunofluorescence. Our data demonstrated that MDA and GO delay wound closure mediated by vimentin disruption, which caused collagen I mRNA decrease, and deciliation. In contrast, HHE treatment (and MGO to a minor degree) induced morphological changes and increased mesenchymal marker expression and gelatinase activity in HK-2 cells. In this study, we have demonstrated for the first time that exposure to RCC differentially affects wound healing in proximal tubular epithelia. A better comprehension of effects of uremic toxins on wound healing and fibrosis and migration is necessary to seek mechanisms to slow down renal fibrosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Exposure to perfluorinated compounds and human semen quality in Arctic and European populations

    DEFF Research Database (Denmark)

    Toft, G; Jönsson, B A G; Lindh, C H

    2012-01-01

    Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality.......Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality....

  3. Human neural tuning estimated from compound action potentials in normal hearing human volunteers

    Science.gov (United States)

    Verschooten, Eric; Desloovere, Christian; Joris, Philip X.

    2015-12-01

    The sharpness of cochlear frequency tuning in humans is debated. Evoked otoacoustic emissions and psychophysical measurements suggest sharper tuning in humans than in laboratory animals [15], but this is disputed based on comparisons of behavioral and electrophysiological measurements across species [14]. Here we used evoked mass potentials to electrophysiologically quantify tuning (Q10) in humans. We combined a notched noise forward masking paradigm [9] with the recording of trans tympanic compound action potentials (CAP) from masked probe tones in awake human and anesthetized monkey (Macaca mulatta). We compare our results to data obtained with the same paradigm in cat and chinchilla [16], and find that CAP-Q10values in human are ˜1.6x higher than in cat and chinchilla and ˜1.3x higher than in monkey. To estimate frequency tuning of single auditory nerve fibers (ANFs) in humans, we derive conversion functions from ANFs in cat, chinchilla, and monkey and apply these to the human CAP measurements. The data suggest that sharp cochlear tuning is a feature of old-world primates.

  4. Caffeine attenuates scopolamine-induced memory impairment in humans.

    Science.gov (United States)

    Riedel, W; Hogervorst, E; Leboux, R; Verhey, F; van Praag, H; Jolles, J

    1995-11-01

    Caffeine consumption can be beneficial for cognitive functioning. Although caffeine is widely recognized as a mild CNS stimulant drug, the most important consequence of its adenosine antagonism is cholinergic stimulation, which might lead to improvement of higher cognitive functions, particularly memory. In this study, the scopolamine model of amnesia was used to test the cholinergic effects of caffeine, administered as three cups of coffee. Subjects were 16 healthy volunteers who received 250 mg caffeine and 2 mg nicotine separately, in a placebo-controlled double-blind cross-over design. Compared to placebo, nicotine attenuated the scopolamine-induced impairment of storage in short-term memory and attenuated the scopolamine-induced slowing of speed of short-term memory scanning. Nicotine also attenuated the scopolamine-induced slowing of reaction time in a response competition task. Caffeine attenuated the scopolamine-induced impairment of free recall from short- and long-term memory, quality and speed of retrieval from long-term memory in a word learning task, and other cognitive and non-cognitive measures, such as perceptual sensitivity in visual search, reading speed, and rate of finger-tapping. On the basis of these results it was concluded that caffeine possesses cholinergic cognition enhancing properties. Caffeine could be used as a control drug in studies using the scopolamine paradigm and possibly also in other experimental studies of cognitive enhancers, as the effects of a newly developed cognition enhancing drug should at least be superior to the effects of three cups of coffee.

  5. Multiple nutritional deficiencies in cerebral palsy compounding physical and functional impairments

    Directory of Open Access Journals (Sweden)

    P G Hariprasad

    2017-01-01

    Full Text Available Introduction: Cerebral palsy (CP refers to a spectrum of disorders causing physical and intellectual morbidity. Macro and micro nutrient deficiencies often contribute to the subnormal physical and mental capabilities of them. Objectives: To assess the growth, nutritional status, physical and functional ability and quality of life in cerebral palsy children and to determine any relation with their gross motor and functional capabilities. Method: The study was conducted at a Tertiary Care Centre, with the participants in the age group 1-16 years. A pretested evaluation tool was prepared which included Anthropometric measurements, tests for hemoglobin and Vitamin D estimation, evidence of micronutrient deficiencies, Dietary patterns, Epidemiological factors, Functional assessment using GMFM (Gross Motor Function Measure and FIM (Functional Independent Measurement scales and Quality of life (QOL assessment. The data was statistically analyzed. Results: Out of the 41 children, 30 had quadriplegia, 3 had hemiplegia and 8 had spastic diplegia. 34 (82.9% were severely underweight, 35 (85.4% had severe stunting and 38 (92.7% had severe wasting. Micronutrient deficiencies were noted like vitamin B complex deficiency in 37 (90.2%, vitamin A deficiency in 31 (75.6%, low vitamin D levels in 27 (65.9% and insufficient levels in 9 (22%, severe anemia in 5 (12.2% and moderate anemia in 26 (63.4%.The gross motor and functional scores were suboptimum in the majority of patients and the care givers had significant impairment in the quality of life. Conclusion: Majority of children with cerebral palsy had multiple nutritional deficiencies, gross motor and functional disabilities. QOL of the children and their care givers were suboptimum. A comprehensive package that address dietary intake, correction of micronutrient deficiencies especially anemia and vitamin D deficiency, physical and emotional support is recommended for the wellbeing of the affected children.

  6. The psychoactive compound of Cannabis sativa, Δ(9)-tetrahydrocannabinol (THC) inhibits the human trophoblast cell turnover.

    Science.gov (United States)

    Costa, M A; Fonseca, B M; Marques, F; Teixeira, N A; Correia-da-Silva, G

    2015-08-06

    The noxious effects of cannabis consumption for fertility and pregnancy outcome are recognized for years. Its consumption during gestation is associated with alterations in foetal growth, low birth weight and preterm labor. The main psychoactive molecule of cannabis, Δ(9)-tetrahydrocannabinol (THC) impairs the production of reproductive hormones and is also able to cross the placenta barrier. However, its effect on the main placental cells, the trophoblasts, are unknown. Actually, the role of THC in cell survival/death of primary human cytotrophoblasts (CTs) and syncytiotrophoblasts (STs) and in the syncytialization process remains to be explored. Here, we show that THC has a dual effect, enhancing MTT metabolism at low concentrations, whereas higher doses decreased cell viability, on both trophoblast phenotypes, though the effects on STs were more evident. THC also diminished the generation of oxidative and nitrative stress and the oxidized form of glutathione, whereas the reduced form of this tripeptide was increased, suggesting that THC prevents ST cell death due to an antioxidant effect. Moreover, this compound enhanced the mitochondrial function of STs, as observed by the increased MTT metabolism and intracellular ATP levels. These effects were independent of cannabinoid receptors activation. Besides, THC impaired CT differentiation into STs, since it decreased the expression of biochemical and morphological biomarkers of syncytialization, through a cannabinoid receptor-dependent mechanism. Together, these results suggest that THC interferes with trophoblast turnover, preventing trophoblast cell death and differentiation, and contribute to disclose the cellular mechanisms that lead to pregnancy complications in women that consume cannabis-derived drugs during gestation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Cryopreservation of human skeletal muscle impairs mitochondrial function

    DEFF Research Database (Denmark)

    Larsen, Steen; Wright-Paradis, C; Gnaiger, E

    2012-01-01

    functionality after long term cryopreservation (1 year). Skeletal muscle samples were preserved in dimethyl sulfoxide (DMSO) for later analysis. Human skeletal muscle fibres were thawed and permeabilised with saponin, and mitochondrial respiration was measured by high-resolution respirometry. The capacity...

  8. Analysis of adverse events of renal impairment related to platinum-based compounds using the Japanese Adverse Drug Event Report database.

    Science.gov (United States)

    Naganuma, Misa; Motooka, Yumi; Sasaoka, Sayaka; Hatahira, Haruna; Hasegawa, Shiori; Fukuda, Akiho; Nakao, Satoshi; Shimada, Kazuyo; Hirade, Koseki; Mori, Takayuki; Yoshimura, Tomoaki; Kato, Takeshi; Nakamura, Mitsuhiro

    2018-01-01

    Platinum compounds cause several adverse events, such as nephrotoxicity, gastrointestinal toxicity, myelosuppression, ototoxicity, and neurotoxicity. We evaluated the incidence of renal impairment as adverse events are related to the administration of platinum compounds using the Japanese Adverse Drug Event Report database. We analyzed adverse events associated with the use of platinum compounds reported from April 2004 to November 2016. The reporting odds ratio at 95% confidence interval was used to detect the signal for each renal impairment incidence. We evaluated the time-to-onset profile of renal impairment and assessed the hazard type using Weibull shape parameter and used the applied association rule mining technique to discover undetected relationships such as possible risk factor. In total, 430,587 reports in the Japanese Adverse Drug Event Report database were analyzed. The reporting odds ratios (95% confidence interval) for renal impairment resulting from the use of cisplatin, oxaliplatin, carboplatin, and nedaplatin were 2.7 (2.5-3.0), 0.6 (0.5-0.7), 0.8 (0.7-1.0), and 1.3 (0.8-2.1), respectively. The lower limit of the reporting odds ratio (95% confidence interval) for cisplatin was >1. The median (lower-upper quartile) onset time of renal impairment following the use of platinum-based compounds was 6.0-8.0 days. The Weibull shape parameter β and 95% confidence interval upper limit of oxaliplatin were impairment during cisplatin use in real-world setting. The present findings demonstrate that the incidence of renal impairment following cisplatin use should be closely monitored when patients are hypertensive or diabetic, or when they are co-administered furosemide, loxoprofen, or pemetrexed. In addition, healthcare professionals should closely assess a patient's background prior to treatment.

  9. Compound sensory action potential in normal and pathological human nerves

    DEFF Research Database (Denmark)

    Krarup, Christian

    2004-01-01

    The compound sensory nerve action potential (SNAP) is the result of phase summation and cancellation of single fiber potentials (SFAPs) with amplitudes that depend on fiber diameter, and the amplitude and shape of the SNAP is determined by the distribution of fiber diameters. Conduction velocitie...... effort and attention to theory and practical detail that may be time consuming....

  10. DNA repair processes and their impairment in some human diseases

    International Nuclear Information System (INIS)

    Cleaver, J.E.

    1977-01-01

    Some human diseases show enhanced sensitivity to the action of environmental mutagens, and among these several are known which are defective in the repair of damaged DNA. Xeroderma pigmentosum (XP) is mainly defective in excision repair of a large variety of damaged DNA bases caused by ultraviolet light and chemical mutagens. XP involves at least 6 distinct groups, some of which may lack cofactors required for excising damage from chromatin. As a result of these defects the sensitivity of XP cells to many mutagens is increased 5- to 10-fold. Ataxia telangiectasia and Fanconi's anemia may similarly involve defects in repair of certain DNA base damage or cross-links, respectively. But most of these and other mutagen-sensitive diseases only show increases of about 2-fold in sensitivity to mutagens, and the biochemical defects in the diseases may be more complex and less directly involved in DNA repair than in XP. (Auth.)

  11. The seleno-organic compound ebselen impairs mitochondrial physiology and induces cell death in AR42J cells.

    Science.gov (United States)

    Santofimia-Castaño, Patricia; Garcia-Sanchez, Lourdes; Ruy, Deborah Clea; Fernandez-Bermejo, Miguel; Salido, Gines M; Gonzalez, Antonio

    2014-09-17

    Ebselen is a seleno-organic compound that causes cell death in several cancer cell types. The mechanisms underlying its deleterious effects have not been fully elucidated. In this study, the effects of ebselen (1 μM-40 μM) on AR42J tumor cells have been examined. Cell viability was studied using AlamarBlue(®) test. Cell cycle phase determination was carried out by flow cytometry. Changes in intracellular free Ca(2+) concentration were followed by fluorimetry analysis of fura-2-loaded cells. Distribution of mitochondria, mitochondrial Ca(2+) concentration and mitochondrial membrane potential were monitored by confocal microscopy of cells loaded with Mitotracker Green™ FM, rhod-2 or TMRM respectively. Caspase-3 activity was calculated following the luorogenic substrate ACDEVD-AMC signal with a spectrofluorimeter. Results show that cell viability decreased in the presence of ebselen. An increase in the number of cells in the S-phase of the cell cycle was observed. Ebselen induced a concentration-dependent mobilization of Ca(2+) from agonist- and thapsigargin-sensitive Ca(2+) pools. Ebselen induced also a transient increase in mitochondrial Ca(2+) concentration, a progressive decrease of the mitochondrial membrane potential and a disruption of the mitochondrial network. Finally, a concentration-dependent increase in caspase-3 activity was detected. We conclude that ebselen exerts deleterious actions on the cells that involve the impairment of mitochondrial physiology and the activation of caspase-3-mediated apoptotic pathway. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Impact of estrogenic compounds on DNA integrity in human spermatozoa: Evidence for cross-linking and redox cycling activities

    International Nuclear Information System (INIS)

    Bennetts, L.E.; De Iuliis, G.N.; Nixon, B.; Kime, M.; Zelski, K.; McVicar, C.M.; Lewis, S.E.; Aitken, R.J.

    2008-01-01

    A great deal of circumstantial evidence has linked DNA damage in human spermatozoa with adverse reproductive outcomes including reduced fertility and high rates of miscarriage. Although oxidative stress is thought to make a significant contribution to DNA damage in the male germ line, the factors responsible for creating this stress have not been elucidated. One group of compounds that are thought to be active in this context are the estrogens, either generated as a result of the endogenous metabolism of androgens within the male reproductive tract or gaining access to the latter as a consequence of environmental exposure. In this study, a wide variety of estrogenic compounds were assessed for their direct effects on human spermatozoa in vitro. DNA integrity was assessed using the Comet and TUNEL assays, lesion frequencies were quantified by QPCR using targets within the mitochondrial and nuclear (β-globin) genomes, DNA adducts were characterized by mass spectrometry and redox activity was monitored using dihydroethidium (DHE) as the probe. Of the estrogenic and estrogen analogue compounds evaluated, catechol estrogens, quercetin, diethylstilbestrol and pyrocatechol stimulated intense redox activity while genistein was only active at the highest doses tested. Other estrogens and estrogen analogues, such as 17β-estradiol, nonylphenol, bisphenol A and 2,3-dihydroxynaphthalene were inactive. Estrogen-induced redox activity was associated with a dramatic loss of motility and, in the case of 2-hydroxyestradiol, the induction of significant DNA fragmentation. Mass spectrometry also indicated that catechol estrogens were capable of forming dimers that can cross-link the densely packed DNA strands in sperm chromatin, impairing nuclear decondensation. These results highlight the potential importance of estrogenic compounds in creating oxidative stress and DNA damage in the male germ line and suggest that further exploration of these compounds in the aetiology of male

  13. Impact of estrogenic compounds on DNA integrity in human spermatozoa: Evidence for cross-linking and redox cycling activities

    Energy Technology Data Exchange (ETDEWEB)

    Bennetts, L.E.; De Iuliis, G.N.; Nixon, B.; Kime, M.; Zelski, K. [ARC Centre of Excellence in Biotechnology and Development and Discipline of Biological Sciences, University of Newcastle, NSW (Australia); McVicar, C.M.; Lewis, S.E. [Obstetrics and Gynaecology, Queen' s University, Belfast (United Kingdom); Aitken, R.J. [ARC Centre of Excellence in Biotechnology and Development and Discipline of Biological Sciences, University of Newcastle, NSW (Australia)], E-mail: jaitken@mail.newcastle.edu.au

    2008-05-10

    A great deal of circumstantial evidence has linked DNA damage in human spermatozoa with adverse reproductive outcomes including reduced fertility and high rates of miscarriage. Although oxidative stress is thought to make a significant contribution to DNA damage in the male germ line, the factors responsible for creating this stress have not been elucidated. One group of compounds that are thought to be active in this context are the estrogens, either generated as a result of the endogenous metabolism of androgens within the male reproductive tract or gaining access to the latter as a consequence of environmental exposure. In this study, a wide variety of estrogenic compounds were assessed for their direct effects on human spermatozoa in vitro. DNA integrity was assessed using the Comet and TUNEL assays, lesion frequencies were quantified by QPCR using targets within the mitochondrial and nuclear ({beta}-globin) genomes, DNA adducts were characterized by mass spectrometry and redox activity was monitored using dihydroethidium (DHE) as the probe. Of the estrogenic and estrogen analogue compounds evaluated, catechol estrogens, quercetin, diethylstilbestrol and pyrocatechol stimulated intense redox activity while genistein was only active at the highest doses tested. Other estrogens and estrogen analogues, such as 17{beta}-estradiol, nonylphenol, bisphenol A and 2,3-dihydroxynaphthalene were inactive. Estrogen-induced redox activity was associated with a dramatic loss of motility and, in the case of 2-hydroxyestradiol, the induction of significant DNA fragmentation. Mass spectrometry also indicated that catechol estrogens were capable of forming dimers that can cross-link the densely packed DNA strands in sperm chromatin, impairing nuclear decondensation. These results highlight the potential importance of estrogenic compounds in creating oxidative stress and DNA damage in the male germ line and suggest that further exploration of these compounds in the aetiology of

  14. Socially Impaired Robots: Human Social Disorders and Robots' Socio-Emotional Intelligence

    OpenAIRE

    Vitale, Jonathan; Williams, Mary-Anne; Johnston, Benjamin

    2016-01-01

    Social robots need intelligence in order to safely coexist and interact with humans. Robots without functional abilities in understanding others and unable to empathise might be a societal risk and they may lead to a society of socially impaired robots. In this work we provide a survey of three relevant human social disorders, namely autism, psychopathy and schizophrenia, as a means to gain a better understanding of social robots' future capability requirements. We provide evidence supporting...

  15. Microencapsulated bitter compounds (from Gentiana lutea) reduce daily energy intakes in humans

    NARCIS (Netherlands)

    Mennella, Ilario; Fogliano, Vincenzo; Ferracane, Rosalia; Arlorio, Marco; Pattarino, Franco; Vitaglione, Paola

    2016-01-01

    Mounting evidence showed that bitter-tasting compounds modulate eating behaviour through bitter taste receptors in the gastrointestinal tract. This study aimed at evaluating the influence of microencapsulated bitter compounds on human appetite and energy intakes. A microencapsulated bitter

  16. 78 FR 72899 - Draft Guidance for Industry on Registration for Human Drug Compounding Outsourcing Facilities...

    Science.gov (United States)

    2013-12-04

    ... information technology. Under the draft guidance, outsourcing facilities that elect to register should submit... guidance provides information on how an outsourcing facility should submit facility registration...] Draft Guidance for Industry on Registration for Human Drug Compounding Outsourcing Facilities Under...

  17. Peripheral inflammation acutely impairs human spatial memory via actions on medial temporal lobe glucose metabolism.

    Science.gov (United States)

    Harrison, Neil A; Doeller, Christian F; Voon, Valerie; Burgess, Neil; Critchley, Hugo D

    2014-10-01

    Inflammation impairs cognitive performance and is implicated in the progression of neurodegenerative disorders. Rodent studies demonstrated key roles for inflammatory mediators in many processes critical to memory, including long-term potentiation, synaptic plasticity, and neurogenesis. They also demonstrated functional impairment of medial temporal lobe (MTL) structures by systemic inflammation. However, human data to support this position are limited. Sequential fluorodeoxyglucose positron emission tomography together with experimentally induced inflammation was used to investigate effects of a systemic inflammatory challenge on human MTL function. Fluorodeoxyglucose positron emission tomography scanning was performed in 20 healthy participants before and after typhoid vaccination and saline control injection. After each scanning session, participants performed a virtual reality spatial memory task analogous to the Morris water maze and a mirror-tracing procedural memory control task. Fluorodeoxyglucose positron emission tomography data demonstrated an acute reduction in human MTL glucose metabolism after inflammation. The inflammatory challenge also selectively compromised human spatial, but not procedural, memory; this effect that was independent of actions on motivation or psychomotor response. Effects of inflammation on parahippocampal and rhinal glucose metabolism directly mediated actions of inflammation on spatial memory. These data demonstrate acute sensitivity of human MTL to mild peripheral inflammation, giving rise to associated functional impairment in the form of reduced spatial memory performance. Our findings suggest a mechanism for the observed epidemiologic link between inflammation and risk of age-related cognitive decline and progression of neurodegenerative disorders including Alzheimer's disease. Copyright © 2014 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  18. Blood-brain transfer of Pittsburgh compound B in humans

    DEFF Research Database (Denmark)

    Gjedde, Albert; Aanerud, Joel; Braendgaard, Hans

    2013-01-01

    -brain barrier is held to be high but the permeability-surface area product and extraction fractions in patients or healthy volunteers are not known. We used PET to determine the clearance associated with the unidrectional blood-brain transfer of [(11)C]PiB and the corresponding cerebral blood flow rates...... with the observation that numerically, but insignificantly, unidirectional blood-brain clearances are lower and extraction fractions higher in the patients. The evidence of unchanged permeability-surface area products in the patients implies that blood flow changes can be deduced from the unidirectional blood......In the labeled form, the Pittsburgh compound B (2-(4'-{N-methyl-[(11)C]}methyl-aminophenyl)-6-hydroxy-benzothiazole, [(11)C]PiB), is used as a biomarker for positron emission tomography (PET) of brain β-amyloid deposition in Alzheimer's disease (AD). The permeability of [(11)C]PiB in the blood...

  19. Compound sensory action potential in normal and pathological human nerves

    DEFF Research Database (Denmark)

    Krarup, Christian

    2004-01-01

    The compound sensory nerve action potential (SNAP) is the result of phase summation and cancellation of single fiber potentials (SFAPs) with amplitudes that depend on fiber diameter, and the amplitude and shape of the SNAP is determined by the distribution of fiber diameters. Conduction velocities...... dispersion over increasing conduction distance is greater for the SNAP than CMAP, and demonstration of conduction block is therefore difficult. In addition, the effect of temporal dispersion on amplitude and shape is strongly dependent on the number of conducting fibers and their distribution, and......, with fiber loss or increased conduction velocity variability changes of the SNAP may be smaller than expected from normal nerve. The biophysical characteristics of sensory and motor fibers differ, and this may to some extent determine divergent pathophysiological changes in sensory and motor fibers...

  20. Neurodegeneration caused by expression of human truncated tau leads to progressive neurobehavioural impairment in transgenic rats.

    Science.gov (United States)

    Hrnkova, Miroslava; Zilka, Norbert; Minichova, Zuzana; Koson, Peter; Novak, Michal

    2007-01-26

    Human truncated tau protein is an active constituent of the neurofibrillary degeneration in sporadic Alzheimer's disease. We have shown that modified tau protein, when expressed as a transgene in rats, induced AD characteristic tau cascade consisting of tau hyperphosphorylation, formation of argyrophilic tangles and sarcosyl-insoluble tau complexes. These pathological changes led to the functional impairment characterized by a variety of neurobehavioural symptoms. In the present study we have focused on the behavioural alterations induced by transgenic expression of human truncated tau. Transgenic rats underwent a battery of behavioural tests involving cognitive- and sensorimotor-dependent tasks accompanied with neurological assessment at the age of 4.5, 6 and 9 months. Behavioural examination of these rats showed altered spatial navigation in Morris water maze resulting in less time spent in target quadrant (popen field was not influenced by transgene expression. However beam walking test revealed that transgenic rats developed progressive sensorimotor disturbances related to the age of tested animals. The disturbances were most pronounced at the age of 9 months (p<0.01). Neurological alterations indicating impaired reflex responses were other added features of behavioural phenotype of this novel transgenic rat. These results allow us to suggest that neurodegeneration, caused by the non-mutated human truncated tau derived from sporadic human AD, result in the neuronal dysfunction consequently leading to the progressive neurobehavioural impairment.

  1. Review of pulmonary toxicity of indium compounds to animals and humans

    International Nuclear Information System (INIS)

    Tanaka, Akiyo; Hirata, Miyuki; Kiyohara, Yutaka; Nakano, Makiko; Omae, Kazuyuki; Shiratani, Masaharu; Koga, Kazunori

    2010-01-01

    Due to the increased production of ITO, the potential health hazards arising from occupational exposure to this material have attracted much attention. This review consists of three parts: 1) toxic effects of indium compounds on animals, 2) toxic effects of indium compounds on humans, and 3) recommendations for preventing exposure to indium compounds in the workplace. Available data have indicated that insoluble form of indium compounds, such as ITO, indium arsenide (InAs) and indium phosphide (InP), can be toxic to animals. Furthermore, InP has demonstrated clear evidence of carcinogenic potential in long-term inhalation studies using experimental animals. As for the dangers to humans, some data are available concerning adverse health effects to workers who have been exposed to indium-containing particles. The Japan Society for Occupational Health recommended the value of 3 μg/L of indium in serum as the occupational exposure limit based on biological monitoring to preventing adverse health effects in workers resulting from occupational exposure to indium compounds. Accordingly, it is essential that much greater attention is focused on human exposure to indium compounds, and precautions against possible exposure to indium compounds are most important with regard to health management among indium-handling workers.

  2. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity

    Directory of Open Access Journals (Sweden)

    Christian Carpéné

    2016-01-01

    Full Text Available Resveratrol has been reported to inhibit monoamine oxidases (MAO. Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO in peripheral organs, such as semicarbazide-sensitive AO (SSAO, known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [14C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO.

  3. Morphological modulation of human fibrosarcoma HT-1080 cells by hydroxybenzoate compounds during apoptosis

    Directory of Open Access Journals (Sweden)

    Jassem G Mahdi

    2015-10-01

    Full Text Available Hydroxybenzoate (HB compounds have shown to modulate the morphology in human fibrosarcoma HT-1080 cells. The changes in HT-1080 cells showed marker signs of apoptosis, which included the condensation of nucleus, cell round, blebbing and the formation of apoptotic bodies. The different stages of apoptosis were assessed microscopically using different staining and immunohistochemical techniques, as well as scanning electron microscopy. In addition, HB compounds increased the expression of caspase-3, which is closely associated with the development of the modulation in HT-1080 cells that are undergoing the programmed cell death. Both acetyl salicylic acid (ASA and HBZn compounds were dose and treatment duration dependent.

  4. Hippocampal Volume Reduction in Humans Predicts Impaired Allocentric Spatial Memory in Virtual-Reality Navigation.

    Science.gov (United States)

    Guderian, Sebastian; Dzieciol, Anna M; Gadian, David G; Jentschke, Sebastian; Doeller, Christian F; Burgess, Neil; Mishkin, Mortimer; Vargha-Khadem, Faraneh

    2015-10-21

    The extent to which navigational spatial memory depends on hippocampal integrity in humans is not well documented. We investigated allocentric spatial recall using a virtual environment in a group of patients with severe hippocampal damage (SHD), a group of patients with "moderate" hippocampal damage (MHD), and a normal control group. Through four learning blocks with feedback, participants learned the target locations of four different objects in a circular arena. Distal cues were present throughout the experiment to provide orientation. A circular boundary as well as an intra-arena landmark provided spatial reference frames. During a subsequent test phase, recall of all four objects was tested with only the boundary or the landmark being present. Patients with SHD were impaired in both phases of this task. Across groups, performance on both types of spatial recall was highly correlated with memory quotient (MQ), but not with intelligence quotient (IQ), age, or sex. However, both measures of spatial recall separated experimental groups beyond what would be expected based on MQ, a widely used measure of general memory function. Boundary-based and landmark-based spatial recall were both strongly related to bilateral hippocampal volumes, but not to volumes of the thalamus, putamen, pallidum, nucleus accumbens, or caudate nucleus. The results show that boundary-based and landmark-based allocentric spatial recall are similarly impaired in patients with SHD, that both types of recall are impaired beyond that predicted by MQ, and that recall deficits are best explained by a reduction in bilateral hippocampal volumes. In humans, bilateral hippocampal atrophy can lead to profound impairments in episodic memory. Across species, perhaps the most well-established contribution of the hippocampus to memory is not to episodic memory generally but to allocentric spatial memory. However, the extent to which navigational spatial memory depends on hippocampal integrity in humans is

  5. Cue-independent memory impairment by reactivation-coupled interference in human declarative memory.

    Science.gov (United States)

    Zhu, Zijian; Wang, Yingying; Cao, Zhijun; Chen, Biqing; Cai, Huaqian; Wu, Yanhong; Rao, Yi

    2016-10-01

    Memory is a dynamic process. While memory becomes increasingly resistant to interference after consolidation, a brief reactivation renders it unstable again. Previous studies have shown that interference, when applied upon reactivation, impairs the consolidated memory, presumably by disrupting the reconsolidation of the memory. However, attempts have failed in disrupting human declarative memory, raising a question about whether declarative memory becomes unstable upon reactivation. Here, we used a double-cue/one-target paradigm, which associated the same target with two different cues in initial memory formation. Only one cue/target association was later reactivated and treated with behavioral interference. Our results showed, for the first time, that reactivation-coupled interference caused cue-independent memory impairment that generalized to other cues associated with the memory. Critically, such memory impairment appeared immediately after interference, before the reconsolidation process was completed, suggesting that common manipulations of reactivation-coupled interference procedures might disrupt other processes in addition to the reconsolidation process in human declarative memory. Copyright © 2016. Published by Elsevier B.V.

  6. Improvement of a synthetic lure for Anopheles gambiae using compounds produced by human skin microbiota.

    Science.gov (United States)

    Verhulst, Niels O; Mbadi, Phoebe A; Kiss, Gabriella Bukovinszkiné; Mukabana, Wolfgang R; van Loon, Joop J A; Takken, Willem; Smallegange, Renate C

    2011-02-08

    Anopheles gambiae sensu stricto is considered to be highly anthropophilic and volatiles of human origin provide essential cues during its host-seeking behaviour. A synthetic blend of three human-derived volatiles, ammonia, lactic acid and tetradecanoic acid, attracts A. gambiae. In addition, volatiles produced by human skin bacteria are attractive to this mosquito species. The purpose of the current study was to test the effect of ten compounds present in the headspace of human bacteria on the host-seeking process of A. gambiae. The effect of each of the ten compounds on the attractiveness of a basic blend of ammonia, lactic and tetradecanoic acid to A. gambiae was examined. The host-seeking response of A. gambiae was evaluated in a laboratory set-up using a dual-port olfactometer and in a semi-field facility in Kenya using MM-X traps. Odorants were released from LDPE sachets and placed inside the olfactometer as well as in the MM-X traps. Carbon dioxide was added in the semi-field experiments, provided from pressurized cylinders or fermenting yeast. The olfactometer and semi-field set-up allowed for high-throughput testing of the compounds in blends and in multiple concentrations. Compounds with an attractive or inhibitory effect were identified in both bioassays. 3-Methyl-1-butanol was the best attractant in both set-ups and increased the attractiveness of the basic blend up to three times. 2-Phenylethanol reduced the attractiveness of the basic blend in both bioassays by more than 50%. Identification of volatiles released by human skin bacteria led to the discovery of compounds that have an impact on the host-seeking behaviour of A. gambiae. 3-Methyl-1-butanol may be used to increase mosquito trap catches, whereas 2-phenylethanol has potential as a spatial repellent. These two compounds could be applied in push-pull strategies to reduce mosquito numbers in malaria endemic areas.

  7. Prediction of human population responses to toxic compounds by a collaborative competition.

    Science.gov (United States)

    Eduati, Federica; Mangravite, Lara M; Wang, Tao; Tang, Hao; Bare, J Christopher; Huang, Ruili; Norman, Thea; Kellen, Mike; Menden, Michael P; Yang, Jichen; Zhan, Xiaowei; Zhong, Rui; Xiao, Guanghua; Xia, Menghang; Abdo, Nour; Kosyk, Oksana; Friend, Stephen; Dearry, Allen; Simeonov, Anton; Tice, Raymond R; Rusyn, Ivan; Wright, Fred A; Stolovitzky, Gustavo; Xie, Yang; Saez-Rodriguez, Julio

    2015-09-01

    The ability to computationally predict the effects of toxic compounds on humans could help address the deficiencies of current chemical safety testing. Here, we report the results from a community-based DREAM challenge to predict toxicities of environmental compounds with potential adverse health effects for human populations. We measured the cytotoxicity of 156 compounds in 884 lymphoblastoid cell lines for which genotype and transcriptional data are available as part of the Tox21 1000 Genomes Project. The challenge participants developed algorithms to predict interindividual variability of toxic response from genomic profiles and population-level cytotoxicity data from structural attributes of the compounds. 179 submitted predictions were evaluated against an experimental data set to which participants were blinded. Individual cytotoxicity predictions were better than random, with modest correlations (Pearson's r < 0.28), consistent with complex trait genomic prediction. In contrast, predictions of population-level response to different compounds were higher (r < 0.66). The results highlight the possibility of predicting health risks associated with unknown compounds, although risk estimation accuracy remains suboptimal.

  8. Anti-human rhinoviral activity of polybromocatechol compounds isolated from the rhodophyta, Neorhodomela aculeata.

    Science.gov (United States)

    Park, Soon-Hye; Song, Jae-Hyoung; Kim, Taejung; Shin, Woon-Seob; Park, Gab Man; Lee, Seokjoon; Kim, Young-Joo; Choi, Pilju; Kim, Heejin; Kim, Hui-Seong; Kwon, Dur-Han; Choi, Hwa Jung; Ham, Jungyeob

    2012-10-01

    An extract of the red alga, Neorhodomela aculeata, exhibited antiviral activity against human rhinoviruses. Bioassay-guided purification was performed to yield six compounds, which were subsequently identified as lanosol (1) and five polybromocatechols (2-6) by spectroscopic methods, including 1D and 2D NMR and mass spectrometric analyses. Structurally, all of these compounds, except compound 5, contain one or two 2,3-dibromo-4,5-dihydroxyphenyl moieties. In a biological activity assay, compound 1 was found to possess antiviral activity with a 50% inhibitory concentration (IC₅₀) of 2.50 μg/mL against HRV2. Compound 3 showed anti-HRV2 activity, with an IC₅₀ of 7.11 μg/mL, and anti-HRV3 activity, with an IC₅₀ of 4.69 μg/mL, without demonstrable cytotoxicity at a concentration of 20 μg/mL. Collectively, the results suggest that compounds 1 and 3 are candidates for novel therapeutics against two different groups of human rhinovirus.

  9. Anti-Human Rhinoviral Activity of Polybromocatechol Compounds Isolated from the Rhodophyta, Neorhodomela aculeata

    Directory of Open Access Journals (Sweden)

    Hui-Seong Kim

    2012-10-01

    Full Text Available An extract of the red alga, Neorhodomela aculeata, exhibited antiviral activity against human rhinoviruses. Bioassay-guided purification was performed to yield six compounds, which were subsequently identified as lanosol (1 and five polybromocatechols (2–6 by spectroscopic methods, including 1D and 2D NMR and mass spectrometric analyses. Structurally, all of these compounds, except compound 5, contain one or two 2,3-dibromo-4,5-dihydroxyphenyl moieties. In a biological activity assay, compound 1 was found to possess antiviral activity with a 50% inhibitory concentration (IC50 of 2.50 μg/mL against HRV2. Compound 3 showed anti-HRV2 activity, with an IC50 of 7.11 μg/mL, and anti-HRV3 activity, with an IC50 of 4.69 μg/mL, without demonstrable cytotoxicity at a concentration of 20 μg/mL. Collectively, the results suggest that compounds 1 and 3 are candidates for novel therapeutics against two different groups of human rhinovirus.

  10. Simultaneous quantitative analysis of nine vitamin D compounds in human blood using LC-MS/MS.

    Science.gov (United States)

    Abu Kassim, Nur Sofiah; Gomes, Fabio P; Shaw, Paul Nicholas; Hewavitharana, Amitha K

    2016-01-01

    It has been suggested that each member of the family of vitamin D compounds may have different function(s). Therefore, selective quantification of each compound is important in clinical research. Development and validation attempts of a simultaneous determination method of 12 vitamin D compounds in human blood using precolumn derivatization followed by LC-MS/MS is described. Internal standard calibration with 12 stable isotope labeled analogs was used to correct for matrix effects in MS detector. Nine vitamin D compounds were quantifiable in blood samples with detection limits within femtomole levels. Serum (compared with plasma) was found to be a more suitable sample type, and protein precipitation (compared with saponification) a more effective extraction method for vitamin D assay.

  11. Direct Electrical Stimulation of the Human Entorhinal Region and Hippocampus Impairs Memory.

    Science.gov (United States)

    Jacobs, Joshua; Miller, Jonathan; Lee, Sang Ah; Coffey, Tom; Watrous, Andrew J; Sperling, Michael R; Sharan, Ashwini; Worrell, Gregory; Berry, Brent; Lega, Bradley; Jobst, Barbara C; Davis, Kathryn; Gross, Robert E; Sheth, Sameer A; Ezzyat, Youssef; Das, Sandhitsu R; Stein, Joel; Gorniak, Richard; Kahana, Michael J; Rizzuto, Daniel S

    2016-12-07

    Deep brain stimulation (DBS) has shown promise for treating a range of brain disorders and neurological conditions. One recent study showed that DBS in the entorhinal region improved the accuracy of human spatial memory. Based on this line of work, we performed a series of experiments to more fully characterize the effects of DBS in the medial temporal lobe on human memory. Neurosurgical patients with implanted electrodes performed spatial and verbal-episodic memory tasks. During the encoding periods of both tasks, subjects received electrical stimulation at 50 Hz. In contrast to earlier work, electrical stimulation impaired memory performance significantly in both spatial and verbal tasks. Stimulation in both the entorhinal region and hippocampus caused decreased memory performance. These findings indicate that the entorhinal region and hippocampus are causally involved in human memory and suggest that refined methods are needed to use DBS in these regions to improve memory. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Designing Second Generation Anti-Alzheimer Compounds as Inhibitors of Human Acetylcholinesterase: Computational Screening of Synthetic Molecules and Dietary Phytochemicals.

    Science.gov (United States)

    Amat-Ur-Rasool, Hafsa; Ahmed, Mehboob

    2015-01-01

    Alzheimer's disease (AD), a big cause of memory loss, is a progressive neurodegenerative disorder. The disease leads to irreversible loss of neurons that result in reduced level of acetylcholine neurotransmitter (ACh). The reduction of ACh level impairs brain functioning. One aspect of AD therapy is to maintain ACh level up to a safe limit, by blocking acetylcholinesterase (AChE), an enzyme that is naturally responsible for its degradation. This research presents an in-silico screening and designing of hAChE inhibitors as potential anti-Alzheimer drugs. Molecular docking results of the database retrieved (synthetic chemicals and dietary phytochemicals) and self-drawn ligands were compared with Food and Drug Administration (FDA) approved drugs against AD as controls. Furthermore, computational ADME studies were performed on the hits to assess their safety. Human AChE was found to be most approptiate target site as compared to commonly used Torpedo AChE. Among the tested dietry phytochemicals, berberastine, berberine, yohimbine, sanguinarine, elemol and naringenin are the worth mentioning phytochemicals as potential anti-Alzheimer drugs The synthetic leads were mostly dual binding site inhibitors with two binding subunits linked by a carbon chain i.e. second generation AD drugs. Fifteen new heterodimers were designed that were computationally more efficient inhibitors than previously reported compounds. Using computational methods, compounds present in online chemical databases can be screened to design more efficient and safer drugs against cognitive symptoms of AD.

  13. Designing Second Generation Anti-Alzheimer Compounds as Inhibitors of Human Acetylcholinesterase: Computational Screening of Synthetic Molecules and Dietary Phytochemicals.

    Directory of Open Access Journals (Sweden)

    Hafsa Amat-Ur-Rasool

    Full Text Available Alzheimer's disease (AD, a big cause of memory loss, is a progressive neurodegenerative disorder. The disease leads to irreversible loss of neurons that result in reduced level of acetylcholine neurotransmitter (ACh. The reduction of ACh level impairs brain functioning. One aspect of AD therapy is to maintain ACh level up to a safe limit, by blocking acetylcholinesterase (AChE, an enzyme that is naturally responsible for its degradation. This research presents an in-silico screening and designing of hAChE inhibitors as potential anti-Alzheimer drugs. Molecular docking results of the database retrieved (synthetic chemicals and dietary phytochemicals and self-drawn ligands were compared with Food and Drug Administration (FDA approved drugs against AD as controls. Furthermore, computational ADME studies were performed on the hits to assess their safety. Human AChE was found to be most approptiate target site as compared to commonly used Torpedo AChE. Among the tested dietry phytochemicals, berberastine, berberine, yohimbine, sanguinarine, elemol and naringenin are the worth mentioning phytochemicals as potential anti-Alzheimer drugs The synthetic leads were mostly dual binding site inhibitors with two binding subunits linked by a carbon chain i.e. second generation AD drugs. Fifteen new heterodimers were designed that were computationally more efficient inhibitors than previously reported compounds. Using computational methods, compounds present in online chemical databases can be screened to design more efficient and safer drugs against cognitive symptoms of AD.

  14. Organotin compounds cause structure-dependent induction of progesterone in human choriocarcinoma Jar cells.

    Science.gov (United States)

    Hiromori, Youhei; Yui, Hiroki; Nishikawa, Jun-ichi; Nagase, Hisamitsu; Nakanishi, Tsuyoshi

    2016-01-01

    Organotin compounds, such as tributyltin (TBT) and triphenyltin (TPT), are typical environmental contaminants and suspected endocrine-disrupting chemicals because they cause masculinization in female mollusks. In addition, previous studies have suggested that the endocrine disruption by organotin compounds leads to activation of peroxisome proliferator-activated receptor (PPAR)γ and retinoid X receptor (RXR). However, whether organotin compounds cause crucial toxicities in human development and reproduction is unclear. We here investigated the structure-dependent effect of 12 tin compounds on mRNA transcription of 3β-hydroxysteroid dehydrogenase type I (3β-HSD I) and progesterone production in human choriocarcinoma Jar cells. TBT, TPT, dibutyltin, monophenyltin, tripropyltin, and tricyclohexyltin enhanced progesterone production in a dose-dependent fashion. Although tetraalkyltin compounds such as tetrabutyltin increased progesterone production, the concentrations necessary for activation were 30-100 times greater than those for trialkyltins. All tested active organotins increased 3β-HSD I mRNA transcription. We further investigated the correlation between the agonistic activity of organotin compounds on PPARγ and their ability to promote progesterone production. Except for DBTCl2, the active organotins significantly induced the transactivation function of PPARγ. In addition, PPARγ knockdown significantly suppressed the induction of mRNA transcription of 3β-HSD I by all active organotins except DBTCl2. These results suggest that some organotin compounds promote progesterone biosynthesis in vitro by inducing 3β-HSD I mRNA transcription via the PPARγ signaling pathway. The placenta represents a potential target organ for these compounds, whose endocrine-disrupting effects might cause local changes in progesterone concentration in pregnant women. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Dihydrochalcone Compounds Isolated from Crabapple Leaves Showed Anticancer Effects on Human Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Xiaoxiao Qin

    2015-11-01

    Full Text Available Seven dihydrochalcone compounds were isolated from the leaves of Malus crabapples, cv. “Radiant”, and their chemical structures were elucidated by UV, IR, ESI-MS, 1H-NMR and 13C-NMR analyses. These compounds, which include trilobatin (A1, phloretin (A2, 3-hydroxyphloretin (A3, phloretin rutinoside (A4, phlorizin (A5, 6′′-O-coumaroyl-4′-O-glucopyranosylphloretin (A6, and 3′′′-methoxy-6′′-O-feruloy-4′-O-glucopyranosyl-phloretin (A7, all belong to the phloretin class and its derivatives. Compounds A6 and A7 are two new rare dihydrochalcone compounds. The results of a MTT cancer cell growth inhibition assay demonstrated that phloretin and these derivatives showed significant positive anticancer activities against several human cancer cell lines, including the A549 human lung cancer cell line, Bel 7402 liver cancer cell line, HepG2 human ileocecal cancer cell line, and HT-29 human colon cancer cell line. A7 had significant effects on all cancer cell lines, suggesting potential applications for phloretin and its derivatives. Adding a methoxyl group to phloretin dramatically increases phloretin’s anticancer activity.

  16. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  17. Exposure to perfluorinated compounds and human semen quality in arctic and European populations

    NARCIS (Netherlands)

    Toft, G.; Jönsson, B.A.G.; Lindh, C.H.; Giwercman, A.; Spano, M.; Heederik, D.J.J.; Lenters, V.C.; Vermeulen, R.C.H.; Rylander, L.; Pedersen, H.S.; Ludwicki, J.K.; Zviezdai, V.; Bonde, J.P.

    2012-01-01

    BACKGROUND Perfluorinated compounds (PFCs) have been suspected to adversely affect human reproductive health. The aim of this study was to investigate the associations between PFC exposure and male semen quality. METHODS PFCs were measured in serum from 588 partners of pregnant women from Greenland,

  18. Consolidation and reconsolidation are impaired by oral propranolol administered before but not after memory (re)activation in humans.

    Science.gov (United States)

    Thomas, Émilie; Saumier, Daniel; Pitman, Roger K; Tremblay, Jacques; Brunet, Alain

    2017-07-01

    Propranolol administered immediately after learning or after recall has been found to impair memory consolidation or reconsolidation (respectively) in animals, but less reliably so in humans. Since reconsolidation impairment has been proposed as a treatment for mental disorders that have at their core an emotional memory, it is desirable to understand how to reliably reduce the strength of pathogenic memories in humans. We postulated that since humans (unlike experimental animals) typically receive propranolol orally, this introduces a delay before this drug can exert its memory impairment effects, which may render it less effective. As a means to test this, in two double-blind placebo-controlled experiments, we examined the capacity of propranolol to impair consolidation and reconsolidation as a function of timing of ingestion in healthy subjects. In Experiment 1, (n=36), propranolol administered immediately after learning or recall failed to impair the consolidation or reconsolidation of the memory of a standardized slideshow with an accompanying emotional story. In Experiment 2 (n=50), propranolol given 60-75min before learning or recall successfully impaired memory consolidation and reconsolidation. These results suggest that it is possible to achieve reliable memory impairment in humans if propranolol is given before learning or before recall, but not after. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Impaired production of proinflammatory cytokines in response to lipopolysaccharide (LPS) stimulation in elderly humans

    DEFF Research Database (Denmark)

    Bruunsgaard, H.; Pedersen, Agnes Nadelmann; Schroll, M.

    1999-01-01

    following LPS stimulation, representing an ex vivo model of sepsis. Levels of tumour necrosis factor-alpha (TNF-alpha), IL-1 beta and IL-6 in whole blood supernatants were measured after in vitro LPS stimulation for 24 h in 168 elderly humans aged 81 years from the 1914 cohort in Glostrup, Denmark and in 91...... of proinflammatory cytokines compared with young men, but this difference was blurred by ageing. No relation was found between circulating plasma levels of TNF-alpha and levels after in vitro LPS stimulation. In conclusion, decreased production of TNF-alpha and IL-1 beta after exposure to LPS may reflect impaired...

  20. Impaired representation of geometric relationships in humans with damage to the hippocampal formation.

    Directory of Open Access Journals (Sweden)

    Carsten Finke

    Full Text Available The pivotal role of the hippocampus for spatial memory is well-established. However, while neurophysiological and imaging studies suggest a specialization of the hippocampus for viewpoint-independent or allocentric memory, results from human lesion studies have been less conclusive. It is currently unclear whether disproportionate impairment in allocentric memory tasks reflects impairment of cognitive functions that are not sufficiently supported by regions outside the medial temporal lobe or whether the deficits observed in some studies are due to experimental factors. Here, we have investigated whether hippocampal contributions to spatial memory depend on the spatial references that are available in a certain behavioral context. Patients with medial temporal lobe lesions affecting systematically the right hippocampal formation performed a series of three oculomotor tasks that required memory of a spatial cue either in retinal coordinates or relative to a single environmental reference across a delay of 5000 ms. Stimulus displays varied the availability of spatial references and contained no complex visuo-spatial associations. Patients showed a selective impairment in a condition that critically depended on memory of the geometric relationship between spatial cue and environmental reference. We infer that regions of the medial temporal lobe, most likely the hippocampal formation, contribute to behavior in conditions that exceed the potential of viewpoint-dependent or egocentric representations. Apparently, this already applies to short-term memory of simple geometric relationships and does not necessarily depend on task difficulty or integration of landmarks into more complex representations. Deficient memory of basic geometric relationships may represent a core deficit that contributes to impaired performance in allocentric spatial memory tasks.

  1. Impaired representation of geometric relationships in humans with damage to the hippocampal formation.

    Science.gov (United States)

    Finke, Carsten; Ostendorf, Florian; Braun, Mischa; Ploner, Christoph J

    2011-01-01

    The pivotal role of the hippocampus for spatial memory is well-established. However, while neurophysiological and imaging studies suggest a specialization of the hippocampus for viewpoint-independent or allocentric memory, results from human lesion studies have been less conclusive. It is currently unclear whether disproportionate impairment in allocentric memory tasks reflects impairment of cognitive functions that are not sufficiently supported by regions outside the medial temporal lobe or whether the deficits observed in some studies are due to experimental factors. Here, we have investigated whether hippocampal contributions to spatial memory depend on the spatial references that are available in a certain behavioral context. Patients with medial temporal lobe lesions affecting systematically the right hippocampal formation performed a series of three oculomotor tasks that required memory of a spatial cue either in retinal coordinates or relative to a single environmental reference across a delay of 5000 ms. Stimulus displays varied the availability of spatial references and contained no complex visuo-spatial associations. Patients showed a selective impairment in a condition that critically depended on memory of the geometric relationship between spatial cue and environmental reference. We infer that regions of the medial temporal lobe, most likely the hippocampal formation, contribute to behavior in conditions that exceed the potential of viewpoint-dependent or egocentric representations. Apparently, this already applies to short-term memory of simple geometric relationships and does not necessarily depend on task difficulty or integration of landmarks into more complex representations. Deficient memory of basic geometric relationships may represent a core deficit that contributes to impaired performance in allocentric spatial memory tasks.

  2. Prediction of Human Intestinal Absorption of Compounds Using Artificial Intelligence Techniques.

    Science.gov (United States)

    Kumar, Rajnish; Sharma, Anju; Siddiqui, Mohammed Haris; Tiwari, Rajesh Kumar

    2017-01-01

    Information about Pharmacokinetics of compounds is an essential component of drug design and development. Modeling the pharmacokinetic properties require identification of the factors effecting absorption, distribution, metabolism and excretion of compounds. There have been continuous attempts in the prediction of intestinal absorption of compounds using various Artificial intelligence methods in the effort to reduce the attrition rate of drug candidates entering to preclinical and clinical trials. Currently, there are large numbers of individual predictive models available for absorption using machine learning approaches. Six Artificial intelligence methods namely, Support vector machine, k- nearest neighbor, Probabilistic neural network, Artificial neural network, Partial least square and Linear discriminant analysis were used for prediction of absorption of compounds. Prediction accuracy of Support vector machine, k- nearest neighbor, Probabilistic neural network, Artificial neural network, Partial least square and Linear discriminant analysis for prediction of intestinal absorption of compounds was found to be 91.54%, 88.33%, 84.30%, 86.51%, 79.07% and 80.08% respectively. Comparative analysis of all the six prediction models suggested that Support vector machine with Radial basis function based kernel is comparatively better for binary classification of compounds using human intestinal absorption and may be useful at preliminary stages of drug design and development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Oxidative stress and mitochondrial impairment can be separated from lipofuscin accumulation in aged human skeletal muscle

    DEFF Research Database (Denmark)

    Hütter, Eveline; Skovbro, Mette; Lener, Barbara

    2007-01-01

    According to the free radical theory of aging, reactive oxygen species (ROS) act as a driving force of the aging process, and it is generally believed that mitochondrial dysfunction is a major source of increased oxidative stress in tissues with high content of mitochondria, such as muscle or brain....... However, recent experiments in mouse models of premature aging have questioned the role of mitochondrial ROS production in premature aging. To address the role of mitochondrial impairment and ROS production for aging in human muscles, we have analyzed mitochondrial properties in muscle fibres isolated...... from the vastus lateralis of young and elderly donors. Mitochondrial respiratory functions were addressed by high-resolution respirometry, and ROS production was analyzed by in situ staining with the redox-sensitive dye dihydroethidium. We found that aged human skeletal muscles contain fully functional...

  4. Concentration and distribution of dioxins and related compounds in various human organs

    Energy Technology Data Exchange (ETDEWEB)

    Iida, T.; Hirakawa, H.; Hori, T.; Tobiishi, K.; Matsueda, T. [Fukuoka Inst. of Health and Environmental Sciences, Dazaifu, Fukuoka (Japan); Todaka, T. [Japan Food Hygiene Association, Tokyo (Japan); Watanabe, S. [Tokyo Univ. of Agriculture, Tokyo (Japan); Yamada, T. [Keio Univ. School of Medicine, Tokyo (Japan)

    2004-09-15

    Polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and non-ortho coplanar polychlorinated biphenyls (Non-Co-PCBs) and mono-ortho coplanar polychlorinated biphenyls (Mono-Co-PCBs) accumulate in the human body due to their highly lipophilic properties. In recent years, there has been some concern about the potential health effects of dioxins and related chemicals for the general population of humans. Although there exists an enormous amount of data on this subject, most of it is from breast milk and blood, due to ease of collection; information concerning concentrations and distribution in various human organs hardly exists. Therefore, new data concerning various human tissues is required to evaluate the pathophysiological significance of dioxins and related compounds in humans. The aim of this study was to investigate the concentration levels and distribution of dioxins and related compounds in various human organ tissues. We previously reported on the concentration levels in the human liver and adipose tissues from 28 donors. In this paper, we determined the concentrations of dioxin-like isomers in 8 organs, including blood, lungs, liver, bile, spleen, pancreas, kidney and mesentery fat from 20 donors.

  5. A Synthetic Thiourea-Based Tripodal Receptor that Impairs the Function of Human First Trimester Cytotrophoblast Cells

    Directory of Open Access Journals (Sweden)

    Darijana Horvat

    2014-07-01

    Full Text Available A synthetic tripodal-based thiourea receptor (PNTTU was used to explore the receptor/ligand binding affinity using CTB cells. The human extravillous CTB cells (Sw.71 used in this study were derived from first trimester chorionic villus tissue. The cell proliferation, migration and angiogenic factors were evaluated in PNTTU-treated CTB cells. The PNTTU inhibited the CTBs proliferation and migration. The soluble fms-like tyrosine kinase-1 (sFlt-1 secretion was increased while vascular endothelial growth factor (VEGF was decreased in the culture media of CTB cells treated with ≥1 nM PNTTU. The angiotensin II receptor type 2 (AT2 expression was significantly upregulated in ≥1 nM PNTTU-treated CTB cells in compared to basal; however, the angiotensin II receptor, type 1 (AT1 and vascular endothelial growth factor receptor 1 (VEGFR-1 expression was downregulated. The anti-proliferative and anti-angiogenic effect of this compound on CTB cells are similar to the effect of CTSs. The receptor/ligand affinity of PNTTU on CTBs provides us the clue to design a potent inhibitor to prevent the CTS-induced impairment of CTB cells.

  6. A high-throughput approach to identify compounds that impair envelope integrity in Escherichia coli

    DEFF Research Database (Denmark)

    Baker, Kristin Renee; Jana, Bimal; Franzyk, Henrik

    2016-01-01

    - to 125-fold) the MICs of erythromycin, fusidic acid, novobiocin and rifampin and displayed synergy (fractional inhibitory concentration index, antibiotics by checkerboard assays in two genetically distinct E. coli strains, including the high-risk multidrug-resistant, CTX-M-15-producing...... the discovery of antimicrobial helper drug candidates and targets that enhance the delivery of existing antibiotics by impairing envelope integrity in Gram-negative bacteria....

  7. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    Energy Technology Data Exchange (ETDEWEB)

    Ross, P.S. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Swart, R.L. de [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands); Timmerman, H.H.; Loveren, H. van [National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Osterhaus, A.D.M.E. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

    1995-12-31

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  8. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    OpenAIRE

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Na?ra; Rau, Fr?d?rique; Jollet, Arnaud; Edom-Vovard, Fr?d?rique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois

    2017-01-01

    International audience; Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded rep...

  9. Sleep deprivation impairs spatial retrieval but not spatial learning in the non-human primate grey mouse lemur.

    Directory of Open Access Journals (Sweden)

    Anisur Rahman

    Full Text Available A bulk of studies in rodents and humans suggest that sleep facilitates different phases of learning and memory process, while sleep deprivation (SD impairs these processes. Here we tested the hypothesis that SD could alter spatial learning and memory processing in a non-human primate, the grey mouse lemur (Microcebus murinus, which is an interesting model of aging and Alzheimer's disease (AD. Two sets of experiments were performed. In a first set of experiments, we investigated the effects of SD on spatial learning and memory retrieval after one day of training in a circular platform task. Eleven male mouse lemurs aged between 2 to 3 years were tested in three different conditions: without SD as a baseline reference, 8 h of SD before the training and 8 h of SD before the testing. The SD was confirmed by electroencephalographic recordings. Results showed no effect of SD on learning when SD was applied before the training. When the SD was applied before the testing, it induced an increase of the amount of errors and of the latency prior to reach the target. In a second set of experiments, we tested the effect of 8 h of SD on spatial memory retrieval after 3 days of training. Twenty male mouse lemurs aged between 2 to 3 years were tested in this set of experiments. In this condition, the SD did not affect memory retrieval. This is the first study that documents the disruptive effects of the SD on spatial memory retrieval in this primate which may serve as a new validated challenge to investigate the effects of new compounds along physiological and pathological aging.

  10. Decision making under explicit risk is impaired in individuals with human immunodeficiency virus (HIV).

    Science.gov (United States)

    Fujiwara, Esther; Tomlinson, Sara E; Purdon, Scot E; Gill, M John; Power, Christopher

    2015-01-01

    Human immunodeficiency virus (HIV) can affect the frontal-striatal brain regions, which are known to subserve decision-making functions. Previous studies have reported impaired decision making among HIV+ individuals using the Iowa Gambling Task, a task that assesses decision making under ambiguity. Previous study populations often had significant comorbidities such as past or present substance use disorders and/or hepatitis C virus coinfection, complicating conclusions about the unique contributions of HIV-infection to decision making. Decision making under explicit risk has very rarely been examined in HIV+ individuals and was tested here using the Game of Dice Task (GDT). We examined decision making under explicit risk in the GDT in 20 HIV+ individuals without substance use disorder or HCV coinfection, including a demographically matched healthy control group (n = 20). Groups were characterized on a standard neuropsychological test battery. For the HIV+ group, several disease-related parameters (viral load, current and nadir CD4 T-cell count) were included. Analyses focused on the GDT and spanned between-group (t-tests; analysis of covariance, ANCOVA) as well as within-group comparisons (Pearson/Spearman correlations). HIV+ individuals were impaired in the GDT, compared to healthy controls (p = .02). Their decision-making impairments were characterized by less advantageous choices and more random choice strategies, especially towards the end of the task. Deficits in the GDT in the HIV+ group were related to executive dysfunctions, slowed processing/motor speed, and current immune system status (CD4+ T-cell levels, ps Decision making under explicit risk in the GDT can occur in HIV-infected individuals without comorbidities. The correlational patterns may point to underlying fronto-subcortical dysfunctions in HIV+ individuals. The GDT provides a useful measure to assess risky decision making in this population and should be tested in larger studies.

  11. Dioxin-like activity of environmental compounds in human blood and environmental samples

    DEFF Research Database (Denmark)

    Long, Manhai; Bonefeld-Jørgensen, Eva Cecilie

    2012-01-01

    and humans. We found that some pesticides, plasticizers and phytoestrogens can activate the AhR, and the combined effect of compounds with no or weak AhR potency cannot be ignored. The significant DL-activity in the wastewater effluent indicates the treatment is not sufficient to prevent contamination...... of surface waters with dioxins. Our results from human studies suggest that the serum DL-activity reflect the complex mixture of persistent organic pollutants (POPs). Greenlandic Inuit had lower serum DL-activity level compared to Europeans, probably due to long distance from the dioxin sources and UV...

  12. The human volatilome: volatile organic compounds (VOCs) in exhaled breath, skin emanations, urine, feces and saliva.

    Science.gov (United States)

    Amann, Anton; Costello, Ben de Lacy; Miekisch, Wolfram; Schubert, Jochen; Buszewski, Bogusław; Pleil, Joachim; Ratcliffe, Norman; Risby, Terence

    2014-09-01

    Breath analysis is a young field of research with its roots in antiquity. Antoine Lavoisier discovered carbon dioxide in exhaled breath during the period 1777-1783, Wilhelm (Vilém) Petters discovered acetone in breath in 1857 and Johannes Müller reported the first quantitative measurements of acetone in 1898. A recent review reported 1765 volatile compounds appearing in exhaled breath, skin emanations, urine, saliva, human breast milk, blood and feces. For a large number of compounds, real-time analysis of exhaled breath or skin emanations has been performed, e.g., during exertion of effort on a stationary bicycle or during sleep. Volatile compounds in exhaled breath, which record historical exposure, are called the 'exposome'. Changes in biogenic volatile organic compound concentrations can be used to mirror metabolic or (patho)physiological processes in the whole body or blood concentrations of drugs (e.g. propofol) in clinical settings-even during artificial ventilation or during surgery. Also compounds released by bacterial strains like Pseudomonas aeruginosa or Streptococcus pneumonia could be very interesting. Methyl methacrylate (CAS 80-62-6), for example, was observed in the headspace of Streptococcus pneumonia in concentrations up to 1420 ppb. Fecal volatiles have been implicated in differentiating certain infectious bowel diseases such as Clostridium difficile, Campylobacter, Salmonella and Cholera. They have also been used to differentiate other non-infectious conditions such as irritable bowel syndrome and inflammatory bowel disease. In addition, alterations in urine volatiles have been used to detect urinary tract infections, bladder, prostate and other cancers. Peroxidation of lipids and other biomolecules by reactive oxygen species produce volatile compounds like ethane and 1-pentane. Noninvasive detection and therapeutic monitoring of oxidative stress would be highly desirable in autoimmunological, neurological, inflammatory diseases and cancer

  13. Protective effects of compound FLZ on β-amyloid peptide-(25-35)-induced mouse hippocampal injury and learning and memory impairment

    Institute of Scientific and Technical Information of China (English)

    Fang FANG; Geng-tao LIU

    2006-01-01

    Aim: To study the protective effects of compound FLZ, a novel synthetic analogue of natural squamosamide, on learning and memory impairment and lesions of the hippocampus caused by icv injection of β-amyloid25-35 (Aβ25-35) in mice. Methods: Mice were icv injected with the Aβ25-35 (15 nmol/mouse), and then treated with oral administration of 75 mg/kg or 150 mg/kg of FLZ once daily for 16 consecutive days. The impairment of learning and memory in mice were tested using step-down test and Morris water maze test. The content of malondialdehyde (MDA) and the expressions of acetylcholinesterase (AChE), Bax, and Bcl-2 in the CA1 region of the mouse hippocampus were measured by biochemical and immu-nohistochemical analysis, respectively. The pathological damages of hippocampus were observed using a microscope. Results: FLZ (75 mg/kg, 150 mg/kg) significantly attenuated Aβ25-35-induced impairment of learning and memory in the step-down test and Morris water maze test. FLZ also reduced pathological damages to the hippocampus induced by Aβ25-35 Furthermore, FLZ prevented the increase of AChE and Bax, and the decrease of Bcl-2 immunoreactive cells in the CA1 region of the hippocampus, and reduced the increase of MDA content in the hippocampus in mice injected with Aβ25-35. Conclusion: FLZ has protective action against the impairment of learning and memory and pathological damage to the hippocampus induced by icv injection of Aβ25-35 in mice.

  14. Blocking mineralocorticoid receptors impairs, blocking glucocorticoid receptors enhances memory retrieval in humans.

    Science.gov (United States)

    Rimmele, Ulrike; Besedovsky, Luciana; Lange, Tanja; Born, Jan

    2013-04-01

    Memory retrieval is impaired at very low as well as very high cortisol levels, but not at intermediate levels. This inverted-U-shaped relationship between cortisol levels and memory retrieval may originate from different roles of the mineralocorticoid (MR) and glucocorticoid receptor (GR) that bind cortisol with distinctly different affinity. Here, we examined the role of MRs and GRs in human memory retrieval using specific receptor antagonists. In two double-blind within-subject, cross-over designed studies, young healthy men were asked to retrieve emotional and neutral texts and pictures (learnt 3 days earlier) between 0745 and 0915 hours in the morning, either after administration of 400 mg of the MR blocker spironolactone vs placebo (200 mg at 2300 hours and 200 mg at 0400 hours, Study I) or after administration of the GR blocker mifepristone vs placebo (200 mg at 2300 hours, Study II). Blockade of MRs impaired free recall of both texts and pictures particularly for emotional material. In contrast, blockade of GRs resulted in better memory retrieval for pictures, with the effect being more pronounced for neutral than emotional materials. These findings indicate indeed opposing roles of MRs and GRs in memory retrieval, with optimal retrieval at intermediate cortisol levels likely mediated by high MR but concurrently low GR activation.

  15. Sleep Deprivation Impairs the Human Central and Peripheral Nervous System Discrimination of Social Threat.

    Science.gov (United States)

    Goldstein-Piekarski, Andrea N; Greer, Stephanie M; Saletin, Jared M; Walker, Matthew P

    2015-07-15

    Facial expressions represent one of the most salient cues in our environment. They communicate the affective state and intent of an individual and, if interpreted correctly, adaptively influence the behavior of others in return. Processing of such affective stimuli is known to require reciprocal signaling between central viscerosensory brain regions and peripheral-autonomic body systems, culminating in accurate emotion discrimination. Despite emerging links between sleep and affective regulation, the impact of sleep loss on the discrimination of complex social emotions within and between the CNS and PNS remains unknown. Here, we demonstrate in humans that sleep deprivation impairs both viscerosensory brain (anterior insula, anterior cingulate cortex, amygdala) and autonomic-cardiac discrimination of threatening from affiliative facial cues. Moreover, sleep deprivation significantly degrades the normally reciprocal associations between these central and peripheral emotion-signaling systems, most prominent at the level of cardiac-amygdala coupling. In addition, REM sleep physiology across the sleep-rested night significantly predicts the next-day success of emotional discrimination within this viscerosensory network across individuals, suggesting a role for REM sleep in affective brain recalibration. Together, these findings establish that sleep deprivation compromises the faithful signaling of, and the "embodied" reciprocity between, viscerosensory brain and peripheral autonomic body processing of complex social signals. Such impairments hold ecological relevance in professional contexts in which the need for accurate interpretation of social cues is paramount yet insufficient sleep is pervasive. Copyright © 2015 the authors 0270-6474/15/3510135-11$15.00/0.

  16. Human Intestinal Fluid Layer Separation: The Effect On Colloidal Structures & Solubility Of Lipophilic Compounds.

    Science.gov (United States)

    Danny, Riethorst; Amitava, Mitra; Filippos, Kesisoglou; Wei, Xu; Jan, Tack; Joachim, Brouwers; Patrick, Augustijns

    2018-05-23

    In addition to individual intestinal fluid components, colloidal structures are responsible for enhancing the solubility of lipophilic compounds. The present study investigated the link between as well as the variability in the ultrastructure of fed state human intestinal fluids (FeHIF) and their solubilizing capacity for lipophilic compounds. For this purpose, FeHIF samples from 10 healthy volunteers with known composition and ultrastructure were used to determine the solubility of four lipophilic compounds. In light of the focus on solubility and ultrastructure, the study carefully considered the methodology of solubility determination in relation to colloid composition and solubilizing capacity of FeHIF. To determine the solubilizing capacity of human and simulated intestinal fluids, the samples were saturated with the compound of interest, shaken for 24 h, and centrifuged. When using FeHIF, solubilities were determined in the micellar layer of FeHIF, i.e. after removing the upper (lipid) layer (standard procedure), as well as in 'full' FeHIF (without removal of the upper layer). Compound concentrations were determined using HPLC-UV/fluorescence. To link the solubilizing capacity with the ultrastructure, all human and simulated fluids were imaged using transmission electron microscopy (TEM) before and after centrifugation and top layer (lipid) removal. Comparing the ultrastructure and solubilizing capacity of individual FeHIF samples demonstrated a high intersubject variability in postprandial intestinal conditions. Imaging of FeHIF after removal of the upper layer clearly showed that only micellar structures remain in the lower layer. This observation suggests that larger colloids such as vesicles and lipid droplets are contained in the upper, lipid layer. The solubilizing capacity of most FeHIF samples substantially increased with inclusion of this lipid layer. The relative increase in solubilizing capacity upon inclusion of the lipid layer was most pronounced

  17. Organobromine compound profiling in human adipose: Assessment of sources of bromophenol

    International Nuclear Information System (INIS)

    Gao, Shixiong; Wan, Yi; Zheng, Guomao; Luo, Kai; Kannan, Kurunthachalam; Giesy, John P.; Lam, Michael H.W.; Hu, Jianying

    2015-01-01

    Bromophenols (BRPs) have been widely detected in human tissues, however, relative proportions from natural products and/or anthropogenic flame retardants are not clear. 21 polybrominated diphenyl ethers (PBDEs), 15 MeO/OH-PBDEs, and 10 BRPs were simultaneously quantified in adipose collected from people from New York City, USA. An in vitro assay utilizing human liver microsomes was performed for detected predominant organobromine. High concentrations of 2,4,6-triBRP and PBDEs were observed, and extremely low concentrations of naturally occurring MeO/OH-PBDEs were detected. Similar biotransformatioin rates of BRPs and MeO/OH-PBDEs indicated that the relative high concentration of 2,4,6-triBRP in humans was not of natural origin. Significant correlation observed between concentrations of 2,4,6-triBRP and BDE-209 suggested that the two chemicals may share a common source. Both 2,4,6-triBRP and BDE-209 were detected in commercial ABS resins, suggesting that plastic products made from ABS resins could be potential sources of co-exposure of the two compounds for humans. - Highlights: • 2,4,6-triBRP detected with high concentrations in human was not of natural origin. • Co-exposure of 2,4,6-triBRP and BDE-209 was observed in human samples. • Products made from ABS resins were potential exposure sources of 2,4,6-triBRP. - The profile of organobromine compounds in human together with biotransformation behaviors indicate that anthropogenic sources mainly contribute to high levels of bromophenols in humans

  18. Heterologous production of a ginsenoside saponin (compound K) and its precursors in transgenic tobacco impairs the vegetative and reproductive growth.

    Science.gov (United States)

    Gwak, Yu Shin; Han, Jung Yeon; Adhikari, Prakash Babu; Ahn, Chang Ho; Choi, Yong Eui

    2017-06-01

    Production of compound K (a ginsenoside saponin) and its precursors in transgenic tobacco resulted in stunted growth and seed set failure, which may be caused by strong autotoxicity of heterologously produced phytochemicals against the tobacco itself. Panax ginseng roots contain various saponins (ginsenosides), which are major bioactive compounds. A monoglucosylated saponin, compound K (20-O-(β-D-glucopyranosyl)-20(S)-protopanaxadiol), has high medicinal and cosmetic values but is present in undetectable amounts in naturally grown ginseng roots. The production of compound K (CK) requires complicated deglycosylation of ginsenosides using physicochemical and/or enzymatic degradation. In this work, we report the production of CK in transgenic tobacco by co-overexpressing three genes (PgDDS, CYP716A47 and UGT71A28) isolated from P. ginseng. Introduction and expression of the transgenes in tobacco lines were confirmed by genomic PCR and RT-PCR. All the lines of transgenic tobacco produced CK including its precursors, protopanaxadiol and dammarenediol-II (DD). The concentrations of CK in the leaves ranged from 1.55 to 2.64 µg/g dry weight, depending on the transgenic line. Interestingly, production of CK in tobacco brought stunted plant growth and gave rise to seed set failure. This seed set failure was caused by both long-styled flowers and abnormal pollen development in transgenic tobacco. Both CK and DD treatments highly suppressed in vitro germination and tube growth in wild-type pollens. Based on these results, metabolic engineering for CK production in transgenic tobacco was successfully achieved, but the production of CK and its precursors in tobacco severely affects vegetative and reproductive growth due to the cytotoxicity of phytochemicals that are heterologously produced in transgenic tobacco.

  19. Serum Compounds of Energy Metabolism Impairment Are Related to Disability, Disease Course and Neuroimaging in Multiple Sclerosis.

    Science.gov (United States)

    Lazzarino, Giacomo; Amorini, Angela M; Petzold, Axel; Gasperini, Claudio; Ruggieri, Serena; Quartuccio, Maria Esmeralda; Lazzarino, Giuseppe; Di Stasio, Enrico; Tavazzi, Barbara

    2017-11-01

    Multiple sclerosis (MS) is characterized by primary inflammation, demyelination, and progressive neurodegeneration. A biochemical MS feature is neuronal mitochondrial dysfunction, compensated by anaerobic metabolism increase, likely aggravating progression of neurodegeneration. Here, we characterized a pragmatic serum profile of compounds related to mitochondrial energy metabolism of potential clinical use. Blood samples of 518 well characterized (disability, disease course) MS patients and 167 healthy controls were analyzed for serum purines, pyrimidines, creatinine, and lactate. Nine of the 15 compounds assayed, hypoxanthine, xanthine, uric acid, inosine, uracil, β-pseudouridine, uridine, creatinine, and lactate, differed significantly between MS patients and controls (p < 0.0001). Using these nine compounds, a unifying Biomarker Score was calculated. Controls and MS patients had mean Biomarker Scores of 0.4 ± 0.7 and 4.4 ± 1.9, respectively (p < 0.00001). The Biomarker Score was higher in patients with progressive (6.0 ± 1.8 than with relapsing remitting disease course (3.6 ± 1.5, p < 0.00001). High association between the Biomarker Score and increase in disability (EDSS) was also observed. Additionally, in 50 patients who underwent magnetic resonance imaging (MRI), increase in the Biomarker Score correlated to neuroanatomical alterations. These results, obtained in a large cohort of MS patients evaluated for serum metabolic compounds connected to energy metabolism, demonstrated that the Biomarker Score might represent a pragmatic, resource saving, easy to obtain, laboratory tool useful to monitor MS patients and predict at an early stage who will switch from an RR to a progressive disease course. For the first time, it was also clearly shown a link between mitochondrial dysfunction and MRI lesions characteristic of MS.

  20. Impaired glucose-induced thermogenesis and arterial norepinephrine response persist after weight reduction in obese humans

    DEFF Research Database (Denmark)

    Astrup, A; Andersen, T; Christensen, N J

    1990-01-01

    A reduced thermic response and an impaired activation of the sympathetic nervous system (SNS) has been reported after oral glucose in human obesity. It is, however, not known whether the reduced SNS activity returns to normal along with weight reduction. The thermic effect of glucose was lower...... in eight obese patients than in matched control subjects (1.7% vs 9.2%, p less than 0.002). The increase in arterial norepinephrine after glucose was also blunted in the obese patients. After a 30-kg weight loss their glucose and lipid profiles were markedly improved but the thermic effect of glucose...... was still lower than that of the control subjects (4.2%, p less than 0.001). The glucose-induced arterial norepinephrine response remained diminished in the reduced obese patients whereas the changes in plasma epinephrine were similar in all three groups. The results suggest that a defective SNS may...

  1. Potent inhibitors of human LAT1 (SLC7A5) transporter based on dithiazole and dithiazine compounds for development of anticancer drugs.

    Science.gov (United States)

    Napolitano, Lara; Scalise, Mariafrancesca; Koyioni, Maria; Koutentis, Panayiotis; Catto, Marco; Eberini, Ivano; Parravicini, Chiara; Palazzolo, Luca; Pisani, Leonardo; Galluccio, Michele; Console, Lara; Carotti, Angelo; Indiveri, Cesare

    2017-11-01

    The LAT1 transporter is acknowledged as a pharmacological target of tumours since it is strongly overexpressed in many human cancers. The purpose of this work was to find novel compounds exhibiting potent and prolonged inhibition of the transporter. To this aim, compounds based on dithiazole and dithiazine scaffold have been screened in the proteoliposome experimental model. Inhibition was tested on the antiport catalysed by hLAT1 as transport of extraliposomal [ 3 H]histidine in exchange with intraliposomal histidine. Out of 59 compounds tested, 8 compounds, showing an inhibition higher than 90% at 100µM concentration, were subjected to dose-response analysis. Two of them exhibited IC 50 lower than 1µM. Inhibition kinetics, performed on the two best inhibitors, indicated a mixed type of inhibition with respect to the substrate. Furthermore, inhibition of the transporter was still present after removal of the compounds from the reaction mixture, but was reversed on addition of dithioerythritol, a S-S reducing agent, indicating the formation of disulfide(s) between the compounds and the protein. Molecular docking of the two best inhibitors on the hLAT1 homology structural model, highlighted interaction with the substrate binding site and formation of a covalent bond with the residue C407. Indeed, the inhibition was impaired in the hLAT1 mutant C407A confirming the involvement of that Cys residue. Treatment of SiHa cells expressing hLAT1 at relatively high level, with the two most potent inhibitors led to cell death which was not observed after treatment with a compound exhibiting very poor inhibitory effect. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Accumulation of 19 environmental phenolic and xenobiotic heterocyclic aromatic compounds in human adipose tissue.

    Science.gov (United States)

    Wang, Lei; Asimakopoulos, Alexandros G; Kannan, Kurunthachalam

    2015-05-01

    The extensive use of environmental phenols (e.g., bisphenol A) and heterocyclic aromatic compounds (e.g., benzothiazole) in consumer products as well as widespread exposure of humans to these compounds have been well documented. Biomonitoring studies have used urinary measurements to assess exposures, based on the assumption that these chemicals are metabolized and eliminated in urine. Despite the fact that some of these chemicals are moderately lipophilic, the extent of their accumulation in adipose fat tissues has not been convincingly demonstrated. In this study, human adipose fat samples (N=20) collected from New York City, USA, were analyzed for the presence of environmental phenols, including bisphenol A (BPA), benzophenone-3 (BP-3), triclosan (TCS), and parabens, as well as heterocyclic aromatic compounds, including benzotriazole (BTR), benzothiazole (BTH), and their derivatives. BPA and TCS were frequently detected in adipose tissues at concentrations (geometric mean [GM]: 3.95ng/g wet wt for BPA and 7.21ng/g wet wt for TCS) similar to or below the values reported for human urine. High concentrations of BP-3 were found in human adipose tissues (GM: 43.4; maximum: 4940ng/g wet wt) and a positive correlation between BP-3 concentrations and donor's age was observed. The metabolite of parabens, p-hydroxybenzoic acid (p-HB), also was found at elevated levels (GM: 4160; max.: 17,400ng/g wet wt) and a positive correlation between donor's age and sum concentration of parabens and p-HB were found. The GM concentrations of BTR and BTH in human adipose tissues were below 1ng/g, although the methylated forms of BTR (i.e., TTR and XTR) and the hydrated form of BTH (i.e., 2-OH-BTH) were frequently detected in adipose samples, indicating widespread exposure to these compounds. Our results suggest that adipose tissue is an important repository for BP-3 and parabens, including p-HB, in the human body. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Endocrine disrupting compounds in drinking water supply system and human health risk implication.

    Science.gov (United States)

    Wee, Sze Yee; Aris, Ahmad Zaharin

    2017-09-01

    To date, experimental and epidemiological evidence of endocrine disrupting compounds (EDCs) adversely affecting human and animal populations has been widely debated. Notably, human health risk assessment is required for risk mitigation. The lack of human health risk assessment and management may thus unreliably regulate the quality of water resources and efficiency of treatment processes. Therefore, drinking water supply systems (DWSSs) may be still unwarranted in assuring safe access to potable drinking water. Drinking water supply, such as tap water, is an additional and crucial route of human exposure to the health risks associated with EDCs. A holistic system, incorporating continuous research in DWSS monitoring and management using multi-barrier approach, is proposed as a preventive measure to reduce human exposure to the risks associated with EDCs through drinking water consumption. The occurrence of EDCs in DWSSs and corresponding human health risk implications are analyzed using the Needs, Approaches, Benefits, and Challenges (NABC) method. Therefore, this review may act as a supportive tool in protecting human health and environmental quality from EDCs, which is essential for decision-making regarding environmental monitoring and management purposes. Subsequently, the public could have sustainable access to safer and more reliable drinking water. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Strawberry Achenes Are an Important Source of Bioactive Compounds for Human Health

    Directory of Open Access Journals (Sweden)

    María Teresa Ariza

    2016-07-01

    Full Text Available Strawberries are highly appreciated for their taste, nutritional value and antioxidant compounds, mainly phenolics. Fruit antioxidants derive from achenes and flesh, but achene contribution to the total fruit antioxidant capacity and to the bioaccessibility after intake is still unknown. In this work, the content of total phenolic compounds, flavonoids, anthocyanins and antioxidant capacity (TEAC, FRAP and DPPH of achenes and flesh were compared in non-digested as well as in gastric and intestinal extracts after in vitro digestion. Results showed that, despite strawberry achenes represent a small fraction of the fruit, their contribution to total fruit antioxidant content was more than 41% and accounted for 81% of antioxidant capacity (TEAC. Achenes have higher quantity and different quality of antioxidants in non-digested and digested extracts. Antioxidant release was higher in the in vitro gastric digested extracts, but digestion conditions did not only affect quantity but quality, resulting in differences in antioxidant capacity and highlighting the importance of simulating physiological-like extraction conditions for assessing fruit antioxidant properties on human health. These results give new insights into the use of strawberry achenes as a source of bioactive compounds to be considered in strawberry breeding programs for improving human health.

  5. Strawberry Achenes Are an Important Source of Bioactive Compounds for Human Health

    Science.gov (United States)

    Ariza, María Teresa; Reboredo-Rodríguez, Patricia; Mazzoni, Luca; Forbes-Hernández, Tamara Yuliett; Giampieri, Francesca; Afrin, Sadia; Gasparrini, Massimiliano; Soria, Carmen; Martínez-Ferri, Elsa; Battino, Maurizio; Mezzetti, Bruno

    2016-01-01

    Strawberries are highly appreciated for their taste, nutritional value and antioxidant compounds, mainly phenolics. Fruit antioxidants derive from achenes and flesh, but achene contribution to the total fruit antioxidant capacity and to the bioaccessibility after intake is still unknown. In this work, the content of total phenolic compounds, flavonoids, anthocyanins and antioxidant capacity (TEAC, FRAP and DPPH) of achenes and flesh were compared in non-digested as well as in gastric and intestinal extracts after in vitro digestion. Results showed that, despite strawberry achenes represent a small fraction of the fruit, their contribution to total fruit antioxidant content was more than 41% and accounted for 81% of antioxidant capacity (TEAC). Achenes have higher quantity and different quality of antioxidants in non-digested and digested extracts. Antioxidant release was higher in the in vitro gastric digested extracts, but digestion conditions did not only affect quantity but quality, resulting in differences in antioxidant capacity and highlighting the importance of simulating physiological-like extraction conditions for assessing fruit antioxidant properties on human health. These results give new insights into the use of strawberry achenes as a source of bioactive compounds to be considered in strawberry breeding programs for improving human health. PMID:27409612

  6. The pathological consequences of impaired genome integrity in humans; disorders of the DNA replication machinery.

    Science.gov (United States)

    O'Driscoll, Mark

    2017-01-01

    Accurate and efficient replication of the human genome occurs in the context of an array of constitutional barriers, including regional topological constraints imposed by chromatin architecture and processes such as transcription, catenation of the helical polymer and spontaneously generated DNA lesions, including base modifications and strand breaks. DNA replication is fundamentally important for tissue development and homeostasis; differentiation programmes are intimately linked with stem cell division. Unsurprisingly, impairments of the DNA replication machinery can have catastrophic consequences for genome stability and cell division. Functional impacts on DNA replication and genome stability have long been known to play roles in malignant transformation through a variety of complex mechanisms, and significant further insights have been gained from studying model organisms in this context. Congenital hypomorphic defects in components of the DNA replication machinery have been and continue to be identified in humans. These disorders present with a wide range of clinical features. Indeed, in some instances, different mutations in the same gene underlie different clinical presentations. Understanding the origin and molecular basis of these features opens a window onto the range of developmental impacts of suboptimal DNA replication and genome instability in humans. Here, I will briefly overview the basic steps involved in DNA replication and the key concepts that have emerged from this area of research, before switching emphasis to the pathological consequences of defects within the DNA replication network; the human disorders. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  7. Impact of androgenic/antiandrogenic compounds (AAC) on human sex steroid metabolizing key enzymes

    International Nuclear Information System (INIS)

    Allera, A.; Lo, S.; King, I.; Steglich, F.; Klingmueller, D.

    2004-01-01

    Various pesticides, industrial pollutants and synthetic compounds, to which human populations are exposed, are known or suspected to interfere with endogenous sex hormone functions. Such interference potentially affect the development and expression of the male and female reproductive system or both. Chemicals in this class are thus referred to as endocrine disruptors (ED). This emphazises on the relevance of screening ED for a wide range of sex hormone-mimicking effects. These compounds are believed to exert influence on hormonal actions predominantly by (i) interfering with endogenous steroids in that they functionally interact with plasma membrane-located receptors as well as with nuclear receptors both for estrogens and androgens or (ii) affecting the levels of sex hormones as a result of their impact on steroid metabolizing key enzymes. Essential sex hormone-related enzymes within the endocrine system of humans are aromatase, 5α-reductase 2 as well as specific sulfotransferases and sulfatases (so-called phase I and phase II enzymes, respectively). Using suitable human tissues and human cancer cell lines (placenta, prostate, liver and JEG-3, lymph node carcinoma of prostate (LnCaP) cells) we investigated the impact of 10 widely used chemicals suspected of acting as ED with androgenic or antiandrogenic activity (so-called AAC) on the activity of these sex hormone metabolizing key enzymes in humans. In addition, the respective effects of six substances were also studied as positive controls due to their well-known specific hormonal agonistic/antagonistic activities. The aim of this report and subsequent investigations is to improve human health risk assessment for AAC and other ED

  8. Sensory and Physiological Effects on Humans of Combined Exposures to Air Temperatures and Volatile Organic Compounds

    DEFF Research Database (Denmark)

    Mølhave, Lars; Liu, Zunyong; Jørgensen, Anne Hempel

    1993-01-01

    Ten healthy humans were exposed to combinations of volatile organic compounds (VOCs) and air temperature (0 mg/m3 and 10 mg/m3 of a mixture of 22 volatile organic compounds and 18, 22 and 26° C). Previously demonstrated effects of VOCs and thermal exposures were replicated. For the first time nasal...... cross-sectional areas and nasal volumes, as measured by acoustic rhinometry, were shown to decrease with decreasing temperature and increasing VOC exposure. Temperature and pollutant exposures affected air quality, the need for more ventilation, skin humidity on the forehead, sweating, acute sensory...... irritation and possibly watering eyes in an additive way. Interactions were found for odor intensity (p = 0.1), perceived facial skin temperature and dryness, general well-being, tear film stability, and nasal cavity dimension. The presence of interactions implies that in the future guidelines for acceptable...

  9. Interaction of Human Enteric Viruses with Microbial Compounds: Implication for Virus Persistence and Disinfection Treatments.

    Science.gov (United States)

    Waldman, Prunelle; Meseguer, Alba; Lucas, Françoise; Moulin, Laurent; Wurtzer, Sébastien

    2017-12-05

    Although the interaction between phages and bacteria has already been well described, it only recently emerged that human viruses also interact with bacteria in the mammalian gut. We studied whether this interaction could occur in tap water and thus confer enteric viruses protection against temperature and the classical disinfection treatments used in drinking water production. We demonstrated that the addition of lipopolysaccharide or peptidoglycan of bacterial origin to enterovirus provides thermal protection through stabilization of the viral capsid. This interaction plays a role when viruses are exposed to disinfection that targets the capsid, but less so when the virus genome is directly targeted. The interaction seems to be serotype-specific, suggesting that the capsid protein sequence could be important. The protection is linked to a direct association between viral particles and bacterial compounds as observed by microscopy. These results show that bacterial compounds present in the environment can affect virus inactivation.

  10. Screening of Compounds Toxicity against Human Monocytic cell line-THP-1 by Flow Cytometry

    Directory of Open Access Journals (Sweden)

    Pick Neora

    2004-01-01

    Full Text Available The worldwide rapid increase in bacterial resistance to numerous antibiotics requires on-going development of new drugs to enter the market. As the development of new antibiotics is lengthy and costly, early monitoring of compound's toxicity is essential in the development of novel agents. Our interest is in a rapid, simple, high throughput screening method to assess cytotoxicity induced by potential agents. Some intracellular pathogens, such as Mycobacterium tuberculosis primary site of infection is human alveolar macrophages. Thus, evaluation of candidate drugs for macrophage toxicity is crucial. Protocols for high throughput drug toxicity screening of macrophages using flow cytometry are lacking in the literature. For this application we modified a preexisting technique, propidium iodide (PI exclusion staining and utilized it for rapid toxicity tests. Samples were prepared in 96 well plates and analyzed by flow cytometry, which allowed for rapid, inexpensive and precise assessment of compound's toxicity associated with cell death.

  11. Progress in the pharmacological treatment of human cystic and alveolar echinococcosis: Compounds and therapeutic targets

    Science.gov (United States)

    Siles-Lucas, Mar; Casulli, Adriano; Cirilli, Roberto

    2018-01-01

    Human cystic and alveolar echinococcosis are helmintic zoonotic diseases caused by infections with the larval stages of the cestode parasites Echinococcus granulosus and E. multilocularis, respectively. Both diseases are progressive and chronic, and often fatal if left unattended for E. multilocularis. As a treatment approach, chemotherapy against these orphan and neglected diseases has been available for more than 40 years. However, drug options were limited to the benzimidazoles albendazole and mebendazole, the only chemical compounds currently licensed for treatment in humans. To compensate this therapeutic shortfall, new treatment alternatives are urgently needed, including the identification, development, and assessment of novel compound classes and drug targets. Here is presented a thorough overview of the range of compounds that have been tested against E. granulosus and E. multilocularis in recent years, including in vitro and in vivo data on their mode of action, dosage, administration regimen, therapeutic outcomes, and associated clinical symptoms. Drugs covered included albendazole, mebendazole, and other members of the benzimidazole family and their derivatives, including improved formulations and combined therapies with other biocidal agents. Chemically synthetized molecules previously known to be effective against other infectious and non-infectious conditions such as anti-virals, antibiotics, anti-parasites, anti-mycotics, and anti-neoplastics are addressed. In view of their increasing relevance, natural occurring compounds derived from plant and fungal extracts are also discussed. Special attention has been paid to the recent application of genomic science on drug discovery and clinical medicine, particularly through the identification of small inhibitor molecules tackling key metabolic enzymes or signalling pathways. PMID:29677189

  12. Progress in the pharmacological treatment of human cystic and alveolar echinococcosis: Compounds and therapeutic targets.

    Directory of Open Access Journals (Sweden)

    Mar Siles-Lucas

    2018-04-01

    Full Text Available Human cystic and alveolar echinococcosis are helmintic zoonotic diseases caused by infections with the larval stages of the cestode parasites Echinococcus granulosus and E. multilocularis, respectively. Both diseases are progressive and chronic, and often fatal if left unattended for E. multilocularis. As a treatment approach, chemotherapy against these orphan and neglected diseases has been available for more than 40 years. However, drug options were limited to the benzimidazoles albendazole and mebendazole, the only chemical compounds currently licensed for treatment in humans. To compensate this therapeutic shortfall, new treatment alternatives are urgently needed, including the identification, development, and assessment of novel compound classes and drug targets. Here is presented a thorough overview of the range of compounds that have been tested against E. granulosus and E. multilocularis in recent years, including in vitro and in vivo data on their mode of action, dosage, administration regimen, therapeutic outcomes, and associated clinical symptoms. Drugs covered included albendazole, mebendazole, and other members of the benzimidazole family and their derivatives, including improved formulations and combined therapies with other biocidal agents. Chemically synthetized molecules previously known to be effective against other infectious and non-infectious conditions such as anti-virals, antibiotics, anti-parasites, anti-mycotics, and anti-neoplastics are addressed. In view of their increasing relevance, natural occurring compounds derived from plant and fungal extracts are also discussed. Special attention has been paid to the recent application of genomic science on drug discovery and clinical medicine, particularly through the identification of small inhibitor molecules tackling key metabolic enzymes or signalling pathways.

  13. Mobile phone use for 5 minutes can cause significant memory impairment in humans.

    Science.gov (United States)

    Kalafatakis, F; Bekiaridis-Moschou, D; Gkioka, Eirini; Tsolaki, Magda

    2017-01-01

    Concerns about the possible adverse health effects of mobile phones (MP) have increased along with the expansion of their use. A number of research papers have tried to address this issue. Although many investigations concluded that MP use does have negative consequences, in terms of cognitive function of the human brain, the results so far have been divisive. A number of studies reported impairment of cognitive function after exposure to mobile phone electromagnetic field (MP EMF), while others observed no effect or improved performance. The variance in the results may be attributed to methodological issues. The present article focuses on possible effects of MP use on cognitive function and more specifically on working memory processes. An emphasis is placed in the lack of a validated tool, a cognitive task, that can produce MP EMF effects on human cognition in a repeatable fashion. Sixty four (64) healthy participants as well as 20 with Mild Cognitive Impairment (MCI) were the experimental group, while 36 healthy individuals were the control group. A computerized list of 10 words was presented and the participants were asked to reproduce it. The words were presented very briefly in order to increase the difficulty and hence the sensitivity of the task. Three measurements were taken for the experimental group: a) before using the MP, b) immediately after using the MP for a duration of 5 minutes, c) 5 minutes after the second measurement with no usage of the MP in between. Three measurements of the memory task were also taken for the control group in the same time intervals with no usage of a MP. The effect of age and gender in the performance of the task was taken into account. Healthy participants of the experimental group performed worst in the memory task after using the MP. While the third measurement (5 minutes after the 2nd measurement) was better than the second (after using the MP), but worse than the first (before using the MP). In contrast for the

  14. Isolation and identification of compounds from Kalanchoe pinnata having human alphaherpesvirus and vaccinia virus antiviral activity.

    Science.gov (United States)

    Cryer, Matthew; Lane, Kyle; Greer, Mary; Cates, Rex; Burt, Scott; Andrus, Merritt; Zou, Jiping; Rogers, Paul; Hansen, Marc D H; Burgado, Jillybeth; Panayampalli, Subbian Satheshkumar; Day, Craig W; Smee, Donald F; Johnson, Brent F

    2017-12-01

    Kalanchoe pinnata (Lam.) Pers. (Crassulaceae) is a succulent plant that is known for its traditional antivirus and antibacterial usage. This work examines two compounds identified from the K. pinnata plant for their antivirus activity against human alphaherpesvirus (HHV) 1 and 2 and vaccinia virus (VACV). Compounds KPB-100 and KPB-200 were isolated using HPLC and were identified using NMR and MS. Both compounds were tested in plaque reduction assay of HHV-2 wild type (WT) and VACV. Both compounds were then tested in virus spread inhibition and virus yield reduction (VYR) assays of VACV. KPB-100 was further tested in viral cytopathic effect (CPE) inhibition assay of HHV-2 TK-mutant and VYR assay of HHV-1 WT. KPB-100 and KPB-200 inhibited HHV-2 at IC 50 values of 2.5 and 2.9 μg/mL, respectively, and VACV at IC 50 values of 3.1 and 7.4 μg/mL, respectively, in plaque reduction assays. In virus spread inhibition assay of VACV KPB-100 and KPB-200 yielded IC 50 values of 1.63 and 13.2 μg/mL, respectively, and KPB-100 showed a nearly 2-log reduction in virus in VYR assay of VACV at 20 μg/mL. Finally, KPB-100 inhibited HHV-2 TK- at an IC 50 value of 4.5 μg/mL in CPE inhibition assay and HHV-1 at an IC 90 of 3.0 μg/mL in VYR assay. Both compounds are promising targets for synthetic optimization and in vivo study. KPB-100 in particular showed strong inhibition of all viruses tested.

  15. Exogenous HIV-1 Nef upsets the IFN-γ-induced impairment of human intestinal epithelial integrity.

    Directory of Open Access Journals (Sweden)

    Maria Giovanna Quaranta

    Full Text Available The mucosal tissues play a central role in the transmission of HIV-1 infection as well as in the pathogenesis of AIDS. Despite several clinical studies reported intestinal dysfunction during HIV infection, the mechanisms underlying HIV-induced impairments of mucosal epithelial barrier are still unclear. It has been postulated that HIV-1 alters enterocytic function and HIV-1 proteins have been detected in several cell types of the intestinal mucosa. In the present study, we analyzed the effect of the accessory HIV-1 Nef protein on human epithelial cell line.We used unstimulated or IFN-γ-stimulated Caco-2 cells, as a model for homeostatic and inflamed gastrointestinal tracts, respectively. We investigated the effect of exogenous recombinant Nef on monolayer integrity analyzing its uptake, transepithelial electrical resistance, permeability to FITC-dextran and the expression of tight junction proteins. Moreover, we measured the induction of proinflammatory mediators. Exogenous Nef was taken up by Caco-2 cells, increased intestinal epithelial permeability and upset the IFN-γ-induced reduction of transepithelial resistance, interfering with tight junction protein expression. Moreover, Nef inhibited IFN-γ-induced apoptosis and up-regulated TNF-α, IL-6 and MIP-3α production by Caco-2 cells while down-regulated IL-10 production. The simultaneous exposure of Caco-2 cells to Nef and IFN-γ did not affect cytokine secretion respect to untreated cells. Finally, we found that Nef counteracted the IFN-γ induced arachidonic acid cascade.Our findings suggest that exogenous Nef, perturbing the IFN-γ-induced impairment of intestinal epithelial cells, could prolong cell survival, thus allowing for accumulation of viral particles. Our results may improve the understanding of AIDS pathogenesis, supporting the discovery of new therapeutic interventions.

  16. The Natural Antiangiogenic Compound AD0157 Induces Caspase-Dependent Apoptosis in Human Myeloid Leukemia Cells

    Directory of Open Access Journals (Sweden)

    Melissa García-Caballero

    2017-11-01

    Full Text Available Evasion of apoptosis is a hallmark of cancer especially relevant in the development and the appearance of leukemia drug resistance mechanisms. The development of new drugs that could trigger apoptosis in aggressive hematological malignancies, such as AML and CML, may be considered a promising antileukemic strategy. AD0157, a natural marine pyrrolidinedione, has already been described as a compound that inhibits angiogenesis by induction of apoptosis in endothelial cells. The crucial role played by defects in the apoptosis pathways in the pathogenesis, progression and response to conventional therapies of several forms of leukemia, moved us to analyze the effect of this compound on the growth and death of leukemia cells. In this work, human myeloid leukemia cells (HL60, U937 and KU812F were treated with AD0157 ranging from 1 to 10 μM and an experimental battery was applied to evaluate its apoptogenic potential. We report here that AD0157 was highly effective to inhibit cell growth by promotion of apoptosis in human myeloid leukemia cells, and provide evidence of its mechanisms of action. The apoptogenic activity of AD0157 on leukemia cells was verified by an increased chromatin condensation and DNA fragmentation, and confirmed by an augmentation in the apoptotic subG1 population, translocation of the membrane phosphatidylserine from the inner face of the plasma membrane to the cell surface and by cleavage of the apoptosis substrates PARP and lamin-A. In addition, AD0157 in the low micromolar range significantly enhanced the activities of the initiator caspases-8 and -9, and the effector caspases-3/-7 in a dose-dependent manner. Results presented here throw light on the apoptogenic mechanism of action of AD0157, mediated through caspase-dependent cascades, with an especially relevant role played by mitochondria. Altogether, these results suggest the therapeutic potential of this compound for the treatment of human myeloid leukemia.

  17. Phenolic compounds apigenin, hesperidin and kaempferol reduce in vitro lipid accumulation in human adipocytes.

    Science.gov (United States)

    Gómez-Zorita, Saioa; Lasa, Arrate; Abendaño, Naiara; Fernández-Quintela, Alfredo; Mosqueda-Solís, Andrea; Garcia-Sobreviela, Maria Pilar; Arbonés-Mainar, Jose M; Portillo, Maria P

    2017-11-21

    Adipocytes derived from human mesenchymal stem cells (MSCs) are widely used to investigate adipogenesis. Taking into account both the novelty of these MSCs and the scarcity of studies focused on the effects of phenolic compounds, the aim of the present study was to analyze the effect of apigenin, hesperidin and kaempferol on pre-adipocyte and mature adipocytes derived from this type of cells. In addition, the expression of genes involved in TG accumulation was also measured. Pre-adipocytes were cultured from day 0 to day 8 and mature adipocytes for 48 h with the polyphenols at doses of 1, 10 and 25 µM. Apigenin did not show an anti-adipogenic action. Pre-adipocytes treated with hesperidin and kaempferol showed reduced TG content at the three experimental doses. Apigenin did not modify the expression of the main adipogenic genes (c/ebpβ, c/ebpα, pparγ and srebp1c), hesperidin inhibited genes involved in the three phases of adipogenesis (c/ebpβ, srebp1c and perilipin) and kaempferol reduced c/ebpβ. In mature adipocytes, the three polyphenols reduced TG accumulation at the dose of 25 µM, but not at lower doses. All compounds increased mRNA levels of atgl. Apigenin and hesperidin decreased fasn expression. The present study shows the anti-adipogenic effect and delipidating effects of apigenin, hesperidin and kaempferol in human adipocytes derived from hMSCs. While hesperidin blocks all the stages of adipogenesis, kaempferol only inhibits the early stage. Regarding mature adipocytes, the three compounds reduce TG accumulation by activating, at least in part, lipolysis, and in the case of hesperidin and apigenin, also by reducing lipogenesis. The present study shows for the first time the anti-adipogenic effect and delipidating effect of apigenin, hesperidin and kaempferol in human adipocytes derived from MSCs for the first time.

  18. Documents for Recommended Toxicity Equivalency Factors for Human Health Risk Assessments of Dioxin and Dioxin-Like Compounds

    Science.gov (United States)

    This document describes the U.S. Environmental Protection Agency’s (U.S. EPA’s) updated approach for evaluating the human health risks from exposures to environmental media containing dioxin-like compounds (DLCs).

  19. Human-Health Pharmaceutical Compounds in Lake Mead, Nevada and Arizona, and Las Vegas Wash, Nevada, October 2000-August 2001

    National Research Council Canada - National Science Library

    Boyd, Robert A; Furlong, Edward T

    2002-01-01

    The U.S. Geological Survey and the National Park Service conducted a reconnaissance study to investigate the occurrence of selected human-health pharmaceutical compounds in water samples collected from Lake...

  20. Gut Microbiota Profiling: Metabolomics Based Approach to Unravel Compounds Affecting Human Health.

    Science.gov (United States)

    Vernocchi, Pamela; Del Chierico, Federica; Putignani, Lorenza

    2016-01-01

    The gut microbiota is composed of a huge number of different bacteria, that produce a large amount of compounds playing a key role in microbe selection and in the construction of a metabolic signaling network. The microbial activities are affected by environmental stimuli leading to the generation of a wide number of compounds, that influence the host metabolome and human health. Indeed, metabolite profiles related to the gut microbiota can offer deep insights on the impact of lifestyle and dietary factors on chronic and acute diseases. Metagenomics, metaproteomics and metabolomics are some of the meta-omics approaches to study the modulation of the gut microbiota. Metabolomic research applied to biofluids allows to: define the metabolic profile; identify and quantify classes and compounds of interest; characterize small molecules produced by intestinal microbes; and define the biochemical pathways of metabolites. Mass spectrometry and nuclear magnetic resonance spectroscopy are the principal technologies applied to metabolomics in terms of coverage, sensitivity and quantification. Moreover, the use of biostatistics and mathematical approaches coupled with metabolomics play a key role in the extraction of biologically meaningful information from wide datasets. Metabolomic studies in gut microbiota-related research have increased, focusing on the generation of novel biomarkers, which could lead to the development of mechanistic hypotheses potentially applicable to the development of nutritional and personalized therapies.

  1. Human Elimination of Phthalate Compounds: Blood, Urine, and Sweat (BUS) Study

    Science.gov (United States)

    Genuis, Stephen J.; Beesoon, Sanjay; Lobo, Rebecca A.; Birkholz, Detlef

    2012-01-01

    Background. Individual members of the phthalate family of chemical compounds are components of innumerable everyday consumer products, resulting in a high exposure scenario for some individuals and population groups. Multiple epidemiological studies have demonstrated statistically significant exposure-disease relationships involving phthalates and toxicological studies have shown estrogenic effects in vitro. Data is lacking in the medical literature, however, on effective means to facilitate phthalate excretion. Methods. Blood, urine, and sweat were collected from 20 individuals (10 healthy participants and 10 participants with assorted health problems) and analyzed for parent phthalate compounds as well as phthalate metabolites using high performance liquid chromatography-tandem mass spectrometry. Results. Some parent phthalates as well as their metabolites were excreted into sweat. All patients had MEHP (mono(2-ethylhexyl) phthalate) in their blood, sweat, and urine samples, suggesting widespread phthalate exposure. In several individuals, DEHP (di (2-ethylhexl) phthalate) was found in sweat but not in serum, suggesting the possibility of phthalate retention and bioaccumulation. On average, MEHP concentration in sweat was more than twice as high as urine levels. Conclusions. Induced perspiration may be useful to facilitate elimination of some potentially toxic phthalate compounds including DEHP and MEHP. Sweat analysis may be helpful in establishing the existence of accrued DEHP in the human body. PMID:23213291

  2. Human peripheral blood mononuclear cell in vitro system to test the efficacy of food bioactive compounds: Effects of polyunsaturated fatty acids and their relation with BMI

    KAUST Repository

    Cifre, Margalida; Diaz Rua, Ruben; Varela-Calviñ o, Rubé n; Reyné s, Bà rbara; Pericá s-Beltrá n, Jordi; Palou, Andreu; Oliver, Paula

    2016-01-01

    is impaired in OW/OB. These results confirm the utility of PBMC ex vivo systems for bioactive-compound screening to promote functional food development and to establish appropriate dietary strategies for obese population.

  3. Danshen-Chuanxiong-Honghua Ameliorates Cerebral Impairment and Improves Spatial Cognitive Deficits after Transient Focal Ischemia and Identification of Active Compounds

    Directory of Open Access Journals (Sweden)

    Xianhua Zhang

    2017-07-01

    Full Text Available Previously, we only apply a traditional Chinese medicine (TCM Danshen-Chuanxiong-Honghua (DCH for cardioprotection via anti-inflammation in rats of acute myocardial infarction by occluding coronary artery. Presently, we select not only DCH but also its main absorbed compound ferulic acid (FA for cerebra protection via similar action of mechanism above in animals of the transient middle cerebral artery occlusion (tMCAO. We investigated whether oral administration of DCH and FA could ameliorate MCAO-induced brain lesions in animals. By using liquid chromatography-tandem mass spectrometry (LC-MS/MS, we analyzed four compounds, including tanshinol, salvianolic acid B, hydroxysafflor yellow A and especially FA as the putative active components of DCH extract in the plasma, cerebrospinal fluid and injured hippocampus of rats with MCAO. In our study, it was assumed that FA played a similar neuroprotective role to DCH. We found that oral pretreatment with DCH (10 or 20 g/kg and FA (100 mg/kg improved neurological function and alleviated the infarct volume as well as brain edema in a dose-dependent manner. These changes were accompanied by improved ischemia-induced apoptosis and decreased the inflammatory response. Additionally, chronic treatment with DCH reversed MCAO-induced spatial cognitive deficits in a manner associated with enhanced neurogenesis and increased the expression of brain-derived neurotrophic factor in lesions of the hippocampus. These findings suggest that DCH has the ability to recover cognitive impairment and offer neuroprotection against cerebral ischemic injury via inhibiting microenvironmental inflammation and triggering of neurogenesis in the hippocampus. FA could be one of the potential active compounds.

  4. Extending breath analysis to the cellular level: current thoughts on the human microbiome and the expression of organic compounds in the human exposome

    Science.gov (United States)

    Human biomarkers are comprised of compounds from cellular metabolism, oxidative stress, and the microbiome of bacteria in the gut, genitourinary, and pulmonary tracts. When we examine patterns in human biomarkers to discern human health state or diagnose specific diseases, it is...

  5. Compound danshen tablet ameliorated aβ25-35-induced spatial memory impairment in mice via rescuing imbalance between cytokines and neurotrophins.

    Science.gov (United States)

    Teng, Yan; Zhang, Meng-Qi; Wang, Wen; Liu, Li-Tao; Zhou, Li-Ming; Miao, Shi-Kun; Wan, Li-Hong

    2014-01-14

    Compound Danshen Tablet (CDT), a Traditional Chinese Medicine, has recently been reported to improve spatial cognition in a rat model of Alzheimer's disease. However, in vivo neuroprotective mechanism of the CDT in models of spatial memory impairment is not yet evaluated. The present study is aimed to elucidate the cellular mechanism of CDT on Aβ25-35-induced cognitive impairment in mice. Mice were randomly divided into 5 groups: the control group (sham operated), the Aβ25-35 treated group, the positive drug group, and large and small dosage of the CDT groups, respectively. CDT was administered at a dose of 0.81 g/kg and 0.405 g/kg for 3 weeks. The mice in the positive drug group were treated with 0.4 mg/kg of Huperzine A, whereas the mice of the control and Aβ25-35 treated groups were administrated orally with equivalent saline. After 7 days of preventive treatment, mice were subjected to lateral ventricle injection of Aβ25-35 to establish the mice model of Alzheimer's disease. Spatial memory impairment was evaluated by Morris water maze test. Choline acetyltransferase (ChAT) contents in hippocampus and cortex were quantified by ELISA. The levels of cytokines, receptor of activated protein kinase C1 (RACK1) and brain-derived neurotrophic factor (BDNF) in hippocampus were measured by RT-PCR and ELISA. The results showed that Aβ25-35 caused spatial memory impairment as demonstrated by performance in the Morris water maze test. CDT was able to confer a significant improvement in spatial memory, and protect mice from Aβ25-35-induced neurotoxicity. Additionally, CDT also inhibited the increase of TNF-α and IL-6 level, and increased the expression of choline acetyltransferase (ChAT), receptor of activated protein kinase C1 (RACK1) and brain-derived neurotrophic factor (BDNF) in brain as compared to model mice. These findings strongly implicate that CDT may be a useful treatment against learning and memory deficits in mice by rescuing imbalance between cytokines

  6. Acacetin and Chrysin, Two Polyphenolic Compounds, Alleviate Telomeric Position Effect in Human Cells

    Directory of Open Access Journals (Sweden)

    Amina Boussouar

    2013-01-01

    Full Text Available We took advantage of the ability of human telomeres to silence neighboring genes (telomere position effect or TPE to design a high-throughput screening assay for drugs altering telomeres. We identified, for the first time, that two dietary flavones, acacetin and chrysin, are able to specifically alleviate TPE in human cells. We further investigated their influence on telomere integrity and showed that both drugs drastically deprotect telomeres against DNA damage response. However, telomere deprotection triggered by shelterin dysfunction does not affect TPE, indicating that acacetin and chrysin target several functions of telomeres. These results show that TPE-based screening assays represent valuable methods to discover new compounds targeting telomeres.

  7. MOLECULAR DOCKING OF COMPOUNDS FROM Chaetomium Sp. AGAINST HUMAN ESTROGEN RECEPTOR ALPHA IN SEARCHING ANTI BREAST CANCER

    Directory of Open Access Journals (Sweden)

    Maywan Hariono

    2016-05-01

    Full Text Available A study on molecular docking-based virtual screening has been conducted to select virtual hit of compounds, reported its existence in fungal endophytes of Chaetomium sp. as cytotoxic agent of breast cancer. The ligands were docked into Human Estrogen Receptor alpha (HERa as the protein which regulates the breast cancer growth via estradiol-estrogen receptor binding intervention. The results showed that two compounds bearing xanthone and two compounds bearing benzonaphtyridinedione scaffolds were selected as virtual hit ligands for HERa leading to the conclusion that these compounds were good to be developed as anti breast cancer.

  8. Evaluation of a Silicone Membrane as an Alternative to Human Skin for Determining Skin Permeation Parameters of Chemical Compounds.

    Science.gov (United States)

    Uchida, Takashi; Yakumaru, Masafumi; Nishioka, Keisuke; Higashi, Yoshihiro; Sano, Tomohiko; Todo, Hiroaki; Sugibayashi, Kenji

    2016-01-01

    We evaluated the effectiveness of a silicone membrane as an alternative to human skin using the skin permeation parameters of chemical compounds. An in vitro permeation study using 15 model compounds was conducted, and permeation parameters comprising permeability coefficient (P), diffusion parameter (DL(-2)), and partition parameter (KL) were calculated from each permeation profile. Significant correlations were obtained in log P, log DL(-2), and log KL values between the silicone membrane and human skin. DL(-2) values of model compounds, except flurbiprofen, in the silicone membrane were independent of the lipophilicity of the model compounds and were 100-fold higher than those in human skin. For antipyrine and caffeine, which are hydrophilic, KL values in the silicone membrane were 100-fold lower than those in human skin, and P values, calculated as the product of a DL(-2) and KL, were similar. For lipophilic compounds, such as n-butyl paraben and flurbiprofen, KL values for silicone were similar to or 10-fold higher than those in human skin, and P values for silicone were 100-fold higher than those in human skin. Furthermore, for amphiphilic compounds with log Ko/w values from 0.5 to 3.5, KL values in the silicone membrane were 10-fold lower than those in human skin, and P values for silicone were 10-fold higher than those in human skin. The silicone membrane was useful as a human skin alternative in an in vitro skin permeation study. However, depending on the lipophilicity of the model compounds, some parameters may be over- or underestimated.

  9. Perfluorinated compounds in human serum and seminal plasma from an urban and rural population in Sri Lanka

    Energy Technology Data Exchange (ETDEWEB)

    Guruge, Keerthi; Miyazaki, Shigeru; Yamanaka, Noriko [National Institute of Animal Health, Tsukuba (Japan); Taniyasu, Sacgu; Yamashita, Nobuyoshi [National Institute of Advance Industrial and Technology, Tsukuba (Japan); Wijeratna, S.; Seneviratne, H. [Colombo Univ. (Sri Lanka)

    2004-09-15

    Fluorinated organic compounds (FOCs) have been used for variety of industrial applications such as surfactants, adhesives, insecticides, and their global production increase since 1970s. These compounds repel both water and oil. The high-energy carbon-fluorine covalent bonds in FOCs are strong enough to have high persistency in the environment. These compounds emerged as priory environmental pollutants since they are found in various biota throughout the world. Human contamination of some FOCs was reported mostly in developed countries such as USA, Japan and from Europe. In the present study, we report 10 FOCs in human serum including seminal plasma for the first time, collected from volunteers from Sri Lanka.

  10. Microencapsulated bitter compounds (from Gentiana lutea) reduce daily energy intakes in humans.

    Science.gov (United States)

    Mennella, Ilario; Fogliano, Vincenzo; Ferracane, Rosalia; Arlorio, Marco; Pattarino, Franco; Vitaglione, Paola

    2016-11-10

    Mounting evidence showed that bitter-tasting compounds modulate eating behaviour through bitter taste receptors in the gastrointestinal tract. This study aimed at evaluating the influence of microencapsulated bitter compounds on human appetite and energy intakes. A microencapsulated bitter ingredient (EBI) with a core of bitter Gentiana lutea root extract and a coating of ethylcellulose-stearate was developed and included in a vanilla microencapsulated bitter ingredient-enriched pudding (EBIP). The coating masked bitterness in the mouth, allowing the release of bitter secoiridoids in the gastrointestinal tract. A cross-over randomised study was performed: twenty healthy subjects consumed at breakfast EBIP (providing 100 mg of secoiridoids) or the control pudding (CP) on two different occasions. Blood samples, glycaemia and appetite ratings were collected at baseline and 30, 60, 120 and 180 min after breakfast. Gastrointestinal peptides, endocannabinoids (EC) and N-acylethanolamines (NAE) were measured in plasma samples. Energy intakes were measured at an ad libitum lunch 3 h after breakfast and over the rest of the day (post lunch) through food diaries. No significant difference in postprandial plasma responses of gastrointestinal hormones, glucose, EC and NAE and of appetite between EBIP and CP was found. However, a trend for a higher response of glucagon-like peptide-1 after EBIP than after CP was observed. EBIP determined a significant 30 % lower energy intake over the post-lunch period compared with CP. These findings were consistent with the tailored release of bitter-tasting compounds from EBIP along the gastrointestinal tract. This study demonstrated that microencapsulated bitter secoiridoids were effective in reducing daily energy intake in humans.

  11. Task-specific impairments and enhancements induced by magnetic stimulation of human visual area V5.

    Science.gov (United States)

    Walsh, V; Ellison, A; Battelli, L; Cowey, A

    1998-03-22

    Transcranial magnetic stimulation (TMS) can be used to simulate the effects of highly circumscribed brain damage permanently present in some neuropsychological patients, by reversibly disrupting the normal functioning of the cortical area to which it is applied. By using TMS we attempted to recreate deficits similar to those reported in a motion-blind patient and to assess the specificity of deficits when TMS is applied over human area V5. We used six visual search tasks and showed that subjects were impaired in a motion but not a form 'pop-out' task when TMS was applied over V5. When motion was present, but irrelevant, or when attention to colour and form were required, TMS applied to V5 enhanced performance. When attention to motion was required in a motion-form conjunction search task, irrespective of whether the target was moving or stationary, TMS disrupted performance. These data suggest that attention to different visual attributes involves mutual inhibition between different extrastriate visual areas.

  12. A zinc-resistant human epithelial cell line is impaired in cadmium and manganese import

    International Nuclear Information System (INIS)

    Rousselet, Estelle; Richaud, Pierre; Douki, Thierry; Chantegrel, Jocelyne Garcia; Favier, Alain; Bouron, Alexandre; Moulis, Jean-Marc

    2008-01-01

    A human epithelial cell line (HZR) growing with high zinc concentrations has been analyzed for its ability to sustain high cadmium concentrations. Exposure to up to 200 μM of cadmium acetate for 24 h hardly impacted viability, whereas most of parental HeLa cells were killed by less than 10 μM of cadmium. Upon challenge by 35 fold higher cadmium concentrations than HeLa cells, HZR cells did not display increased DNA damage, increased protein oxidation, or changed intracellular cadmium localization. Rather, the main cause of resistance against cadmium was by avoiding cadmium entry into cells, which differs from that against zinc as the latter accumulates inside cells. The zinc-resistant phenotype of these cells was shown to also impair extracellular manganese uptake. Manganese and cadmium competed for entry into HeLa cells. Probing formerly identified cadmium or manganese transport systems in different animal cells did not evidence any significant change between HeLa and HZR cells. These results reveal zinc adaptation influences manganese and cadmium cellular traffic and they highlight previously unknown connections among homeostasis of divalent metals

  13. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  14. Organohalogen compounds in human breast milk from Republic of Buryatia, Russia

    Energy Technology Data Exchange (ETDEWEB)

    Tsydenova, Oyuna V. [Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan); Sudaryanto, Agus [Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan); Kajiwara, Natsuko [Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan); Kunisue, Tatsuya [Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan); Batoev, Valeriy B. [Baikal Institute of Nature Management, Siberian Branch of Russian Academy of Sciences, Sakhyanova st. 6, Ulan-Ude 670047 (Russian Federation); Tanabe, Shinsuke [Center for Marine Environmental Studies (CMES), Ehime University, Bunkyo-cho 2-5, Matsuyama 790-8577 (Japan)]. E-mail: shinsuke@agr.ehime-u.ac.jp

    2007-03-15

    Human breast milk samples collected during 2003/04 in Buryatia, a Russian autonomous republic, were analyzed in order to assess human exposure to organohalogen compounds including organochlorine pesticides, polychlorinated biphenyls (PCBs), and polybrominated diphenyl ethers (PBDEs). When compared with available worldwide data, levels of HCB (23-880 ng/g lipid wt.), PCBs (69-680 ng/g lipid wt.), and HCHs (100-3700 ng/g lipid wt.) were relatively high, indicating elevated human exposure to these organochlorines (OCs) in Buryatia. In contrast to OCs, PBDE concentrations were low (0.46-1.7 ng/g lipid wt.). Out of 14 BDE congeners analyzed, BDE-28, BDE-47, BDE-100, BDE-153, BDE-197, and BDE-207 were detected. Estimated daily intakes (EDIs) of HCHs, HCB, CHLs, and PCBs by infants solely from human milk for 100%, 43%, 34%, and 17% of the samples, respectively, exceeded guideline thresholds. Although high EDIs raise concern for possible toxic effects of OCs, women in Buryatia are recommended to breastfeed due to numerous advantages of breastfeeding for mother and child. - People in the Republic of Buryatia, Russia are exposed to relatively high levels of HCHs, HCB and PCBs.

  15. Organohalogen compounds in human breast milk from Republic of Buryatia, Russia

    International Nuclear Information System (INIS)

    Tsydenova, Oyuna V.; Sudaryanto, Agus; Kajiwara, Natsuko; Kunisue, Tatsuya; Batoev, Valeriy B.; Tanabe, Shinsuke

    2007-01-01

    Human breast milk samples collected during 2003/04 in Buryatia, a Russian autonomous republic, were analyzed in order to assess human exposure to organohalogen compounds including organochlorine pesticides, polychlorinated biphenyls (PCBs), and polybrominated diphenyl ethers (PBDEs). When compared with available worldwide data, levels of HCB (23-880 ng/g lipid wt.), PCBs (69-680 ng/g lipid wt.), and HCHs (100-3700 ng/g lipid wt.) were relatively high, indicating elevated human exposure to these organochlorines (OCs) in Buryatia. In contrast to OCs, PBDE concentrations were low (0.46-1.7 ng/g lipid wt.). Out of 14 BDE congeners analyzed, BDE-28, BDE-47, BDE-100, BDE-153, BDE-197, and BDE-207 were detected. Estimated daily intakes (EDIs) of HCHs, HCB, CHLs, and PCBs by infants solely from human milk for 100%, 43%, 34%, and 17% of the samples, respectively, exceeded guideline thresholds. Although high EDIs raise concern for possible toxic effects of OCs, women in Buryatia are recommended to breastfeed due to numerous advantages of breastfeeding for mother and child. - People in the Republic of Buryatia, Russia are exposed to relatively high levels of HCHs, HCB and PCBs

  16. Comparison of the neurotoxicities between volatile organic compounds and fragrant organic compounds on human neuroblastoma SK-N-SH cells and primary cultured rat neurons

    Directory of Open Access Journals (Sweden)

    Yasue Yamada

    2015-01-01

    Full Text Available These are many volatile organic compounds (VOCs that are synthesized, produced from petroleum or derived from natural compounds, mostly plants. Fragrant and volatile organic compounds from plants have been used as food additives, medicines and aromatherapy. Several clinical and pathological studies have shown that chronic abuse of VOCs, mainly toluene, causes several neuropsychiatric disorders. Little is known about the mechanisms of neurotoxicity of the solvents. n-Octanal, nonanal, and 2-ethyl-1-hexanol, which are used catalyzers or intermediates of chemical reactions, are released into the environment. Essential oils have the functions of self-defense, sterilization, and antibiosis in plants. When volatile organic compounds enter the body, there is the possibility that they will pass through the blood–brain barrier (BBB and affect the central nervous system (CNS. However, the direct effects of volatile organic compounds on neural function and their toxicities are still unclear. We compared the toxicities of n-octanal, nonanal and 2-ethyl-1-hexanol with those of five naturally derived fragrant organic compounds (FOCs, linalool, cis-3-hexen-1-ol, isoamyl alcohol, n-propyl alcohol and n-phenethyl alcohol. MTT assay of human neuroblastoma SK-N-SH cells showed that the IC50 values of linalool, cis-3-hexen-1-ol, isoamyl alcohol, n-propyl alcohol and phenethyl alcohol were 1.33, 2.3, >5, >5, and 2.39 mM, respectively, and the IC50 values of toluene, n-octanal, nonanal and 2-ethyl-1-hexanol were 850, 37.2, 8.31 and 15.1 μM, respectively. FOCs showed lower toxicities than those of VOCs. These results indicate that FOCs are safer than other compounds.

  17. Clinical breath analysis: Discriminating between human endogenous compounds and exogenous (environmental) chemical confounders

    Science.gov (United States)

    Volatile organic compounds (VOCs) in exhaled breath originate from current or previous environmental exposures (exogenous compounds) and internal metabolic anabolic and catabolic) production (endogenous compounds). The origins of certain VOCs in breath presumed to be endogenous ...

  18. Human peripheral blood mononuclear cell in vitro system to test the efficacy of food bioactive compounds: Effects of polyunsaturated fatty acids and their relation with BMI

    KAUST Repository

    Cifre, Margalida

    2016-11-22

    Scope: To analyse the usefulness of isolated human peripheral blood mononuclear cells (PBMC) to rapidly/easily reflect n-3 long-chain polyunsaturated fatty acid (LCPUFA) effects on lipid metabolism/inflammation gene profile, and evaluate if these effects are body mass index (BMI) dependent. Methods and results: PBMC from normoweight (NW) and overweight/obese (OW/OB) subjects were incubated with physiological doses of docosahexaenoic (DHA), eicosapentaenoic acid (EPA), or their combination. PBMC reflected increased beta-oxidation-like capacity (CPT1A expression) in OW/OB but only after DHA treatment. However, insensitivity to n-3 LCPUFA was evident in OW/OB for lipogenic genes: both PUFA diminished FASN and SREBP1C expression in NW, but no effect was observed for DHA in PBMC from high-BMI subjects. This insensitivity was also evident for inflammation gene profile: all treatments inhibited key inflammatory genes in NW; nevertheless, no effect was observed in OW/OB after DHA treatment, and EPA effect was impaired. SLC27A2, IL6 and TNFα PBMC expression analysis resulted especially interesting to determine obesity-related n-3 LCPUFA insensitivity. Conclusion: A PBMC-based human in vitro system reflects n-3 LCPUFA effects on lipid metabolism/inflammation which is impaired in OW/OB. These results confirm the utility of PBMC ex vivo systems for bioactive-compound screening to promote functional food development and to establish appropriate dietary strategies for obese population.

  19. A biotechnological approach for the development of new antifungal compounds to protect the environment and the human health

    Directory of Open Access Journals (Sweden)

    Claudia Zani

    2015-11-01

    Full Text Available Background. In the Po Valley aflatoxins play a relevant role: the local food economy is heavily based on cereal cultivations for animal feed and human nutrition. Aims of this project are the identification of new compounds that inhibit Aspergillus proliferation, the development of new inhibitors of aflatoxins production, and the set-up a practical screening procedure to identify the most effective and safe compounds. Design and Methods. New compounds will be synthetized with natural origin molecules as ligands and endogenous metal ions to increase their bioavailability for the fungi as metal complexes. A biotechnological high-throughput screening will be set up to identify efficiently the most powerful substances. The newly synthesized compounds with effective antifungal activities, will be evaluated with battery of tests with different end-points to assess the toxic potential risk for environmental and human health. Expected impact of the study for public health. The fundamental step in the project will be the synthesis of new compounds and the study of their capability to inhibit aflatoxin biosynthesis. A new, simple, inexpensive and high-throughput method to screen the anti-fungine and anti-mycotoxin activity of the new synthesised compounds will be applied. The evaluation of possible risks for humans due to toxic and genotoxic activities of the molecules will be made with a new approach using different types of cells (bacteria, plants and human cells.

  20. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    Science.gov (United States)

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Naïra; Rau, Frédérique; Jollet, Arnaud; Edom-Vovard, Frédérique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois; Mouly, Vincent; Klein, Arnaud F.

    2017-01-01

    ABSTRACT Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations. PMID:28188264

  1. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds

    Directory of Open Access Journals (Sweden)

    Ludovic Arandel

    2017-04-01

    Full Text Available Myotonic dystrophy type 1 (DM1 and type 2 (DM2 are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations.

  2. Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds.

    Science.gov (United States)

    Arandel, Ludovic; Polay Espinoza, Micaela; Matloka, Magdalena; Bazinet, Audrey; De Dea Diniz, Damily; Naouar, Naïra; Rau, Frédérique; Jollet, Arnaud; Edom-Vovard, Frédérique; Mamchaoui, Kamel; Tarnopolsky, Mark; Puymirat, Jack; Battail, Christophe; Boland, Anne; Deleuze, Jean-Francois; Mouly, Vincent; Klein, Arnaud F; Furling, Denis

    2017-04-01

    Myotonic dystrophy type 1 (DM1) and type 2 (DM2) are autosomal dominant neuromuscular diseases caused by microsatellite expansions and belong to the family of RNA-dominant disorders. Availability of cellular models in which the DM mutation is expressed within its natural context is essential to facilitate efforts to identify new therapeutic compounds. Here, we generated immortalized DM1 and DM2 human muscle cell lines that display nuclear RNA aggregates of expanded repeats, a hallmark of myotonic dystrophy. Selected clones of DM1 and DM2 immortalized myoblasts behave as parental primary myoblasts with a reduced fusion capacity of immortalized DM1 myoblasts when compared with control and DM2 cells. Alternative splicing defects were observed in differentiated DM1 muscle cell lines, but not in DM2 lines. Splicing alterations did not result from differentiation delay because similar changes were found in immortalized DM1 transdifferentiated fibroblasts in which myogenic differentiation has been forced by overexpression of MYOD1. As a proof-of-concept, we show that antisense approaches alleviate disease-associated defects, and an RNA-seq analysis confirmed that the vast majority of mis-spliced events in immortalized DM1 muscle cells were affected by antisense treatment, with half of them significantly rescued in treated DM1 cells. Immortalized DM1 muscle cell lines displaying characteristic disease-associated molecular features such as nuclear RNA aggregates and splicing defects can be used as robust readouts for the screening of therapeutic compounds. Therefore, immortalized DM1 and DM2 muscle cell lines represent new models and tools to investigate molecular pathophysiological mechanisms and evaluate the in vitro effects of compounds on RNA toxicity associated with myotonic dystrophy mutations. © 2017. Published by The Company of Biologists Ltd.

  3. High-content screening of small compounds on human embryonic stem cells.

    Science.gov (United States)

    Barbaric, Ivana; Gokhale, Paul J; Andrews, Peter W

    2010-08-01

    Human ES (embryonic stem) cells and iPS (induced pluripotent stem) cells have been heralded as a source of differentiated cells that could be used in the treatment of degenerative diseases, such as Parkinson's disease or diabetes. Despite the great potential for their use in regenerative therapy, the challenge remains to understand the basic biology of these remarkable cells, in order to differentiate them into any functional cell type. Given the scale of the task, high-throughput screening of agents and culture conditions offers one way to accelerate these studies. The screening of small-compound libraries is particularly amenable to such high-throughput methods. Coupled with high-content screening technology that enables simultaneous assessment of multiple cellular features in an automated and quantitative way, this approach is proving powerful in identifying both small molecules as tools for manipulating stem cell fates and novel mechanisms of differentiation not previously associated with stem cell biology. Such screens performed on human ES cells also demonstrate the usefulness of human ES/iPS cells as cellular models for pharmacological testing of drug efficacy and toxicity, possibly a more imminent use of these cells than in regenerative medicine.

  4. Transformations of Phenolic Compounds in an in vitro Model Simulating the Human Alimentary Tract

    Directory of Open Access Journals (Sweden)

    Aleksandra Duda-Chodak

    2009-01-01

    Full Text Available The aim of this work is to establish the antioxidant properties of polyphenolic compounds of selected fruits before and after their transformations during digestion. The experiment was conducted in in vitro conditions on a set of dialysis membranes which simulated the human digestive tract. Apples of the Šampion, Malinowka and Golden Delicious cultivars, black chokeberry, banana, Wegierka zwykla blue plum, melon and Lukasowka pear were chosen for examination. It was found that compounds obtained after simulated digestion of chokeberries, pears and bananas showed lower antioxidant potential than fresh fruits, while the opposite results were obtained for apples and plums. All dialysates obtained after digestion were characterized by lower content of total polyphenols in comparison with raw material (fresh fruits. It was found that the polyphenols were hydrolyzed, especially glycosides of quercetin and cyanidin. Phenolic acids and cyanidin were characterized by low availability for absorption, whereas catechin and quercetin had a very high level of accessibility in the model small intestine.

  5. Bioactive Compound Content and Cytotoxic Effect on Human Cancer Cells of Fresh and Processed Yellow Tomatoes

    Directory of Open Access Journals (Sweden)

    Assunta Raiola

    2015-12-01

    Full Text Available Tomato, as a fresh or processed product, has a high nutritional value due to its content of bioactive components such as phenolic compounds. Few studies describe the effect of processing on antioxidant content and the cancer cell growth inhibition activity. In this study we determined the phenolic and ascorbic acid content of three yellow tomato varieties, before and after thermal processing. Moreover, we determined the antioxidative power and tested the effects of tomato extracts on three human cancer cell lines. We found that the amount of phenolic acids (chlorogenic acid and caffeic acid decreased in all the samples after processing, whereas the flavonoid content increased after the heat treatment in two samples. A cytotoxic effect of tomato extracts was observed only after processing. This result well correlates with the flavonoid content after processing and clearly indicates that processed yellow tomatoes have a high content of bioactive compounds endowed with cytotoxicity towards cancer cells, thus opening the way to obtain tomato-based functional foods.

  6. Effect of tritiated compounds on sister-chromatid exchanges (SCE) in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Gong Manli; Rao Yongqing; Chen Guanying; Wu Weiwei; Zhao Zilan; Shen Lei

    1990-01-01

    Human lymphocytes treated in vitro with various activities of 3 H-TdR and 3 H-UdR were cultured to understand the effects of tritium on the cell cycle and the frequency of SCE. The results of these experiments indicated that both tritiated compounds make the frequency of SCE increase and the cell cycle delay. The frequency of SCE increased markedly with activity of 3 H. With respect to delaying cell cycle, 3 H-UdR was more effective than 3 H-TdR. The average frequencies of SCE for 3 H-UdR were higher than those for 3 H-TdR. With the exception of 3.7 x 10 3 Bq/mL group and differences between other 3 H-UdR groups and corresponding 3 H-TdR group were significant (t test, p < 0.01). These results suggest that tritiated compounds may have the effect on the cell proliferating rate. The cell proliferating rate index (PRI) seems to be related with the frequency of SCE: the higher the frequency of SCE, the lower the PRI is

  7. EZH2 Impairs Human Dental Pulp Cell Mineralization via the Wnt/β-Catenin Pathway.

    Science.gov (United States)

    Li, B; Yu, F; Wu, F; Hui, T; A, P; Liao, X; Yin, B; Wang, C; Ye, L

    2018-05-01

    The enhancer of zeste homolog 2 (EZH2) is a catalytic subunit of PRC2 (polycomb repressor complex 2). It mediates gene silencing via methyltransferase activity and is involved in the determination of cell lineage. However, the function of EZH2 and the underlying mechanisms by which it affects the differentiation of human dental pulp cell (hDPC) have remained underexplored. In this research, we found that EZH2 expression decreased during the mineralization of hDPCs, with attenuated H3K27me3 (trimethylation on lysine 27 in histone H3). Overexpression of EZH2 impaired the odontogenic differentiation of hDPCs, while EZH2 without methyltransferase activity mutation (mutation of suppressed variegation of 3 to 9, enhancer of zeste and trithorax domain, EZH2ΔSET) did not display this phenotype. In addition, siRNA knockdown studies showed that EZH2 negatively modulated hDPC differentiation in vitro and inhibited mineralized nodule formation in transplanted β-tricalcium phosphate / hDPC composites. To further investigate the underlying mechanisms, we explored the Wnt/β-catenin signaling pathway in view of the fact that previous research had documented the essential role that it plays during hDPC mineralization, as well as its links to EZH2 in other cells. We demonstrated for the first time that EZH2 depletion activated the Wnt/β-catenin signaling pathway and enhanced the accumulation of β-catenin in hDPCs. Chromatin immunoprecipitation analysis suggested that these effects are attributable to the level of the EZH2-regulated H3K27me3 on the β-catenin promoter. We conclude that EZH2 plays a negative role during the odontogenic differentiation of hDPCs. Suppression of EZH2 could promote hDPC mineralization by epigenetically regulating the expression of β-catenin and activating the Wnt canonical signaling pathway.

  8. Severely impaired bone material quality in Chihuahua zebrafish resembles classical dominant human osteogenesis imperfecta.

    Science.gov (United States)

    Fiedler, Imke A K; Schmidt, Felix N; Wölfel, Eva M; Plumeyer, Christine; Milovanovic, Petar; Gioia, Roberta; Tonelli, Francesca; Bale, Hrishikesh A; Jähn, Katharina; Besio, Roberta; Forlino, Antonella; Busse, Björn

    2018-04-17

    Excessive skeletal deformations and brittle fractures in the vast majority of patients suffering from osteogenesis imperfecta (OI) are a result of substantially reduced bone quality. Since the mechanical competence of bone is dependent on the tissue characteristics at small length scales, it is of crucial importance to assess how osteogenesis imperfecta manifests at the micro- and nanoscale of bone. In this context, the Chihuahua (Chi/ +) zebrafish, carrying a heterozygous glycine substitution in the α1 chain of collagen type I, has recently been proposed as suitable animal model of classical dominant OI, showing skeletal deformities, altered mineralization patterns and a smaller body size. This study assessed the bone quality properties of Chi/+ at multiple length scales using micro-computed tomography (micro-CT), histomorphometry, quantitative back-scattered electron imaging, Fourier transform infrared spectroscopy, nanoindentation and X-ray microscopy. At the skeletal level, Chi/+ display smaller body size, deformities and fracture calli in the ribs. Morphological changes at the whole bone level showed that the vertebrae in Chi/+ had a smaller size, smaller thickness and distorted shape. At the tissue level, Chi/+ displayed a higher degree of mineralization, lower collagen maturity, lower mineral maturity, altered osteoblast morphology, and lower osteocyte lacunar density compared to WT. The alterations in the cellular, compositional and structural properties of Chi/+ bones bear an explanation for the impaired local mechanical properties, which promote an increase in overall bone fragility in Chi/ +. The quantitative assessment of bone quality in Chi/+ thus further validates this mutant as an important model reflecting osseous characteristics associated with human classical dominant osteogenesis imperfecta. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  9. The action of sennosides and related compounds on human colon and rectum 1

    Science.gov (United States)

    Hardcastle, J. D.; Wilkins, J. L.

    1970-01-01

    The direct action of intraluminal senna and related compounds on the human colon and rectum has been investigated. Motility was recorded by balloon kymography with recording units inserted into well established transverse colostomies or into the rectum. The motility of the colon was not changed by intraluminal senna glycosides but the introduction of senna previously incubated with faeces or Esch. coli stimulated the colon to peristalt. The peristalsis was similar to that stimulated by rheinanthrone, an oxanthrone produced by chemical hydrolysis and reduction of senna. Both activated senna and rheinanthrone appeared to act in the colon by contact stimulation. No peristaltic response was stimulated in the rectum, either with activated senna or with rheinanthrone. PMID:4929273

  10. SPE-HPLC purification of endocrine disrupting compounds from human serum for assessment of xenoestrogenic activity

    DEFF Research Database (Denmark)

    Hjelmborg, P.S.; Ghisari, Mandana; Bonefeld-Jørgensen, Eva

    2006-01-01

    Assessment of xenoestrogenic activity in human serum samples requires the removal of endogenous sex hormones to assure that the activity measured originates from xenobiotic compounds only. Serum samples representing high, medium and lower accumulation of persistent organic pollutants (POPs) were...... measured by ERE-CALUX was validated and considered to be a valuable tool to assess the combined ER effect of lipophilic serum POPs where additive/synergistic and agonistic/antagonistic effects are integrated giving an overall estimate of exposure and bioactivity....... for the study. MVLN cells, stably transfected with an estrogen receptor (ER) luciferase reporter vector (ERE-CALUX), were exposed to the reconstituted SPE-HPLC extracts for determination of the integrated estrogenic activity. The effects of PCBs were analyzed by direct in vitro exposure of PCBs (138, 153...

  11. Concentration of perfluorinated compounds and cotinine in human foetal organs, placenta, and maternal plasma

    DEFF Research Database (Denmark)

    Mamsen, Linn Salto; Jönsson, Bo A.G.; Lindh, Christian H.

    2017-01-01

    levels. Foetal exposure has previously been estimated from umbilical cord plasma, but the actual concentration in foetal organs has never been measured. Objectives The concentrations of 5 PFASs and cotinine – the primary metabolite of nicotine – were measured in human foetuses, placentas, and maternal...... plasma to evaluate to what extent these compounds were transferred from mother to foetus and to determine if the PFAS concentrations were associated with maternal cigarette smoking. Methods Thirty-nine Danish women who underwent legal termination of pregnancy before gestational week 12 were included; 24...... ratio for all five PFASs and cotinine. Smokers presented 99 ng/g cotinine in plasma, 108 ng/g in placenta, and 61 ng/g in foetal organs. No correlation between the maternal cotinine concentrations and PFAS concentrations was found. Conclusions PFASs were transferred from mother to foetus, however...

  12. The effects of compound danshen dripping pills and human umbilical cord blood mononuclear cell transplant after acute myocardial infarction.

    Science.gov (United States)

    Jun, Yi; Chunju, Yuan; Qi, Ai; Liuxia, Deng; Guolong, Yu

    2014-04-01

    The low frequency of survival of stem cells implanted in the myocardium after acute myocardial infarction may be caused by inflammation and oxidative stress in the myocardial microenvironment. We evaluated the effects of a traditional Chinese medicine, Compound Danshen Dripping Pills, on the cardiac microenvironment and cardiac function when used alone or in combination with human umbilical cord blood mononuclear cell transplant after acute myocardial infarction. After surgically induced acute myocardial infarction, rabbits were treated with Compound Danshen Dripping Pills alone or in combination with human umbilical cord blood mononuclear cell transplant. Evaluation included histology, measurement of left ventricular ejection fraction and fractional shortening, leukocyte count, count of green fluorescent protein positive cells, superoxide dismutase activity, and malondialdehyde content. Combination treatment with Compound Danshen Dripping Pills and human umbilical cord blood mononuclear cell transplant significantly increased the survival of implanted cells, inhibited cardiac cell apoptosis, decreased oxidative stress, decreased the inflammatory response, and improved cardiac function. Rabbits treated with either Compound Danshen Dripping Pills or human umbilical cord blood mononuclear cells alone had improvement in these effects compared with untreated control rabbits. Combination therapy with Compound Danshen Dripping Pills and human umbilical cord blood mononuclear cells may improve cardiac function and morphology after acute myocardial infarction.

  13. An Overview of Plant Phenolic Compounds and Their Importance in Human Nutrition and Management of Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Derong Lin

    2016-10-01

    Full Text Available In this paper, the biosynthesis process of phenolic compounds in plants is summarized, which includes the shikimate, pentose phosphate and phenylpropanoid pathways. Plant phenolic compounds can act as antioxidants, structural polymers (lignin, attractants (flavonoids and carotenoids, UV screens (flavonoids, signal compounds (salicylic acid and flavonoids and defense response chemicals (tannins and phytoalexins. From a human physiological standpoint, phenolic compounds are vital in defense responses, such as anti-aging, anti-inflammatory, antioxidant and anti-proliferative activities. Therefore, it is beneficial to eat such plant foods that have a high antioxidant compound content, which will cut down the incidence of certain chronic diseases, for instance diabetes, cancers and cardiovascular diseases, through the management of oxidative stress. Furthermore, berries and other fruits with low-amylase and high-glucosidase inhibitory activities could be regarded as candidate food items in the control of the early stages of hyperglycemia associated with type 2 diabetes.

  14. Apoptosis induction in human lymphocytes after in vitro exposure to cobalt/hard metal compounds

    International Nuclear Information System (INIS)

    Boeck, M. de; Decordier, I.; Lombaert, N.; Cundari, E.; Kirsch-Volders, M.; Lison, D.

    2001-01-01

    Full text: An increased risk of lung cancer is associated with occupational exposure to mixtures of cobalt metal (Co) and tungsten carbide (WC) particles, but apparently not when exposure is to cobalt alone. The mechanism for this increased cancer risk is not fully understood. The evaluation of the in vitro genotoxic effects in lymphocytes exposed to varying cobalt species demonstrated that the WC-Co hard metal mixture is more genotoxic (DNA damage, chromosome/genome mutations) than metallic Co alone. WC alone was not genotoxic. Thus, WC-Co represents a specific (geno)toxic entity. In order to assess the survival of human lymphocytes after in vitro exposure to metallic Co, CoCl 2 , WC and the WC-Co mixture, two apoptosis/necrosis detection methods were applied (annexin V staining and flow cytometry). Annexin-V staining of early apoptotic cells demonstrated a dose- and time dependent induction of apoptosis by metallic Co, CoCl 2 , WC and the WC-Co mixture. The time course of the process varied according to the metal species tested. Metallic Co and CoCl 2 caused a gradually increasing frequency of apoptotic cells with time (up to 24 h). WC-induced apoptosis displayed a typical 6 hour peak, which was not the case for the WC-Co mixture or for Co. Apoptosis induction by the WC-Co mixture was intermediate between that induced by Co and WC separately. Analysis of propidium iodide stained cells by flow cytometry was performed as a later marker for apoptosis induction. Preliminary data indicate similar tendencies of apoptosis induction as those detected by annexin-V. Identification of the apoptotic pathway triggered by the metal compounds was studied by inhibition of the ceramide-apoptosis pathway by fumonisin causing reduction of apoptosis induction for all compounds, but strongest after 6 hour exposure to WC. The use of specific caspase inhibitors will allow to further elucidate the different pathways involved. The current data demonstrating in vitro the apoptosis

  15. Apoptosis induction in human lymphocytes after in vitro exposure to cobalt/hard metal compounds

    Energy Technology Data Exchange (ETDEWEB)

    Boeck, M de; Decordier, I; Lombaert, N; Cundari, E; Kirsch-Volders, M [Vrije Universiteit Brussel, Laboratorium voor Cellulaire Genetica, Brussel (Belgium); Lison, D [Universite catholique de Louvain, Unite de Toxicologie industrielle et Medecine du Travail, Bruxelles (Belgium)

    2001-07-01

    Full text: An increased risk of lung cancer is associated with occupational exposure to mixtures of cobalt metal (Co) and tungsten carbide (WC) particles, but apparently not when exposure is to cobalt alone. The mechanism for this increased cancer risk is not fully understood. The evaluation of the in vitro genotoxic effects in lymphocytes exposed to varying cobalt species demonstrated that the WC-Co hard metal mixture is more genotoxic (DNA damage, chromosome/genome mutations) than metallic Co alone. WC alone was not genotoxic. Thus, WC-Co represents a specific (geno)toxic entity. In order to assess the survival of human lymphocytes after in vitro exposure to metallic Co, CoCl{sub 2}, WC and the WC-Co mixture, two apoptosis/necrosis detection methods were applied (annexin V staining and flow cytometry). Annexin-V staining of early apoptotic cells demonstrated a dose- and time dependent induction of apoptosis by metallic Co, CoCl{sub 2}, WC and the WC-Co mixture. The time course of the process varied according to the metal species tested. Metallic Co and CoCl{sub 2} caused a gradually increasing frequency of apoptotic cells with time (up to 24 h). WC-induced apoptosis displayed a typical 6 hour peak, which was not the case for the WC-Co mixture or for Co. Apoptosis induction by the WC-Co mixture was intermediate between that induced by Co and WC separately. Analysis of propidium iodide stained cells by flow cytometry was performed as a later marker for apoptosis induction. Preliminary data indicate similar tendencies of apoptosis induction as those detected by annexin-V. Identification of the apoptotic pathway triggered by the metal compounds was studied by inhibition of the ceramide-apoptosis pathway by fumonisin causing reduction of apoptosis induction for all compounds, but strongest after 6 hour exposure to WC. The use of specific caspase inhibitors will allow to further elucidate the different pathways involved. The current data demonstrating in vitro the

  16. Compound K induced apoptosis via endoplasmic reticulum Ca2+ release through ryanodine receptor in human lung cancer cells

    Directory of Open Access Journals (Sweden)

    Dong-Hyun Shin

    2018-04-01

    Full Text Available Background: Extended endoplasmic reticulum (ER stress may initiate apoptotic pathways in cancer cells, and ER stress has been reported to possibly increase tumor death in cancer therapy. We previously reported that caspase-8 played an important role in compound K-induced apoptosis via activation of caspase-3 directly or indirectly through Bid cleavage, cytochrome c release, and caspase-9 activation in HL-60 human leukemia cells. The mechanisms leading to apoptosis in A549 and SK-MES-1 human lung cancer cells and the role of ER stress have not yet been understood. Methods: The apoptotic effects of compound K were analyzed using flow cytometry, and the changes in protein levels were determined using Western blot analysis. The intracellular calcium levels were monitored by staining with Fura-2/AM and Fluo-3/AM. Results: Compound K-induced ER stress was confirmed through increased phosphorylation of eIF2α and protein levels of GRP78/BiP, XBP-1S, and IRE1α in human lung cancer cells. Moreover, compound-K led to the accumulation of intracellular calcium and an increase in m-calpain activities that were both significantly inhibited by pretreatment either with BAPTA-AM (an intracellular Ca2+ chelator or dantrolene (an RyR channel antagonist. These results were correlated with the outcome that compound K induced ER stress-related apoptosis through caspase-12, as z-ATAD-fmk (a specific inhibitor of caspase-12 partially ameliorated this effect. Interestingly, 4-PBA (ER stress inhibitor dramatically improved the compound K-induced apoptosis. Conclusion: Cell survival and intracellular Ca2+ homeostasis during ER stress in human lung cancer cells are important factors in the induction of the compound K-induced apoptotic pathway. Keywords: apoptosis, calcium, compound K, ER stress, lung cancer cells

  17. Evaluation of the suitability of chromatographic systems to predict human skin permeation of neutral compounds.

    Science.gov (United States)

    Hidalgo-Rodríguez, Marta; Soriano-Meseguer, Sara; Fuguet, Elisabet; Ràfols, Clara; Rosés, Martí

    2013-12-18

    Several chromatographic systems (three systems of high-performance liquid chromatography and two micellar electrokinetic chromatography systems) besides the reference octanol-water partition system are evaluated by a systematic procedure previously proposed in order to know their ability to model human skin permeation. The precision achieved when skin-water permeability coefficients are correlated against chromatographic retention factors is predicted within the framework of the solvation parameter model. It consists in estimating the contribution of error due to the biological and chromatographic data, as well as the error coming from the dissimilarity between the human skin permeation and the chromatographic systems. Both predictions and experimental tests show that all correlations are greatly affected by the considerable uncertainty of the skin permeability data and the error associated to the dissimilarity between the systems. Correlations with much better predictive abilities are achieved when the volume of the solute is used as additional variable, which illustrates the main roles of both lipophilicity and size of the solute to penetrate through the skin. In this way, the considered systems are able to give precise estimations of human skin permeability coefficients. In particular, the HPLC systems with common C18 columns provide the best performances in emulating the permeation of neutral compounds from aqueous solution through the human skin. As a result, a methodology based on easy, fast, and economical HPLC measurements in a common C18 column has been developed. After a validation based on training and test sets, the method has been applied with good results to the estimation of skin permeation of several hormones and pesticides. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Development of an Intracellular Screen for New Compounds Able To Inhibit Mycobacterium tuberculosis Growth in Human Macrophages.

    Science.gov (United States)

    Sorrentino, Flavia; Gonzalez del Rio, Ruben; Zheng, Xingji; Presa Matilla, Jesus; Torres Gomez, Pedro; Martinez Hoyos, Maria; Perez Herran, Maria Esther; Mendoza Losana, Alfonso; Av-Gay, Yossef

    2016-01-01

    Here we describe the development and validation of an intracellular high-throughput screening assay for finding new antituberculosis compounds active in human macrophages. The assay consists of a luciferase-based primary identification assay, followed by a green fluorescent protein-based secondary profiling assay. Standard tuberculosis drugs and 158 previously recognized active antimycobacterial compounds were used to evaluate assay robustness. Data show that the assay developed is a short and valuable tool for the discovery of new antimycobacterial compounds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Aging impairs transcriptional regulation of vascular endothelial growth factor in human microvascular endothelial cells: implications for angiogenesis and cell survival.

    Science.gov (United States)

    Ahluwalia, A; Jones, M K; Szabo, S; Tarnawski, A S

    2014-04-01

    In some tissues, aging impairs angiogenesis and reduces expression of vascular endothelial growth factor A (VEGF), a fundamental regulator of angiogenesis. We previously examined angiogenesis in aging and young gastric mucosa in vivo and in vitro and showed that an imbalance between expressions of VEGF (pro-angiogenic factor) and endostatin (anti-angiogenic protein) results in an aging-related impairment of angiogenesis in rats. However, the human relevance of these findings, and whether these mechanisms apply to endothelial cells derived from other tissues, is not clear. Since P-STAT3 and P-CREB are transcription factors that, in association with HIF-1α, can activate VEGF gene expression in some cells (e.g., liver cancer cells, vascular smooth muscle cells), we examined the expression of these two proteins in human dermal microvascular endothelial cells (HMVECs) derived from aging and neonatal individuals. We examined and quantified in vitro angiogenesis, expression of VEGF, P-STAT3, P-CREB and importin-α in HMVECs isolated from neonates (neonatal) and a 66 year old subject (aging). We also examined the effects of treatment with exogenous VEGF and endostatin on in vitro angiogenesis in these cells. Endothelial cells isolated from aging individuals had impaired angiogenesis (vs. neonatal endothelial cells) and reduced expression of VEGF mRNA and protein. Aged HMVECs also had reduced importin-α expression, and reduced expression and nuclear translocation of P-STAT3 and P-CREB. Reduced VEGF gene expression in aged HMVECs strongly correlated with the decreased levels of P-STAT3, P-CREB and importin-α in these cells. Our study clearly demonstrates that endothelial cells from aging individuals have impaired angiogenesis and reduced expression of VEGF likely due to impaired nuclear transport of P-STAT3 and P-CREB transcription factors in these cells.

  20. Transcriptional response to organic compounds from diverse gasoline and biogasoline fuel emissions in human lung cells.

    Science.gov (United States)

    Libalova, Helena; Rossner, Pavel; Vrbova, Kristyna; Brzicova, Tana; Sikorova, Jitka; Vojtisek-Lom, Michal; Beranek, Vit; Klema, Jiri; Ciganek, Miroslav; Neca, Jiri; Machala, Miroslav; Topinka, Jan

    2018-04-01

    Modern vehicles equipped with Gasoline Direct Injection (GDI) engine have emerged as an important source of particulate emissions potentially harmful to human health. We collected and characterized gasoline exhaust particles (GEPs) produced by neat gasoline fuel (E0) and its blends with 15% ethanol (E15), 25% n-butanol (n-But25) and 25% isobutanol (i-But25). To study the toxic effects of organic compounds extracted from GEPs, we analyzed gene expression profiles in human lung BEAS-2B cells. Despite the lowest GEP mass, n-But25 extract contained the highest concentration of polycyclic aromatic hydrocarbons (PAHs), while i-But25 extract the lowest. Gene expression analysis identified activation of the DNA damage response and other subsequent events (cell cycle arrest, modulation of extracellular matrix, cell adhesion, inhibition of cholesterol biosynthesis) following 4 h exposure to all GEP extracts. The i-But25 extract induced the most distinctive gene expression pattern particularly after 24 h exposure. Whereas E0, E15 and n-But25 extract treatments resulted in persistent stress signaling including DNA damage response, MAPK signaling, oxidative stress, metabolism of PAHs or pro-inflammatory response, i-But25 induced changes related to the metabolism of the cellular nutrients required for cell recovery. Our results indicate that i-But25 extract possessed the weakest genotoxic potency possibly due to the low PAH content. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Association between human herpesvirus infections and dementia or mild cognitive impairment: a systematic review protocol.

    Science.gov (United States)

    Warren-Gash, Charlotte; Forbes, Harriet; Breuer, Judith; Hayward, Andrew C; Mavrodaris, Angelique; Ridha, Basil H; Rossor, Martin; Thomas, Sara L; Smeeth, Liam

    2017-06-23

    Persisting neurotropic viruses are proposed to increase the risk of dementia, but evidence of association from robust, adequately powered population studies is lacking. This is essential to inform clinical trials of targeted preventive interventions. We will carry out a comprehensive systematic review of published and grey literature of the association between infection with, reactivation of, vaccination against or treatment of any of the eight human herpesviruses and dementia or mild cognitive impairment. We will search the Cochrane Library, Embase, Global Health, Medline, PsycINFO, Scopus, Web of Science, clinical trials registers, the New York Academy of Medicine Grey Literature Report, Electronic Theses Online Service through the British Library and the ISI Conference Proceedings Citation Index for randomised controlled trials, cohort, caseâ€"control, case crossover or self-controlled case series studies reported in any language up to January 2017. Titles, abstracts and full-text screening will be conducted by two researchers independently. Data will be extracted systematically from eligible studies using a piloted template. We will assess risk of bias of individual studies in line with the Cochrane Collaboration tool. We will conduct a narrative synthesis, grouping studies by exposure and outcome definitions, and will describe any differences by population subgroups and dementia subtypes. We will consider performing meta-analyses if there are adequate numbers of sufficiently homogeneous studies. The overall quality of cumulative evidence will be assessed using selected Grading of Recommendations, Assessment, Development and Evaluations criteria. As this is a review of existing studies, no ethical approval is required. Results will be disseminated through a peer-reviewed publication and at national and international conferences. We anticipate the review will clarify the current extent and quality of evidence for a link between herpesviruses and dementia

  2. Human neuron-astrocyte 3D co-culture-based assay for evaluation of neuroprotective compounds.

    Science.gov (United States)

    Terrasso, Ana Paula; Silva, Ana Carina; Filipe, Augusto; Pedroso, Pedro; Ferreira, Ana Lúcia; Alves, Paula Marques; Brito, Catarina

    Central nervous system drug development has registered high attrition rates, mainly due to the lack of efficacy of drug candidates, highlighting the low reliability of the models used in early-stage drug development and the need for new in vitro human cell-based models and assays to accurately identify and validate drug candidates. 3D human cell models can include different tissue cell types and represent the spatiotemporal context of the original tissue (co-cultures), allowing the establishment of biologically-relevant cell-cell and cell-extracellular matrix interactions. Nevertheless, exploitation of these 3D models for neuroprotection assessment has been limited due to the lack of data to validate such 3D co-culture approaches. In this work we combined a 3D human neuron-astrocyte co-culture with a cell viability endpoint for the implementation of a novel in vitro neuroprotection assay, over an oxidative insult. Neuroprotection assay robustness and specificity, and the applicability of Presto Blue, MTT and CytoTox-Glo viability assays to the 3D co-culture were evaluated. Presto Blue was the adequate endpoint as it is non-destructive and is a simpler and reliable assay. Semi-automation of the cell viability endpoint was performed, indicating that the assay setup is amenable to be transferred to automated screening platforms. Finally, the neuroprotection assay setup was applied to a series of 36 test compounds and several candidates with higher neuroprotective effect than the positive control, Idebenone, were identified. The robustness and simplicity of the implemented neuroprotection assay with the cell viability endpoint enables the use of more complex and reliable 3D in vitro cell models to identify and validate drug candidates. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. A biokinetic model of inhaled Cm compounds in dogs: Application to human exposure data

    International Nuclear Information System (INIS)

    Guilmette, R.A.; Mewhinney, J.A.

    1989-01-01

    Curium isotopes are major by-products in irradiated nuclear reactor fuel and comprise a significant fraction of the alpha-emitting radionuclide inventory. Although little use is currently being made of purified Cm sources, such usage is possible if reprocessing of spent fuel becomes feasible. Because little information is available on the biokinetics and dosimetry of inhaled Cm compounds, a study was conducted in which adult beagle dogs received a single inhalation exposure to either a monodisperse aerosol of 244Cm2O3 (1.4 micron activity median aerodynamic diameter [AMAD]; sigma g = 1.16) or a polydisperse aerosol of 244Cm (NO3)3 (1.1 micron AMAD; sigma g = 1.74). At times ranging from 4 h to 2 y after exposure, animals were sacrificed and their tissues analyzed for Cm content. The data describing the uptake and retention of 244Cm in the different organs and tissues and the measured rates of excretion of these dogs formed the basis on which a biokinetic model of Cm metabolism was constructed. This Cm model was based on a previously published model of the biokinetics of 241Am that was shown to be applicable to data from human cases of inhalation exposure to 241Am aerosols. This Cm model was found to be adequate to describe the biological distribution of Cm in dogs and was also applied to the sparse data from humans. Reasonable agreement was found between the model predictions for lung retention of Cm and for urinary excretion patterns in humans

  4. Functional cardiotoxicity assessment of cosmetic compounds using human-induced pluripotent stem cell-derived cardiomyocytes.

    Science.gov (United States)

    Chaudhari, Umesh; Nemade, Harshal; Sureshkumar, Poornima; Vinken, Mathieu; Ates, Gamze; Rogiers, Vera; Hescheler, Jürgen; Hengstler, Jan Georg; Sachinidis, Agapios

    2018-01-01

    There is a large demand of a human relevant in vitro test system suitable for assessing the cardiotoxic potential of cosmetic ingredients and other chemicals. Using human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), we have already established an in vitro cardiotoxicity assay and identified genomic biomarkers of anthracycline-induced cardiotoxicity in our previous work. Here, five cosmetic ingredients were studied by the new hiPSC-CMs test; kojic acid (KJA), triclosan (TS), triclocarban (TCC), 2,7-naphthalenediol (NPT), and basic red 51 (BR51) based on cytotoxicity as well as ATP assays, beating rate, and genomic biomarkers to determine the lowest observed effect concentration (LOEC) and no observed effect concentration (NOEC). The LOEC for beating rate were 400, 10, 3, >400, and 3 µM for KJA, TS, TCC, NPT, and BR51, respectively. The corresponding concentrations for cytotoxicity or ATP depletion were similar, with the exception of TS and TCC, where the cardiomyocyte-beating assay showed positive results at non-cytotoxic concentrations. Functional analysis also showed that the individual compounds caused different effects on hiPSC-CMs. While exposure to KJA, TS, TCC, and BR51 induced significant arrhythmic beating, NPT slightly decreased cell viability, but did not influence beating. Gene expression studies showed that TS and NPT caused down-regulation of cytoskeletal and cardiac ion homeostasis genes. Moreover, TS and NPT deregulated genomic biomarkers known to be affected also by anthracyclines. The present study demonstrates that hiPSC-CMs can be used to determine LOECs and NOECs in vitro, which can be compared to human blood concentrations to determine margins of exposure. Our in vitro assay, which so far has been tested with several anthracyclines and cosmetics, still requires validation by larger numbers of positive and negative controls, before it can be recommended for routine analysis.

  5. Exhaled human breath measurement method for assessing exposure to halogenated volatile organic compounds.

    Science.gov (United States)

    Pleil, J D; Lindstrom, A B

    1997-05-01

    The organic constituents of exhaled human breath are representative of blood-borne concentrations through gas exchange in the blood/breath interface in the lungs. The presence of specific compounds can be an indicator of recent exposure or represent a biological response of the subject. For volatile organic compounds (VOCs), sampling and analysis of breath is preferred to direct measurement from blood samples because breath collection is noninvasive, potentially infectious waste is avoided, and the measurement of gas-phase analytes is much simpler in a gas matrix rather than in a complex biological tissue such as blood. To exploit these advantages, we have developed the "single breath canister" (SBC) technique, a simple direct collection method for individual alveolar breath samples, and adapted conventional gas chromatography-mass spectrometry analytical methods for trace-concentration VOC analysis. The focus of this paper is to describe briefly the techniques for making VOC measurements in breath, to present some specific applications for which these methods are relevant, and to demonstrate how to estimate exposure to example VOCs on the basis of breath elimination. We present data from three different exposure scenarios: (a) vinyl chloride and cis-1,2-dichloroethene from showering with contaminated water from a private well, (b) chloroform and bromodichloromethane from high-intensity swimming in chlorinated pool water, and (c) trichloroethene from a controlled exposure chamber experiment. In all cases, for all subjects, the experiment is the same: preexposure breath measurement, exposure to halogenated VOC, and a postexposure time-dependent series of breath measurements. Data are presented only to demonstrate the use of the method and how to interpret the analytical results.

  6. Early impairment of gut function and gut flora supporting a role for alteration of gastrointestinal mucosa in human immunodeficiency virus pathogenesis

    NARCIS (Netherlands)

    Gori, Andrea; Tincati, Camilla; Rizzardini, Giuliano; Torti, Carlo; Quirino, Tiziana; Haarman, Monique; Ben Amor, Kaouther; van Schaik, Jacqueline; Vriesema, Aldwin; Knol, Jan; Marchetti, Giulia; Welling, Gjalt; Clerici, Mario

    Our results show that impairment of the gastrointestinal tracts in human immunodeficiency virus (HIV)-positive patients is present in the early phases of HIV disease. This impairment is associated with alterations in gut microbiota and intestinal inflammatory parameters. These findings support the

  7. Anti-proliferative, Cytotoxic and NF-ĸB Inhibitory Properties of Spiro(Lactone-Cyclohexanone) Compounds in Human Leukemia.

    Science.gov (United States)

    Bouhenna, Mustapha M; Orlikova, Barbora; Talhi, Oualid; Schram, Ben; Pinto, Diana C G A; Taibi, Nadia; Bachari, Khaldoun; Diederich, Marc; Silva, Artur M S; Mameri, Nabil

    2017-09-01

    NF-ĸB affects most aspects of cellular physiology. Deregulation of NF-ĸB signaling is associated with inflammatory diseases and cancer. In this study, we evaluated the cytotoxic and NF-ĸB inhibition potential of new spiro(lactone-cyclohexanone) compounds in two different human leukemia cell lines (U937 and K562). The anti-proliferative effects of the spiro(lactone-cyclohexanone) compounds on human K562 and U937 cell lines was evaluated by trypan blue staining, as well as their involvement in NF-kB regulation were analyzed by luciferase reporter gene assay, Caspase-3/7 activities were evaluated to analyze apoptosis induction. Both spiro(coumarin-cyclohexanone) 4 and spiro(6- methyllactone-cyclohexanone) 9 down-regulated cancer cell viability and proliferation. Compound 4 inhibited TNF-α-induced NF-ĸB activation in a dose-dependent manner and induced caspase-dependent apoptosis in both leukemia cell lines. Results show that compound 4 and compound 9 have potential as anti-cancer agents. In addition, compound 4 exerted NF-kB inhibition activity in leukemia cancer cells. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  8. Neuroimaging Impaired Response Inhibition and Salience Attribution in Human Drug Addiction: A Systematic Review.

    Science.gov (United States)

    Zilverstand, Anna; Huang, Anna S; Alia-Klein, Nelly; Goldstein, Rita Z

    2018-06-06

    The impaired response inhibition and salience attribution (iRISA) model proposes that impaired response inhibition and salience attribution underlie drug seeking and taking. To update this model, we systematically reviewed 105 task-related neuroimaging studies (n > 15/group) published since 2010. Results demonstrate specific impairments within six large-scale brain networks (reward, habit, salience, executive, memory, and self-directed networks) during drug cue exposure, decision making, inhibitory control, and social-emotional processing. Addicted individuals demonstrated increased recruitment of these networks during drug-related processing but a blunted response during non-drug-related processing, with the same networks also being implicated during resting state. Associations with real-life drug use, relapse, therapeutic interventions, and the relevance to initiation of drug use during adolescence support the clinical relevance of the results. Whereas the salience and executive networks showed impairments throughout the addiction cycle, the reward network was dysregulated at later stages of abuse. Effects were similar in alcohol, cannabis, and stimulant addiction. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Transient impairment of the axolemma following regional anaesthesia by lidocaine in humans

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Lange, Kai Henrik Wiborg; Aachmann-Andersen, Niels Jacob

    2014-01-01

    The local anaesthetic lidocaine is known to block voltage-gated Na(+) channels (VGSCs), although at high concentration it was also reported to block other ion channel currents as well as to alter lipid membranes. The aim of this study was to investigate whether the clinical regional anaesthetic...... reflect, at least in part, a reversible structural impairment of the axolemma....

  10. Training of Speechreading for Severely Hearing-Impaired Persons by Human and Computer

    DEFF Research Database (Denmark)

    Bothe, Hans-Heinrich

    2007-01-01

    This paper describes evaluation results for a software programme that is intended to be used as a training-aid for lipreading in German. Tests were carried out in schools for hearing-impaired children in Germany which indicate that the ability to lipread increases significantly already after use...... of the software during a short period of time....

  11. Progress and Prospects in Human Genetic Research into Age-Related Hearing Impairment

    Directory of Open Access Journals (Sweden)

    Yasue Uchida

    2014-01-01

    Full Text Available Age-related hearing impairment (ARHI is a complex, multifactorial disorder that is attributable to confounding intrinsic and extrinsic factors. The degree of impairment shows substantial variation between individuals, as is also observed in the senescence of other functions. This individual variation would seem to refute the stereotypical view that hearing deterioration with age is inevitable and may indicate that there is ample scope for preventive intervention. Genetic predisposition could account for a sizable proportion of interindividual variation. Over the past decade or so, tremendous progress has been made through research into the genetics of various forms of hearing impairment, including ARHI and our knowledge of the complex mechanisms of auditory function has increased substantially. Here, we give an overview of recent investigations aimed at identifying the genetic risk factors involved in ARHI and of what we currently know about its pathophysiology. This review is divided into the following sections: (i genes causing monogenic hearing impairment with phenotypic similarities to ARHI; (ii genes involved in oxidative stress, biologic stress responses, and mitochondrial dysfunction; and (iii candidate genes for senescence, other geriatric diseases, and neurodegeneration. Progress and prospects in genetic research are discussed.

  12. Assembled microneedle arrays enhance the transport of compounds varying over a large range of molecular weight across human dermatomed skin

    NARCIS (Netherlands)

    Verbaan, F.J.; Bal, S.M.; van den Berg, D.J.; Groenink, W.H.H.; Verpoorten, H.; Lüttge, Regina; Bouwstra, J.A.

    2007-01-01

    In this study, we demonstrate the feasibility to use microneedle arrays manufactured from commercially available 30G hypodermal needles to enhance the transport of compounds up to a molecular weight of 72 kDa. Piercing of human dermatomed skin with microneedle arrays was studied by Trypan Blue

  13. Formation of harmful compounds in biotransformation of lilial by microorganisms isolated from human skin.

    Science.gov (United States)

    Esmaeili, Akbar; Afshari, Shima; Esmaeili, Davood

    2015-01-01

    The biotransformation of lilial results in an acid that is used in the dairy industry, in perfumery, as an intermediate in the manufacture of pharmaceuticals and cosmetics, and as a food additive for enhancing taste. This study investigates the biotransformation of lilial by Staphylococcus aureus and Staphylococcus epidermidis, two bacterial species isolated from human skin. Both species of Staphylococcus were isolated in samples taken from the skin of individuals living in a rural area of Iran. The pH of the culture medium was optimized, and after culturing the microorganisms, the bacteria were added to a flask containing a nutrient broth and incubated for several hours. The flasks of bacteria were combined with lilial, and various biochemical tests and diagnostics were performed, including Fourier transform infrared spectroscopy (FT-IR), ultraviolet-visible spectrophotometry (UV-Vis), and gas chromatography-mass spectroscopy (GC-MS). The S. aureus produced isobutyric acid (2-methylpropanoic acid) after 72 h (71% of the total products yielded during biotransformation), whereas the S. epidermidis produced terpenoid alcoholic media after 24 h (90% of total products obtained). The results obtained indicate that biotransformation of lilial by S. aureus is more desirable than by S. epidermidis due to the highly efficient production of a single product. Bourgeonal and liliol were two toxic compounds produced during biotransformation, which indicates that the use of lilial in cosmetics can be harmful to the skin.

  14. The human bitter taste receptor T2R38 is broadly tuned for bacterial compounds.

    Directory of Open Access Journals (Sweden)

    Christophe Verbeurgt

    Full Text Available T2R38 has been shown to be a specific bacterial detector implicated in innate immune defense mechanism of human upper airway. Several clinical studies have demonstrated that this receptor is associated with the development of chronic rhinosinusitis (CRS. T2R38 was previously reported to bind to homoserine lactones (HSL, quorum sensing molecules specific of Pseudomonas Aeruginosa and other gram negative species. Nevertheless, these bacteria are not the major pathogens found in CRS. Here we report on the identification of bacterial metabolites acting as new agonists of T2R38 based on a single cell calcium imaging study. Two quorum sensing molecules (Agr D1 thiolactone from Staphylococcus Aureus and CSP-1 from Streptococcus Pneumoniae and a list of 32 bacterial metabolites from pathogens frequently implicated in CRS were tested. First, we observed that HSL failed to activate T2R38 in our experimental system, but that the dimethylsulfoxide (DMSO, used as a solvent for these lactones may, by itself, account for the agonistic effect previously described. Secondly, we showed that both Agr D1 thiolactone and CSP-1 are inactive but that at least 7 bacterial metabolites (acetone, 2-butanone, 2-pentanone, 2-methylpropanal, dimethyl disulfide, methylmercaptan, γ-butyrolactone are able to specifically trigger this receptor. T2R38 is thus much more broadly tuned for bacterial compounds than previously thought.

  15. Compound A398, a novel podophyllotoxin analogue: cytotoxicity and induction of apoptosis in human leukemia cells.

    Directory of Open Access Journals (Sweden)

    Alethéia L Silveira

    Full Text Available Despite advances in oncology research, cancer is one of the leading causes of death worldwide. Thus, there is a demand for the development of more selective and effective antitumor agents. This study showed that A398, a novel podophyllotoxin analogue, was cytotoxic to the HT-29, MCF-7, MOLT-4 and HL-60 tumor cell lines, being less active in human peripheral blood mononuclear cells and normal cell lines FGH and IEC-6. Tests using the HepG2 lineage indicated that its metabolites do not contribute to its cytotoxicity. In the HL-60 cells, A398 induced apoptosis in a time and concentration-dependent manner, promoting mitochondrial depolarization, inhibition of Bcl-2, phosphatidylserine exposure, activation of caspases -8, -9 and -3, and DNA fragmentation. The production of reactive oxygen species does not seem to be a crucial event for the apoptotic process. Pretreatment with specific inhibitors of kinases ERK1/2, JNK and p38 resulted in an increased percentage of death induced by A398. These results indicate that the compound induced apoptosis through activation of intrinsic and extrinsic death pathways with the mechanism involving the inhibition of the MAPKs and Bcl-2. Taken together, our findings suggest that A398 has an anticancer potential, proving itself to be a candidate for preclinical studies.

  16. Optimization of Phenolic Compounds Extraction from Flax Shives and Their Effect on Human Fibroblasts

    Directory of Open Access Journals (Sweden)

    Magdalena Czemplik

    2017-01-01

    Full Text Available The goal of this study was to evaluate the most effective technique for extraction of phenolics present in flax shives and to assess their effect on human fibroblasts. Flax shives are by-products of fibre separation, but they were found to be a rich source of phenolic compounds and thus might have application potential. It was found that the optimal procedure for extraction of phenolics was hydrolysis enhanced by the ultrasound with NaOH for 24 h at 65°C and subsequent extraction with ethyl acetate. The influence of the flax shives extract on fibroblast growth and viability was assessed using the MTT and SRB tests. Moreover, the influence of flax shives extract on the extracellular matrix remodelling process was verified. The 20% increase of the viability was observed upon flax shives extract treatment and the decrease of mRNA collagen genes, an increase of matrix metalloproteinase gene expression, and reduction in levels of interleukin 6, interleukin 10, and suppressor of cytokinin signaling 1 mRNA were observed. Alterations in MCP-1 mRNA levels were dependent on flax shives extract concentration. Thus, we suggested the possible application of flax shives extract in the wound healing process.

  17. Bioavailability and pharmacokinetic profile of grape pomace phenolic compounds in humans.

    Science.gov (United States)

    Castello, Fabio; Costabile, Giuseppina; Bresciani, Letizia; Tassotti, Michele; Naviglio, Daniele; Luongo, Delia; Ciciola, Paola; Vitale, Marilena; Vetrani, Claudia; Galaverna, Gianni; Brighenti, Furio; Giacco, Rosalba; Del Rio, Daniele; Mena, Pedro

    2018-05-15

    Grape pomace, the major byproduct of the wine and juice industry, is a relevant source of bioactive phenolic compounds. However, polyphenol bioavailability in humans is not well understood, and the inter-individual variability in the production of phenolic metabolites has not been comprehensively assessed to date. The pharmacokinetic and excretive profiles of phenolic metabolites after the acute administration of a drink made from red grape pomace was here investigated in ten volunteers. A total of 35 and 28 phenolic metabolites were quantified in urine and plasma, respectively. The main circulating metabolites included phenyl-γ-valerolactones, hydroxybenzoic acids, simple phenols, hydroxyphenylpropionic acids, hydroxycinnamates, and (epi)catechin phase II conjugates. A high inter-individual variability was shown both in urine and plasma samples, and different patterns of circulating metabolites were unravelled by applying unsupervised multivariate analysis. Besides the huge variability in the production of microbial metabolites of colonic origin, an important variability was observed due to phase II conjugates. These results are of interest to further understand the potential health benefits of phenolic metabolites on individual basis. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  19. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  20. Aryl hydrocarbon receptor activation by 2,3,7,8-tetrachlorodibenzo-p-dioxin impairs human B lymphopoiesis

    International Nuclear Information System (INIS)

    Li, Jinpeng; Phadnis-Moghe, Ashwini S.; Crawford, Robert B.; Kaminski, Norbert E.

    2017-01-01

    The homeostasis of peripheral B cell compartment requires lifelong B lymphopoiesis from hematopoietic stem cells (HSC). As a result, the B cell repertoire is susceptible to disruptions of hematopoiesis. Increasing evidence, primarily from rodent models, shows that the aryl hydrocarbon receptor (AHR) regulates hematopoiesis. To study the effects of persistent AHR activation on human B cell development, a potent AHR agonist and known environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was utilized. An in vitro B cell development model system was established by co-culturing human cord blood-derived HSCs with irradiated human primary bone marrow stromal cells. Using this in vitro model, we found that TCDD significantly suppressed the total number of hematopoietic stem and progenitor cells (HSPC) in a concentration-dependent manner. Cell death analysis demonstrated that the decrease in cell number was not due to cytotoxicity by TCDD. In addition, TCDD markedly decreased CD34 expression on HSPCs. Structure-activity relationship studies using dioxin congeners demonstrated a correlation between the relative AHR binding affinity and the magnitude of decrease in the number of HSPCs and CD34 expression, suggesting that AHR mediates the observed TCDD-elicited changes in HSPCs. Moreover, a significant reduction in lineage committed B cell-derived from HSCs was observed in the presence of TCDD, indicating impairment of human B cell development. Similar effects of TCDD were observed regardless of the use of stromal cells in cultures indicating a direct effect of TCDD on HSCs. Collectively, we demonstrate that AHR activation by TCDD on human HSCs impairs early stages of human B lymphopoiesis.

  1. Compound K, a metabolite of ginseng saponin, induces apoptosis via caspase-8-dependent pathway in HL-60 human leukemia cells

    International Nuclear Information System (INIS)

    Cho, Sung-Hee; Chung, Kyung-Sook; Choi, Jung-Hye; Kim, Dong-Hyun; Lee, Kyung-Tae

    2009-01-01

    Compound K [20-O-β-(D-glucopyranosyl)-20(S)-protopanaxadiol], a metabolite of the protopanaxadiol-type saponins of Panax ginseng C.A. Meyer, has been reported to possess anti-tumor properties to inhibit angiogenesis and to induce tumor apoptosis. In the present study, we investigated the effect of Compound K on apoptosis and explored the underlying mechanisms involved in HL-60 human leukemia cells. We examined the effect of Compound K on the viabilities of various cancer cell lines using MTT assays. DAPI assay, Annexin V and PI double staining, Western blot assay and immunoprecipitation were used to determine the effect of Compound K on the induction of apoptosis. Compound K was found to inhibit the viability of HL-60 cells in a dose- and time-dependent manner with an IC 50 of 14 μM. Moreover, this cell death had typical features of apoptosis, that is, DNA fragmentation, DNA ladder formation, and the externalization of Annexin V targeted phosphatidylserine residues in HL-60 cells. In addition, compound-K induced a series of intracellular events associated with both the mitochondrial- and death receptor-dependent apoptotic pathways, namely, (1) the activation of caspases-3, -8, and -9; (2) the loss of mitochondrial membrane potential; (3) the release of cytochrome c and Smac/DIABLO to the cytosol; (4) the translocation of Bid and Bax to mitochondria; and (5) the downregulations of Bcl-2 and Bcl-xL. Furthermore, a caspase-8 inhibitor completely abolished caspase-3 activation, Bid cleavage, and subsequent DNA fragmentation by Compound K. Interestingly, the activation of caspase-3 and -8 and DNA fragmentation were significantly prevented in the presence of cycloheximide, suggesting that Compound K-induced apoptosis is dependent on de novo protein synthesis. The results indicate that caspase-8 plays a key role in Compound K-stimulated apoptosis via the activation of caspase-3 directly or indirectly through Bid cleavage, cytochrome c release, and caspase-9 activation

  2. Cell death effects of resin-based dental material compounds and mercurials in human gingival fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Reichl, Franz-Xaver [Walther-Straub-Institute of Pharmacology and Toxicology, Munich (Germany); Ludwig-Maximilians-University, Department of Operative Dentistry and Periodontology, Munich (Germany); Esters, Magali; Simon, Sabine; Seiss, Mario [Walther-Straub-Institute of Pharmacology and Toxicology, Munich (Germany); Kehe, Kai [Bundeswehr Institute of Pharmacology and Toxicology, Munich (Germany); Kleinsasser, Norbert [University of Regensburg, Head and Neck Surgery, Department of Otolaryngology, Regensburg (Germany); Folwaczny, Matthias; Glas, Juergen; Hickel, Reinhard [Ludwig-Maximilians-University, Department of Operative Dentistry and Periodontology, Munich (Germany)

    2006-06-15

    In order to test the hypothesis that released dental restorative materials can reach toxic levels in human oral tissues, the cytotoxicities of the resin-based dental (co)monomers hydroxyethylmethacrylate (HEMA), triethyleneglycoldimethacrylate (TEGDMA), urethanedimethacrylate (UDMA), and bisglycidylmethacrylate (BisGMA) compared with methyl mercury chloride (MeHgCl) and the amalgam component mercuric chloride (HgCl{sub 2}) were investigated on human gingival fibroblasts (HGF) using two different test systems: (1) the modified XTT-test and (2) the modified H 33342 staining assay. The HGF were exposed to various concentrations of the test-substances in all test systems for 24 h. All tested (co)monomers and mercury compounds significantly (P<0.05) decreased the formazan formation in the XTT-test. EC{sub 50} values in the XTT assay were obtained as half-maximum-effect concentrations from fitted curves. Following EC{sub 50} values were found (mean [mmol/l]; s.e.m. in parentheses; n=12; * significantly different to HEMA): HEMA 11.530 (0.600); TEGDMA* 3.460 (0.200); UDMA* 0.106 (0.005); BisGMA* 0.087 (0.001); HgCl{sub 2}* 0.013 (0.001); MeHgCl* 0.005 (0.001). Following relative toxicities were found: HEMA 1; TEGDMA 3; UDMA 109; BisGMA 133; HgCl{sub 2} 887; MeHgCl 2306. A significant (P<0.05) increase of the toxicity of (co)monomers and mercurials was found in the XTT-test in the following order: HEMA < TEGDMA < UDMA < BisGMA < HgCl{sub 2} < MeHgCl. TEGDMA and MeHgCl induced mainly apoptotic cell death. HEMA, UDMA, BisGMA, and HgCl{sub 2} induced mainly necrotic cell death. The results of this study indicate that resin composite components have a lower toxicity than mercury from amalgam in HGF. HEMA, BisGMA, UDMA, and HgCl{sub 2} induced mainly necrosis, but it is rather unlikely that eluted substances (solely) can reach concentrations, which might induce necrotic cell death in the human physiological situation, indicating that other (additional) factors may be involved in

  3. Thinking After Drinking: Impaired Hippocampal Dependent Cognition in Human Alcoholics and Animal Models of Alcohol Dependence

    Directory of Open Access Journals (Sweden)

    Miranda Staples

    2016-09-01

    Full Text Available Alcohol use disorder currently affects approximately 18 million Americans, with at least half of these individuals having significant cognitive impairments subsequent to their chronic alcohol use. This is most widely apparent as frontal cortex dependent cognitive dysfunction, where executive function and decision making are severely compromised, as well as hippocampus dependent cognitive dysfunction, where contextual and temporal reasoning are negatively impacted. This review discusses the relevant clinical literature to support the theory that cognitive recovery in tasks dependent on the prefrontal cortex and hippocampus is temporally different across extended periods of abstinence from alcohol. Additional studies from preclinical models are discussed to support clinical findings. Finally, the unique cellular composition of the hippocampus and cognitive impairment dependent on the hippocampus is highlighted in the context of alcohol dependence.

  4. Human peripheral blood mononuclear cell in vitro system to test the efficacy of food bioactive compounds: Effects of polyunsaturated fatty acids and their relation with BMI.

    Science.gov (United States)

    Cifre, Margalida; Díaz-Rúa, Rubén; Varela-Calviño, Rubén; Reynés, Bàrbara; Pericás-Beltrán, Jordi; Palou, Andreu; Oliver, Paula

    2017-04-01

    To analyse the usefulness of isolated human peripheral blood mononuclear cells (PBMC) to rapidly/easily reflect n-3 long-chain polyunsaturated fatty acid (LCPUFA) effects on lipid metabolism/inflammation gene profile, and evaluate if these effects are body mass index (BMI) dependent. PBMC from normoweight (NW) and overweight/obese (OW/OB) subjects were incubated with physiological doses of docosahexaenoic (DHA), eicosapentaenoic acid (EPA), or their combination. PBMC reflected increased beta-oxidation-like capacity (CPT1A expression) in OW/OB but only after DHA treatment. However, insensitivity to n-3 LCPUFA was evident in OW/OB for lipogenic genes: both PUFA diminished FASN and SREBP1C expression in NW, but no effect was observed for DHA in PBMC from high-BMI subjects. This insensitivity was also evident for inflammation gene profile: all treatments inhibited key inflammatory genes in NW; nevertheless, no effect was observed in OW/OB after DHA treatment, and EPA effect was impaired. SLC27A2, IL6 and TNFα PBMC expression analysis resulted especially interesting to determine obesity-related n-3 LCPUFA insensitivity. A PBMC-based human in vitro system reflects n-3 LCPUFA effects on lipid metabolism/inflammation which is impaired in OW/OB. These results confirm the utility of PBMC ex vivo systems for bioactive-compound screening to promote functional food development and to establish appropriate dietary strategies for obese population. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Fast track, dynein-dependent nuclear targeting of human immunodeficiency virus Vpr protein; impaired trafficking in a clinical isolate

    Energy Technology Data Exchange (ETDEWEB)

    Caly, Leon [Department of Biochemistry and Molecular Biology, Monash University, Clayton, Vic. 3800 (Australia); Kassouf, Vicki T. [Centre for Virus Research, The Westmead Institute for Medical Research, The University of Sydney, Westmead, NSW 2145 (Australia); Moseley, Gregory W. [Department of Biochemistry and Molecular Biology, Monash University, Clayton, Vic. 3800 (Australia); Diefenbach, Russell J.; Cunningham, Anthony L. [Centre for Virus Research, The Westmead Institute for Medical Research, The University of Sydney, Westmead, NSW 2145 (Australia); Jans, David A., E-mail: david.jans@monash.edu [Department of Biochemistry and Molecular Biology, Monash University, Clayton, Vic. 3800 (Australia)

    2016-02-12

    Nuclear import of the accessory protein Vpr is central to infection by human immunodeficiency virus (HIV). We previously identified the Vpr F72L mutation in a HIV-infected, long-term non-progressor, showing that it resulted in reduced Vpr nuclear accumulation and altered cytoplasmic localisation. Here we demonstrate for the first time that the effects of nuclear accumulation of the F72L mutation are due to impairment of microtubule-dependent-enhancement of Vpr nuclear import. We use high resolution imaging approaches including fluorescence recovery after photobleaching and other approaches to document interaction between Vpr and the dynein light chain protein, DYNLT1, and impaired interaction of the F72L mutant with DYNLT1. The results implicate MTs/DYNLT1 as drivers of Vpr nuclear import and HIV infection, with important therapeutic implications. - Highlights: • HIV-1 Vpr utilizes the microtubule network to traffic towards the nucleus. • Mechanism relies on interaction between Vpr and dynein light chain protein DYNLT1. • Long-term non-progressor derived mutation (F72L) impairs this interaction. • Key residues in the vicinity of F72 contribute to interaction with DYNLT1.

  6. Fast track, dynein-dependent nuclear targeting of human immunodeficiency virus Vpr protein; impaired trafficking in a clinical isolate

    International Nuclear Information System (INIS)

    Caly, Leon; Kassouf, Vicki T.; Moseley, Gregory W.; Diefenbach, Russell J.; Cunningham, Anthony L.; Jans, David A.

    2016-01-01

    Nuclear import of the accessory protein Vpr is central to infection by human immunodeficiency virus (HIV). We previously identified the Vpr F72L mutation in a HIV-infected, long-term non-progressor, showing that it resulted in reduced Vpr nuclear accumulation and altered cytoplasmic localisation. Here we demonstrate for the first time that the effects of nuclear accumulation of the F72L mutation are due to impairment of microtubule-dependent-enhancement of Vpr nuclear import. We use high resolution imaging approaches including fluorescence recovery after photobleaching and other approaches to document interaction between Vpr and the dynein light chain protein, DYNLT1, and impaired interaction of the F72L mutant with DYNLT1. The results implicate MTs/DYNLT1 as drivers of Vpr nuclear import and HIV infection, with important therapeutic implications. - Highlights: • HIV-1 Vpr utilizes the microtubule network to traffic towards the nucleus. • Mechanism relies on interaction between Vpr and dynein light chain protein DYNLT1. • Long-term non-progressor derived mutation (F72L) impairs this interaction. • Key residues in the vicinity of F72 contribute to interaction with DYNLT1.

  7. Β-amyloid 1-42 oligomers impair function of human embryonic stem cell-derived forebrain cholinergic neurons.

    Directory of Open Access Journals (Sweden)

    Linn Wicklund

    Full Text Available Cognitive impairment in Alzheimer's disease (AD patients is associated with a decline in the levels of growth factors, impairment of axonal transport and marked degeneration of basal forebrain cholinergic neurons (BFCNs. Neurogenesis persists in the adult human brain, and the stimulation of regenerative processes in the CNS is an attractive prospect for neuroreplacement therapy in neurodegenerative diseases such as AD. Currently, it is still not clear how the pathophysiological environment in the AD brain affects stem cell biology. Previous studies investigating the effects of the β-amyloid (Aβ peptide on neurogenesis have been inconclusive, since both neurogenic and neurotoxic effects on progenitor cell populations have been reported. In this study, we treated pluripotent human embryonic stem (hES cells with nerve growth factor (NGF as well as with fibrillar and oligomeric Aβ1-40 and Aβ1-42 (nM-µM concentrations and thereafter studied the differentiation in vitro during 28-35 days. The process applied real time quantitative PCR, immunocytochemistry as well as functional studies of intracellular calcium signaling. Treatment with NGF promoted the differentiation into functionally mature BFCNs. In comparison to untreated cells, oligomeric Aβ1-40 increased the number of functional neurons, whereas oligomeric Aβ1-42 suppressed the number of functional neurons. Interestingly, oligomeric Aβ exposure did not influence the number of hES cell-derived neurons compared with untreated cells, while in contrast fibrillar Aβ1-40 and Aβ1-42 induced gliogenesis. These findings indicate that Aβ1-42 oligomers may impair the function of stem cell-derived neurons. We propose that it may be possible for future AD therapies to promote the maturation of functional stem cell-derived neurons by altering the brain microenvironment with trophic support and by targeting different aggregation forms of Aβ.

  8. Impaired epithelial differentiation of induced pluripotent stem cells from ectodermal dysplasia-related patients is rescued by the small compound APR-246/PRIMA-1MET.

    Science.gov (United States)

    Shalom-Feuerstein, Ruby; Serror, Laura; Aberdam, Edith; Müller, Franz-Josef; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing; Aberdam, Daniel; Petit, Isabelle

    2013-02-05

    Ectodermal dysplasia is a group of congenital syndromes affecting a variety of ectodermal derivatives. Among them, ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome is caused by single point mutations in the p63 gene, which controls epidermal development and homeostasis. Phenotypic defects of the EEC syndrome include skin defects and limbal stem-cell deficiency. In this study, we designed a unique cellular model that recapitulated major embryonic defects related to EEC. Fibroblasts from healthy donors and EEC patients carrying two different point mutations in the DNA binding domain of p63 were reprogrammed into induced pluripotent stem cell (iPSC) lines. EEC-iPSC from both patients showed early ectodermal commitment into K18(+) cells but failed to further differentiate into K14(+) cells (epidermis/limbus) or K3/K12(+) cells (corneal epithelium). APR-246 (PRIMA-1(MET)), a small compound that restores functionality of mutant p53 in human tumor cells, could revert corneal epithelial lineage commitment and reinstate a normal p63-related signaling pathway. This study illustrates the relevance of iPSC for p63 related disorders and paves the way for future therapy of EEC.

  9. Effect of compounds with antibacterial activities in human milk on respiratory syncytial virus and cytomegalovirus in vitro.

    Science.gov (United States)

    Portelli, J; Gordon, A; May, J T

    1998-11-01

    The effect of some antibacterial compounds present in human milk were tested for antiviral activity against respiratory syncytial virus, Semliki Forest virus and cytomegalovirus. These included the gangliosides GM1, GM2 and GM3, sialyl-lactose, lactoferrin and chondroitin sulphate A, B and C, which were all tested for their ability to inhibit the viruses in cell culture. Of the compounds tested, only the ganglioside GM2, chondroitin sulphate B and lactoferrin inhibited the absorption and growth of respiratory syncytial virus in cell culture, and none inhibited the growth of Semliki Forest virus, indicating that lipid antiviral activity was not associated with any of the gangliosides. While the concentrations of these two compounds required to inhibit respiratory syncytial virus were in excess of those present in human milk, sialyl-lactose concentrations similar to those present in human milk increased the growth of cytomegalovirus. Lactoferrin was confirmed as inhibiting both respiratory syncytial virus and cytomegalovirus growth in culture even when used at lower concentrations than those present in human milk. The antiviral activities of GM2, chondroitin sulphate B and lactoferrin were tested when added to an infant formula. Lactoferrin continued to have antiviral activity against cytomegalovirus, but a lower activity against respiratory syncytial virus; ganglioside GM2 and chondroitin sulphate B still maintained antiviral activity against respiratory syncytial virus.

  10. Non-occlusive topical exposure of human skin in vitro as model for cytotoxicity testing of irritant compounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Briheim, Kristina; Kratz, Gunnar

    2016-02-01

    Testing of irritant compounds has traditionally been performed on animals and human volunteers. Animal testing should always be restricted and for skin irritancy mice and rabbits hold poor predictive value for irritant potential in humans. Irritant testing on human volunteers is restricted by the duration subjects can be exposed, and by the subjectivity of interpreting the visual signs of skin irritation. We propose an irritant testing system using viable human full thickness skin with the loss of cell viability in the exposed skin area as end point measurement. Skin was exposed to sodium dodecyl sulfate (SDS) at 20% concentration by non-occluded topical exposure to establish a positive control response and subsequent test compounds were statistically compared with the 20% SDS response. Cell viability and metabolism were measured with 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. The model presents correlation between increased concentration of SDS and decreased viability of cells in the exposed skin area (R(2) = 0.76). We propose the model to be used for cytotoxicity testing of irritant compounds. With fully intact barrier function, the model comprises all cells present in the skin with quantifiable end point measurement.

  11. The citrus flavanone naringenin impairs dengue virus replication in human cells

    OpenAIRE

    Frabasile, Sandra; Koishi, Andrea Cristine; Kuczera, Diogo; Silveira, Guilherme Ferreira; Verri, Waldiceu Aparecido; Duarte dos Santos, Claudia Nunes; Bordignon, Juliano

    2017-01-01

    Dengue is one of the most significant health problems in tropical and sub-tropical regions throughout the world. Nearly 390 million cases are reported each year. Although a vaccine was recently approved in certain countries, an anti-dengue virus drug is still needed. Fruits and vegetables may be sources of compounds with medicinal properties, such as flavonoids. This study demonstrates the anti-dengue virus activity of the citrus flavanone naringenin, a class of flavonoid. Naringenin prevente...

  12. Dietary sodium loading impairs microvascular function independent of blood pressure in humans: role of oxidative stress

    Science.gov (United States)

    Greaney, Jody L; DuPont, Jennifer J; Lennon-Edwards, Shannon L; Sanders, Paul W; Edwards, David G; Farquhar, William B

    2012-01-01

    Animal studies have reported dietary salt-induced reductions in vascular function independent of increases in blood pressure (BP). The purpose of this study was to determine if short-term dietary sodium loading impairs cutaneous microvascular function in normotensive adults with salt resistance. Following a control run-in diet, 12 normotensive adults (31 ± 2 years) were randomized to a 7 day low-sodium (LS; 20 mmol day−1) and 7 day high-sodium (HS; 350 mmol day−1) diet (controlled feeding study). Salt resistance, defined as a ≤5 mmHg change in 24 h mean BP determined while on the LS and HS diets, was confirmed in all subjects undergoing study (LS: 84 ± 1 mmHg vs. HS: 85 ± 2 mmHg; P > 0.05). On the last day of each diet, subjects were instrumented with two microdialysis fibres for the local delivery of Ringer solution and 20 mm ascorbic acid (AA). Laser Doppler flowmetry was used to measure red blood cell flux during local heating-induced vasodilatation (42°C). After the established plateau, 10 mm l-NAME was perfused to quantify NO-dependent vasodilatation. All data were expressed as a percentage of maximal cutaneous vascular conductance (CVC) at each site (28 mm sodium nitroprusside; 43°C). Sodium excretion increased during the HS diet (P sodium loading impairs cutaneous microvascular function independent of BP in normotensive adults and suggest a role for oxidative stress. PMID:22907057

  13. The impairment of MAGMAS function in human is responsible for a severe skeletal dysplasia.

    Directory of Open Access Journals (Sweden)

    Cybel Mehawej

    2014-05-01

    Full Text Available Impairment of the tightly regulated ossification process leads to a wide range of skeletal dysplasias and deciphering their molecular bases has contributed to the understanding of this complex process. Here, we report a homozygous mutation in the mitochondria-associated granulocyte macrophage colony stimulating factor-signaling gene (MAGMAS in a novel and severe spondylodysplastic dysplasia. MAGMAS, also referred to as PAM16 (presequence translocase-associated motor 16, is a mitochondria-associated protein involved in preprotein translocation into the matrix. We show that MAGMAS is specifically expressed in trabecular bone and cartilage at early developmental stages and that the mutation leads to an instability of the protein. We further demonstrate that the mutation described here confers to yeast strains a temperature-sensitive phenotype, impairs the import of mitochondrial matrix pre-proteins and induces cell death. The finding of deleterious MAGMAS mutations in an early lethal skeletal dysplasia supports a key role for this mitochondrial protein in the ossification process.

  14. Cognitive impairment and antiretroviral treatment in a Peruvian population of patients with human immunodeficiency virus.

    Science.gov (United States)

    Guevara-Silva, E A

    2014-05-01

    HIV-associated cognitive impairment occurs even in the early stages of infection. Short-term memory, psychomotor speed, attention, and executive functioning are the main capacities affected. Controversy exists regarding whether highly active antiretroviral therapy (HAART) is helpful in combating this process. The objective of the present study is to determine the association between cognitive impairment and HAART in HIV-infected patients from Hospital Regional de Huacho. Prospective study of HIV patients meeting criteria to start HAART. Twenty-one HIV-positive patients were recruited between April and July 2011. Researchers administered a standardised neuropsychological test battery before and 4 weeks after onset of HAART. Psychomotor speed, executive function, short term memory (visual and verbal), attention, and visuospatial performance were evaluated. Nineteen patients completed the study (14 males and 5 females). In the pre-HAART evaluation, most patients scored below average on the executive function and psychomotor speed subtests. Psychomotor speed and immediate visual memory improved significantly after four months of treatment with HAART. Some degree of cognitive decline may present even in the early and asymptomatic stages of HIV infection. The benefits of antiretroviral treatment for cognitive performance can be detected after only a few weeks of follow-up. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  15. Are patients with schizophrenia impaired in processing non-emotional features of human faces?

    Directory of Open Access Journals (Sweden)

    Hayley eDarke

    2013-08-01

    Full Text Available It is known that individuals with schizophrenia exhibit signs of impaired face processing, however, the exact perceptual and cognitive mechanisms underlying these deficits are yet to be elucidated. One possible source of confusion in the current literature is the methodological and conceptual inconsistencies that can arise from the varied treatment of different aspects of face processing relating to emotional and non-emotional aspects of face perception. This review aims to disentangle the literature by focusing on the performance of patients with schizophrenia in a range of tasks that required processing of non-emotional features of face stimuli (e.g. identity or gender. We also consider the performance of patients on non-face stimuli that share common elements such as familiarity (e.g. cars and social relevance (e.g. gait. We conclude by exploring whether observed deficits are best considered as face-specific and note that further investigation is required to properly assess the potential contribution of more generalised attentional or perceptual impairments.

  16. Activation of PPAR{gamma} by Human Cytomegalovirus for de novo Replication Impairs Migration and Invasiveness of Cytotrophoblast from Early Placenta

    DEFF Research Database (Denmark)

    Rauwel, Benjamin; Mariamé, Bernard; Martin, Hélène

    2010-01-01

    , as assessed by using well-established in vitro models of invasive trophoblast i.e. primary cultures of EVCT isolated from first trimester placentas and the EVCT-derived cell line HIPEC. Our data provide new clues to explain how early infection during pregnancy could impair implantation, placentation...... and chromatin immunoprecipitation assays. Due to the key role of PPARgamma in placentation and its specific trophoblast expression within the human placenta, we then provided evidence that by activating PPARgamma human cytomegalovirus dramatically impaired early human trophoblast migration and invasiveness...

  17. Development of sampling method and chromatographic analysis of volatile organic compounds emitted from human skin.

    Science.gov (United States)

    Grabowska-Polanowska, Beata; Miarka, Przemysław; Skowron, Monika; Sułowicz, Joanna; Wojtyna, Katarzyna; Moskal, Karolina; Śliwka, Ireneusz

    2017-10-01

    The studies on volatile organic compounds emitted from skin are an interest for chemists, biologists and physicians due to their role in development of different scientific areas, including medical diagnostics, forensic medicine and the perfume design. This paper presents a proposal of two sampling methods applied to skin odor collection: the first one uses a bag of cellulose film, the second one, using cellulose sachets filled with active carbon. Volatile organic compounds were adsorbed on carbon sorbent, removed via thermal desorption and analyzed using gas chromatograph with mass spectrometer. The first sampling method allowed identification of more compounds (52) comparing to the second one (30). Quantitative analyses for acetone, butanal, pentanal and hexanal were done. The skin odor sampling method using a bag of cellulose film, allowed the identification of many more compounds when compared with the method using a sachet filled with active carbon.

  18. Factors that influence the volatile organic compound content in human breath

    NARCIS (Netherlands)

    Blanchet, L.; Smolinska, Agnieszka; Baranska, Agnieszka; Tigchelaar-Feenstra, E.; Swertz, M.; Zhernakova, A.; Dallinga, J. W.; Wijmenga, C.; van Schooten, Frederik J.

    Background. Thousands of endogenous and exogenous volatile organic compounds (VOCs) are excreted in each breath. Inflammatory and deviant metabolic processes affect the level of endogeneous VOCs, which can serve as specific biomarkers for clinical diagnosis and disease monitoring. Important issues

  19. An electroconvulsive therapy procedure impairs reconsolidation of episodic memories in humans

    NARCIS (Netherlands)

    Kroes, Marijn C. W.; Tendolkar, Indira; van Wingen, Guido A.; van Waarde, Jeroen A.; Strange, Bryan A.; Fernández, Guillén

    2014-01-01

    Despite accumulating evidence for a reconsolidation process in animals, support in humans, especially for episodic memory, is limited. Using a within-subjects manipulation, we found that a single application of electroconvulsive therapy following memory reactivation in patients with unipolar

  20. Connexin 43 expression in human and mouse testes with impaired spermatogenesis

    Directory of Open Access Journals (Sweden)

    M Kotula-Balak

    2009-08-01

    Full Text Available Connexin 43 (Cx43 belongs to a family of proteins that form gap junction channels. The aim of this study was to examine the expression of Cx43 in the testis of a patient with Klinefelter’s syndrome and of mice with the mosaic mutation and a partial deletion in the long arm of the Y chromosome. These genetic disorders are characterized by the presence of numerous degenerated seminiferous tubules and impaired spermatogenesis. In mouse testes, the expression and presence of Cx43 were detected by means of immunohistochemistry and Western blot analysis, respectively. In testes of Klinefelter’s patient only immunoexpression of Cx43 was detected. Regardless of the species Cx43 protein was ubiquitously distributed in testes of reproductively normal males, whereas in those with testicular disorders either a weak intensity of staining or no staining within the seminiferous tubules was observed. Moderate to strong or very strong staining was confined to the interstitial tissue. In an immunoblot analysis of testicular homogenates Cx43 appeared as one major band of approximately 43 kDa. Our study adds three more examples of pathological gonads in which the absence or apparent decrease of Cx43 expression within the seminiferous tubules was found. A positive correlation between severe spermatogenic impairment and loss of Cx43 immunoreactivity observed in this study supports previous data that gap junctions play a crucial role in spermatogenesis. Strong Cx43 expression detected mostly in the interstitial tissue of the Klinefelter’s patient may presumably be of importance in sustaining Leydig cell metabolic activity. However, the role of gap junction communication in the control of Leydig cell function seems to be more complex than originally thought.

  1. Interleukin-6 induces impairment in human subcutaneous adipogenesis in obesity-associated insulin resistance.

    Science.gov (United States)

    Almuraikhy, Shamma; Kafienah, Wael; Bashah, Moataz; Diboun, Ilhame; Jaganjac, Morana; Al-Khelaifi, Fatima; Abdesselem, Houari; Mazloum, Nayef A; Alsayrafi, Mohammed; Mohamed-Ali, Vidya; Elrayess, Mohamed A

    2016-11-01

    A subset of obese individuals remains insulin sensitive by mechanisms as yet unclear. The hypothesis that maintenance of normal subcutaneous (SC) adipogenesis accounts, at least partially, for this protective phenotype and whether it can be abrogated by chronic exposure to IL-6 was investigated. Adipose tissue biopsies were collected from insulin-sensitive (IS) and insulin-resistant (IR) individuals undergoing weight-reduction surgery. Adipocyte size, pre-adipocyte proportion of stromal vascular fraction (SVF)-derived cells, adipogenic capacity and gene expression profiles of isolated pre-adipocytes were determined, along with local in vitro IL-6 secretion. Adipogenic capacity was further assessed in response to exogenous IL-6 application. Despite being equally obese, IR individuals had significantly lower plasma leptin and adiponectin levels and higher IL-6 levels compared with age-matched IS counterparts. Elevated systemic IL-6 in IR individuals was associated with hyperplasia of adipose tissue-derived SVF cells, despite higher frequency of hypertrophied adipocytes. SC pre-adipocytes from these tissues exhibited lower adipogenic capacity accompanied by downregulation of PPARγ (also known as PPARG) and CEBPα (also known as CEBPA) and upregulation of GATA3 expression. Impaired adipogenesis in IR individuals was further associated with increased adipose secretion of IL-6. Treatment of IS-derived SC pre-adipocytes with IL-6 reduced their adipogenic capacity to levels of the IR group. Obesity-associated insulin resistance is marked by impaired SC adipogenesis, mediated, at least in a subset of individuals, by elevated local levels of IL-6. Understanding the molecular mechanisms underlying reduced adipogenic capacity in IR individuals could help target appropriate therapeutic strategies aimed at those at greatest risk of insulin resistance and type 2 diabetes mellitus.

  2. Human computer interaction and communication aids for hearing-impaired, deaf and deaf-blind people: Introduction to the special thematic session

    DEFF Research Database (Denmark)

    Bothe, Hans-Heinrich

    2008-01-01

    This paper gives ail overview and extends the Special Thematic Session (STS) oil research and development of technologies for hearing-impaired, deaf, and deaf-blind people. The topics of the session focus oil special equipment or services to improve communication and human computer interaction....... The papers are related to visual communication using captions, sign language, speech-reading, to vibro-tactile stimulation, or to general services for hearing-impaired persons....

  3. Compound K, a metabolite of ginseng saponin, induces apoptosis via caspase-8-dependent pathway in HL-60 human leukemia cells

    Directory of Open Access Journals (Sweden)

    Choi Jung-Hye

    2009-12-01

    Full Text Available Abstract Background Compound K [20-O-β-(D-glucopyranosyl-20(S-protopanaxadiol], a metabolite of the protopanaxadiol-type saponins of Panax ginseng C.A. Meyer, has been reported to possess anti-tumor properties to inhibit angiogenesis and to induce tumor apoptosis. In the present study, we investigated the effect of Compound K on apoptosis and explored the underlying mechanisms involved in HL-60 human leukemia cells. Methods We examined the effect of Compound K on the viabilities of various cancer cell lines using MTT assays. DAPI assay, Annexin V and PI double staining, Western blot assay and immunoprecipitation were used to determine the effect of Compound K on the induction of apoptosis. Results Compound K was found to inhibit the viability of HL-60 cells in a dose- and time-dependent manner with an IC50 of 14 μM. Moreover, this cell death had typical features of apoptosis, that is, DNA fragmentation, DNA ladder formation, and the externalization of Annexin V targeted phosphatidylserine residues in HL-60 cells. In addition, compound-K induced a series of intracellular events associated with both the mitochondrial- and death receptor-dependent apoptotic pathways, namely, (1 the activation of caspases-3, -8, and -9; (2 the loss of mitochondrial membrane potential; (3 the release of cytochrome c and Smac/DIABLO to the cytosol; (4 the translocation of Bid and Bax to mitochondria; and (5 the downregulations of Bcl-2 and Bcl-xL. Furthermore, a caspase-8 inhibitor completely abolished caspase-3 activation, Bid cleavage, and subsequent DNA fragmentation by Compound K. Interestingly, the activation of caspase-3 and -8 and DNA fragmentation were significantly prevented in the presence of cycloheximide, suggesting that Compound K-induced apoptosis is dependent on de novo protein synthesis. Conclusions The results indicate that caspase-8 plays a key role in Compound K-stimulated apoptosis via the activation of caspase-3 directly or indirectly through

  4. Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

    Science.gov (United States)

    Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

    2016-01-01

    Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment. PMID:26775677

  5. Human Platelet-Rich Plasma- and Extracellular Matrix-Derived Peptides Promote Impaired Cutaneous Wound Healing In Vivo

    Science.gov (United States)

    Demidova-Rice, Tatiana N.; Wolf, Lindsey; Deckenback, Jeffry; Hamblin, Michael R.; Herman, Ira M.

    2012-01-01

    Previous work in our laboratory has described several pro-angiogenic short peptides derived from endothelial extracellular matrices degraded by bacterial collagenase. Here we tested whether these peptides could stimulate wound healing in vivo. Our experiments demonstrated that a peptide created as combination of fragments of tenascin X and fibrillin 1 (comb1) applied into cranial dermal wounds created in mice treated with cyclophosphamide to impair wound healing, can improve the rate of wound closure. Furthermore, we identify and characterize a novel peptide (UN3) created and modified from two naturally-occurring peptides, which are present in human platelet-rich plasma. In vitro testing of UN3 demonstrates that it causes a 50% increase in endothelial proliferation, 250% increase in angiogenic response and a tripling of epithelial cell migration in response to injury. Results of in vivo experiments where comb1 and UN3 peptides were added together to cranial wounds in cyclophosphamide-treated mice leads to improvement of wound vascularization as shown by an increase of the number of blood vessels present in the wound beds. Application of the peptides markedly promotes cellular responses to injury and essentially restores wound healing dynamics to those of normal, acute wounds in the absence of cyclophosphamide impairment. Our current work is aimed at understanding the mechanisms underlying the stimulatory effects of these peptides as well as identification of the cellular receptors mediating these effects. PMID:22384158

  6. Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells.

    Science.gov (United States)

    Sonoda, Soichiro; Yamaza, Haruyoshi; Ma, Lan; Tanaka, Yosuke; Tomoda, Erika; Aijima, Reona; Nonaka, Kazuaki; Kukita, Toshio; Shi, Songtao; Nishimura, Fusanori; Yamaza, Takayoshi

    2016-01-18

    Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we examined the stem cell potency of IP-DPSCs. In comparison with healthy DPSCs, IP-DPSCs expressed lower colony-forming capacity, population-doubling rate, cell proliferation, multipotency, in vivo dentin regeneration, and immunosuppressive activity, suggesting that intact IP-DPSCs may be inadequate for dentin/pulp regeneration. Therefore, we attempted to improve the impaired in vivo dentin regeneration and in vitro immunosuppressive functions of IP-DPSCs to enable dentin/pulp regeneration. Interferon gamma (IFN-γ) treatment enhanced in vivo dentin regeneration and in vitro T cell suppression of IP-DPSCs, whereas treatment with tumor necrosis factor alpha did not. Therefore, these findings suggest that IFN-γ may be a feasible modulator to improve the functions of impaired IP-DPSCs, suggesting that autologous transplantation of IFN-γ-accelerated IP-DPSCs might be a promising new therapeutic strategy for dentin/pulp tissue engineering in future endodontic treatment.

  7. Expression of human PQBP-1 in Drosophila impairs long-term memory and induces abnormal courtship.

    Science.gov (United States)

    Yoshimura, Natsue; Horiuchi, Daisuke; Shibata, Masao; Saitoe, Minoru; Qi, Mei-Ling; Okazawa, Hitoshi

    2006-04-17

    Frame shift mutations of the polyglutamine binding protein-1 (PQBP1) gene lead to total or partial truncation of the C-terminal domain (CTD) and cause mental retardation in human patients. Interestingly, normal Drosophila homologue of PQBP-1 lacks CTD. As a model to analyze the molecular network of PQBP-1 affecting intelligence, we generated transgenic flies expressing human PQBP-1 with CTD. Pavlovian olfactory conditioning revealed that the transgenic flies showed disturbance of long-term memory. In addition, they showed abnormal courtship that male flies follow male flies. Abnormal functions of PQBP-1 or its binding partner might be linked to these symptoms.

  8. Interactions between wine phenolic compounds and human saliva in astringency perception.

    Science.gov (United States)

    García-Estévez, Ignacio; Ramos-Pineda, Alba María; Escribano-Bailón, María Teresa

    2018-03-01

    Astringency is a complex perceptual phenomenon involving several sensations that are perceived simultaneously. The mechanism leading to these sensations has been thoroughly and controversially discussed in the literature and it is still not well understood since there are many contributing factors. Although we are still far from elucidating the mechanisms whereby astringency develops, the interaction between phenolic compounds and proteins (from saliva, oral mucosa or cells) seems to be most important. This review summarizes the recent trends in the protein-phenol interaction, focusing on the effect of the structure of the phenolic compound on the interaction with salivary proteins and on methodologies based on these interactions to determine astringency.

  9. Treatment with 1,25-dihydroxyvitamin D3 reduces impairment of human osteoblast functions during cellular aging in culture

    DEFF Research Database (Denmark)

    Kveiborg, M.; Rattan, Suresh; Eriksen, E.F.

    2001-01-01

    is due to impaired responsiveness to calcitriol known to be important for the regulation of biological activities of the osteoblasts. Thus, we examined changes in vitamin D receptor (VDR) system and the osteoblastic responses to calcitriol treatment during in vitro osteoblast aging. We found no change...... in the amount of VDR at either steady state mRNA level or protein level with increasing in vitro osteoblast age and examination of VDR localization, nuclear translocation and DNA binding activity revealed no in vitro age-related changes. Furthermore, calcitriol (10(-8)M) treatment of early-passage osteoblastic......Adequate responses to various hormones, such as 1,25-dihydroxyvitamin D(3) (calcitriol) are a prerequisite for optimal osteoblast functions. We have previously characterized several human diploid osteoblastic cell lines that exhibit typical in vitro aging characteristics during long...

  10. High Uric Acid Activates the ROS-AMPK Pathway, Impairs CD68 Expression and Inhibits OxLDL-Induced Foam-Cell Formation in a Human Monocytic Cell Line, THP-1

    Directory of Open Access Journals (Sweden)

    Chaohuan Luo

    2016-11-01

    Full Text Available Background/Aims: Hyperuricemia is part of the metabolic-syndrome cluster of abdominal obesity, impaired glucose tolerance, insulin resistance, dyslipidemia, and hypertension. Monocytes/macrophages are critical in the development of metabolic syndrome, including gout, obesity and atherosclerosis. However, how high uric acid (HUA exposure affects monocyte/macrophage function remains unclear. In this study, we investigated the molecular mechanism of HUA exposure in monocytes/macrophages and its impact on oxidized low-density lipoprotein (oxLDL-induced foam-cell formation in a human monocytic cell line, THP-1. Methods: We primed THP-1 cells with phorbol-12-myristate-13-acetate (PMA for differentiation, then exposed cells to HUA and detected the production of reactive oxygen species (ROS and analyzed the level of phospho-AMPKα. THP-1 cells were pre-incubated with Compound C, an AMPK inhibitor, or N-acetyl-L-cysteine (NAC, a ROS scavenger, or HUA before PMA, to assess CD68 expression and phospho-AMPKα level. PMA-primed THP-1 cells were pre-treated with oxLDL before Compound C and HUA treatment. Western blot analysis was used to examine the levels of phospho-AMPKα, CD68, ABCG1, ABCA1, cyclooxygenase-2 (COX-2 and NF-κB (p65. Flow cytometry was used to assess ROS production and CD68 expression in live cells. Oil-red O staining was used to observe oxLDL uptake in cells. Results: HUA treatment increased ROS production in PMA-primed THP-1 cells; NAC blocked HUA-induced oxidative stress. HUA treatment time-dependently increased phospho-AMPKα level in PMA-primed THP-1 cells. The HUA-induced oxidative stress increased phospho-AMPKα levels, which was blocked by NAC. HUA treatment impaired CD68 expression during cell differentiation by activating the AMPK pathway, which was reversed by Compound C treatment. Finally, HUA treatment inhibited oxLDL uptake in the formation of foam cells in THP-1 cells, which was blocked by Compound C treatment. HUA treatment

  11. Humane Education for Students with Visual Impairments: Learning about Working Dogs

    Science.gov (United States)

    Bruce, Susan M.; Feinstein, Jennie Dapice; Kennedy, Meghan C.; Liu, Ming

    2015-01-01

    Introduction: This study examined the effect of an animal-assisted humane education course on the knowledge of students about caring for dogs physically and psychologically and making informed decisions about dog ownership, including working dogs. Method: This collaborative action-research study employed case study design to examine the effect of…

  12. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  13. Thrombin impairs human endometrial endothelial angiogenesis; implications for progestin-only contraceptive-induced abnormal uterine bleeding.

    Science.gov (United States)

    Shapiro, John P; Guzeloglu-Kayisli, Ozlem; Kayisli, Umit A; Semerci, Nihan; Huang, S Joseph; Arlier, Sefa; Larsen, Kellie; Fadda, Paolo; Schatz, Frederick; Lockwood, Charles J

    2017-06-01

    Progestin-only contraceptives induce abnormal uterine bleeding, accompanied by prothrombin leakage from dilated endometrial microvessels and increased thrombin generation by human endometrial stromal cell (HESC)-expressed tissue factor. Initial studies of the thrombin-treated HESC secretome identified elevated levels of cleaved chondroitin sulfate proteoglycan 4 (CSPG4), impairing pericyte-endothelial interactions. Thus, we investigated direct and CSPG4-mediated effects of thrombin in eliciting abnormal uterine bleeding by disrupting endometrial angiogenesis. Liquid chromatography/tandem mass spectrometry, enzyme-linked immunosorbent assay (ELISA) and quantitative real-time-polymerase chain reaction (PCR) evaluated conditioned medium supernatant and cell lysates from control versus thrombin-treated HESCs. Pre- and post-Depo medroxyprogesterone acetate (DMPA)-administered endometria were immunostained for CSPG4. Proliferation, apoptosis and tube formation were assessed in human endometrial endothelial cells (HEECs) incubated with recombinant human (rh)-CSPG4 or thrombin or both. Thrombin induced CSPG4 protein expression in cultured HESCs as detected by mass spectrometry and ELISA (pabnormal uterine bleeding in DMPA users. Mass spectrometry analysis identified several HESC-secreted proteins regulated by thrombin. Therapeutic agents blocking angiogenic effects of thrombin in HESCs can prevent or minimize progestin-only contraceptive-induced abnormal uterine bleeding. Copyright © 2017. Published by Elsevier Inc.

  14. Possible additional exposure to dioxin and dioxin-like compounds from waste incineration. Biomonitoring using human milk and animal samples

    Energy Technology Data Exchange (ETDEWEB)

    Sampaio, C.; M. Fatima Reis; J. Pereira Miguel [Inst. of Preventive Medicine, Univ. of Lisbon (Portugal); Murk, A. [Wageningen Univ., Dept. of Toxicology (Netherlands)

    2004-09-15

    In the ambit of an Environmental Health Survey Program relative to a MSW facility, which has been operating near to Lisbon since 1999 a biomonitoring study using human breast milk has been performed. Specific aims of this study were: (1) determine whether living in the vicinity of the incinerator increases dioxin maternal body burden and accordingly perinatal (intra-uterus and lactacional) exposure; (2) to investigate the possibility of increased human exposure to dioxins and dioxin-like compounds via locally produced food items from animal origin. Therefore, levels of dioxins and dioxin-like compounds have been determined in human milk samples collected in the vicinity of the incinerator and in a control area, for comparison. From the same areas, cow and sheep milk and eggs from free-range chickens have also been collected to get an indication of possible local additional exposure to air-borne dioxins via the food chain. Analyses of TCDD-equivalents (TEQs) were mainly performed with a reporter gene assay for dioxin-like activity, the DR-CALUX bioassay (Dioxin Responsive Chemical Activated LUciferase gene eXpression).To determine congeners profile, some human milk samples have also been analysed for PCDD/Fs and relevant dioxin-like PCBs, by using high-resolution gas chromatography and high-resolution mass spectrometry (HRGC/HRMS). Both the Ethics Committees of the Faculty of Medicine, University of Lisbon, and of the Maternity Dr. Alfredo da Costa have approved the study protocol.

  15. Characterization of Calcium Compounds in Opuntia ficus indica as a Source of Calcium for Human Diet

    Directory of Open Access Journals (Sweden)

    Isela Rojas-Molina

    2015-01-01

    Full Text Available Analyses of calcium compounds in cladodes, soluble dietary fiber (SDF, and insoluble dietary fiber (IDF of Opuntia ficus indica are reported. The characterization of calcium compounds was performed by using Scanning Electron Microscopy, Energy Dispersive Spectrometry, X-ray diffraction, and infrared spectroscopy. Atomic Absorption Spectroscopy and titrimetric methods were used for quantification of total calcium and calcium compounds. Whewellite (CaC2O4·H2O, weddellite (CaC2O4·(H2O2.375, and calcite (CaCO3 were identified in all samples. Significant differences (P≤0.05 in the total calcium contents were detected between samples. CaC2O4·H2O content in cladodes and IDF was significantly higher (P≤0.05 in comparison to that observed in SDF, whereas minimum concentration of CaCO3 was detected in IDF with regard to CaCO3 contents observed in cladodes and SDF. Additionally, molar ratio oxalate : Ca2+ in all samples changed in a range from 0.03 to 0.23. These results support that calcium bioavailability in O. ficus indica modifies according to calcium compounds distribution.

  16. 78 FR 72897 - Draft Guidance for Industry on Interim Product Reporting for Human Drug Compounding Outsourcing...

    Science.gov (United States)

    2013-12-04

    ... reporting of product information by registered outsourcing facilities under section 503B of the FD&C Act... collection techniques, when appropriate, and other forms of information technology. Under the draft guidance... report should include the following information for all drugs compounded by the outsourcing facility...

  17. Characterization of the apoptotic response of human leukemia cells to organosulfur compounds

    International Nuclear Information System (INIS)

    Wong, W Wei-Lynn; Langler, Richard F; Penn, Linda Z; Boutros, Paul C; Wasylishen, Amanda R; Guckert, Kristal D; O'Brien, Erin M; Griffiths, Rebecca; Martirosyan, Anna R; Bros, Christina; Jurisica, Igor

    2010-01-01

    Novel therapeutic agents that selectively induce tumor cell death are urgently needed in the clinical management of cancers. Such agents would constitute effective adjuvant approaches to traditional chemotherapy regimens. Organosulfur compounds (OSCs), such as diallyl disulfide, have demonstrated anti-proliferative effects on cancer cells. We have previously shown that synthesized relatives of dysoxysulfone, a natural OSC derived from the Fijian medicinal plant, Dysoxylum richi, possess tumor-specific antiproliferative effects and are thus promising lead candidates. Because our structure-activity analyses showed that regions flanking the disulfide bond mediated specificity, we synthesized 18 novel OSCs by structural modification of the most promising dysoxysulfone derivatives. These compounds were tested for anti-proliferative and apoptotic activity in both normal and leukemic cells. Six OSCs exhibited tumor-specific killing, having no effect on normal bone marrow, and are thus candidates for future toxicity studies. We then employed mRNA expression profiling to characterize the mechanisms by which different OSCs induce apoptosis. Using Gene Ontology analysis we show that each OSC altered a unique set of pathways, and that these differences could be partially rationalized from a transcription factor binding site analysis. For example, five compounds altered genes with a large enrichment of p53 binding sites in their promoter regions (p < 0.0001). Taken together, these data establish OSCs derivatized from dysoxysulfone as a novel group of compounds for development as anti-cancer agents

  18. Impaired IFNγ-Signaling and Mycobacterial Clearance in IFNγR1-Deficient Human iPSC-Derived Macrophages

    Directory of Open Access Journals (Sweden)

    Anna-Lena Neehus

    2018-01-01

    Full Text Available Mendelian susceptibility to mycobacterial disease (MSMD is caused by inborn errors of interferon gamma (IFNγ immunity and is characterized by severe infections by weakly virulent mycobacteria. Although IFNγ is the macrophage-activating factor, macrophages from these patients have never been studied. We demonstrate the generation of heterozygous and compound heterozygous (iMSMD-cohet induced pluripotent stem cells (iPSCs from a single chimeric patient, who suffered from complete autosomal recessive IFNγR1 deficiency and received bone-marrow transplantation. Loss of IFNγR1 expression had no influence on the macrophage differentiation potential of patient-specific iPSCs. In contrast, lack of IFNγR1 in iMSMD-cohet macrophages abolished IFNγ-dependent phosphorylation of STAT1 and induction of IFNγ-downstream targets such as IRF-1, SOCS-3, and IDO. As a consequence, iMSMD-cohet macrophages show impaired upregulation of HLA-DR and reduced intracellular killing of Bacillus Calmette-Guérin. We provide a disease-modeling platform that might be suited to investigate novel treatment options for MSMD and to gain insights into IFNγ signaling in macrophages.

  19. Impaired IFNγ-Signaling and Mycobacterial Clearance in IFNγR1-Deficient Human iPSC-Derived Macrophages.

    Science.gov (United States)

    Neehus, Anna-Lena; Lam, Jenny; Haake, Kathrin; Merkert, Sylvia; Schmidt, Nico; Mucci, Adele; Ackermann, Mania; Schubert, Madline; Happle, Christine; Kühnel, Mark Philipp; Blank, Patrick; Philipp, Friederike; Goethe, Ralph; Jonigk, Danny; Martin, Ulrich; Kalinke, Ulrich; Baumann, Ulrich; Schambach, Axel; Roesler, Joachim; Lachmann, Nico

    2018-01-09

    Mendelian susceptibility to mycobacterial disease (MSMD) is caused by inborn errors of interferon gamma (IFNγ) immunity and is characterized by severe infections by weakly virulent mycobacteria. Although IFNγ is the macrophage-activating factor, macrophages from these patients have never been studied. We demonstrate the generation of heterozygous and compound heterozygous (iMSMD-cohet) induced pluripotent stem cells (iPSCs) from a single chimeric patient, who suffered from complete autosomal recessive IFNγR1 deficiency and received bone-marrow transplantation. Loss of IFNγR1 expression had no influence on the macrophage differentiation potential of patient-specific iPSCs. In contrast, lack of IFNγR1 in iMSMD-cohet macrophages abolished IFNγ-dependent phosphorylation of STAT1 and induction of IFNγ-downstream targets such as IRF-1, SOCS-3, and IDO. As a consequence, iMSMD-cohet macrophages show impaired upregulation of HLA-DR and reduced intracellular killing of Bacillus Calmette-Guérin. We provide a disease-modeling platform that might be suited to investigate novel treatment options for MSMD and to gain insights into IFNγ signaling in macrophages. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Task-specific impairments and enhancements induced by magnetic stimulation of human visual area V5.

    OpenAIRE

    Walsh, V; Ellison, A; Battelli, L; Cowey, A

    1998-01-01

    Transcranial magnetic stimulation (TMS) can be used to simulate the effects of highly circumscribed brain damage permanently present in some neuropsychological patients, by reversibly disrupting the normal functioning of the cortical area to which it is applied. By using TMS we attempted to recreate deficits similar to those reported in a motion-blind patient and to assess the specificity of deficits when TMS is applied over human area V5. We used six visual search tasks and showed that subje...

  1. Impaired IGF1R signaling in cells expressing longevity-associated human IGF1R alleles

    OpenAIRE

    Tazearslan, Cagdas; Huang, Jing; Barzilai, Nir; Suh, Yousin

    2011-01-01

    Dampening of insulin/insulin like growth factor-1 (IGF1) signaling results in extension of lifespan in invertebrate as well as murine models. The impact of this evolutionarily conserved pathway on modulation of human lifespan remains unclear. We previously identified two IGF1R mutations (Ala-37-Thr and Arg-407-His) that are enriched in Ashkenazi Jewish centenarians as compared to younger controls and are associated with reduced activity of the IGF1 receptor as measured in immortalized lymphoc...

  2. Language Impairments in ASD Resulting from a Failed Domestication of the Human Brain

    Science.gov (United States)

    Benítez-Burraco, Antonio; Lattanzi, Wanda; Murphy, Elliot

    2016-01-01

    Autism spectrum disorders (ASD) are pervasive neurodevelopmental disorders entailing social and cognitive deficits, including marked problems with language. Numerous genes have been associated with ASD, but it is unclear how language deficits arise from gene mutation or dysregulation. It is also unclear why ASD shows such high prevalence within human populations. Interestingly, the emergence of a modern faculty of language has been hypothesized to be linked to changes in the human brain/skull, but also to the process of self-domestication of the human species. It is our intention to show that people with ASD exhibit less marked domesticated traits at the morphological, physiological, and behavioral levels. We also discuss many ASD candidates represented among the genes known to be involved in the “domestication syndrome” (the constellation of traits exhibited by domesticated mammals, which seemingly results from the hypofunction of the neural crest) and among the set of genes involved in language function closely connected to them. Moreover, many of these genes show altered expression profiles in the brain of autists. In addition, some candidates for domestication and language-readiness show the same expression profile in people with ASD and chimps in different brain areas involved in language processing. Similarities regarding the brain oscillatory behavior of these areas can be expected too. We conclude that ASD may represent an abnormal ontogenetic itinerary for the human faculty of language resulting in part from changes in genes important for the “domestication syndrome” and, ultimately, from the normal functioning of the neural crest. PMID:27621700

  3. Determination of total and methylmercury compounds in the IAEA human hair intercomparison samples - Experience of the IAEA-MEL

    International Nuclear Information System (INIS)

    Horvat, M.; Liang, L.; Mandic, V.

    1995-01-01

    The programme of this CRP is focused on the analyses of human hair samples. There are only two human hair samples certified for total mercury, and no RMs for methylmercury compounds is available. One of the main objectives of this CRP is to produce, through the IAEA AQCS Programme, a human hair intercomparison material for quality assurance requirements in population monitoring programmes for total and methylmercury exposure. Through the reporting period, MESL has introduced a new method for simultaneous determination of total and methylmercury in biological samples. As the laboratory has close collaboration with the CRP's Reference Laboratory in Ljubljana, Slovenia, it has also been actively involved in the quality assurance component of this CRP. This report represents a summary on the results for total and methylmercury in two intercomparison samples, IAEA-085 and IAEA-086 using newly developed method

  4. Impaired insulin action in the human brain: causes and metabolic consequences.

    Science.gov (United States)

    Heni, Martin; Kullmann, Stephanie; Preissl, Hubert; Fritsche, Andreas; Häring, Hans-Ulrich

    2015-12-01

    Over the past few years, evidence has accumulated that the human brain is an insulin-sensitive organ. Insulin regulates activity in a limited number of specific brain areas that are important for memory, reward, eating behaviour and the regulation of whole-body metabolism. Accordingly, insulin in the brain modulates cognition, food intake and body weight as well as whole-body glucose, energy and lipid metabolism. However, brain imaging studies have revealed that not everybody responds equally to insulin and that a substantial number of people are brain insulin resistant. In this Review, we provide an overview of the effects of insulin in the brain in humans and the relevance of the effects for physiology. We present emerging evidence for insulin resistance of the human brain. Factors associated with brain insulin resistance such as obesity and increasing age, as well as possible pathogenic factors such as visceral fat, saturated fatty acids, alterations at the blood-brain barrier and certain genetic polymorphisms, are reviewed. In particular, the metabolic consequences of brain insulin resistance are discussed and possible future approaches to overcome brain insulin resistance and thereby prevent or treat obesity and type 2 diabetes mellitus are outlined.

  5. Multifaceted processes controlling the distribution of hazardous compounds in the spontaneous combustion of coal and the effect of these compounds on human health.

    Science.gov (United States)

    Oliveira, Marcos L S; da Boit, Kátia; Pacheco, Fernanda; Teixeira, Elba C; Schneider, Ismael L; Crissien, Tito J; Pinto, Diana C; Oyaga, Rafael M; Silva, Luis F O

    2018-01-01

    Pollution generated by hazardous elements and persistent organic compounds that affect coal fire is a major environmental concern because of its toxic nature, persistence, and potential risk to human health. The coal mining activities are growing in the state of Santa Catarina in Brazil, thus the collateral impacts on the health and economy are yet to be analyzed. In addition, the environment is also enduring the collateral damage as the waste materials directly influence the coal by-products applied in civil constructions. This study was aimed to establish the relationships between the composition, morphology, and structural characteristics of ultrafine particles emitted by coal mine fires. In Brazil, the self-combustions produced by Al-Ca-Fe-Mg-Si coal spheres are rich in chalcophile elements (As, Cd, Cu, Hg, Pb, Sb, Se, Sn, and Zn), lithophile elements (Ce, Hf, In, La, Th, and U), and siderophile elements (Co, Cr, Mo, Fe, Ni, and V). The relationship between nanomineralogy and the production of hazardous elements as analyzed by advanced methods for the geochemical analysis of different materials were also delineated. The information obtained by the mineral substance analysis may provide a better idea for the understanding of coal-fire development and assessing the response of particular coal in different combustion processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Simplified fate modelling in respect to ecotoxicological and human toxicological characterisation of emissions of chemical compounds

    DEFF Research Database (Denmark)

    Birkved, Morten; Heijungs, Reinout

    2011-01-01

    The impact assessment of chemical compounds in Life Cycle Impact Assessment (LCIA) and Environmental Risk Assessment (ERA) requires a vast amount of data on the properties of the chemical compounds being assessed. The purpose of the present study is to explore statistical options for reduction...... of the data demand associated with characterisation of chemical emissions in LCIA and ERA.Based on a USEtox™ characterisation factor set consisting of 3,073 data records, multi-dimensional bilinear models for emission compartment specific fate characterisation of chemical emissions were derived by application...... the independent chemical input parameters from the minimum data set, needed for characterisation in USEtox™, according to general availability, importance and relevance for fate factor prediction.Each approach (63% and 75% of the minimum data set needed for characterisation in USEtox™) yielded 66 meta...

  7. Modeling Human Exposure Levels to Airborne Volatile Organic Compounds by the Hebei Spirit Oil Spill

    OpenAIRE

    Kim, Jong Ho; Kwak, Byoung Kyu; Ha, Mina; Cheong, Hae-Kwan; Yi, Jongheop

    2012-01-01

    Objectives The goal was to model and quantify the atmospheric concentrations of volatile organic compounds (VOCs) as the result of the Hebei Spirit oil spill, and to predict whether the exposure levels were abnormally high or not. Methods We developed a model for calculating the airborne concentration of VOCs that are produced in an oil spill accident. The model was applied to a practical situation, namely the Hebei Spirit oil spill. The accuracy of the model was verified by comparing the res...

  8. Effects of selected bioactive food compounds on human white adipocyte function

    DEFF Research Database (Denmark)

    Björk, Christel; Wilhelm, Uta; Mandrup, Susanne

    2016-01-01

    BACKGROUND: Previous studies suggest that intake of specific bioactive compounds may have beneficial clinical effects on adipose tissue partly due to their anti-inflammatory and insulin-sensitizing properties. With the overall aim to contribute to better understanding of the mechanisms of selecte...... uptake albeit only with the combination of DHA and AC. Taken together, our results may link the reported health benefits of the selected bioactives on metabolic disorders such as insulin resistance, hypertension and dyslipidemia to effects on white adipocytes....

  9. Phenolic Compounds in Extra Virgin Olive Oil Stimulate Human Osteoblastic Cell Proliferation

    Science.gov (United States)

    García-Martínez, Olga; De Luna-Bertos, Elvira; Ramos-Torrecillas, Javier; Ruiz, Concepción; Milia, Egle; Lorenzo, María Luisa; Jimenez, Brigida; Sánchez-Ortiz, Araceli; Rivas, Ana

    2016-01-01

    In this study, we aimed to clarify the effects of phenolic compounds and extracts from different extra virgin olive oil (EVOO) varieties obtained from fruits of different ripening stages on osteoblast cells (MG-63) proliferation. Cell proliferation was increased by hydroxytyrosol, luteolin, apigenin, p-coumaric, caffeic, and ferulic acids by approximately 11–16%, as compared with controls that were treated with one vehicle alone, while (+)-pinoresinol, oleuropein, sinapic, vanillic acid and derivative (vanillin) did not affect cell proliferation. All phenolic extracts stimulated MG-63 cell growth, and they induced higher cell proliferation rates than individual compounds. The most effective EVOO phenolic extracts were those obtained from the Picual variety, as they significantly increased cell proliferation by 18–22%. Conversely, Arbequina phenolic extracts increased cell proliferation by 9–13%. A decline in osteoblast proliferation was observed in oils obtained from olive fruits collected at the end of the harvest period, as their total phenolic content decreases at this late stage. Further research on the signaling pathways of olive oil phenolic compounds involved in the processes and their metabolism should be carried out to develop new interventions and adjuvant therapies using EVOO for bone health (i.e.osteoporosis) in adulthood and the elderly. PMID:26930190

  10. Phenolic Compounds in Extra Virgin Olive Oil Stimulate Human Osteoblastic Cell Proliferation.

    Science.gov (United States)

    García-Martínez, Olga; De Luna-Bertos, Elvira; Ramos-Torrecillas, Javier; Ruiz, Concepción; Milia, Egle; Lorenzo, María Luisa; Jimenez, Brigida; Sánchez-Ortiz, Araceli; Rivas, Ana

    2016-01-01

    In this study, we aimed to clarify the effects of phenolic compounds and extracts from different extra virgin olive oil (EVOO) varieties obtained from fruits of different ripening stages on osteoblast cells (MG-63) proliferation. Cell proliferation was increased by hydroxytyrosol, luteolin, apigenin, p-coumaric, caffeic, and ferulic acids by approximately 11-16%, as compared with controls that were treated with one vehicle alone, while (+)-pinoresinol, oleuropein, sinapic, vanillic acid and derivative (vanillin) did not affect cell proliferation. All phenolic extracts stimulated MG-63 cell growth, and they induced higher cell proliferation rates than individual compounds. The most effective EVOO phenolic extracts were those obtained from the Picual variety, as they significantly increased cell proliferation by 18-22%. Conversely, Arbequina phenolic extracts increased cell proliferation by 9-13%. A decline in osteoblast proliferation was observed in oils obtained from olive fruits collected at the end of the harvest period, as their total phenolic content decreases at this late stage. Further research on the signaling pathways of olive oil phenolic compounds involved in the processes and their metabolism should be carried out to develop new interventions and adjuvant therapies using EVOO for bone health (i.e.osteoporosis) in adulthood and the elderly.

  11. p53-independent structure-activity relationships of 3-ring mesogenic compounds' activity as cytotoxic effects against human non-small cell lung cancer lines.

    Science.gov (United States)

    Fukushi, Saori; Yoshino, Hironori; Yoshizawa, Atsushi; Kashiwakura, Ikuo

    2016-07-25

    We recently demonstrated the cytotoxicity of liquid crystal precursors (hereafter referred to as "mesogenic compounds") in the human non-small cell lung cancer (NSCLC) cell line A549 which carry wild-type p53. p53 mutations are observed in 50 % of NSCLC and contribute to their resistance to chemotherapy. To develop more effective and cancer-specific agents, in this study, we investigated the structure-activity relationships of mesogenic compounds with cytotoxic effects against multiple NSCLC cells. The pharmacological effects of mesogenic compounds were examined in human NSCLC cells (A549, LU99, EBC-1, and H1299) and normal WI-38 human fibroblast. Analyses of the cell cycle, cell-death induction, and capsases expression were performed. The 3-ring compounds possessing terminal alkyl and hydroxyl groups (compounds C1-C5) showed cytotoxicity in NSCLC cells regardless of the p53 status. The compounds C1 and C3, which possess a pyrimidine at the center of the core, induced G2/M arrest, while the compounds without a pyrimidine (C2, C4, and C5) caused G1 arrest; all compounds produced caspase-mediated cell death. These events occurred in a p53-independent manner. Furthermore, it was suggested that compounds induced cell death through p53-independent DNA damage-signaling pathway. Compounds C2, C4, and C5 did not show strong cytotoxicity in WI-38 cells, whereas C1 and C3 did. However, the cytotoxicity of compound C1 against WI-38 cells was improved by modulating the terminal alkyl chain lengths of the compound. We showed the p53-indepdent structure-activity relationships of mesogenic compounds related to the cytotoxic effects. These structure-activity relationships will be helpful in the development of more effective and cancer-specific agents.

  12. Esters of Bendamustine Are by Far More Potent Cytotoxic Agents than the Parent Compound against Human Sarcoma and Carcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Stefan Huber

    Full Text Available The alkylating agent bendamustine is approved for the treatment of hematopoietic malignancies such as non-Hodgkin lymphoma, chronic lymphocytic leukemia and multiple myeloma. As preliminary data on recently disclosed bendamustine esters suggested increased cytotoxicity, we investigated representative derivatives in more detail. Especially basic esters, which are positively charged under physiological conditions, were in the crystal violet and the MTT assay up to approximately 100 times more effective than bendamustine, paralleled by a higher fraction of early apoptotic cancer cells and increased expression of p53. Analytical studies performed with bendamustine and representative esters revealed pronounced cellular accumulation of the derivatives compared to the parent compound. In particular, the pyrrolidinoethyl ester showed a high enrichment in tumor cells and inhibition of OCT1- and OCT3-mediated transport processes, suggesting organic cation transporters to be involved. However, this hypothesis was not supported by the differential expression of OCT1 (SLC22A1 and OCT3 (SLC22A3, comparing a panel of human cancer cells. Bendamustine esters proved to be considerably more potent cytotoxic agents than the parent compound against a broad panel of human cancer cell types, including hematologic and solid malignancies (e.g. malignant melanoma, colorectal carcinoma and lung cancer, which are resistant to bendamustine. Interestingly, spontaneously immortalized human keratinocytes, as a model of "normal" cells, were by far less sensitive than tumor cells against the most potent bendamustine esters.

  13. Human Disturbance during Early Life Impairs Nestling Growth in Birds Inhabiting a Nature Recreation Area.

    Science.gov (United States)

    Remacha, Carolina; Delgado, Juan Antonio; Bulaic, Mateja; Pérez-Tris, Javier

    2016-01-01

    Nature recreation conflicts with conservation, but its impacts on wildlife are not fully understood. Where recreation is not regulated, visitors to natural areas may gather in large numbers on weekends and holidays. This may increase variance in fitness in wild populations, if individuals whose critical life cycle stages coincide with periods of high human disturbance are at a disadvantage. We studied nestling development of blue tits (Cyanistes caeruleus) in a natural area where recreation activities intensify during weekends and other public holidays at picnic and leisure facilities, but not in the surrounding woods. In nests located near recreation facilities, blue tit nestlings that hatched during holidays developed slowly, and fledged with low body mass and poor body condition. However, nestlings that hatched outside of holidays and weekends in these nest boxes developed normally, eventually attaining similar phenotypes as those hatching in the surrounding woods. Within-brood variance in body mass was also higher in broods that began growing during holidays in disturbed areas. Our results show that early disturbance events may have negative consequences for wild birds if they overlap with critical stages of development, unveiling otherwise cryptic impacts of human activities. These new findings may help managers better regulate nature recreation.

  14. Human Disturbance during Early Life Impairs Nestling Growth in Birds Inhabiting a Nature Recreation Area.

    Directory of Open Access Journals (Sweden)

    Carolina Remacha

    Full Text Available Nature recreation conflicts with conservation, but its impacts on wildlife are not fully understood. Where recreation is not regulated, visitors to natural areas may gather in large numbers on weekends and holidays. This may increase variance in fitness in wild populations, if individuals whose critical life cycle stages coincide with periods of high human disturbance are at a disadvantage. We studied nestling development of blue tits (Cyanistes caeruleus in a natural area where recreation activities intensify during weekends and other public holidays at picnic and leisure facilities, but not in the surrounding woods. In nests located near recreation facilities, blue tit nestlings that hatched during holidays developed slowly, and fledged with low body mass and poor body condition. However, nestlings that hatched outside of holidays and weekends in these nest boxes developed normally, eventually attaining similar phenotypes as those hatching in the surrounding woods. Within-brood variance in body mass was also higher in broods that began growing during holidays in disturbed areas. Our results show that early disturbance events may have negative consequences for wild birds if they overlap with critical stages of development, unveiling otherwise cryptic impacts of human activities. These new findings may help managers better regulate nature recreation.

  15. Improvement of a synthetic lure for Anopheles gambiae using compounds produced by human skin microbiota

    NARCIS (Netherlands)

    Verhulst, N.O.; Mbadi, P.A.; Bukovinszkine-Kiss, G.; Mukabana, W.R.; Loon, van J.J.A.; Takken, W.; Smallegange, R.C.

    2011-01-01

    Background - Anopheles gambiae sensu stricto is considered to be highly anthropophilic and volatiles of human origin provide essential cues during its host-seeking behaviour. A synthetic blend of three human-derived volatiles, ammonia, lactic acid and tetradecanoic acid, attracts A. gambiae. In

  16. Is Toxoplasma Gondii Infection Related to Brain and Behavior Impairments in Humans? Evidence from a Population-Representative Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Karen Sugden

    Full Text Available Toxoplasma gondii (T. gondii is a protozoan parasite present in around a third of the human population. Infected individuals are commonly asymptomatic, though recent reports have suggested that infection might influence aspects of the host's behavior. In particular, Toxoplasma infection has been linked to schizophrenia, suicide attempt, differences in aspects of personality and poorer neurocognitive performance. However, these studies are often conducted in clinical samples or convenience samples.In a population-representative birth-cohort of individuals tested for presence of antibodies to T. gondii (N = 837 we investigated the association between infection and four facets of human behavior: neuropsychiatric disorder (schizophrenia and major depression, poor impulse control (suicidal behavior and criminality, personality, and neurocognitive performance. Suicide attempt was marginally more frequent among individuals with T. gondii seropositivity (p = .06. Seropositive individuals also performed worse on one out of 14 measures of neuropsychological function.On the whole, there was little evidence that T. gondii was related to increased risk of psychiatric disorder, poor impulse control, personality aberrations or neurocognitive impairment.

  17. Distributions of polyhalogenated compounds in Hudson River (New York, USA) fish in relation to human uses along the river

    International Nuclear Information System (INIS)

    Skinner, Lawrence C.

    2011-01-01

    PCBs (as Aroclor concentrations) have been extensively examined in fish along the Hudson River, but other xenobiotic chemicals in fish have had limited assessment. This study determined concentrations and congener distributions of polybrominated diphenyl ethers (PBDEs), polybrominated and polychlorinated dibenzo-p-dioxins and dibenzofurans (PBDD/Fs and PCDD/Fs), and polychlorinated biphenyls (PCBs) in smallmouth bass and striped bass taken from a 385 km reach of the Hudson River. Concentrations of PBDEs and PCBs in smallmouth bass, and PCBs in striped bass, were positively related to human uses of the compounds in the basin. Generally low levels of PCDD/Fs were found. One striped bass, however, contained elevated 2,3,7,8-TCDD, indicating exposure to a known source in the adjacent Newark Bay-Passaic River basin. PBDDs were generally below detection. PBDFs were present in four of 18 smallmouth bass, but were not detected in striped bass. Dioxin-like PCBs contribute most to 2,3,7,8-TCDD toxic equivalents in 29 of 30 samples. - Highlights: → In the Hudson River, → PBDEs in smallmouth bass follow human population patterns, but do not for striped bass. → Proximity to known PCB sources govern PCB levels and patterns in fish. → PBDFs were in smallmouth bass but not striped bass. PBDDs were present in one fish. → PCDD/Fs were low in 29 of 30 fish. A 2,3,7,8-TCDD source affected one striped bass. → PCBs contribute most to 2,3,7,8-TCDD toxic equivalents in 29 of 30 samples. - Residues of polyhalogenated compounds in resident and migratory fish from the Hudson River are compared with human uses of the compounds in the river basin.

  18. Chlorinated volatile organic compounds (Cl-VOCs) in environment - sources, potential human health impacts, and current remediation technologies.

    Science.gov (United States)

    Huang, Binbin; Lei, Chao; Wei, Chaohai; Zeng, Guangming

    2014-10-01

    Chlorinated volatile organic compounds (Cl-VOCs), including polychloromethanes, polychloroethanes and polychloroethylenes, are widely used as solvents, degreasing agents and a variety of commercial products. These compounds belong to a group of ubiquitous contaminants that can be found in contaminated soil, air and any kind of fluvial mediums such as groundwater, rivers and lakes. This review presents a summary of the research concerning the production levels and sources of Cl-VOCs, their potential impacts on human health as well as state-of-the-art remediation technologies. Important sources of Cl-VOCs principally include the emissions from industrial processes, the consumption of Cl-VOC-containing products, the disinfection process, as well as improper storage and disposal methods. Human exposure to Cl-VOCs can occur through different routes, including ingestion, inhalation and dermal contact. The toxicological impacts of these compounds have been carefully assessed, and the results demonstrate the potential associations of cancer incidence with exposure to Cl-VOCs. Most Cl-VOCs thus have been listed as priority pollutants by the Ministry of Environmental Protection (MEP) of China, Environmental Protection Agency of the U.S. (U.S. EPA) and European Commission (EC), and are under close monitor and strict control. Yet, more efforts will be put into the epidemiological studies for the risk of human exposure to Cl-VOCs and the exposure level measurements in contaminated sites in the future. State-of-the-art remediation technologies for Cl-VOCs employ non-destructive methods and destructive methods (e.g. thermal incineration, phytoremediation, biodegradation, advanced oxidation processes (AOPs) and reductive dechlorination), whose advantages, drawbacks and future developments are thoroughly discussed in the later sections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Distributions of polyhalogenated compounds in Hudson River (New York, USA) fish in relation to human uses along the river

    Energy Technology Data Exchange (ETDEWEB)

    Skinner, Lawrence C., E-mail: lxskinne@gw.dec.state.ny.us [New York State Department of Environmental Conservation, 625 Broadway, Albany, NY 12233 (United States)

    2011-10-15

    PCBs (as Aroclor concentrations) have been extensively examined in fish along the Hudson River, but other xenobiotic chemicals in fish have had limited assessment. This study determined concentrations and congener distributions of polybrominated diphenyl ethers (PBDEs), polybrominated and polychlorinated dibenzo-p-dioxins and dibenzofurans (PBDD/Fs and PCDD/Fs), and polychlorinated biphenyls (PCBs) in smallmouth bass and striped bass taken from a 385 km reach of the Hudson River. Concentrations of PBDEs and PCBs in smallmouth bass, and PCBs in striped bass, were positively related to human uses of the compounds in the basin. Generally low levels of PCDD/Fs were found. One striped bass, however, contained elevated 2,3,7,8-TCDD, indicating exposure to a known source in the adjacent Newark Bay-Passaic River basin. PBDDs were generally below detection. PBDFs were present in four of 18 smallmouth bass, but were not detected in striped bass. Dioxin-like PCBs contribute most to 2,3,7,8-TCDD toxic equivalents in 29 of 30 samples. - Highlights: > In the Hudson River, > PBDEs in smallmouth bass follow human population patterns, but do not for striped bass. > Proximity to known PCB sources govern PCB levels and patterns in fish. > PBDFs were in smallmouth bass but not striped bass. PBDDs were present in one fish. > PCDD/Fs were low in 29 of 30 fish. A 2,3,7,8-TCDD source affected one striped bass. > PCBs contribute most to 2,3,7,8-TCDD toxic equivalents in 29 of 30 samples. - Residues of polyhalogenated compounds in resident and migratory fish from the Hudson River are compared with human uses of the compounds in the river basin.

  20. Impaired growth of pancreatic exocrine cells in transgenic mice expressing human activin βE subunit

    International Nuclear Information System (INIS)

    Hashimoto, Osamu; Ushiro, Yuuki; Sekiyama, Kazunari; Yamaguchi, Osamu; Yoshioka, Kazuki; Mutoh, Ken-Ichiro; Hasegawa, Yoshihisa

    2006-01-01

    Activins, TGF-β superfamily members, have multiple functions in a variety of cells and tissues. Recently, additional activin β subunit genes, βC and βE, have been identified. To explore the role of activin E, we created transgenic mice overexpressing human activin βE subunit. There were pronounced differences in the pancreata of the transgenic animals as compared with their wild-type counterparts. Pancreatic weight, expressed relative to total body weight, was significantly reduced. Histologically, adipose replacement of acini in the exocrine pancreas was observed. There was a significant decrease in the number of PCNA-positive cells in the acinar cells, indicating reduced proliferation in the exocrine pancreas of the transgenic mice. However, quantitative pancreatic morphometry showed that the total number and mass of the islets of the transgenic mice were comparable with those of the nontransgenic control mice. Our findings suggest a role for activin E in regulating the proliferation of pancreatic exocrine cells

  1. Angiotensin-converting enzyme activity and cognitive impairment during hypoglycaemia in healthy humans

    DEFF Research Database (Denmark)

    Pedersen-Bjergaard, Ulrik; Thomsen, Carsten E; Høgenhaven, Hans

    2008-01-01

    INTRODUCTION: In type 1 diabetes increased risk of severe hypoglycaemia is associated with high angiotensin-converting enzyme (ACE) activity. We tested in healthy humans the hypothesis that this association is explained by the reduced ability of subjects with high ACE activity to maintain normal...... cognitive function during hypoglycaemia. METHODS: Sixteen healthy volunteers selected by either particularly high or low serum ACE activity were subjected to hypoglycaemia (plasma glucose 2.7 mmol/L). Cognitive function was assessed by choice reaction tests. RESULTS: Despite a similar hypoglycaemic stimulus...... in the two groups, only the group with high ACE activity showed significant deterioration in cognitive performance during hypoglycaemia. In the high ACE group mean reaction time (MRT) in the most complex choice reaction task was prolonged and error rate (ER) was increased in contrast to the low ACE group...

  2. Arctigenin, a natural lignan compound, induces G0/G1 cell cycle arrest and apoptosis in human glioma cells

    OpenAIRE

    Maimaitili, Aisha; Shu, Zunhua; Cheng, Xiaojiang; Kaheerman, Kadeer; Sikandeer, Alifu; Li, Weimin

    2016-01-01

    The aim of the current study was to investigate the anticancer potential of arctigenin, a natural lignan compound, in malignant gliomas. The U87MG and T98G human glioma cell lines were treated with various concentrations of arctigenin for 48 h and the effects of arctigenin on the aggressive phenotypes of glioma cells were assessed. The results demonstrated that arctigenin dose-dependently inhibited the growth of U87MG and T98G cells, as determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphen...

  3. Functional Impairment of Mononuclear Phagocyte System by the Human Respiratory Syncytial Virus

    Directory of Open Access Journals (Sweden)

    Karen Bohmwald

    2017-11-01

    Full Text Available The mononuclear phagocyte system (MPS comprises of monocytes, macrophages (MΦ, and dendritic cells (DCs. MPS is part of the first line of immune defense against a wide range of pathogens, including viruses, such as the human respiratory syncytial virus (hRSV. The hRSV is an enveloped virus that belongs to the Pneumoviridae family, Orthopneumovirus genus. This virus is the main etiological agent causing severe acute lower respiratory tract infection, especially in infants, children and the elderly. Human RSV can cause bronchiolitis and pneumonia and it has also been implicated in the development of recurrent wheezing and asthma. Monocytes, MΦ, and DCs significantly contribute to acute inflammation during hRSV-induced bronchiolitis and asthma exacerbation. Furthermore, these cells seem to be an important component for the association between hRSV and reactive airway disease. After hRSV infection, the first cells encountered by the virus are respiratory epithelial cells, alveolar macrophages (AMs, DCs, and monocytes in the airways. Because AMs constitute the predominant cell population at the alveolar space in healthy subjects, these cells work as major innate sentinels for the recognition of pathogens. Although adaptive immunity is crucial for viral clearance, AMs are required for the early immune response against hRSV, promoting viral clearance and controlling immunopathology. Furthermore, exposure to hRSV may affect the phagocytic and microbicidal capacity of monocytes and MΦs against other infectious agents. Finally, different studies have addressed the roles of different DC subsets during infection by hRSV. In this review article, we discuss the role of the lung MPS during hRSV infection and their involvement in the development of bronchiolitis.

  4. Apnea-induced rapid eye movement sleep disruption impairs human spatial navigational memory.

    Science.gov (United States)

    Varga, Andrew W; Kishi, Akifumi; Mantua, Janna; Lim, Jason; Koushyk, Viachaslau; Leibert, David P; Osorio, Ricardo S; Rapoport, David M; Ayappa, Indu

    2014-10-29

    Hippocampal electrophysiology and behavioral evidence support a role for sleep in spatial navigational memory, but the role of particular sleep stages is less clear. Although rodent models suggest the importance of rapid eye movement (REM) sleep in spatial navigational memory, a similar role for REM sleep has never been examined in humans. We recruited subjects with severe obstructive sleep apnea (OSA) who were well treated and adherent with continuous positive airway pressure (CPAP). Restricting CPAP withdrawal to REM through real-time monitoring of the polysomnogram provides a novel way of addressing the role of REM sleep in spatial navigational memory with a physiologically relevant stimulus. Individuals spent two different nights in the laboratory, during which subjects performed timed trials before and after sleep on one of two unique 3D spatial mazes. One night of sleep was normally consolidated with use of therapeutic CPAP throughout, whereas on the other night, CPAP was reduced only in REM sleep, allowing REM OSA to recur. REM disruption via this method caused REM sleep reduction and significantly fragmented any remaining REM sleep without affecting total sleep time, sleep efficiency, or slow-wave sleep. We observed improvements in maze performance after a night of normal sleep that were significantly attenuated after a night of REM disruption without changes in psychomotor vigilance. Furthermore, the improvement in maze completion time significantly positively correlated with the mean REM run duration across both sleep conditions. In conclusion, we demonstrate a novel role for REM sleep in human memory formation and highlight a significant cognitive consequence of OSA. Copyright © 2014 the authors 0270-6474/14/3414571-07$15.00/0.

  5. HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

    Science.gov (United States)

    Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

    2014-07-01

    The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

  6. Enterolactone: A novel radiosensitizer for human breast cancer cell lines through impaired DNA repair and increased apoptosis

    International Nuclear Information System (INIS)

    Bigdeli, Bahareh; Goliaei, Bahram; Masoudi-Khoram, Nastaran; Jooyan, Najmeh; Nikoofar, Alireza; Rouhani, Maryam; Haghparast, Abbas; Mamashli, Fatemeh

    2016-01-01

    human breast cancer. • Enterolactone pretreatment enhances radiation induced apoptosis. • Enterolactone pretreatment impairs repair of radiation-induced DNA damages. • Chromosomal aberrations increases in cells receiving enterolactone and X-ray. • Micronuclei formation is elevated after combined treatment with enterolactone.

  7. Enterolactone: A novel radiosensitizer for human breast cancer cell lines through impaired DNA repair and increased apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Bigdeli, Bahareh, E-mail: bhr.bigdeli@ut.ac.ir [Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, 16th Azar St., Enghelab Sq., Tehran (Iran, Islamic Republic of); Goliaei, Bahram, E-mail: goliaei@ut.ac.ir [Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, 16th Azar St., Enghelab Sq., Tehran (Iran, Islamic Republic of); Masoudi-Khoram, Nastaran, E-mail: n.masoudi@alumni.ut.ac.ir [Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, 16th Azar St., Enghelab Sq., Tehran (Iran, Islamic Republic of); Jooyan, Najmeh, E-mail: n.jooyan@ut.ac.ir [Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, 16th Azar St., Enghelab Sq., Tehran (Iran, Islamic Republic of); Nikoofar, Alireza, E-mail: nikoofar@iums.ac.ir [Department of Radiotherapy, Iran University of Medical Sciences (IUMS), Shahid Hemmat Highway, Tehran (Iran, Islamic Republic of); Rouhani, Maryam, E-mail: rouhani@iasbs.ac.ir [Department of Biological Sciences, Institute for Advanced Studies in Basic Sciences (IASBS), Prof. Yousef Sobouti Blvd., Gava Zang, Zanjan (Iran, Islamic Republic of); Haghparast, Abbas, E-mail: Haghparast@sbmu.ac.ir [Neuroscience Research Center, Shahid Beheshti University of Medical Sciences, Daneshjo St., Evin, Tehran (Iran, Islamic Republic of); Mamashli, Fatemeh, E-mail: mamashli@ut.ac.ir [Department of Biophysics, Institute of Biochemistry and Biophysics, University of Tehran, 16th Azar St., Enghelab Sq., Tehran (Iran, Islamic Republic of)

    2016-12-15

    human breast cancer. • Enterolactone pretreatment enhances radiation induced apoptosis. • Enterolactone pretreatment impairs repair of radiation-induced DNA damages. • Chromosomal aberrations increases in cells receiving enterolactone and X-ray. • Micronuclei formation is elevated after combined treatment with enterolactone.

  8. The effects of marine carbohydrates and glycosylated compounds on human health.

    Science.gov (United States)

    Kang, Hee-Kyoung; Seo, Chang Ho; Park, Yoonkyung

    2015-03-16

    Marine organisms have been recognized as a valuable source of bioactive compounds with industrial and nutraceutical potential. Recently, marine-derived carbohydrates, including polysaccharides and low molecular weight glycosylated oligosaccharides, have attracted much attention because of their numerous health benefits. Moreover, several studies have reported that marine carbohydrates exhibit various biological activities, including antioxidant, anti-infection, anticoagulant, anti-inflammatory, and anti-diabetic effects. The present review discusses the potential industrial applications of bioactive marine carbohydrates for health maintenance and disease prevention. Furthermore, the use of marine carbohydrates in food, cosmetics, agriculture, and environmental protection is discussed.

  9. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  10. Neurodevelopmental Impairment among Infants Born to Mothers Infected with Human Immunodeficiency Virus and Uninfected Mothers from Three Peri-Urban Primary Care Clinics in Harare, Zimbabwe

    Science.gov (United States)

    Kandawasvika, Gwendoline Q.; Ogundipe, Enitan; Gumbo, Felicity Z.; Kurewa, Edith N.; Mapingure, Munyaradzi P.; Stray-Pedersen, Babill

    2011-01-01

    Aim: The aim of this article is to document the risk of neurodevelopmental impairment (NDI) among infants enrolled in a programme for the prevention of mother-to-child transmission of HIV (human immunodeficiency virus) in Zimbabwe using the Bayley Infant Neurodevelopmental Screener (BINS). Method: We prospectively followed up infants at three…

  11. 1,25-dihydroxyvitamin D{sub 3} impairs NF-{kappa}B activation in human naive B cells

    Energy Technology Data Exchange (ETDEWEB)

    Geldmeyer-Hilt, Kerstin, E-mail: kerstin.hilt@charite.de [Allergie-Centrum-Charite, CCM, Klinik fuer Dermatologie und Allergologie, Charite - Universitaetsmedizin Berlin, Chariteplatz 1, 10117 Berlin (Germany); Heine, Guido, E-mail: guido.heine@charite.de [Allergie-Centrum-Charite, CCM, Klinik fuer Dermatologie und Allergologie, Charite - Universitaetsmedizin Berlin, Chariteplatz 1, 10117 Berlin (Germany); Deutsches Rheuma-Forschungszentrum Berlin, Chariteplatz 1, 10117 Berlin (Germany); Hartmann, Bjoern, E-mail: bjoern.hartmann@charite.de [Allergie-Centrum-Charite, CCM, Klinik fuer Dermatologie und Allergologie, Charite - Universitaetsmedizin Berlin, Chariteplatz 1, 10117 Berlin (Germany); Baumgrass, Ria, E-mail: baumgrass@drfz.de [Deutsches Rheuma-Forschungszentrum Berlin, Chariteplatz 1, 10117 Berlin (Germany); Radbruch, Andreas, E-mail: radbruch@drfz.de [Deutsches Rheuma-Forschungszentrum Berlin, Chariteplatz 1, 10117 Berlin (Germany); Worm, Margitta, E-mail: margitta.worm@charite.de [Allergie-Centrum-Charite, CCM, Klinik fuer Dermatologie und Allergologie, Charite - Universitaetsmedizin Berlin, Chariteplatz 1, 10117 Berlin (Germany)

    2011-04-22

    Highlights: {yields} In naive B cells, VDR activation by calcitriol results in reduced NF-{kappa}B p105 and p50 protein expression. {yields} Ligating the VDR with calcitriol causes reduced nuclear translocation of NF-{kappa}B p65. {yields} Reduced nuclear amount of p65 after calcitriol incubation results in reduced binding of p65 on the p105 promoter. {yields} Thus, vitamin D receptor signaling may reduce or prevent activation of B cells and unwanted immune responses, e.g. in IgE dependent diseases such as allergic asthma. -- Abstract: 1{alpha},25-dihydroxyvitamin D{sub 3} (calcitriol), the bioactive metabolite of vitamin D, modulates the activation and inhibits IgE production of anti-CD40 and IL-4 stimulated human peripheral B cells. Engagement of CD40 results in NF-{kappa}B p50 activation, which is essential for the class switch to IgE. Herein, we investigated by which mechanism calcitriol modulates NF-{kappa}B mediated activation of human naive B cells. Naive B cells were predominantly targeted by calcitriol in comparison with memory B cells as shown by pronounced induction of the VDR target gene cyp24a1. Vitamin D receptor activation resulted in a strongly reduced p105/p50 protein and mRNA expression in human naive B cells. This effect is mediated by impaired nuclear translocation of p65 and consequently reduced binding of p65 to its binding site in the p105 promoter. Our data indicate that the vitamin D receptor reduces NF-{kappa}B activation by interference with NF-{kappa}B p65 and p105. Thus, the vitamin D receptor inhibits costimulatory signal transduction in naive B cells, namely by reducing CD40 signaling.

  12. Impact of Salinomycin on human cholangiocarcinoma: induction of apoptosis and impairment of tumor cell proliferation in vitro

    Directory of Open Access Journals (Sweden)

    Lieke Thorsten

    2012-10-01

    Full Text Available Abstract Background Cholangiocarcinoma (CC is a primary liver cancer with increasing incidence worldwide. Despite all efforts made in past years, prognosis remains to be poor. At least in part, this might be explained by a pronounced resistance of CC cells to undergo apoptosis. Thus, new therapeutic strategies are imperatively required. In this study we investigated the effect of Salinomycin, a polyether ionophore antibiotic, on CC cells as an appropriate agent to treat CC. Salinomycin was quite recently identified to induce apoptosis in cancer stem cells and to overcome apoptosis-resistance in several leukemia-cells and other cancer cell lines of different origin. Methods To delineate the effects of Salinomycin on CC, we established an in vitro cell culture model using three different human CC cell lines. After treatment apoptosis as well as migration and proliferation behavior was assessed and additional cell cycle analyses were performed by flowcytometry. Results By demonstrating Annexin V and TUNEL positivity of human CC cells, we provide evidence that Salinomycin reveals the capacity to break apoptosis-resistance in CC cells. Furthermore, we are able to demonstrate that the non-apoptotic cell fraction is characterized by sustainable impaired migration and proliferation. Cell cycle analyses revealed G2-phase accumulation of human CC cells after treatment with Salinomycin. Even though apoptosis is induced in two of three cell lines of CC cells, one cell line remained unaffected in regard of apoptosis but revealed as the other CC cells decreased proliferation and migration. Conclusion In this study, we are able to demonstrate that Salinomycin is an effective agent against previously resistant CC cells and might be a potential candidate for the treatment of CC in the future.

  13. 1,25-dihydroxyvitamin D3 impairs NF-κB activation in human naive B cells

    International Nuclear Information System (INIS)

    Geldmeyer-Hilt, Kerstin; Heine, Guido; Hartmann, Bjoern; Baumgrass, Ria; Radbruch, Andreas; Worm, Margitta

    2011-01-01

    Highlights: → In naive B cells, VDR activation by calcitriol results in reduced NF-κB p105 and p50 protein expression. → Ligating the VDR with calcitriol causes reduced nuclear translocation of NF-κB p65. → Reduced nuclear amount of p65 after calcitriol incubation results in reduced binding of p65 on the p105 promoter. → Thus, vitamin D receptor signaling may reduce or prevent activation of B cells and unwanted immune responses, e.g. in IgE dependent diseases such as allergic asthma. -- Abstract: 1α,25-dihydroxyvitamin D 3 (calcitriol), the bioactive metabolite of vitamin D, modulates the activation and inhibits IgE production of anti-CD40 and IL-4 stimulated human peripheral B cells. Engagement of CD40 results in NF-κB p50 activation, which is essential for the class switch to IgE. Herein, we investigated by which mechanism calcitriol modulates NF-κB mediated activation of human naive B cells. Naive B cells were predominantly targeted by calcitriol in comparison with memory B cells as shown by pronounced induction of the VDR target gene cyp24a1. Vitamin D receptor activation resulted in a strongly reduced p105/p50 protein and mRNA expression in human naive B cells. This effect is mediated by impaired nuclear translocation of p65 and consequently reduced binding of p65 to its binding site in the p105 promoter. Our data indicate that the vitamin D receptor reduces NF-κB activation by interference with NF-κB p65 and p105. Thus, the vitamin D receptor inhibits costimulatory signal transduction in naive B cells, namely by reducing CD40 signaling.

  14. Skin-mimetic chromatography for prediction of human percutaneous absorption of biologically active compounds occurring in medicinal plant extracts.

    Science.gov (United States)

    Stepnik, Katarzyna; Malinowska, Irena

    2017-04-01

    The main aim of this study was to predict quantitatively human percutaneous absorption of chosen compounds commonly occurring in plants which can be used as medicinal extracts in the drug and beauty industries. The most important human percutaneous descriptors, i.e. logK p (logarithm of the water/skin partition coefficient) and logJ max (logarithm of the maximum flux of solutes penetrating the skin), of fatty acids and polyphenols were determined using both in vitro and in silico methods. For in vitro determination of human percutaneous absorption, micellar liquid chromatography based on hexadecyltrimethylammonium bromide, sodium dodecyl sulfate and polyoxyethylene (23) lauryl ether (Brij35) was used. Human percutaneous absorption was characterized by entirely new QSAR/QRAR models based on retention, lipophilic, steric and electronic data as well as on the linear free energy relationship parameters. Many different correlations between human skin absorption and different physicochemical parameters were performed, e.g. the in silico estimated logK p value was correlated with the retention parameter logk w (logarithm of the retention factor extrapolated to pure water) from the systems imitating a cutaneous environment (R 2  = 0.92). Moreover, the influence of lipophilicity on percutaneous absorption was examined. The obtained correlation was excellent (R 2  = 0.95). Copyright © 2016 John Wiley & Sons, Ltd.

  15. Antioxidative Effects of Phenolic Compounds of Mushroom Mycelia in Simulated Regions of the Human Colon, In Vitro Study

    Directory of Open Access Journals (Sweden)

    Vamanu Emanuel

    2018-03-01

    Full Text Available Many compounds in mushrooms are biologically active; however, the in vivo actions of their metabolites are poorly understood. An in vitro system, GIS1, was used to simulate the fermentation action of microbiota in each colon region. We used MycoPo, a natural product obtained from the lyophilized mycelia of different Pleurotus ostreatus species to determine the biological effects in human-colon regions. Controls (Lentinula edodes mycelia; dried basidia of Agaricus brunnescens were chosen to confirm the biological activity of P. ostreatus mycelia in vitro. We measured total antioxidant capacity and ferric ion-reducing antioxidant power (FRAP in simulated colon regions to identify antioxidant compounds, and undertook in vitro gastrointestinal simulation and microbiological analyses. The highest FRAP was found for the ascending colon, and the antioxidant effect was higher when MycoPo was administered. A. brunnescens consumption resulted in low total antioxidant capacity. Polyphenol content was correlated with the antioxidant status and microbial composition of microbiota. Total polyphenolic content was higher after A. brunnescens consumption, and four types of polyphenols were identified by high-performance liquid chromatography. Major phenolic acids were gentisic acid, homogentisic acid, and small amounts of caffeic acid. The Enterobacteriaceae species populations varied greatly across the three parts of the colon. We noted a significant (p0.85. These data suggest a direct relationship between favorable bacterial strains and availability of bioactive compounds, with specificity for each colon region.

  16. Environmental contamination and human exposure to dioxin-related compounds in e-waste recycling sites of developing countries.

    Science.gov (United States)

    Tue, Nguyen Minh; Takahashi, Shin; Subramanian, Annamalai; Sakai, Shinichi; Tanabe, Shinsuke

    2013-07-01

    E-waste recycling using uncontrolled processes is a major source of dioxin-related compounds (DRCs), including not only the regulated polychlorinated dibenzo-p-dioxins/dibenzofurans (PCDD/Fs) and dioxin-like polychlorinated biphenyls (DL-PCBs) but also non-regulated brominated and mixed halogenated compounds (PBDD/Fs and PXDD/Fs). Various studies at informal e-waste recycling sites (EWRSs) in Asian developing countries found the soil contamination levels of PCDD/Fs from tens to ten thousand picogram TCDD-equivalents (TEQ) per gram and those of DL-PCBs up to hundreds of picogram TEQ per gram. The air concentration of PCDD/Fs was reported as high as 50 pg TEQ per m(3) in Guiyu, the largest Chinese EWRS. Non-regulated compounds also contributed substantially to the total DL toxicity of the DRC mixtures from e-waste, as evidenced by the high TEQ levels estimated for the currently identifiable PBDD/Fs as well as the large portion of unexplained bioassay-derived TEQ levels in soils/dusts from EWRSs. Considering the high exposure levels estimated for EWRS residents, especially children, comprehensive emission inventories of DRCs from informal e-waste recycling, the identities and toxic potencies of unidentified DRCs released, and their impacts on human health need to be investigated in future studies.

  17. Influence of Laccase and Tyrosinase on the Antioxidant Capacity of Selected Phenolic Compounds on Human Cell Lines

    Directory of Open Access Journals (Sweden)

    Matthias Riebel

    2015-09-01

    Full Text Available Polyphenolic compounds affect the color, odor and taste of numerous food products of plant origin. In addition to the visual and gustatory properties, they serve as radical scavengers and have antioxidant effects. Polyphenols, especially resveratrol in red wine, have gained increasing scientific and public interest due to their presumptive beneficial impact on human health. Enzymatic oxidation of phenolic compounds takes place under the influence of polyphenol oxidases (PPO, including tyrosinase and laccase. Several studies have demonstrated the radical scavenger effect of plants, food products and individual polyphenols in vitro, but, apart from resveratrol, such impact has not been proved in physiological test systems. Furthermore, only a few data exist on the antioxidant capacities of the enzymatic oxidation products of phenolic compounds generated by PPO. We report here first results about the antioxidant effects of phenolic substances, before and after oxidation by fungal model tyrosinase and laccase. In general, the common chemical 2,2-diphenyl-1-picrylhydrazyl assay and the biological tests using two different types of cell cultures (monocytes and endothelial cells delivered similar results. The phenols tested showed significant differences with respect to their antioxidant activity in all test systems. Their antioxidant capacities after enzymatic conversion decreased or increased depending on the individual PPO used.

  18. Manganese induces mitochondrial dynamics impairment and apoptotic cell death: a study in human Gli36 cells.

    Science.gov (United States)

    Alaimo, Agustina; Gorojod, Roxana M; Miglietta, Esteban A; Villarreal, Alejandro; Ramos, Alberto J; Kotler, Mónica L

    2013-10-25

    Manganese (Mn) is an essential trace element due to its participation in many physiological processes. However, overexposure to this metal leads to a neurological disorder known as Manganism whose clinical manifestations and molecular mechanisms resemble Parkinson's disease. Several lines of evidence implicate astrocytes as an early target of Mn neurotoxicity being the mitochondria the most affected organelles. The aim of this study was to investigate the possible mitochondrial dynamics alterations in Mn-exposed human astrocytes. Therefore, we employed Gli36 cells which express the astrocytic markers GFAP and S100B. We demonstrated that Mn triggers the mitochondrial apoptotic pathway revealed by increased Bax/Bcl-2 ratio, by the loss of mitochondrial membrane potential and by caspase-9 activation. This apoptotic program may be in turn responsible of caspase-3/7 activation, PARP-1 cleavage, chromatin condensation and fragmentation. In addition, we determined that Mn induces deregulation in mitochondria-shaping proteins (Opa-1, Mfn-2 and Drp-1) expression levels in parallel with the disruption of the mitochondrial network toward to an exacerbated fragmentation. Since mitochondrial dynamics is altered in several neurodegenerative diseases, these proteins could become future targets to be considered in Manganism treatment. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. Impaired Angiogenic Potential of Human Placental Mesenchymal Stromal Cells in Intrauterine Growth Restriction.

    Science.gov (United States)

    Mandò, Chiara; Razini, Paola; Novielli, Chiara; Anelli, Gaia Maria; Belicchi, Marzia; Erratico, Silvia; Banfi, Stefania; Meregalli, Mirella; Tavelli, Alessandro; Baccarin, Marco; Rolfo, Alessandro; Motta, Silvia; Torrente, Yvan; Cetin, Irene

    2016-04-01

    Human placental mesenchymal stromal cells (pMSCs) have never been investigated in intrauterine growth restriction (IUGR). We characterized cells isolated from placental membranes and the basal disc of six IUGR and five physiological placentas. Cell viability and proliferation were assessed every 7 days during a 6-week culture. Expression of hematopoietic, stem, endothelial, and mesenchymal markers was evaluated by flow cytometry. We characterized the multipotency of pMSCs and the expression of genes involved in mitochondrial content and function. Cell viability was high in all samples, and proliferation rate was lower in IUGR compared with control cells. All samples presented a starting heterogeneous population, shifting during culture toward homogeneity for mesenchymal markers and occurring earlier in IUGR than in controls. In vitro multipotency of IUGR-derived pMSCs was restricted because their capacity for adipocyte differentiation was increased, whereas their ability to differentiate toward endothelial cell lineage was decreased. Mitochondrial content and function were higher in IUGR pMSCs than controls, possibly indicating a shift from anaerobic to aerobic metabolism, with the loss of the metabolic characteristics that are typical of undifferentiated multipotent cells. This study demonstrates that the loss of endothelial differentiation potential and the increase of adipogenic ability are likely to play a significant role in the vicious cycle of abnormal placental development in intrauterine growth restriction (IUGR). This is the first observation of a potential role for placental mesenchymal stromal cells in intrauterine growth restriction, thus leading to new perspectives for the treatment of IUGR. ©AlphaMed Press.

  20. Protein Kinase-C Beta Contributes to Impaired Endothelial Insulin Signaling in Humans with Diabetes Mellitus

    Science.gov (United States)

    Tabit, Corey E; Shenouda, Sherene M; Holbrook, Monica; Fetterman, Jessica L; Kiani, Soroosh; Frame, Alissa A; Kluge, Matthew A; Held, Aaron; Dohadwala, Mustali; Gokce, Noyan; Farb, Melissa; Rosenzweig, James; Ruderman, Neil; Vita, Joseph A; Hamburg, Naomi M

    2013-01-01

    Background Abnormal endothelial function promotes atherosclerotic vascular disease in diabetes. Experimental studies indicate that disruption of endothelial insulin signaling through the activity of protein kinase C-β (PKCβ) and nuclear factor κB (NFκB) reduces nitric oxide availability. We sought to establish whether similar mechanisms operate in the endothelium in human diabetes mellitus. Methods and Results We measured protein expression and insulin response in freshly isolated endothelial cells from patients with Type 2 diabetes mellitus (n=40) and non-diabetic controls (n=36). Unexpectedly, we observed 1.7-fold higher basal endothelial nitric oxide synthase (eNOS) phosphorylation at serine 1177 in patients with diabetes (P=0.007) without a difference in total eNOS expression. Insulin stimulation increased eNOS phosphorylation in non-diabetic subjects but not in diabetic patients (P=0.003) consistent with endothelial insulin resistance. Nitrotyrosine levels were higher in diabetic patients indicating endothelial oxidative stress. PKCβ expression was higher in diabetic patients and was associated with lower flow-mediated dilation (r=−0.541, P=0.02) Inhibition of PKCβ with LY379196 reduced basal eNOS phosphorylation and improved insulin-mediated eNOS activation in patients with diabetes. Endothelial NFκB activation was higher in diabetes and was reduced with PKCβ inhibition. Conclusions We provide evidence for the presence of altered eNOS activation, reduced insulin action and inflammatory activation in the endothelium of patients with diabetes. Our findings implicate PKCβ activity in endothelial insulin resistance. PMID:23204109

  1. Perfluorinated compounds: Levels, trophic web enrichments and human dietary intakes in transitional water ecosystems

    International Nuclear Information System (INIS)

    Renzi, Monia; Guerranti, Cristiana; Giovani, Andrea; Perra, Guido; Focardi, Silvano E.

    2013-01-01

    Highlights: • PFOA/S levels in a trophic web of a heavily human-stressed lagoon are measured. • High levels were found in mussels, clams and crabs. • The principal PFCs inflow sources for the ecosystem is the river. • Biota (i.e. macroalgae proliferation) contributes to redistribute pollutants in the lagoon. • Human daily dietary intakes are below maximum tolerable levels suggested by the EFSA. -- Abstract: The results of a study on levels of perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA), analyzed in terms of HPLC-ESI-MS in water, sediment, macrophyte, bivalve, crustacean and fish samples, are reported here. The aim of the research is to define, for the first time, PFOA/S levels in a heavily human-stressed transitional water ecosystem (Orbetello lagoon, Italy) and evaluate trophic web enrichments and human dietary intakes. The results obtained show that: (i) levels significantly higher than those reported in the literature were found in mussels, clams and crabs; (ii) the river is a significant pollution source; (iii) although absolute levels are relatively low, macroalgae proliferation contributes to redistribute pollutants from river-affected areas throughout the entire lagoon basin; (iv) to the best of our current knowledge, water-filtering species considered in this study are the most exposed to PFOA/S pollution; (v) human daily dietary intakes of PFOA/S through Slow Food-endorsed product consumption are below maximum tolerable levels suggested by the EFSA

  2. Effects of the anti-malarial compound cryptolepine and its analogues in human lymphocytes and sperm in the Comet assay.

    Science.gov (United States)

    Gopalan, Rajendran C; Emerce, Esra; Wright, Colin W; Karahalil, Bensu; Karakaya, Ali E; Anderson, Diana

    2011-12-15

    Malaria is a mosquito-borne infectious disease caused by the genus Plasmodium. It causes one million deaths per year in African children under the age of 5 years. There is an increasing development of resistance of malarial parasites to chloroquine and other currently used anti-malarial drugs. Some plant products such as the indoloquinoline alkaloid cryptolepine have been shown to have potent activity against P. falciparum in vitro. On account of its toxicity, cryptolepine is not suitable for use as an antimalarial drug but a number of analogues of cryptolepine have been synthesised in an attempt to find compounds that have reduced cytotoxicity and these have been investigated in the present study in human sperm and lymphocytes using the Comet assay. The results suggest that cryptolepine and the analogues cause DNA damage in lymphocytes, but appear to have no effect on human sperm at the assessed doses. In the context of antimalarial drug development, the data suggest that all cryptolepine compounds and in particular 2,7-dibromocryptolepine cause DNA damage and therefore may not be suitable for pre clinical development as antimalarial agents. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  3. Evaluation of T-lymphocyte populations in humans exposed to action of beryllium compounds

    Energy Technology Data Exchange (ETDEWEB)

    Ermakova, N G

    1977-10-01

    Earlier studies in vitro on beryllosis and cellular immunity, and knowledge of the role of T-cells in development of cellular immunity suggested usefulness of a quantitative determination of T-cell populations in beryllosis. Assay was based on the test for spontaneous rosette formation in beryllosis patients and in healthy workers who come in contact with Be compounds (Jondal, modified by M. A. Stenina) and on the leucocyte migration inhibition reaction (Soborg and Bendixen). A large range of changes were revealed in population size and in adhesion qualities of T-lymphocytes in the patients and in those exposed to Be. The test for spontaneous rosette formation was found to be sufficiently indicative for use in study of beryllosis pathogenesis and to correlate with the state of activity of the disease.

  4. Effect of Antimicrobial Compounds on Balamuthia mandrillaris Encystment and Human Brain Microvascular Endothelial Cell Cytopathogenicity▿

    OpenAIRE

    Siddiqui, Ruqaiyyah; Matin, Abdul; Warhurst, David; Stins, Monique; Khan, Naveed Ahmed

    2007-01-01

    Cycloheximide, ketoconazole, or preexposure of organisms to cytochalasin D prevented Balamuthia mandrillaris-associated cytopathogenicity in human brain microvascular endothelial cells, which constitute the blood-brain barrier. In an assay for inhibition of cyst production, these three agents prevented the production of cysts, suggesting that the biosynthesis of proteins and ergosterol and the polymerization of actin are important in cytopathogenicity and encystment.

  5. Maximum Permissible Risk Levels for Human Intake of Soil Contaminants: Fourth Series of Compounds

    NARCIS (Netherlands)

    Janssen PJCM; Apeldoorn ME van; Engelen JGM van; Schielen PCJI; Wouters MFA; CSR

    1998-01-01

    This report documents the human-toxicological risk assessment work done in 1996 and 1997 at RIVM's Centre for Substances and Risk Assessment within the scope of the RIVM project on soil intervention values for soil clean-up. The method used for derivation of the Maximum Permissible Risk, as

  6. Age-Associated Impairments in Mitochondrial ADP Sensitivity Contribute to Redox Stress in Senescent Human Skeletal Muscle

    Directory of Open Access Journals (Sweden)

    Graham P. Holloway

    2018-03-01

    Full Text Available Summary: It remains unknown if mitochondrial bioenergetics are altered with aging in humans. We established an in vitro method to simultaneously determine mitochondrial respiration and H2O2 emission in skeletal muscle tissue across a range of biologically relevant ADP concentrations. Using this approach, we provide evidence that, although the capacity for mitochondrial H2O2 emission is not increased with aging, mitochondrial ADP sensitivity is impaired. This resulted in an increase in mitochondrial H2O2 and the fraction of electron leak to H2O2, in the presence of virtually all ADP concentrations examined. Moreover, although prolonged resistance training in older individuals increased muscle mass, strength, and maximal mitochondrial respiration, exercise training did not alter H2O2 emission rates in the presence of ADP, the fraction of electron leak to H2O2, or the redox state of the muscle. These data establish that a reduction in mitochondrial ADP sensitivity increases mitochondrial H2O2 emission and contributes to age-associated redox stress. : Holloway et al. show that an inability of ADP to decrease mitochondrial reactive oxygen species emission contributes to redox stress in skeletal muscle tissue of older individuals and that this process is not recovered following prolonged resistance-type exercise training, despite the general benefits of resistance training for muscle health. Keywords: mitochondria, aging, muscle, ROS, H2O2, ADP, respiration, bioenergetics, exercise, resistance training

  7. Effect of Antimicrobial Compounds on Balamuthia mandrillaris Encystment and Human Brain Microvascular Endothelial Cell Cytopathogenicity▿

    Science.gov (United States)

    Siddiqui, Ruqaiyyah; Matin, Abdul; Warhurst, David; Stins, Monique; Khan, Naveed Ahmed

    2007-01-01

    Cycloheximide, ketoconazole, or preexposure of organisms to cytochalasin D prevented Balamuthia mandrillaris-associated cytopathogenicity in human brain microvascular endothelial cells, which constitute the blood-brain barrier. In an assay for inhibition of cyst production, these three agents prevented the production of cysts, suggesting that the biosynthesis of proteins and ergosterol and the polymerization of actin are important in cytopathogenicity and encystment. PMID:17875991

  8. Compounding Impacts of Human-Induced Water Stress and Climate Change on Water Availability

    Science.gov (United States)

    Mehran, Ali; AghaKouchak, Amir; Nakhjiri, Navid; Stewardson, Michael J.; Peel, Murray C.; Phillips, Thomas J.; Wada, Yoshihide; Ravalico, Jakin K.

    2017-01-01

    The terrestrial phase of the water cycle can be seriously impacted by water management and human water use behavior (e.g., reservoir operation, and irrigation withdrawals). Here we outline a method for assessing water availability in a changing climate, while explicitly considering anthropogenic water demand scenarios and water supply infrastructure designed to cope with climatic extremes. The framework brings a top-down and bottom-up approach to provide localized water assessment based on local water supply infrastructure and projected water demands. When our framework is applied to southeastern Australia we find that, for some combinations of climatic change and water demand, the region could experience water stress similar or worse than the epic Millennium Drought. We show considering only the influence of future climate on water supply, and neglecting future changes in water demand and water storage augmentation might lead to opposing perspectives on future water availability. While human water use can significantly exacerbate climate change impacts on water availability, if managed well, it allows societies to react and adapt to a changing climate. The methodology we present offers a unique avenue for linking climatic and hydrologic processes to water resource supply and demand management and other human interactions.

  9. A study of volatile organic compounds evolved from the decaying human body.

    Science.gov (United States)

    Statheropoulos, M; Spiliopoulou, C; Agapiou, A

    2005-10-29

    Two men were found dead near the island of Samos, Greece, in the Mediterranean sea. The estimated time of death for both victims was 3-4 weeks. Autopsy revealed no remarkable external injuries or acute poisoning. The exact cause of death remained unclear because the bodies had advanced decomposition. Volatile organic compounds (VOCs) evolved from these two corpses were determined by thermal desorption/gas chromatography/mass spectrometry analysis (TD/GC/MS). Over 80 substances have been identified and quantified. The most prominent among them were dimethyl disulfide (13.39 nmol/L), toluene (10.11 nmol/L), hexane (5.58 nmol/L), benzene 1,2,4-trimethyl (4.04 nmol/L), 2-propanone (3.84 nmol/L), 3-pentanone (3.59 nmol/L). Qualitative and quantitative differences among the evolved VOCs and CO2 mean concentration values might indicate different rates of decomposition between the two bodies. The study of the evolved VOCs appears to be a promising adjunct to the forensic pathologist as they may offer important information which can be used in his final evaluation.

  10. Modeling Human Exposure Levels to Airborne Volatile Organic Compounds by the Hebei Spirit Oil Spill

    Science.gov (United States)

    Kim, Jong Ho; Kwak, Byoung Kyu; Ha, Mina; Cheong, Hae-Kwan

    2012-01-01

    Objectives The goal was to model and quantify the atmospheric concentrations of volatile organic compounds (VOCs) as the result of the Hebei Spirit oil spill, and to predict whether the exposure levels were abnormally high or not. Methods We developed a model for calculating the airborne concentration of VOCs that are produced in an oil spill accident. The model was applied to a practical situation, namely the Hebei Spirit oil spill. The accuracy of the model was verified by comparing the results with previous observation data. The concentrations were compared with the currently used air quality standards. Results Evaporation was found to be 10- to 1,000-fold higher than the emissions produced from a surrounding industrial complex. The modeled concentrations for benzene failed to meet current labor environmental standards, and the concentration of benzene, toluene, ortho- meta- para-xylene were higher than the values specified by air quality standards and guideline values on the ocean. The concentrations of total VOCs were much higher than indoor environmental criteria for the entire Taean area for a few days. Conclusions The extent of airborne exposure was clearly not the same as that for normal conditions. PMID:22468262

  11. Assessment of chimeric mice with humanized livers in new drug development: generation of pharmacokinetics, metabolism and toxicity data for selecting the final candidate compound.

    Science.gov (United States)

    Kamimura, Hidetaka; Ito, Satoshi

    2016-01-01

    1. Chimeric mice with humanized livers are expected to be a novel tool for new drug development. This review discusses four applications where these animals can be used efficiently to collect supportive data for selecting the best compound in the final stage of drug discovery. 2. The first application is selection of the final compound based on estimated pharmacokinetic parameters in humans. Since chimeric mouse livers are highly repopulated with human hepatocytes, hepatic clearance values in vivo could be used preferentially to estimate pharmacokinetic profiles for humans. 3. The second is prediction of human-specific or disproportionate metabolites. Chimeric mice reproduce human-specific metabolites of drugs under development to conform to ICH guidance M3(R2), except for compounds that were extensively eliminated by co-existing mouse hepatocytes. 4. The third is identifying metabolites with distinct pharmacokinetic profiles in humans. Slow metabolite elimination specifically in humans increases its exposure level, but if its elimination is faster in laboratory animals, the animal exposure level might not satisfy ICH guidance M3(R2). 5. Finally, two examples of reproducing acute liver toxicity in chimeric mice are introduced. Integrated pharmacokinetics, metabolism and toxicity information are expected to assist pharmaceutical scientists in selecting the best candidate compound in new drug development.

  12. Lipodystrophy in human immunodeficiency virus patients impairs insulin action and induces defects in beta-cell function

    DEFF Research Database (Denmark)

    Andersen, Ove; Haugaard, Steen B; Andersen, Ulrik B

    2003-01-01

    similar between study groups. A hyperinsulinemic euglycemic clamp showed an impaired glucose disposal rate (GDR) in HALS patients (5.6 v 8.3 mg glucose/min. kg(FFM), P =.0006). As demonstrated by indirect calorimetry, HALS patients showed an impaired nonoxidative glucose metabolism (NOGM, 2.2 v 4.2, P...

  13. TGF-β signaling is an effective target to impair survival and induce apoptosis of human cholangiocarcinoma cells: A study on human primary cell cultures.

    Directory of Open Access Journals (Sweden)

    Anna Maria Lustri

    a repair mechanism in CCAs. LY2157299 failed to influence cell proliferation or apoptosis but significantly inhibited cell migration. At a 50 μM concentration, in fact, LY2157299 significantly impaired (at 24, 48 and 120 hrs the wound-healing of primary cell cultures from both mucin-and mixed-CCA. In conclusion, we demonstrated that CX4945 and LY2157299 exert relevant but distinct anticancer effects against human CCA cells, with CX4945 acting on cell viability and apoptosis, and LY2157299 impairing cell migration. These results suggest that targeting the TGF-β signaling with a combination of CX-4945 and LY2157299 could have potential benefits in the treatment of human CCA.

  14. Metabolomics and Ionomics of Potato Tuber Reveals an Influence of Cultivar and Market Class on Human Nutrients and Bioactive Compounds

    Directory of Open Access Journals (Sweden)

    Jacqueline M. Chaparro

    2018-05-01

    Full Text Available Potato (Solanum tuberosum L. is an important global food crop that contains phytochemicals with demonstrated effects on human health. Understanding sources of chemical variation of potato tuber can inform breeding for improved health attributes of the cooked food. Here, a comprehensive metabolomics (UPLC- and GC-MS and ionomics (ICP-MS analysis of raw and cooked potato tuber was performed on 60 unique potato genotypes that span 5 market classes including russet, red, yellow, chip, and specialty potatoes. The analyses detected 2,656 compounds that included known bioactives (43 compounds, nutrients (42, lipids (76, and 23 metals. Most nutrients and bioactives were partially degraded during cooking (44 out of 85; 52%, however genotypes with high quantities of bioactives remained highest in the cooked tuber. Chemical variation was influenced by genotype and market class. Specifically, ~53% of all detected compounds from cooked potato varied among market class and 40% varied by genotype. The most notable metabolite profiles were observed in yellow-flesh potato which had higher levels of carotenoids and specialty potatoes which had the higher levels of chlorogenic acid as compared to the other market classes. Variation in several molecules with known association to health was observed among market classes and included vitamins (e.g., pyridoxal, ~2-fold variation, bioactives (e.g., chlorogenic acid, ~40-fold variation, medicinals (e.g., kukoamines, ~6-fold variation, and minerals (e.g., calcium, iron, molybdenum, ~2-fold variation. Furthermore, more metabolite variation was observed within market class than among market class (e.g., α-tocopherol, ~1-fold variation among market class vs. ~3-fold variation within market class. Taken together, the analysis characterized significant metabolite and mineral variation in raw and cooked potato tuber, and support the potential to breed new cultivars for improved health traits.

  15. Metabolomics and Ionomics of Potato Tuber Reveals an Influence of Cultivar and Market Class on Human Nutrients and Bioactive Compounds

    Science.gov (United States)

    Chaparro, Jacqueline M.; Holm, David G.; Broeckling, Corey D.; Prenni, Jessica E.; Heuberger, Adam L.

    2018-01-01

    Potato (Solanum tuberosum L.) is an important global food crop that contains phytochemicals with demonstrated effects on human health. Understanding sources of chemical variation of potato tuber can inform breeding for improved health attributes of the cooked food. Here, a comprehensive metabolomics (UPLC- and GC-MS) and ionomics (ICP-MS) analysis of raw and cooked potato tuber was performed on 60 unique potato genotypes that span 5 market classes including russet, red, yellow, chip, and specialty potatoes. The analyses detected 2,656 compounds that included known bioactives (43 compounds), nutrients (42), lipids (76), and 23 metals. Most nutrients and bioactives were partially degraded during cooking (44 out of 85; 52%), however genotypes with high quantities of bioactives remained highest in the cooked tuber. Chemical variation was influenced by genotype and market class. Specifically, ~53% of all detected compounds from cooked potato varied among market class and 40% varied by genotype. The most notable metabolite profiles were observed in yellow-flesh potato which had higher levels of carotenoids and specialty potatoes which had the higher levels of chlorogenic acid as compared to the other market classes. Variation in several molecules with known association to health was observed among market classes and included vitamins (e.g., pyridoxal, ~2-fold variation), bioactives (e.g., chlorogenic acid, ~40-fold variation), medicinals (e.g., kukoamines, ~6-fold variation), and minerals (e.g., calcium, iron, molybdenum, ~2-fold variation). Furthermore, more metabolite variation was observed within market class than among market class (e.g., α-tocopherol, ~1-fold variation among market class vs. ~3-fold variation within market class). Taken together, the analysis characterized significant metabolite and mineral variation in raw and cooked potato tuber, and support the potential to breed new cultivars for improved health traits. PMID:29876353

  16. Human exposure to endocrine disrupting compounds: Their role in reproductive systems, metabolic syndrome and breast cancer. A review.

    Science.gov (United States)

    Giulivo, Monica; Lopez de Alda, Miren; Capri, Ettore; Barceló, Damià

    2016-11-01

    Endocrine disrupting chemicals (EDCs) are released into the environment from different sources. They are mainly used in packaging industries, pesticides and food constituents. Clinical evidence, experimental models, and epidemiological studies suggest that EDCs have major risks for humans by targeting different organs and systems in the body (e.g. reproductive system, breast tissue, adipose tissue, pancreas, etc.). Due to the ubiquity of human exposure to these compounds the aim of this review is to describe the most recent data on the effects induced by phthalates, bisphenol A and parabens in a critical window of exposure: in utero, during pregnancy, infants, and children. The interactions and mechanisms of toxicity of EDCs in relation to human general health problems, especially those broadening the term of endocrine disruption to 'metabolic disruption', should be deeply investigated. These include endocrine disturbances, with particular reference to reproductive problems and breast, testicular and ovarian cancers, and metabolic diseases such as obesity or diabetes. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Induction of apoptosis in human ovarian cancer cells by new anticancer compounds, epothilone A and B.

    Science.gov (United States)

    Rogalska, Aneta; Marczak, Agnieszka; Gajek, Arkadiusz; Szwed, Marzena; Śliwińska, Agnieszka; Drzewoski, Józef; Jóźwiak, Zofia

    2013-02-01

    Epothilones are a new group of compounds with action mechanisms similar to taxanes. The aim of this study was to compare the effects of epothilone A (Epo A) and epothilone B (Epo B) on ovarian cancer cell line SKOV-3 with those of paclitaxel (PTX), a classic taxane. We evaluate glycoprotein P (P-gp) activity in the ovarian cancer cell line. Apoptotic and necrotic cell levels were measured by double staining with Hoechst 33258 and propidium iodide (PI) as well as Annexin V staining. The production of reactive oxygen species (ROS) and changes in mitochondrial membrane potential (ΔΨm) in cells exposed to Epo A, Epo B and PTX were studied using specific fluorescence probes, DCFH(2)-DA (2',7'-dichlorodihydrofluorescein diacetate) and JC-1 (5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolcarbocyanine). The cytotoxic activity of the drugs was determined by the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide) test. All probes were analyzed in both the presence and absence of the antioxidant N-acetylcysteine (NAC). The results obtained demonstrated that the antiproliferative capacity of Epo A and Epo B in SKOV-3 cell line (measured as IC(50) after 72 h continuous treatment) was six and five times greater than that of PTX's respectively. Epothilones induced timecourse-dependent apoptosis and necrosis. Apoptotic and necrotic events were partially blocked by NAC, indicating ROS played a substantial role in epothilone-induced apoptosis. Cell death was also associated with a decrease in mitochondrial membrane potential, which was more pronounced after treatment with epothilones as compared to paclitaxel. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. New phytochemicals as potential human anti-aging compounds: Reality, promise, and challenges.

    Science.gov (United States)

    Corrêa, Rúbia C G; Peralta, Rosane M; Haminiuk, Charles W I; Maciel, Giselle Maria; Bracht, Adelar; Ferreira, Isabel C F R

    2018-04-13

    Aging is an inevitable process influenced by genetic, lifestyle, and environmental factors. Indirect evidence shows that several phytochemicals can have anti-aging capabilities, although direct evidence in this field is still limited. This report aims to provide a critical review on aspects related to the use of novel phytochemicals as anti-aging agents, to discuss the obstacles found when performing most anti-aging study protocols in humans, and to analyze future perspectives. In addition to the extensively studied resveratrol, epicatechin, quercetin, and curcumin, new phytochemicals have been reported to act as anti-aging agents, such as the amino acid L-theanine isolated from green tea, and the lignans arctigenin and matairesinol isolated from Arctium lappa seeds. Furthermore, this review discusses the application of several new extracts rich in phytochemicals with potential use in anti-aging therapies. Finally, this review also discusses the most important biomarkers to test anti-aging interventions, the necessity of conducting epidemiological studies and the need of clinical trials with adequate study protocols for humans.

  19. Compound haplotypes at Xp11.23 and human population growth in Eurasia.

    Science.gov (United States)

    Alonso, S; Armour, J A L

    2004-09-01

    To investigate patterns of diversity and the evolutionary history of Eurasians, we have sequenced a 2.8 kb region at Xp11.23 in a sample of African and Eurasian chromosomes. This region is in a long intron of CLCN5 and is immediately flanked by a highly variable minisatellite, DXS255, and a human-specific Ta0 LINE. Compared to Africans, Eurasians showed a marked reduction in sequence diversity. The main Euro-Asiatic haplotype seems to be the ancestral haplotype for the whole sample. Coalescent simulations, including recombination and exponential growth, indicate a median length of strong linkage disequilibrium, up to approximately 9 kb for this area. The Ka/Ks ratio between the coding sequence of human CLCN5 and its mouse orthologue is much less than 1. This implies that the region sequenced is unlikely to be under the strong influence of positive selective processes on CLCN5, mutations in which have been associated with disorders such as Dent's disease. In contrast, a scenario based on a population bottleneck and exponential growth seems a more likely explanation for the reduced diversity observed in Eurasians. Coalescent analysis and linked minisatellite diversity (which reaches a gene diversity value greater than 98% in Eurasians) suggest an estimated age of origin of the Euro-Asiatic diversity compatible with a recent out-of-Africa model for colonization of Eurasia by modern Homo sapiens.

  20. Saponin B, a novel cytostatic compound purified from Anemone taipaiensis, induces apoptosis in a human glioblastoma cell line.

    Science.gov (United States)

    Wang, Yuangang; Tang, Haifeng; Zhang, Yun; Li, Juan; Li, Bo; Gao, Zhenhui; Wang, Xiaoyang; Cheng, Guang; Fei, Zhou

    2013-11-01

    Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors. Saponin B, a novel compound isolated from the medicinal plant, Anemone taipaiensis, has been found to have a strong time- and dose-dependent cytostatic effect on human glioma cells and to suppress the growth of U87MG GBM cells. In this study, we investigated whether saponin B induces the apoptosis of glioblastoma cells and examined the underlying mechanism(s) of action of saponin B. Saponin B significantly suppressed U87MG cell proliferation. Flow cytometric analysis of DNA in the U87MG cells confirmed that saponin B blocked the cell cycle at the S phase. Furthermore, treatment of the U87MG cells with saponin B induced chromatin condensation and led to the formation of apoptotic bodies, as observed under a fluorescence microscope, and Annexin V/PI assay further suggested that phosphatidylserine (PS) externalization was apparent at higher drug concentrations. Treatment with saponin B activated the receptor-mediated pathway of apoptosis, as western blot analysis revealed the activation of Fas-l. Saponin B increased the Bax and caspase-3 ratio and decreased the protein expression of Bcl-2. The results from the present study demonstrate that the novel compound, saponin B, effectively induces the apoptosis of GBM cells and inhibits glioma cell growth and survival. Therefore, saponin B may be a potential candidate for the development of novel cancer therapeutics with antitumor activity against gliomas.

  1. Investigation of fruit peel extracts as sources for compounds with antioxidant and antiproliferative activities against human cell lines.

    Science.gov (United States)

    Khonkarn, Ruttiros; Okonogi, Siriporn; Ampasavate, Chadarat; Anuchapreeda, Songyot

    2010-01-01

    The aim of this study was to evaluate antioxidant activity and cytotoxicity against human cell lines of fruit peel extracts from rambutan, mangosteen and coconut. The highest antioxidant activity was found from rambutan peel crude extract where the highest radical scavenging capacity via ABTS assay was from its ethyl acetate fraction with a TEAC value of 23.0mM/mg and the highest ferric ion reduction activity via FRAP assay was from its methanol fraction with an EC value of 20.2mM/mg. Importantly, using both assays, these fractions had a higher antioxidant activity than butylated hydroxyl toluene and vitamin E. It was shown that the ethyl acetate fraction of rambutan peel had the highest polyphenolic content with a gallic acid equivalent of 2.3mg/mL. The results indicate that the polyphenolic compounds are responsible for the observed antioxidant activity of the extracts. Interestingly, the hexane fraction of coconut peel showed a potent cytotoxic effect on KB cell line by MTT assay (IC(50)=7.7 microg/mL), and no detectable cytotoxicity toward normal cells. We concluded that the ethyl acetate fraction of rambutan peel is a promising resource for potential novel antioxidant agents whereas the hexane fraction of coconut peel may contain novel anticancer compounds. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  2. The human taste receptor hTAS2R14 responds to a variety of different bitter compounds

    International Nuclear Information System (INIS)

    Behrens, Maik; Brockhoff, Anne; Kuhn, Christina; Bufe, Bernd; Winnig, Marcel; Meyerhof, Wolfgang

    2004-01-01

    The recent advances in the functional expression of TAS2Rs in heterologous systems resulted in the identification of bitter tastants that specifically activate receptors of this family. All bitter taste receptors reported to date exhibit a pronounced selectivity for single substances or structurally related bitter compounds. In the present study we demonstrate the expression of the hTAS2R14 gene by RT-PCR analyses and in situ hybridisation in human circumvallate papillae. By functional expression in HEK-293T cells we show that hTAS2R14 displays a, so far, unique broad tuning towards a variety of structurally diverse bitter compounds, including the potent neurotoxins, (-)-α-thujone, the pharmacologically active component of absinthe, and picrotoxinin, a poisonous substance of fishberries. The observed activation of heterologously expressed hTAS2R14 by low concentrations of (-)-α-thujone and picrotoxinin suggests that the receptor is sufficiently sensitive to caution us against the ingestion of toxic amounts of these substances

  3. Multipurpose Compound

    Science.gov (United States)

    1983-01-01

    Specially formulated derivatives of an unusual basic compound known as Alcide may be the answer to effective treatment and prevention of the disease bovine mastitis, a bacterial inflammation of a cow's mammary gland that results in loss of milk production and in extreme cases, death. Manufactured by Alcide Corporation the Alcide compound has killed all tested bacteria, virus and fungi, shortly after contact, with minimal toxic effects on humans or animals. Alcide Corporation credits the existence of the mastitis treatment/prevention products to assistance provided the company by NERAC, Inc.

  4. Quantification of volatile organic compounds in exhaled human breath. Acetonitrile as biomarker for passive smoking. Model for isoprene in human breath

    International Nuclear Information System (INIS)

    Prazeller, P.

    2000-03-01

    The topic of this thesis is the quantification of volatile organic compounds in human breath under various circumstances. The composition of exhaled breath reflects metabolic processes in the human body. Breath analysis is a non invasive technique which makes it most interesting especially for medical or toxicological applications. Measurements were done with Proton-Transfer-Reaction Mass-Spectrometry (PTR-MS). This technique combines the advantage of small fragmentation of chemical ionization with highly time resolved mass spectrometry. A big part of this work is about investigations of exposition due to tobacco smoke. After smoking cigarettes the initial increase and time dependence of some compounds in the human breath are monitored . The calculated decrease resulting only from breathing out the compounds is presented and compared to the measured decline in the breath. This allows the distinction whether breathing is the dominant loss of a compound or a different metabolic process remover it more efficiently. Acetonitrile measured in human breath is presented as a biomarker for exposition to tobacco smoke. Especially its use for quantification of passive smoking, the exposition to environmental tobacco smoke (ETS) is shown. The reached accuracy and the fast way of measuring of acetonitrile in human breath using PTR-MS offer a good alternative to common used biomarkers. Numerous publications have described measurements of breath isoprene in humans, and there has been a hope that breath isoprene analyses could be a non-invasive diagnostic tool to assess serum cholesterol levels or cholesterol synthesis rate. However, significant analytical problems in breath isoprene analysis and variability in isoprene levels with age, exercise, diet, etc. have limited the usefulness of these measurements. Here, we have applied proton-transfer-reaction mass spectrometry (PTR-MS) to this problem, allowing on-line detection of breath isoprene. We show that breath isoprene

  5. Assessment of an in vitro model of human cells to evaluate the toxic and irritating potential of chemical compounds

    Directory of Open Access Journals (Sweden)

    M. Catalano

    2011-01-01

    Full Text Available We attempted to induce differentation in unidifferentiated NCTC2544 human keratinocyte line, by exposure to ZnSO4 and CaCl2. Analysis of specific markers, transglutaminase I, involucrin and loricrin, show that basal NCTC2544 (BL reached spinous- (SL and granular-like (GL phenotypes. BL-, SI- and GL- NCTC were exposed to SDS, as irritant stimulus and Neutral red uptake (NRU and MTT cytoxicity tests evidenced a relatively higher toxicity in SL- and GL cells on lysosomes respect to mitochondria. ILIα cytokine was monitored as early inflammation marker. The complex of data provides evidence for the suitability of our in vitro model to the analysis of cytotoxic/biological effects of topically applied exogenous compounds.

  6. Bioactive Compounds in Some Culinary Aromatic Herbs and Their Effects on Human Health.

    Science.gov (United States)

    Guiné, Raquel P F; Gonçalves, Fernando J

    2016-01-01

    Culinary herbs are herbaceous (leafy) plants that add flavour and colour to all types of meals. There is a wide variety of herbs that are used for culinary purposes worldwide, which are also recognized for their beneficial health effects, and thus have also been used in folk medicine. Besides their nutritional value herbs are rich in many phytochemical components with bioactive effects, thus improving human health. The aim of the present work was to make a general overview of some of these herbs, including their gastronomic usage, their chemical composition in bioactive components and their reported health effects. This work showed that the health effects are very diverse and differ according to the herb in question. However, some of the most frequently citted biological activities include antioxidant, antimicrobial, and antiviral effects.

  7. The menagerie of human lipocalins: a natural protein scaffold for molecular recognition of physiological compounds.

    Science.gov (United States)

    Schiefner, André; Skerra, Arne

    2015-04-21

    all higher organisms, physiologically important members of this family have long been known in the human body, for example with the plasma retinol-binding protein that serves for the transport of vitamin A. This prototypic human lipocalin was the first for which a crystal structure was solved. Notably, several other lipocalins were discovered and assigned to this protein class before the term itself became familiar, which explains their diverse names in the scientific literature. To date, up to 15 distinct members of the lipocalin family have been characterized in humans, and during the last two decades the three-dimensional structures of a dozen major subtypes have been elucidated. This Account presents a comprehensive overview of the human lipocalins, revealing common structural principles but also deviations that explain individual functional features. Taking advantage of modern methods for combinatorial protein design, lipocalins have also been employed as scaffolds for the construction of artifical binding proteins with novel ligand specificities, so-called Anticalins, hence opening perspectives as a new class of biopharmaceuticals for medical therapy.

  8. WDR81 mutations cause extreme microcephaly and impair mitotic progression in human fibroblasts and Drosophila neural stem cells.

    Science.gov (United States)

    Cavallin, Mara; Rujano, Maria A; Bednarek, Nathalie; Medina-Cano, Daniel; Bernabe Gelot, Antoinette; Drunat, Severine; Maillard, Camille; Garfa-Traore, Meriem; Bole, Christine; Nitschké, Patrick; Beneteau, Claire; Besnard, Thomas; Cogné, Benjamin; Eveillard, Marion; Kuster, Alice; Poirier, Karine; Verloes, Alain; Martinovic, Jelena; Bidat, Laurent; Rio, Marlene; Lyonnet, Stanislas; Reilly, M Louise; Boddaert, Nathalie; Jenneson-Liver, Melanie; Motte, Jacques; Doco-Fenzy, Martine; Chelly, Jamel; Attie-Bitach, Tania; Simons, Matias; Cantagrel, Vincent; Passemard, Sandrine; Baffet, Alexandre; Thomas, Sophie; Bahi-Buisson, Nadia

    2017-10-01

    Microlissencephaly is a rare brain malformation characterized by congenital microcephaly and lissencephaly. Microlissencephaly is suspected to result from abnormalities in the proliferation or survival of neural progenitors. Despite the recent identification of six genes involved in microlissencephaly, the pathophysiological basis of this condition remains poorly understood. We performed trio-based whole exome sequencing in seven subjects from five non-consanguineous families who presented with either microcephaly or microlissencephaly. This led to the identification of compound heterozygous mutations in WDR81, a gene previously associated with cerebellar ataxia, intellectual disability and quadrupedal locomotion. Patient phenotypes ranged from severe microcephaly with extremely reduced gyration with pontocerebellar hypoplasia to moderate microcephaly with cerebellar atrophy. In patient fibroblast cells, WDR81 mutations were associated with increased mitotic index and delayed prometaphase/metaphase transition. Similarly, in vivo, we showed that knockdown of the WDR81 orthologue in Drosophila led to increased mitotic index of neural stem cells with delayed mitotic progression. In summary, we highlight the broad phenotypic spectrum of WDR81-related brain malformations, which include microcephaly with moderate to extremely reduced gyration and cerebellar anomalies. Our results suggest that WDR81 might have a role in mitosis that is conserved between Drosophila and humans. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Different radiosensitization effects of the halogenated compounds on the human chromosome in vitro

    International Nuclear Information System (INIS)

    Kang, Y.S.

    1976-01-01

    Unscheduled DNA synthesis and chromosome aberrations were compared following X- or UV-irradiation or methyl methanesulfonate treatment in cultures of HeLa S 3 or KB cells or human and rabbit lymphocytes. The sensitization by incorporation of the halouridines BUdR and IUdR was also investigated. Unscheduled DNA synthesis occurred in two established cell lines after irradiation with 0 to 10 kR of X-rays. The rate of unscheduled synthesis was dose dependent and differed for the two cell lines. The unscheduled synthesis was not correlated with the modal chromosome number nor with the number of aberrations produced. UV-irradiated rabbit lymphocytes exhibited unscheduled DNA synthesis which saturated after a dose of 250 ergs/mm 2 . In contrast the incorporation of BUdR or IUdR eliminated this saturation and caused an increasing effect with increasing dose up to 1000 ergs/mm 2 . The degree of sensitization varied between the two halo-uridines, BUdR being more effective at high doses while IUdR was a more potent sensitizer at low doses. Chromosome aberrations were not directly related to unscheduled DNA synthesis but were sensitized by halo-uridine incorporation. In this case IUdR was more potent than BUdR at all doses studied. Methyl methanesulfonate was an effective producer of chromosome aberration in human lymphocytes of both the chromosome and chromatid type. Prior incorporation of BUdR or IUdR did not increase the total aberration produced but did increase the number of chromosome type aberration at the expense of the chromatid type

  10. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Lower levels of interleukin-1β gene expression are associated with impaired Langerhans' cell migration in aged human skin.

    Science.gov (United States)

    Pilkington, Suzanne M; Ogden, Stephanie; Eaton, Laura H; Dearman, Rebecca J; Kimber, Ian; Griffiths, Christopher E M

    2018-01-01

    Langerhans' cells (LC) play pivotal roles in skin immune responses, linking innate and adaptive immunity. In aged skin there are fewer LC and migration is impaired compared with young skin. These changes may contribute to declining skin immunity in the elderly, including increased skin infections and skin cancer. Interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) are mandatory signals for LC migration and previous studies suggest that IL-1β signalling may be dysregulated in aged skin. Therefore, we sought to explore the mechanisms underlying these phenomena. In skin biopsies of photoprotected young ( 70 years) human skin ex vivo, we assessed the impact of trauma, and mandatory LC mobilizing signals on LC migration and gene expression. Biopsy-related trauma induced LC migration from young epidermis, whereas in aged skin, migration was greatly reduced. Interleukin-1β treatment restored LC migration in aged epidermis whereas TNF-α was without effect. In uncultured, aged skin IL-1β gene expression was lower compared with young skin; following culture, IL-1βmRNA remained lower in aged skin under control and TNF-α conditions but was elevated after culture with IL-1β. Interleukin-1 receptor type 2 (IL1R2) gene expression was significantly increased in aged, but not young skin, after cytokine treatment. Keratinocyte-derived factors secreted from young and aged primary cells did not restore or inhibit LC migration from aged and young epidermis, respectively. These data suggest that in aged skin, IL-1β signalling is diminished due to altered expression of IL1B and decoy receptor gene IL1R2. © 2017 The Authors. Immunology Published by John Wiley & Sons Ltd., Immunology.

  12. Palmitate-induced inflammatory pathways in human adipose microvascular endothelial cells promote monocyte adhesion and impair insulin transcytosis.

    Science.gov (United States)

    Pillon, Nicolas J; Azizi, Paymon M; Li, Yujin E; Liu, Jun; Wang, Changsen; Chan, Kenny L; Hopperton, Kathryn E; Bazinet, Richard P; Heit, Bryan; Bilan, Philip J; Lee, Warren L; Klip, Amira

    2015-07-01

    Obesity is associated with inflammation and immune cell recruitment to adipose tissue, muscle and intima of atherosclerotic blood vessels. Obesity and hyperlipidemia are also associated with tissue insulin resistance and can compromise insulin delivery to muscle. The muscle/fat microvascular endothelium mediates insulin delivery and facilitates monocyte transmigration, yet its contribution to the consequences of hyperlipidemia is poorly understood. Using primary endothelial cells from human adipose tissue microvasculature (HAMEC), we investigated the effects of physiological levels of fatty acids on endothelial inflammation and function. Expression of cytokines and adhesion molecules was measured by RT-qPCR. Signaling pathways were evaluated by pharmacological manipulation and immunoblotting. Surface expression of adhesion molecules was determined by immunohistochemistry. THP1 monocyte interaction with HAMEC was measured by cell adhesion and migration across transwells. Insulin transcytosis was measured by total internal reflection fluorescence microscopy. Palmitate, but not palmitoleate, elevated the expression of IL-6, IL-8, TLR2 (Toll-like receptor 2), and intercellular adhesion molecule 1 (ICAM-1). HAMEC had markedly low fatty acid uptake and oxidation, and CD36 inhibition did not reverse the palmitate-induced expression of adhesion molecules, suggesting that inflammation did not arise from palmitate uptake/metabolism. Instead, inhibition of TLR4 to NF-κB signaling blunted palmitate-induced ICAM-1 expression. Importantly, palmitate-induced surface expression of ICAM-1 promoted monocyte binding and transmigration. Conversely, palmitate reduced insulin transcytosis, an effect reversed by TLR4 inhibition. In summary, palmitate activates inflammatory pathways in primary microvascular endothelial cells, impairing insulin transport and increasing monocyte transmigration. This behavior may contribute in vivo to reduced tissue insulin action and enhanced tissue

  13. Brain-Derived Neurotrophic Factor Val66Met Human Polymorphism Impairs the Beneficial Exercise-Induced Neurobiological Changes in Mice

    Science.gov (United States)

    Ieraci, Alessandro; Madaio, Alessandro I; Mallei, Alessandra; Lee, Francis S; Popoli, Maurizio

    2016-01-01

    Several studies have shown that exercise improves cognitive functions and emotional behaviors. Positive effects of exercise have been associated with enhanced brain plasticity, adult hippocampal neurogenesis, and increased levels of brain-derived neurotrophic factor (BDNF). However, a substantial variability of individual response to exercise has been described, which may be accounted for by individual genetic variants. Here, we have assessed whether and how the common human BDNF Val66Met polymorphism influences the neurobiological effects modulated by exercise in BDNF Val66Met knock-in male mice. Wild-type (BDNFVal/Val) and homozygous BDNF Val66Met (BDNFMet/Met) male mice were housed in cages equipped with or without running wheels for 4 weeks. Changes in behavioral phenotype, hippocampal adult neurogenesis, and gene expression were evaluated in exercised and sedentary control mice. We found that exercise reduced the latency to feed in the novelty suppressed feeding and the immobility time in the forced swimming test in BDNFVal/Val but not in BDNFMet/Met mice. Hippocampal neurogenesis was reduced in BDNFMet/Met mice compared with BDNFVal/Val mice. BDNFMet/Met mice had lower basal BDNF protein levels in the hippocampus, which was not recovered following exercise. Moreover, exercise-induced expression of total BDNF, BDNF splice variants 1, 2, 4, 6 and fibronectin type III domain-containing protein 5 (FNDC5) mRNA levels were absent or reduced in the dentate gyrus of BDNFMet/Met mice. Exercise failed to enhance PGC-1α and FNDC5 mRNA levels in the BDNFMet/Met muscle. Overall these results indicate that, in adult male mice, the BDNF Val66Met polymorphism impairs the beneficial behavioral and neuroplasticity effects induced by physical exercise. PMID:27388329

  14. Severely altered guanidino compound levels, disturbed body weight homeostasis and impaired fertility in a mouse model of guanidinoacetate N-methyltransferase (GAMT) deficiency.

    NARCIS (Netherlands)

    Schmidt, A.; Marescau, B.; Boehm, E.A.; Renema, W.K.J.; Peco, R.; Das, A.; Steinfeld, R.; Chan, S.; Wallis, J.; Davidoff, M.; Ullrich, K.; Waldschutz, R.; Heerschap, A.; Deyn, P.P. de; Neubauer, S.; Isbrandt, D.

    2004-01-01

    We generated a knockout mouse model for guanidinoacetate N-methyltransferase (GAMT) deficiency (MIM 601240), the first discovered human creatine deficiency syndrome, by gene targeting in embryonic stem cells. Disruption of the open reading frame of the murine GAMT gene in the first exon resulted in

  15. Serum metabolome biomarkers associate low-level environmental perfluorinated compound exposure with oxidative /nitrosative stress in humans.

    Science.gov (United States)

    Wang, Xiaofei; Liu, Liangpo; Zhang, Weibing; Zhang, Jie; Du, Xiaoyan; Huang, Qingyu; Tian, Meiping; Shen, Heqing

    2017-10-01

    Previous in vivo and in vitro studies have linked perfluorinated compound (PFC) exposure with metabolic interruption, but the inter-species difference and high treatment doses usually make the results difficult to be extrapolated to humans directly. The best strategy for identifying the metabolic interruption may be to establish the direct correlations between monitored PFCs data and metabolic data on human samples. In this study, serum metabolome data and PFC concentrations were acquired for a Chinese adult male cohort. The most abundant PFCs are PFOA and PFOS with concentration medians 7.56 and 12.78 nM, respectively; in together they count around 81.6% of the total PFCs. PFC concentration-related serum metabolic profile changes and the related metabolic biomarkers were explored by using partial least squares-discriminant analysis (PLS-DA). Respectively taking PFOS, PFOA and total PFC as the classifiers, serum metabolome can be differentiated between the lowest dose group (1st quartile PFCs) and the highest PFC dose group (4th quartile PFCs). Ten potential PFC biomarkers were identified, mainly involving in pollutant detoxification, antioxidation and nitric oxide (NO) signal pathways. These suggested that low-level environmental PFC exposure has significantly adverse impacts on glutathione (GSH) cycle, Krebs cycle, nitric oxide (NO) generation and purine oxidation in humans. To the best of our knowledge, this is the first report investigating the association of environmental PFC exposure with human serum metabolome alteration. Given the important biological functions of the identified biomarkers, we suggest that PFC could increase the metabolism syndromes risk including diabetes and cardiovascular diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Valsartan improves adipose tissue function in humans with impaired glucose metabolism: a randomized placebo-controlled double-blind trial.

    Directory of Open Access Journals (Sweden)

    Gijs H Goossens

    Full Text Available BACKGROUND: Blockade of the renin-angiotensin system (RAS reduces the incidence of type 2 diabetes mellitus. In rodents, it has been demonstrated that RAS blockade improved adipose tissue (AT function and glucose homeostasis. However, the effects of long-term RAS blockade on AT function have not been investigated in humans. Therefore, we examined whether 26-wks treatment with the angiotensin II type 1 receptor blocker valsartan affects AT function in humans with impaired glucose metabolism (IGM. METHODOLOGY/PRINCIPAL FINDINGS: We performed a randomized, double-blind, placebo-controlled parallel-group study, in which 38 subjects with IGM were treated with valsartan (VAL, 320 mg/d or placebo (PLB for 26 weeks. Before and after treatment, an abdominal subcutaneous AT biopsy was collected for measurement of adipocyte size and AT gene/protein expression of angiogenesis/capillarization, adipogenesis, lipolytic and inflammatory cell markers. Furthermore, we evaluated fasting and postprandial AT blood flow (ATBF ((133Xe wash-out, systemic inflammation and insulin sensitivity (hyperinsulinemic-euglycemic clamp. VAL treatment markedly reduced adipocyte size (P<0.001, with a shift toward a higher proportion of small adipocytes. In addition, fasting (P = 0.043 and postprandial ATBF (P = 0.049 were increased, whereas gene expression of angiogenesis/capillarization, adipogenesis and macrophage infiltration markers in AT was significantly decreased after VAL compared with PLB treatment. Interestingly, the change in adipocyte size was associated with alterations in insulin sensitivity and reduced AT gene expression of macrophage infiltration markers. VAL did not alter plasma monocyte-chemoattractant protein (MCP-1, TNF-α, adiponectin and leptin concentrations. CONCLUSIONS/SIGNIFICANCE: 26-wks VAL treatment markedly reduced abdominal subcutaneous adipocyte size and AT macrophage infiltration markers, and increased ATBF in IGM subjects. The VAL

  17. Task sharing in Zambia: HIV service scale-up compounds the human resource crisis

    Directory of Open Access Journals (Sweden)

    Simbaya Joseph

    2010-09-01

    Full Text Available Abstract Background Considerable attention has been given by policy makers and researchers to the human resources for health crisis in Africa. However, little attention has been paid to quantifying health facility-level trends in health worker numbers, distribution and workload, despite growing demands on health workers due to the availability of new funds for HIV/AIDS control scale-up. This study analyses and reports trends in HIV and non-HIV ambulatory service workloads on clinical staff in urban and rural district level facilities. Methods Structured surveys of health facility managers, and health services covering 2005-07 were conducted in three districts of Zambia in 2008 (two urban and one rural, to fill this evidence gap. Intra-facility analyses were conducted, comparing trends in HIV and non-HIV service utilisation with staff trends. Results Clinical staff (doctors, nurses and nurse-midwives, and clinical officers numbers and staff population densities fell slightly, with lower ratios of staff to population in the rural district. The ratios of antenatal care and family planning registrants to nurses/nurse-midwives were highest at baseline and increased further at the rural facilities over the three years, while daily outpatient department (OPD workload in urban facilities fell below that in rural facilities. HIV workload, as measured by numbers of clients receiving antiretroviral treatment (ART and prevention of mother to child transmission (PMTCT per facility staff member, was highest in the capital city, but increased rapidly in all three districts. The analysis suggests evidence of task sharing, in that staff designated by managers as ART and PMTCT workers made up a higher proportion of frontline service providers by 2007. Conclusions This analysis of workforce patterns across 30 facilities in three districts of Zambia illustrates that the remarkable achievements in scaling-up HIV/AIDS service delivery has been on the back of

  18. Task sharing in Zambia: HIV service scale-up compounds the human resource crisis

    LENUS (Irish Health Repository)

    Walsh, Aisling

    2010-09-17

    Abstract Background Considerable attention has been given by policy makers and researchers to the human resources for health crisis in Africa. However, little attention has been paid to quantifying health facility-level trends in health worker numbers, distribution and workload, despite growing demands on health workers due to the availability of new funds for HIV\\/AIDS control scale-up. This study analyses and reports trends in HIV and non-HIV ambulatory service workloads on clinical staff in urban and rural district level facilities. Methods Structured surveys of health facility managers, and health services covering 2005-07 were conducted in three districts of Zambia in 2008 (two urban and one rural), to fill this evidence gap. Intra-facility analyses were conducted, comparing trends in HIV and non-HIV service utilisation with staff trends. Results Clinical staff (doctors, nurses and nurse-midwives, and clinical officers) numbers and staff population densities fell slightly, with lower ratios of staff to population in the rural district. The ratios of antenatal care and family planning registrants to nurses\\/nurse-midwives were highest at baseline and increased further at the rural facilities over the three years, while daily outpatient department (OPD) workload in urban facilities fell below that in rural facilities. HIV workload, as measured by numbers of clients receiving antiretroviral treatment (ART) and prevention of mother to child transmission (PMTCT) per facility staff member, was highest in the capital city, but increased rapidly in all three districts. The analysis suggests evidence of task sharing, in that staff designated by managers as ART and PMTCT workers made up a higher proportion of frontline service providers by 2007. Conclusions This analysis of workforce patterns across 30 facilities in three districts of Zambia illustrates that the remarkable achievements in scaling-up HIV\\/AIDS service delivery has been on the back of sustained non

  19. Task sharing in Zambia: HIV service scale-up compounds the human resource crisis.

    Science.gov (United States)

    Walsh, Aisling; Ndubani, Phillimon; Simbaya, Joseph; Dicker, Patrick; Brugha, Ruairí

    2010-09-17

    Considerable attention has been given by policy makers and researchers to the human resources for health crisis in Africa. However, little attention has been paid to quantifying health facility-level trends in health worker numbers, distribution and workload, despite growing demands on health workers due to the availability of new funds for HIV/AIDS control scale-up. This study analyses and reports trends in HIV and non-HIV ambulatory service workloads on clinical staff in urban and rural district level facilities. Structured surveys of health facility managers, and health services covering 2005-07 were conducted in three districts of Zambia in 2008 (two urban and one rural), to fill this evidence gap. Intra-facility analyses were conducted, comparing trends in HIV and non-HIV service utilisation with staff trends. Clinical staff (doctors, nurses and nurse-midwives, and clinical officers) numbers and staff population densities fell slightly, with lower ratios of staff to population in the rural district. The ratios of antenatal care and family planning registrants to nurses/nurse-midwives were highest at baseline and increased further at the rural facilities over the three years, while daily outpatient department (OPD) workload in urban facilities fell below that in rural facilities. HIV workload, as measured by numbers of clients receiving antiretroviral treatment (ART) and prevention of mother to child transmission (PMTCT) per facility staff member, was highest in the capital city, but increased rapidly in all three districts. The analysis suggests evidence of task sharing, in that staff designated by managers as ART and PMTCT workers made up a higher proportion of frontline service providers by 2007. This analysis of workforce patterns across 30 facilities in three districts of Zambia illustrates that the remarkable achievements in scaling-up HIV/AIDS service delivery has been on the back of sustained non-HIV workload levels, increasing HIV workload and stagnant

  20. Compound biological effectiveness (CBE) factors in human undifferentiated thyroid cancer (UTC)

    International Nuclear Information System (INIS)

    Dagrosa, M.A.; Pisarev, M.; Chung, Y.; Coderre, J.; Riley, K.; Binns, P.; Kahl, S.

    2006-01-01

    We determined the CBE values for BPA an BOPP both individually and combined in a human UTC cell line as preliminary data for future treatments with BNCT. In these studies the exponentially growing cell line (ARO) were distributed into the following groups: 1) BPA (10 ppm 10 B) +neutrons; 2) BOPP (10 ppm 10 B) + neutrons; 3) BPA (5 ppm 10 B) + BOPP (5 ppm 10 B) + neutrons; 4) neutrons alone; 5) X-rays. The cells were irradiated in the thermal neutron beam of the MIT Research Reactor (flux=8.5 10 9 n/cm 2 sec). Surviving fraction (SF) was studied as the endpoint from colony forming assays. The RBE of the beam as well as the CBEs for BPA and BOPP both individually and in combination were determined for two different endpoints. At SF of 0.02 and 0.07 respectively the results were beam RBE: 1.2 and 1.2; CBE for BPA: 3.0 and 3.9; CBE for BOPP: 1.6 and 1.7; and the CBE for BPA and BOPP in combination: 2.4 and 2.6. The CBE values for BPA in combination with BOPP appear additive. These are the first measured data for CBEs for UTC that should prove useful for future clinical studies. (author)

  1. The Antitumor Activity of the Novel Compound Jesridonin on Human Esophageal Carcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Cong Wang

    Full Text Available Jesridonin, a small molecule obtained through the structural modification of Oridonin, has extensive antitumor activity. In this study, we evaluated both its in vitro activity in the cancer cell line EC109 and its in vivo effect on tumor xenografts in nude mice. Apoptosis induced by Jesridonin was determined using an MTT assay, Annexin-V FITC assay and Hoechest 33258 staining. Apoptosis via mitochondrial and death receptor pathways were confirmed by detecting the regulation of MDM2, p53, and Bcl-2 family members and by activation of caspase-3/-8/-9. In addition, vena caudalis injection of Jesridonin showed significant inhibition of tumor growth in the xenograft model, and Jesridonin-induced cell apoptosis in tumor tissues was determined using TUNEL. Biochemical serum analysis of alkaline phosphatase (ALP, alanine transaminase (ALT, aspartate transaminase (AST, gamma-glutamyl transferase (GGT, total protein (TP and albumin (ALB indicated no obvious effects on liver function. Histopathological examination of the liver, kidney, lung, heart and spleen revealed no signs of JD-induced toxicity. Taken together, these results demonstrated that Jesridonin exhibits antitumor activity in human esophageal carcinomas EC109 cells both in vitro and in vivo and demonstrated no adverse effects on major organs in nude mice. These studies provide support for new drug development.

  2. Surface Chemistry Interactions of Cationorm with Films by Human Meibum and Tear Film Compounds

    Directory of Open Access Journals (Sweden)

    Georgi As. Georgiev

    2017-07-01

    Full Text Available Cationorm® (CN cationic nanoemulsion was demonstrated to enhance tear film (TF stability in vivo possibly via effects on tear film lipid layer (TFLL. Therefore the interactions of CN with human meibum (MGS and TFLL in vitro and in vivo deserve special study. MGS and CN were spread at the air/water interface of a Langmuir surface balance to ensure a range of MGS/CN oil phase ratios: 20/1, 10/1, 5/1, 3/1, 2/1 and 1/1. The films capability to reorganize during dynamic area changes was evaluated via the surface pressure-area compression isotherms and step/relaxation dilatational rheology studies. Films structure was monitored with Brewster angle microscopy. CN/TFLL interactions at the ocular surface were monitored with non-contact specular microscopy. The in vitro studies of MGS/CN layers showed that (i CN inclusion (at fixed MGS content increased film elasticity and thickness and that (ii CN can compensate for moderate meibum deficiency in MGS/CN films. In vivo CN mixed with TFLL in a manner similar to CN/MGS interactions in vitro, and resulted in enhanced thickness of TFLL. In vitro and in vivo data complement each other and facilitated the study of the composition-structure-function relationship that determines the impact of cationic nanoemulsions on TF.

  3. Phosphorylation of chloroform soluble compounds in plasma membranes of human epidermoid carcinoma A431 cells

    International Nuclear Information System (INIS)

    Brautigan, D.L.; Randazzo, P.; Shriner, C.; Fain, J.N.

    1985-01-01

    This study investigated a possible role for the epidermal growth factor (EGF) receptor protein tyrosine kinase in phosphoinositide metabolism with plasma membrane vesicles from human epidermoid carcinoma (A431) cells. The authors found a novel chloroform-soluble product radiolabeled with [gamma- 32 P]ATP that did not migrate from the origin in the thin layer system designed to separate the phosphoinositides, appeared as a single band of Mr = 3500 on polyacrylamide gels in the presence of dodecyl sulfate, had an ultraviolet absorbance spectrum with a maximum at 275 nm and stained with Coomassie dye. Based on these properties this phosphorylation product is referred to as a proteolipid. The 32 P label was not detected in phosphotyrosine [Tyr(P)], phosphoserine [Ser(P)] or phosphothreonine [Thr(P)] and was lost during acid or base hydrolysis. Phosphorylation of proteolipid was increased significantly by EGF, whereas phosphorylation of phosphatidic acid was decreased and labeling of phosphoinositides was unaffected. Thus, it appears that in A431 membranes the EGF receptor/kinase does not utilize phosphatidylinositol as a substrate, but does phosphorylate a membrane proteolipid

  4. Progress towards in vitro quantitative imaging of human femur using compound quantitative ultrasonic tomography

    International Nuclear Information System (INIS)

    Lasaygues, Philippe; Ouedraogo, Edgard; Lefebvre, Jean-Pierre; Gindre, Marcel; Talmant, Marilyne; Laugier, Pascal

    2005-01-01

    The objective of this study is to make cross-sectional ultrasonic quantitative tomography of the diaphysis of long bones. Ultrasonic propagation in bones is affected by the severe mismatch between the acoustic properties of this biological solid and those of the surrounding soft medium, namely, the soft tissues in vivo or water in vitro. Bone imaging is then a nonlinear inverse-scattering problem. In this paper, we showed that in vitro quantitative images of sound velocities in a human femur cross section could be reconstructed by combining ultrasonic reflection tomography (URT), which provides images of the macroscopic structure of the bone, and ultrasonic transmission tomography (UTT), which provides quantitative images of the sound velocity. For the shape, we developed an image-processing tool to extract the external and internal boundaries and cortical thickness measurements. For velocity mapping, we used a wavelet analysis tool adapted to ultrasound, which allowed us to detect precisely the time of flight from the transmitted signals. A brief review of the ultrasonic tomography that we developed using correction algorithms of the wavepaths and compensation procedures are presented. Also shown are the first results of our analyses on models and specimens of long bone using our new iterative quantitative protocol

  5. Two immunosuppressive compounds from the mushroom Rubinoboletus ballouii using human peripheral blood mononuclear cells by bioactivity-guided fractionation.

    Science.gov (United States)

    Li, Long-Fei; Chan, Ben Chung-Lap; Yue, Grace Gar-Lee; Lau, Clara Bik-San; Han, Quan-Bin; Leung, Ping-Chung; Liu, Ji-Kai; Fung, Kwok-Pui

    2013-10-15

    Rubinoboletus ballouii is an edible mushroom wildly grown in Yunnan province, China. Up till now, little was known about the chemical and biological properties of this mushroom. The aim of this study was to investigate the immunomodulatory effects of the ethanolic extract of Rubinoboletus ballouii and its fractions on human peripheral blood mononuclear cells (PBMCs) using bioactivity-guided fractionation. The crude extract of the fruiting bodies of RB was fractionated by high-speed counter current chromatography (HSCCC). Twelve fractions were obtained and the third fraction (Fraction C) exerted the most potent anti-inflammatory activities in mitogen-activated PBMCs. Further fractionation of fraction C led to the isolation of two single compounds which were elucidated as 1-ribofuranosyl-s-triazin-2(1H)-one and pistillarin, respectively. The results showed that both 1-ribofuranosyl-s-triazin-2(1H)-one and pistillarin exhibited significant immunosuppressive effects on phytohemagglutinin (PHA)-stimulated human PBMCs by inhibiting [methyl-(3)H]-thymidine uptake and inflammatory cytokines productions such as tumor necrosis factor (TNF)-α, interleukin (IL)-10, interferon (IFN)-γ and IL-1β. Besides, 1-ribofuranosyl-s-triazin-2(1H)-one was firstly found in natural resources, and pistillarin was also isolated from the family Boletaceae for the first time. They exhibited great potential in developing as anti-inflammatory reagents. Copyright © 2013 Elsevier GmbH. All rights reserved.

  6. Anti-inflammatory compound resveratrol suppresses homocysteine formation in stimulated human peripheral blood mononuclear cells in vitro.

    Science.gov (United States)

    Schroecksnadel, Katharina; Winkler, Christiana; Wirleitner, Barbara; Schennach, Harald; Weiss, Günter; Fuchs, Dietmar

    2005-01-01

    Inflammation, immune activation and oxidative stress play a major role in the pathogenesis of cardiovascular disorders. In addition to markers of inflammation, moderate hyperhomocysteinemia is an independent risk factor for cardiovascular disease, and there is a link between the activation of immunocompetent cells and the enhanced formation of homocysteine in vitro. Likewise, anti-inflammatory drugs and nutrients rich in antioxidant vitamins are able to reduce cardiovascular risk and to slow down the atherogenic process. Resveratrol, a phenolic antioxidant synthesized in grapes and vegetables and present in wine, has also been supposed to be beneficial for the prevention of cardiovascular events. Apart from its strong antioxidant properties, resveratrol has also been demonstrated to act as an anti-inflammatory agent. In this study the influence of resveratrol on the production of homocysteine by stimulated human peripheral blood mononuclear cells (PBMCs) was investigated. Results were compared to earlier described effects of the anti-inflammatory compounds aspirin and salicylic acid and of the lipid-lowering drug atorvastatin. Stimulation of PBMCs with the mitogens concanavalin A and phytohemagglutinin induced significantly higher homocysteine accumulation in supernatants compared with unstimulated cells. Treatment with 10-100 muM resveratrol suppressed homocysteine formation in a dose-dependent manner. Resveratrol did not influence the release of homocysteine from resting PBMCs. The data suggest that resveratrol may prevent homocysteine accumulation in the blood by suppressing immune activation cascades and the proliferation of mitogen-driven T-cells. The effect of resveratrol to down-regulate the release of homo-cysteine was comparable to the decline of neopterin concentrations in the same experiments. The suppressive effect of resveratrol was very similar to results obtained earlier with aspirin, salicylic acid and atorvastatin; however, it appeared that doses

  7. Determination of the levels of dioxin and dioxin-like compounds in the Australian population by analysis of pooled human breast milk

    Energy Technology Data Exchange (ETDEWEB)

    Harden, F.; Mueller, J.F.; Toms, L.M.L.; Moore, M. [National Research Centre for Environmental Toxicology, The Univ. of Queensland, Brisbane (Australia); Burniston, D.; Symons, R. [AGAL, Sydney (Australia); Ahokas, J. [RMIT, Melbourne (Australia); Fuerst, P. [State Lab. of NRW, Muenster (Germany); Paepke, O. [ERGO Forschungsgesellschaft, Hamburg (Germany)

    2004-09-15

    Dioxin-like compounds are ubiquitously distributed and humans are exposed to them via various sources but primarily through food. They can be detected in air, water, soil, sediment and biota. These compounds are lipid soluble, poorly eliminated and thus can accumulate in human adipose tissue. They can cross the placenta and are also transferred to breast milk during the lactation process. Therefore infants are exposed ante and postnatally. Since PCDD/PCDF concentration in blood and human milk are very similar when concentrations are expressed on a lipid basis, human milk provides a good monitoring tool of exposure for a given population in a given area. Previously the WHO has co-ordinated international studies on dioxin-like compounds in breast milk. These were conducted in 1987/88, 1992/93 and 2001. In summary, these studies demonstrated that levels of dioxins in breast milk are relatively high in industrialised countries when compared to non-industrialised countries that PCDD/PCDFs were higher in human milk from mothers with their first child and that the levels decrease over a given lactation period. The present study aims to examine the levels of these compounds in primiparae women throughout Australia.

  8. Analytical method for biomonitoring of endocrine-disrupting compounds (bisphenol A, parabens, perfluoroalkyl compounds and a brominated flame retardant) in human hair by liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Martín, Julia; Santos, Juan Luis; Aparicio, Irene, E-mail: iaparicio@us.es; Alonso, Esteban

    2016-11-16

    In this paper, a method for the determination of four groups of endocrine-disrupting compounds in human hair is proposed. Target compounds were a plastic monomer (bisphenol A), three parabens commonly used as preservatives (methylparaben, ethylparaben and propylparaben), six perfluoroalkyl compounds commonly used as water, oil and dirt repellents (perfluorooctane sulfonic acid and five perfluoroalkyl carboxylic acids, with alkyl chains from four to eight carbon atoms) and a brominated flame retardant (hexabromocyclododecane). All of them are of especial concern to human health because they are utilized in many everyday products. The method is based on hair incubation with methanol/acetic acid solution (85:15, v/v), extraction with acetone for 15 min in an ultrasonic bath and analysis by liquid chromatography-electrospray-tandem mass spectrometry in negative ionization mode. Limits of quantification in hair samples ranged from 0.6 ng g{sup −1} to 6.1 ng g{sup −1}, except for hexabromocyclododecane (36 ng g{sup −1}). Recoveries were higher than 69%. Intra-day and inter-day precision, expressed as relative standard deviation, were lower than 15% and 10%, respectively. The applicability of the method was proven by analyzing the target compounds in hair samples from six volunteers. High frequencies of detection and concentrations were obtained for bisphenol A (83% of samples; concentrations up to 158 ng g{sup −1}) and parabens (100% of samples; concentrations up to 624 ng g{sup −1}). Lower concentrations were detected for the perfluoroalkyl compounds (up to 13 ng g{sup −1}). Hexabromocyclododecane was not detected. - Highlights: • Method for biomonitoring of endocrine-disrupting compounds in human hair. • Target compounds are commonly present in everyday products. • Method based on hair digestion and liquid chromatography-tandem mass spectrometry. • Good sensitivity, recoveries and precision and low matrix effect were obtained.

  9. Analytical method for biomonitoring of endocrine-disrupting compounds (bisphenol A, parabens, perfluoroalkyl compounds and a brominated flame retardant) in human hair by liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Martín, Julia; Santos, Juan Luis; Aparicio, Irene; Alonso, Esteban

    2016-01-01

    In this paper, a method for the determination of four groups of endocrine-disrupting compounds in human hair is proposed. Target compounds were a plastic monomer (bisphenol A), three parabens commonly used as preservatives (methylparaben, ethylparaben and propylparaben), six perfluoroalkyl compounds commonly used as water, oil and dirt repellents (perfluorooctane sulfonic acid and five perfluoroalkyl carboxylic acids, with alkyl chains from four to eight carbon atoms) and a brominated flame retardant (hexabromocyclododecane). All of them are of especial concern to human health because they are utilized in many everyday products. The method is based on hair incubation with methanol/acetic acid solution (85:15, v/v), extraction with acetone for 15 min in an ultrasonic bath and analysis by liquid chromatography-electrospray-tandem mass spectrometry in negative ionization mode. Limits of quantification in hair samples ranged from 0.6 ng g"−"1 to 6.1 ng g"−"1, except for hexabromocyclododecane (36 ng g"−"1). Recoveries were higher than 69%. Intra-day and inter-day precision, expressed as relative standard deviation, were lower than 15% and 10%, respectively. The applicability of the method was proven by analyzing the target compounds in hair samples from six volunteers. High frequencies of detection and concentrations were obtained for bisphenol A (83% of samples; concentrations up to 158 ng g"−"1) and parabens (100% of samples; concentrations up to 624 ng g"−"1). Lower concentrations were detected for the perfluoroalkyl compounds (up to 13 ng g"−"1). Hexabromocyclododecane was not detected. - Highlights: • Method for biomonitoring of endocrine-disrupting compounds in human hair. • Target compounds are commonly present in everyday products. • Method based on hair digestion and liquid chromatography-tandem mass spectrometry. • Good sensitivity, recoveries and precision and low matrix effect were obtained. • Method was successfully

  10. Exposure to perfluorononanoic acid combined with a low-dose mixture of 14 human-relevant compounds disturbs energy/lipid homeostasis in rats

    DEFF Research Database (Denmark)

    Skov, Kasper; Kongsbak, Kristine Grønning; Hadrup, Niels

    2015-01-01

    , whereas effects on lipid metabolism in the liver were mainly driven by PFNA. This study verifies that a chemical mixture given at high-end human exposure levels can affect lipid homeostasis and that the combined use of metabolomics and transcriptomics can provide complimentary information allowing......Humans are constantly exposed to a significant number of compounds and many are readily detected in human body fluids. Worryingly, several of these compounds are either suspected to be, or have already been shown to be harmful to humans either individually or in combination. However, the potential...... consequences of low-dose exposure to complex mixtures remain poorly understood. We have profiled the effects on rat blood plasma and liver homeostasis using metabolomics and transcriptomics following 2-week exposure to either a mixture of 14 common chemicals (Mix), perfluorononanoic acid (PFNA) at low (0...

  11. Increasing human Th17 differentiation through activation of orphan nuclear receptor retinoid acid-related orphan receptor γ (RORγ) by a class of aryl amide compounds.

    Science.gov (United States)

    Zhang, Wei; Zhang, Jing; Fang, Leiping; Zhou, Ling; Wang, Shuai; Xiang, Zhijun; Li, Yuan; Wisely, Bruce; Zhang, Guifeng; An, Gang; Wang, Yonghui; Leung, Stewart; Zhong, Zhong

    2012-10-01

    In a screen for small-molecule inhibitors of retinoid acid-related orphan receptor γ (RORγ), we fortuitously discovered that a class of aryl amide compounds behaved as functional activators of the interleukin 17 (IL-17) reporter in Jurkat cells. Three of these compounds were selected for further analysis and found to activate the IL-17 reporter with potencies of ∼0.1 μM measured by EC₅₀. These compounds were shown to directly bind to RORγ by circular dichroism-based thermal stability experiments. Furthermore, they can enhance an in vitro Th17 differentiation process in human primary T cells. As RORγ remains an orphan nuclear receptor, discovery of these aryl amide compounds as functional agonists will now provide pharmacological tools for us to dissect functions of RORγ and facilitate drug discovery efforts for immune-modulating therapies.

  12. Suitability of fluorescent whitening compounds (FWCs) as indicators of human faecal contamination from septic tanks in rural catchments.

    Science.gov (United States)

    Dubber, Donata; Gill, Laurence W

    2017-12-15

    Rural river catchments are impacted by diffuse pollution sources from agricultural practices and on-site domestic wastewater treatment systems (DWWTS), mainly septic tanks. Methods that can distinguish between contamination sources will significantly increase water management efficiency as they will allow for the development and application of targeted remediation measures. Fluorescent whitening compounds (FWC), are used as optical brighteners in laundry detergents and enter the environment through the discharge of domestic wastewater effluents. Due to their human specific source and potential simple fluorometric measurement this represents a very attractive method to be used by state monitoring agencies. In this study the suitability of FWCs as chemical indicators for human faecal contamination has been investigated in rural Irish catchments. It was found that no quantitative measurements are possible for FWCs in natural waters when using simple fluorometric methods. Hence a simple presence/absence approach needs to be applied. The detectability of FWCs was quantified and found to decrease with higher organic matter content of the river water which has its own fluorescence. This enabled the establishment of equations to predict detection limits and assess the method's suitability for individual catchments based on organic matter concentrations. Furthermore a modified photodecay method is suggested that increases sensitivity of the technique by up to 59%. Applications at rural study sites found some removal of FWCs in percolation areas of DWWTSs but they were still detectable 40 cm below the infiltration depth. FWCs were also detected as distinguishable peaks in impacted streams where septic tank effluents have a high contribution to the river flow. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Compound heterozygous mutations (p.Leu13Pro and p.Tyr294*) associated with factor VII deficiency cause impaired secretion through ineffective translocation and extensive intracellular degradation of factor VII.

    Science.gov (United States)

    Suzuki, Keijiro; Sugawara, Takeshi; Ishida, Yoji; Suwabe, Akira

    2013-02-01

    Congenital coagulation factor VII (FVII) deficiency is a rare coagulation disease. We investigated the molecular mechanisms of this FVII deficiency in a patient with compound heterozygous mutations. A 22-year-old Japanese female was diagnosed with asymptomatic FVII deficiency. The FVII activity and antigen were greatly reduced (activity, 13.0%; antigen, 10.8%). We analyzed the F7 gene of this patient and characterized mutant FVII proteins using in vitro expression studies. Sequence analysis revealed that the patient was compound heterozygous with a point mutation (p.Leu13Pro) in the central hydrophobic core of the signal peptides and a novel non-sense mutation (p.Tyr294*) in the catalytic domain. Expression studies revealed that mutant FVII with p.Leu13Pro (FVII13P) showed less accumulation in the cells (17.5%) and less secretion into the medium (64.8%) than wild type showed. Truncated FVII resulting from p.Tyr294* (FVII294X) was also decreased in the cells (32.0%), but was not secreted into the medium. Pulse-chase experiments revealed that both mutants were extensively degraded intracellularly compared to wild type. The majority of FVII13P cannot translocate into endoplasmic reticulum (ER). However, a small amount of FVII13P was processed normally with post-translational modifications and was secreted into the medium. The fact that FVII294X was observed only in ER suggests that it is retained in ER. Proteasome apparently plays a central role in these degradations. These findings demonstrate that both mutant FVIIs impaired secretion through ineffective translocation to and retention in ER with extensive intracellular degradation, resulting in an insufficient phenotype. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Comparison of aryl hydrocarbon hydroxylase and acetanilide 4-hydroxylase induction by polycyclic aromatic compounds in human and mouse cell lines.

    Science.gov (United States)

    Jaiswal, A K; Nebert, D W; Eisen, H W

    1985-08-01

    The human MCF-7 and the mouse Hepa-1 cell culture lines were compared for aryl hydrocarbon hydroxylase and acetanilide 4-hydroxylase inducibility by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and benzo[a]anthracene (BA) and TCDD- and BA-specific binding in the cytosol and nucleus. The effective concentration of BA in the growth medium required to induce either enzyme to 50% of its maximally inducible activity (EC50) was the same (5-11 microM) in both MCF-7 and Hepa-1 cells. On the other hand, the EC50 for TCDD in MCF-7 cells (5-25 nM) was more than 40-fold greater than that in Hepa-1 cells (0.4 to 0.6 nM). P1-450- and P3-450-specific mouse cDNA probes were used to quantitate mRNA induction in the Hepa-1 cell line. P1-450 mRNA was induced markedly by TCDD and benzo[a] anthracene, whereas P3-450 mRNA was induced negligibly. A P1-450-specific human cDNA probe was used to quantitate P1-450 mRNA induction in the MCF-7 cell line. Aryl hydrocarbon hydroxylase inducibility by TCDD or BA always paralleled P1-450 mRNA inducibility in either the mouse or human line. Although the cytosolic Ah receptor in Hepa-1 cells was easily detected by sucrose density gradient centrifugation, gel permeation chromatography, and anion-exchange high-performance liquid chromatography, the cytosolic receptor cannot be detected in MCF-7 cells. Following in vivo exposure of cultures to radiolabeled TCDD, the intranuclear concentration of inducer-receptor complex was at least fifty times greater in Hepa-1 than MCF-7 cultures. The complete lack of measurable cytosolic receptor and almost totally absent inducer-receptor complex in the nucleus of MCF-7 cells was, therefore, out of proportion to its capacity for aryl hydrocarbon hydroxylase and acetanilide 4-hydroxylase inducibility. This MCF-7 line should provide an interesting model for a better understanding of the mechanisms of drug-metabolizing enzyme induction by polycyclic aromatic compounds, including the Ah receptor-mediated mechanism.

  15. Impairment of the transition from proliferative stage to prehypertrophic stage in chondrogenic differentiation of human induced pluripotent stem cells harboring the causative mutation of achondroplasia in fibroblast growth factor receptor 3

    Directory of Open Access Journals (Sweden)

    Naohiro Horie

    2017-06-01

    Conclusions: These results suggested that chondrocyte maturation was impaired between the proliferative stage and prehypertrophic stage in the chondrocytes of ACH. The development of chemical compounds which affect the specific maturation stage of chondrocytes is expected to contribute to the ACH treatment, and FGFR3 genome-edited hiPSCs will be a valuable tool in such research studies.

  16. Rejoining of DNA double-strand breaks in human fibroblasts and its impairment in one ataxia telangiectasia and two Fanconi strains

    International Nuclear Information System (INIS)

    Coquerelle, T.M.; Weibezahn, K.F.

    1981-01-01

    Using the technique of neutral elution through polycarbonate filters as a measure of DNA length, and hence of the number of double-strand breaks incurred as a result of radiation damage, we found that normal human fibroblasts rejoin 50% of all breaks within only 3 min (37 degrees C). This fast rejoining was impaired in fibroblasts from one patient with Ataxia telangiectasia and in fibroblasts from two patients with Fanconi's anemia. Also the number of residual breaks after several hours of repair was higher than in control cells. Other cases with the same diseases were normal in their rejoining of double-strand breaks

  17. PD-L1 Expression Induced by the 2009 Pandemic Influenza A(H1N1 Virus Impairs the Human T Cell Response

    Directory of Open Access Journals (Sweden)

    Nuriban Valero-Pacheco

    2013-01-01

    Full Text Available PD-L1 expression plays a critical role in the impairment of T cell responses during chronic infections; however, the expression of PD-L1 on T cells during acute viral infections, particularly during the pandemic influenza virus (A(H1N1pdm09, and its effects on the T cell response have not been widely explored. We found that A(H1N1pdm09 virus induced PD-L1 expression on human dendritic cells (DCs and T cells, as well as PD-1 expression on T cells. PD-L1 expression impaired the T cell response against A(H1N1pdm09 by promoting CD8+ T cell death and reducing cytokine production. Furthermore, we found increased PD-L1 expression on DCs and T cells from influenza-infected patients from the first and second 2009 pandemic waves in Mexico City. PD-L1 expression on CD8+ T cells correlated inversely with T cell proportions in patients infected with A(H1N1pdm09. Therefore, PD-L1 expression on DCs and T cells could be associated with an impaired T cell response during acute infection with A(H1N1pdm09 virus.

  18. Arctigenin, a natural lignan compound, induces G0/G1 cell cycle arrest and apoptosis in human glioma cells.

    Science.gov (United States)

    Maimaitili, Aisha; Shu, Zunhua; Cheng, Xiaojiang; Kaheerman, Kadeer; Sikandeer, Alifu; Li, Weimin

    2017-02-01

    The aim of the current study was to investigate the anticancer potential of arctigenin, a natural lignan compound, in malignant gliomas. The U87MG and T98G human glioma cell lines were treated with various concentrations of arctigenin for 48 h and the effects of arctigenin on the aggressive phenotypes of glioma cells were assessed. The results demonstrated that arctigenin dose-dependently inhibited the growth of U87MG and T98G cells, as determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and bromodeoxyuridine incorporation assays. Arctigenin exposure also induced a 60-75% reduction in colony formation compared with vehicle-treated control cells. However, arctigenin was not observed to affect the invasiveness of glioma cells. Arctigenin significantly increased the proportion of cells in the G 0 /G 1 phase and reduced the number of cells in the S phase, as compared with the control group (Parctigenin increased the expression levels of p21, retinoblastoma and p53 proteins, and significantly decreased the expression levels of cyclin D1 and cyclin-dependent kinase 4 proteins. Additionally, arctigenin was able to induce apoptosis in glioma cells, coupled with increased expression levels of cleaved caspase-3 and the pro-apoptotic BCL2-associated X protein. Furthermore, arctigenin-induced apoptosis was significantly suppressed by the pretreatment of cells with Z-DEVD-FMK, a caspase-3 inhibitor. In conclusion, the results suggest that arctigenin is able to inhibit cell proliferation and may induce apoptosis and cell cycle arrest at the G 0 /G 1 phase in glioma cells. These results warrant further investigation of the anticancer effects of arctigenin in animal models of gliomas.

  19. Structure-dependent binding and activation of perfluorinated compounds on human peroxisome proliferator-activated receptor γ

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Lianying [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China); College of Life Science, Dezhou University, Dezhou 253023 (China); Ren, Xiao-Min; Wan, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China); Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China)

    2014-09-15

    Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group. For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.

  20. Impairments and compensation in mouth and limb use in free feeding after unilateral dopamine depletions in a rat analog of human Parkinson's disease.

    Science.gov (United States)

    Whishaw, I Q; Coles, B L; Pellis, S M; Miklyaeva, E I

    1997-03-01

    Rats depleted unilaterally of dopamine (DA) with the neurotoxin 6-hydroxydopamine (6-OHDA) have contralateral sensorimotor deficits. These include pronounced impairments in using the contralateral limbs (bad limbs) for skilled movements in tests of reaching and bar pressing. There has been no systematic examination of the changes that take place in movements of spontaneous food handling. This was the purpose of the present study. Rats were filmed as they picked up and ate pieces of angel hair pasta (Capelli d'Angelo), a food item that challenges the rats to use delicate and bilaterally coordinated limb and paw movements. Control rats picked up the food with their incisors, transferred it to their paws, and manipulated it using a variety of bilaterally coordinated limb and paw movements. The DA-depleted rats were impaired in both their mouth and paw movements. They seemed unable to use their teeth to grasp the food and so used their tongue. They did not use the bad side of their mouth to chew and relied upon the good side of their mouth. The bad paw was impaired in grasping the food, grasped only with a whole paw grip, did not make manipulatory movements, and did not open to release the food or open to regain support once the food was eaten. Although the rats improved over a 30-day recovery period, much of the improvement was due to compensatory adjustments. That unilateral DA-depletion results in profound contralateral impairments of the mouth and limb with improvements due mainly to compensatory adjustments confirms a role for dopaminergic systems in motor control. Additionally, the behavioral tests described here could provide important adjuncts for assessing therapies in this animal analog of human Parkinson's disease.

  1. Quantification of the Triazole Antifungal Compounds Voriconazole and Posaconazole in Human Serum or Plasma Using Liquid Chromatography Electrospray Tandem Mass Spectrometry (HPLC-ESI-MS/MS).

    Science.gov (United States)

    Molinelli, Alejandro R; Rose, Charles H

    2016-01-01

    Voriconazole and posaconazole are triazole antifungal compounds used in the treatment of fungal infections. Therapeutic drug monitoring of both compounds is recommended in order to guide drug dosing to achieve optimal blood concentrations. In this chapter we describe an HPLC-ESI-MS/MS method for the quantification of both compounds in human plasma or serum following a simple specimen preparation procedure. Specimen preparation consists of protein precipitation using methanol and acetonitrile followed by a cleanup step that involves filtration through a cellulose acetate membrane. The specimen is then injected into an HPLC-ESI-MS/MS equipped with a C18 column and separated over an acetonitrile gradient. Quantification of the drugs in the specimen is achieved by comparing the response of the unknown specimen to that of the calibrators in the standard curve using multiple reaction monitoring.

  2. Pathogenic mutations of the human mitochondrial citrate carrier SLC25A1 lead to impaired citrate export required for lipid, dolichol, ubiquinone and sterol synthesis.

    Science.gov (United States)

    Majd, Homa; King, Martin S; Smith, Anthony C; Kunji, Edmund R S

    2018-01-01

    Missense mutations of the human mitochondrial citrate carrier, encoded by the SLC25A1 gene, lead to an autosomal recessive neurometabolic disorder characterised by neonatal-onset encephalopathy with severe muscular weakness, intractable seizures, respiratory distress, and lack of psychomotor development, often resulting in early death. Here, we have measured the effect of all twelve known pathogenic mutations on the transport activity. The results show that nine mutations abolish transport of citrate completely, whereas the other three reduce the transport rate by >70%, indicating that impaired citrate transport is the most likely primary cause of the disease. Some mutations may be detrimental to the structure of the carrier, whereas others may impair key functional elements, such as the substrate binding site and the salt bridge network on the matrix side of the carrier. To understand the consequences of impaired citrate transport on metabolism, the substrate specificity was also determined, showing that the human citrate carrier predominantly transports citrate, isocitrate, cis-aconitate, phosphoenolpyruvate and malate. Although D-2- and L-2 hydroxyglutaric aciduria is a metabolic hallmark of the disease, it is unlikely that the citrate carrier plays a significant role in the removal of hydroxyglutarate from the cytosol for oxidation to oxoglutarate in the mitochondrial matrix. In contrast, computer simulations of central metabolism predict that the export of citrate from the mitochondrion cannot be fully compensated by other pathways, restricting the cytosolic production of acetyl-CoA that is required for the synthesis of lipids, sterols, dolichols and ubiquinone, which in turn explains the severe disease phenotypes. Copyright © 2017. Published by Elsevier B.V.

  3. Human surfactant protein A2 gene mutations impair dimmer/trimer assembly leading to deficiency in protein sialylation and secretion.

    Directory of Open Access Journals (Sweden)

    Yi Song

    Full Text Available Surfactant protein A2 (SP-A2 plays an essential role in surfactant metabolism and lung host defense. SP-A2 mutations in the carbohydrate recognition domain have been related to familial pulmonary fibrosis and can lead to a recombinant protein secretion deficiency in vitro. In this study, we explored the molecular mechanism of protein secretion deficiency and the subsequent biological effects in CHO-K1 cells expressing both wild-type and several different mutant forms of SP-A2. We demonstrate that the SP-A2 G231V and F198S mutants impair the formation of dimmer/trimer SP-A2 which contributes to the protein secretion defect. A deficiency in sialylation, but not N-linked glycosylation, is critical to the observed dimmer/trimer impairment-induced secretion defect. Furthermore, both mutant forms accumulate in the ER and form NP-40-insoluble aggregates. In addition, the soluble mutant SP-A2 could be partially degraded through the proteasome pathway but not the lysosome or autophagy pathway. Intriguingly, 4-phenylbutyrate acid (4-PBA, a chemical chaperone, alleviates aggregate formation and partially rescued the protein secretion of SP-A2 mutants. In conclusion, SP-A2 G231V and F198S mutants impair the dimmer/trimer assembly, which contributes to the protein sialylation and secretion deficiency. The intracellular protein mutants could be partially degraded through the proteasome pathway and also formed aggregates. The treatment of the cells with 4-PBA resulted in reduced aggregation and rescued the secretion of mutant SP-A2.

  4. Identification and quantification of major maillard cross-links in human serum albumin and lens protein. Evidence for glucosepane as the dominant compound.

    Science.gov (United States)

    Biemel, Klaus M; Friedl, D Alexander; Lederer, Markus O

    2002-07-12

    Glycation reactions leading to protein modifications (advanced glycation end products) contribute to various pathologies associated with the general aging process and long term complications of diabetes. However, only few relevant compounds have so far been detected in vivo. We now report on the first unequivocal identification of the lysine-arginine cross-links glucosepane 5, DOGDIC 6, MODIC 7, and GODIC 8 in human material. For their accurate quantification by coupled liquid chromatography-electrospray ionization mass spectrometry, (13)C-labeled reference compounds were synthesized independently. Compounds 5-8 are formed via the alpha-dicarbonyl compounds N(6)-(2,3-dihydroxy-5,6-dioxohexyl)-l-lysinate (1a,b), 3-deoxyglucosone (), methylglyoxal (), and glyoxal (), respectively. The protein-bound dideoxyosone 1a,b seems to be of prime significance for cross-linking because it presumably is not detoxified by mammalian enzymes as readily as 2-4. Hence, the follow-up product glucosepane 5 was found to be the dominant compound. Up to 42.3 pmol of 5/mg of protein was identified in human serum albumin of diabetics; the level of 5 correlates markedly with the glycated hemoglobin HbA(1c). In the water-insoluble fraction of lens proteins from normoglycemics, concentration of 5 ranges between 132.3 and 241.7 pmol/mg. The advanced glycoxidation end product GODIC 8 is elevated significantly in brunescent lenses, indicating enhanced oxidative stress in this material. Compounds 5-8 thus appear predestined as markers for pathophysiological processes.

  5. Impaired NFAT and NFκB activation are involved in suppression of CD40 ligand expression by Δ9-tetrahydrocannabinol in human CD4+ T cells

    International Nuclear Information System (INIS)

    Ngaotepprutaram, Thitirat; Kaplan, Barbara L.F.; Kaminski, Norbert E.

    2013-01-01

    We have previously reported that Δ 9 -tetrahydrocannabinol (Δ 9 -THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4 + T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ 9 -THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ 9 -THC attenuated CD40L expression in human CD4 + T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ 9 -THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ 9 -THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ 9 -THC suppresses human T cell function. - Highlights: • Δ 9 -THC attenuated CD40L expression in activated human CD4+ T cells. • Δ 9 -THC suppressed DNA-binding activity of NFAT and NFκB. • Δ 9 -THC impaired elevation of intracellular Ca2+. • Δ 9 -THC did not affect phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β

  6. Human Health Risk Assessment of a landfill based on volatile organic compounds emission, immission and soil gas concentration measurements

    International Nuclear Information System (INIS)

    Martí, Vicenç; Jubany, Irene; Pérez, Consol; Rubio, Xavier; De Pablo, Joan; Giménez, Javier

    2014-01-01

    Highlights: • VOCs were quantified as emission fluxes, immission and soil–gas levels. • HHRA was performed with these measurements and admissible risk was obtained. • VOCs that contributed more to risk indexes were chlorinated aliphatics hydrocarbons. • The methodology approach can be applied to other landfills with potential risk. - Abstract: A Human Health Risk Assessment (HHRA) was required for a closed landfill located in Cerdanyola del Vallès (Barcelona, Spain). The HHRA had two objectives, to evaluate the present risk of the identified receptors in the area and to safely develop the future urban planning of the area, therefore 3 scenarios for the current situation and 4 for the future situation were developed. After reviewing the existing data and exploring the needs of information, the assessment in this study was focused on the measurement of volatile organic compounds (VOCs) fluxes from the subsoil (emission from the landfill at 5 points), concentrations of VOCs in the air (immission in 4 urban sites) and concentration of VOCs in soil–gas (measurements at 5 m below ground surface outside the landfill at 8 sites). Around 70 VOCs were analyzed by using multi-sorbent tubes and Thermal Desorption Gas Chromatography (TD–GC–MS). The VOCs that were detected and quantified include alkanes, aromatic hydrocarbons, alcohols, ketones, halocarbons, aldehydes, esters, terpenoids, ethers and some nitrogenated and sulfur compounds, furans and carboxylic acids. Specific mercury flux measurements were performed in a hot spot by using carulite tubes, that were also analyzed by using Thermal Decomposition, Amalgamation, and Atomic Absorption Spectrophotometry. Results showed average values of volatile emission fluxes ranging from non-detected to 331 μg m −2 day −1 (dichlorodifluoromethane). In the case of immission, the concentration of VOCs measured in the air of populated area surrounding the landfill ranged values from non-detected to 42.0 μg m −3

  7. Inhibitory effects of black pepper (Piper nigrum) extracts and compounds on human tumor cell proliferation, cyclooxygenase enzymes, lipid peroxidation and nuclear transcription factor-kappa-B.

    Science.gov (United States)

    Liu, Yunbao; Yadev, Vivek R; Aggarwal, Bharat B; Nair, Muraleedharan G

    2010-08-01

    Black pepper (Piper nigrum) and hot pepper (Capsicum spp.) are widely used in traditional medicines. Although hot Capsicum spp. extracts and its active principles, capsaicinoids, have been linked with anticancer and anti-inflammatory activities, whether black pepper and its active principle exhibit similar activities is not known. In this study, we have evaluated the antioxidant, anti-inflammatory and anticancer activities of extracts and compounds from black pepper by using proinflammatory transcription factor NF-kappaB, COX-1 and -2 enzymes, human tumor cell proliferation and lipid peroxidation (LPO). The capsaicinoids, the alkylamides, isolated from the hot pepper Scotch Bonnet were also used to compare the bioactivities of alkylamides and piperine from black pepper. All compounds derived from black pepper suppressed TNF-induced NF-kappaB activation, but alkyl amides, compound 4 from black pepper and 5 from hot pepper, were most effective. The human cancer cell proliferation inhibitory activities of piperine and alklyl amides in Capsicum and black pepper were dose dependant. The inhibitory concentrations 50% (IC50) of the alklylamides were in the range 13-200 microg/mL. The extracts of black pepper at 200 microg/mL and its compounds at 25 microg/mL inhibited LPO by 45-85%, COX enzymes by 31-80% and cancer cells proliferation by 3.5-86.8%. Overall, these results suggest that black pepper and its constituents like hot pepper, exhibit anti-inflammatory, antioxidant and anticancer activities.

  8. Fast gradient HPLC method to determine compounds binding to human serum albumin. Relationships with octanol/water and immobilized artificial membrane lipophilicity.

    Science.gov (United States)

    Valko, Klara; Nunhuck, Shenaz; Bevan, Chris; Abraham, Michael H; Reynolds, Derek P

    2003-11-01

    A fast gradient HPLC method (cycle time 15 min) has been developed to determine Human Serum Albumin (HSA) binding of discovery compounds using chemically bonded protein stationary phases. The HSA binding values were derived from the gradient retention times that were converted to the logarithm of the equilibrium constants (logK HSA) using data from a calibration set of molecules. The method has been validated using literature plasma protein binding data of 68 known drug molecules. The method is fully automated, and has been used for lead optimization in more than 20 company projects. The HSA binding data obtained for more than 4000 compounds were suitable to set up global and project specific quantitative structure binding relationships that helped compound design in early drug discovery. The obtained HSA binding of known drug molecules were compared to the Immobilized Artificial Membrane binding data (CHI IAM) obtained by our previously described HPLC-based method. The solvation equation approach has been used to characterize the normal binding ability of HSA, and this relationship shows that compound lipophilicity is a significant factor. It was found that the selectivity of the "baseline" lipophilicity governing HSA binding, membrane interaction, and octanol/water partition are very similar. However, the effect of the presence of positive or negative charges have very different effects. It was found that negatively charged compounds bind more strongly to HSA than it would be expected from the lipophilicity of the ionized species at pH 7.4. Several compounds showed stronger HSA binding than can be expected from their lipophilicity alone, and comparison between predicted and experimental binding affinity allows the identification of compounds that have good complementarities with any of the known binding sites. Copyright 2003 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 92:2236-2248, 2003

  9. Visual Impairment

    Science.gov (United States)

    ... site Sitio para adolescentes Body Mind Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español Visual Impairment KidsHealth / For Teens / Visual Impairment What's in ...

  10. A human fecal contamination index for ranking impaired recreational watersusing the HF183 quantitative real-time PCR method

    Science.gov (United States)

    Human fecal pollution of surface water remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for recreational water quality risk managem...

  11. Per- and polyfluorinated compounds (PFCs) in house dust and indoor air in Catalonia, Spain: implications for human exposure.

    Science.gov (United States)

    Ericson Jogsten, I; Nadal, M; van Bavel, B; Lindström, G; Domingo, J L

    2012-02-01

    A total of 27 per- and polyfluorinated compounds (PFCs) were determined in both house dust (n=10) and indoor air (n=10) from selected homes in Catalonia, Spain. Concentrations were found to be similar or lower than those previously reported for household microenvironments in other countries. Ten PFCs were detected in all house dust samples. The highest mean concentrations corresponded to perfluorodecanoic acid (PFDA) and perfluorononanoic acid (PFNA), 10.7 ng/g (median: 1.5 ng/g) and 10.4 ng/g (median: 5.4 ng/g), respectively, while the 8:2 fluorotelomer alcohol (FTOH) was the dominating neutral PFC at a concentration of 0.41 ng/g (median: 0.35 ng/g). The indoor air was dominated by the FTOHs, especially the 8:2 FTOH at a mean (median) concentration of 51 pg/m(3) (median: 42 pg/m(3)). A limited number of ionic PFCs were also detected in the indoor air samples. Daily intakes of PFCs were estimated for average and worst case scenarios of human exposure from indoor sources. For toddlers, this resulted in average intakes of ∑ionic PFCs of 4.9ng/day (0.33 ng/kg(bw)/day for a 15 kg toddlers) and ∑neutral PFCs of 0.072 ng/day (0.005 ng/kg(bw)/day) from house dust. For adults, the average daily intakes of dust were 3.6 and 0.053 ng/day (0.05 and 0.001 ng/kg(bw)/day for a 70 kg adult) for ∑ionic and ∑neutral PFCs, respectively. The average daily inhalation of ∑neutral PFCs was estimated to be 0.9 and 1.3 ng/day (0.06 and 0.02 ng/kg(bw)/day) for toddlers and adults, respectively. For PFOS, the main ionic PFC detected in indoor air samples, the median intakes (based on those samples where PFOS was detected), resulted in indoor exposures of 0.06 and 0.11 ng/day (0.004 and 0.002 ng/kg(bw)/day) for toddlers and adults, respectively. Based on previous studies on dietary intake and drinking water consumption, both house dust and indoor air contribute significantly less to PFC exposure within this population. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

    International Nuclear Information System (INIS)

    Josse, Rozenn; Dumont, Julie; Fautrel, Alain; Robin, Marie-Anne; Guillouzo, André

    2012-01-01

    Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cell cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other

  13. Monitoring of selected skin- and breath-borne volatile organic compounds emitted from the human body using gas chromatography ion mobility spectrometry (GC-IMS).

    Science.gov (United States)

    Mochalski, Paweł; Wiesenhofer, Helmut; Allers, Maria; Zimmermann, Stefan; Güntner, Andreas T; Pineau, Nicolay J; Lederer, Wolfgang; Agapiou, Agapios; Mayhew, Christopher A; Ruzsanyi, Veronika

    2018-02-15

    Human smuggling and associated cross-border crimes have evolved as a major challenge for the European Union in recent years. Of particular concern is the increasing trend of smuggling migrants hidden inside shipping containers or trucks. Therefore, there is a growing demand for portable security devices for the non-intrusive and rapid monitoring of containers to detect people hiding inside. In this context, chemical analysis of volatiles organic compounds (VOCs) emitted from the human body is proposed as a locating tool. In the present study, an in-house made ion mobility spectrometer coupled with gas chromatography (GC-IMS) was used to monitor the volatile moieties released from the human body under conditions that mimic entrapment. A total of 17 omnipresent volatile compounds were identified and quantified from 35 ion mobility peaks corresponding to human presence. These are 7 aldehydes (acrolein, 2-methylpropanal, 3-methylbutanal, 2-ethacrolein, n-hexanal, n-heptanal, benzaldehyde), 3 ketones (acetone, 2-pentanone, 4-methyl-2-pentanone), 5 esters (ethyl formate, ethyl propionate, vinyl butyrate, butyl acetate, ethyl isovalerate), one alcohol (2-methyl-1-propanol) and one organic acid (acetic acid). The limits of detection (0.05-7.2 ppb) and relative standard deviations (0.6-11%) should be sufficient for detecting these markers of human presence in field conditions. This study shows that GC-IMS can be used as a portable field detector of hidden or entrapped people. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Acute interleukin-6 administration does not impair muscle glucose uptake or whole-body glucose disposal in healthy humans

    DEFF Research Database (Denmark)

    Steensberg, Adam; Fischer, Christian P; Sacchetti, Massimo

    2003-01-01

    adrenaline (epinephrine). IL-6 infusion, irrespective of dose, did not result in any changes to endogenous glucose production, whole-body glucose disposal or leg- glucose uptake. These data demonstrate that acute IL-6 administration does not impair whole-body glucose disposal, net leg-glucose uptake......The cytokine interleukin (IL)-6 has recently been linked with type 2 diabetes mellitus and has been suggested to affect glucose metabolism. To determine whether acute IL-6 administration affects whole-body glucose kinetics or muscle glucose uptake, 18 healthy young men were assigned to one of three...... the cessation of infusion (recovery) to determine endogenous glucose production and whole-body glucose disposal. Infusion with HiIL-6 and LoIL-6 resulted in a marked (P

  15. Antioxidant Activity of Inulin and Its Role in the Prevention of Human Colonic Muscle Cell Impairment Induced by Lipopolysaccharide Mucosal Exposure

    Science.gov (United States)

    Guarino, Michele Pier Luca; Locato, Vittoria; Cocca, Silvia; Cimini, Sara; Palma, Rossella; Alloni, Rossana; De Gara, Laura; Cicala, Michele

    2014-01-01

    Background Fructans, such as inulin, are dietary fibers which stimulate gastro-intestinal (GI) function acting as prebiotics. Lipopolysaccharide (LPS) impairs GI motility, through production of reactive oxygen species. The antioxidant activity of various fructans was tested and the protective effect of inulin on colonic smooth muscle cell (SMC) impairment, induced by exposure of human mucosa to LPS, was assessed in an ex vivo experimental model. Methods The antioxidant capacity of fructans was measured in an in vitro system that simulates cooking and digestion processes. Human colonic mucosa and submucosa, obtained from disease-free margins of resected segments for cancer, were sealed between two chambers, with the mucosal side facing upwards with Krebs solution with or without purified LPS from a pathogenic strain of Escherichia coli (O111:B4) and inulin (Frutafit IQ), and the submucosal side facing downwards into Krebs solution. The solutions on the submucosal side were collected following mucosal exposure to Krebs in the absence (N-undernatant) or presence of LPS (LPS-undernatant) or LPS+inulin (LPS+INU-undernatant). Undernatants were tested for their antioxidant activity and the effects on SMCs contractility. Inulin protective effects on mucosa and submucosa layers were assessed measuring the protein oxidation level in the experimental conditions analyzed. Results Antioxidant activity of inulin, which was significantly higher compared to simple sugars, remained unaltered despite cooking and digestion processes. Inulin protected the mucosal and submucosal layers against protein oxidation. Following exposure to LPS-undernatant, a significant decrease in maximal acetylcholine (Ach)-induced contraction was observed when compared to the contraction induced in cells incubated with the N-undernatant (4±1% vs 25±5% respectively, PInulin (35±5%). Conclusions Inulin protects the human colon mucosa from LPS-induced damage and this effect appears to be related to the

  16. Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells

    Science.gov (United States)

    Lafaille, Fabien G; Pessach, Itai M.; Zhang, Shen-Ying; Ciancanelli, Michael J.; Herman, Melina; Abhyankar, Avinash; Ying, Shui-Wang; Keros, Sotirios; Goldstein, Peter A.; Mostoslavsky, Gustavo; Ordovas-Montanes, Jose; Jouanguy, Emmanuelle; Plancoulaine, Sabine; Tu, Edmund; Elkabetz, Yechiel; Al-Muhsen, Saleh; Tardieu, Marc; Schlaeger, Thorsten M.; Daley, George Q.; Abel, Laurent; Casanova, Jean-Laurent; Studer, Lorenz; Notarangelo, Luigi D.

    2012-01-01

    In the course of primary infection with herpes simplex virus 1 (HSV-1), children with inborn errors of TLR3 immunity are prone to HSV-1 encephalitis (HSE) 1–3. We tested the hypothesis that the pathogenesis of HSE involves non hematopoietic central nervous system (CNS)-resident cells. We derived induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of TLR3- and UNC-93B-deficient patients and from controls. These iPSCs were differentiated into highly purified populations of neural stem cells (NSCs), neurons, astrocytes and oligodendrocytes. The induction of IFN-β and/or IFN-γ1 in response to poly(I:C) stimulation was dependent on TLR3 and UNC-93B in all cells tested. However, the induction of IFN-β and IFN-γ1 in response to HSV-1 infection was impaired selectively in UNC-93B-deficient neurons and oligodendrocytes. These cells were also much more susceptible to HSV-1 infection than control cells, whereas UNC-93B-deficient NSCs and astrocytes were not. TLR3-deficient neurons were also found to be susceptible to HSV-1 infection. The rescue of UNC-93B- and TLR3-deficient cells with the corresponding wild-type allele demonstrated that the genetic defect was the cause of the poly(I:C) and HSV-1 phenotypes. The viral infection phenotype was further rescued by treatment with exogenous IFN-α/β, but not IFN-γ1.Thus, impaired TLR3- and UNC-93B-dependent IFN-α/β intrinsic immunity to HSV-1 in the CNS, in neurons and oligodendrocytes in particular, may underlie the pathogenesis of HSE in children with TLR3 pathway deficiencies. PMID:23103873

  17. Impaired control of body cooling during heterothermia represents the major energetic constraint in an aging non-human primate exposed to cold.

    Directory of Open Access Journals (Sweden)

    Jeremy Terrien

    2009-10-01

    Full Text Available Daily heterothermia is used by small mammals for energy and water savings, and seems to be preferentially exhibited during winter rather than during summer. This feature induces a trade-off between the energy saved during daily heterothermia and the energy cost of arousal, which can impact energy balance and survival under harsh environmental conditions. Especially, aging may significantly affect such trade off during cold-induced energy stress, but direct evidences are still lacking. We hypothesized that aging could alter the energetics of daily heterothermia, and that the effects could differ according to season. In the gray mouse lemur (Microcebus murinus, a non-human primate species which exhibits daily heterothermia, we investigated the effects of exposures to 25 and 12 degrees C on body composition, energy balance, patterns of heterothermia and water turnover in adult (N = 8 and aged animals (N = 7 acclimated to winter-like or summer-like photoperiods. Acclimation to summer prevented animals from deep heterothermia, even during aging. During winter, adult animals at 12 degrees C and aged animals at 25 degrees C exhibited low levels of energy expenditure with minor modulations of heterothermia. The major effects of cold were observed during winter, and were particularly pronounced in aged mouse lemurs which exhibited deep heterothermia phases. Body composition was not significantly affected by age and could not explain the age-related differences in heterothermia patterns. However, aging was associated with increased levels of energy expenditure during cold exposure, in concomitance with impaired energy balance. Interestingly, increased energy expenditure and depth of heterothermia phases were strongly correlated. In conclusion, it appeared that the exhibition of shallow heterothermia allowed energy savings during winter in adult animals only. Aged animals exhibited deep heterothermia and increased levels of energy expenditure, impairing

  18. Levels of persistent fluorinated, chlorinated and brominated compounds in human blood collected in Sweden in 1997-2000

    Energy Technology Data Exchange (ETDEWEB)

    Lindstroem, G.; Kaerrman, A.; Bavel, B. van [MTM Research Centre, Oerebro Univ. (Sweden); Hardell, L. [Dept. of Oncology, Univ. Hospital, Oerebro (Sweden); Hedlund, B. [Environmental Monitoring Section, Swedish EPA, Stockholm (Sweden)

    2004-09-15

    Levels of persistent fluorinated, chlorinated and brominated compounds in blood collected from the Swedish population have been determined in connection with several exposure and monitoring studies at the MTM Research Centre. A data base with 631 individual congener specific measurements on halogenated POPs such as dioxins, PCBs, HCB, DDE, chlordanes, PBDEs and PFAs including information on residency, age, BMI, diet, occupation, number of children, smoking habits, immunological status etc. has been compiled from samples collected between 1994 and 2004. A brief overview focusing on levels of some persistent chlorinated, brominated and fluorinated, compounds in blood collected in a background population group (n=83) in 1997-2000 is given here.

  19. Impaired Driving

    Science.gov (United States)

    ... Get the Facts What Works: Strategies to Increase Car Seat and Booster Seat ... narcotics. 3 That’s one percent of the 111 million self-reported episodes of alcohol-impaired driving among U.S. ...

  20. Exposure to a High-Fat Diet during Early Development Programs Behavior and Impairs the Central Serotonergic System in Juvenile Non-Human Primates

    Directory of Open Access Journals (Sweden)

    Jacqueline R. Thompson

    2017-07-01

    Full Text Available Perinatal exposure to maternal obesity and high-fat diet (HFD consumption not only poses metabolic risks to offspring but also impacts brain development and mental health. Using a non-human primate model, we observed a persistent increase in anxiety in juvenile offspring exposed to a maternal HFD. Postweaning HFD consumption also increased anxiety and independently increased stereotypic behaviors. These behavioral changes were associated with modified cortisol stress response and impairments in the development of the central serotonin synthesis, with altered tryptophan hydroxylase-2 mRNA expression in the dorsal and median raphe. Postweaning HFD consumption decreased serotonergic immunoreactivity in area 10 of the prefrontal cortex. These results suggest that perinatal exposure to HFD consumption programs development of the brain and endocrine system, leading to behavioral impairments associated with mental health and neurodevelopmental disorders. Also, an early nutritional intervention (consumption of the control diet at weaning was not sufficient to ameliorate many of the behavioral changes, such as increased anxiety, that were induced by maternal HFD consumption. Given the level of dietary fat consumption and maternal obesity in developed nations these findings have important implications for the mental health of future generations.

  1. Do estrogenic compounds in drinking water migrating from plastic pipe distribution system pose adverse effects to human? An analysis of scientific literature.

    Science.gov (United States)

    Liu, Ze-Hua; Yin, Hua; Dang, Zhi

    2017-01-01

    With the widespread application of plastic pipes in drinking water distribution system, the effects of various leachable organic chemicals have been investigated and their occurrence in drinking water supplies is monitored. Most studies focus on the odor problems these substances may cause. This study investigates the potential endocrine disrupting effects of the migrating compound 2,4-di-tert-butylphenol (2,4-d-t-BP). The summarized results show that the migration of 2,4-d-t-BP from plastic pipes could result in chronic exposure and the migration levels varied greatly among different plastic pipe materials and manufacturing brands. Based on estrogen equivalent (EEQ), the migrating levels of the leachable compound 2,4-d-t-BP in most plastic pipes were relative low. However, the EEQ levels in drinking water migrating from four out of 15 pipes may pose significant adverse effects. With the increasingly strict requirements on regulation of drinking water quality, these results indicate that some drinking water transported with plastic pipes may not be safe for human consumption due to the occurrence of 2,4-d-t-BP. Moreover, 2,4-d-t-BP is not the only plastic pipe-migrating estrogenic compound, other compounds such as 2-tert-butylphenol (2-t-BP), 4-tert-butylphenol (4-t-BP), and others may also be leachable from plastic pipes.

  2. A rapid and sensitive screening system for human type I collagen with the aim of discovering potent anti-aging or anti-fibrotic compounds.

    Science.gov (United States)

    Hashem, Md Abul; Jun, Kyu-Yeon; Lee, Eunyoung; Lim, Soyun; Choo, Hea-Young Park; Kwon, Youngjoo

    2008-12-31

    This study was undertaken with the aim of developing an easy and quick means of analyzing the effect of various compounds on the synthesis and secretion of human type I collagen at the protein level. A modification of the ELISA method was used on HFF-1 cells. For the proof of concept, we used thirteen compounds most of which are known to be antioxidants. Each compound was tested at concentrations of 0, 10 and 100 microM on HFF-1 cells for 24 h. Thirteen sets of experiments for each compound were performed in ANOVA with three replicates. Duncan multiple range test (DMRT) was used to compare the mean values obtained from the treatment groups. From the results it was concluded that Vitamin C, undecylenic acid, conjugated linoleic acid, glycolic acid, and citric acid at 100 microM concentration could be used for anti-wrinkling or protection from premature aging, which requires enhancement of collagen synthesis. Lactic acid, EGCG, resveratrol, and retinol that can inhibit collagen synthesis effectively in a dose-dependent manner may be used for anti-fibrosis treatment purposes.

  3. Human breath measurements in a clean-air chamber to determine half-lives for volatile organic compounds

    Science.gov (United States)

    Gordon, Sydney M.; Wallace, Lance A.; Pelllzzari, Edo D.; O'Neill, Hugh J.

    The expired breath of four non-occupationally exposed subjects was monitored following exposure at near-normal environmental concentrations using a specially developed pulmonary clearance technique. The four were exposed to polluted air on a heavily trafficked freeway or at a local dry-cleaning establishment, then spent the next 10 h in a clean-air environmental chamber. Breath and chamber-air samples were collected at regular intervals throughout the 10-h period and analyzed for the presence of selected target compounds. The breath levels of two of the compounds were elevated and decreased slowly with time once the subjects began to breathe clean air. Nonlinear least-squares fitting of the decay-uptake curves permitted the calculation of biological half-lives. Several of the target compounds occurred, however, at very low levels, and the resultant experimental scatter limited the value of these measurements. Higher initial exposures to most of the target compounds would have improved the reliability of the estimates.

  4. Insight into eukaryotic topoisomerase II-inhibiting fused heterocyclic compounds in human cancer cell lines by molecular docking.

    Science.gov (United States)

    Taskin, T; Yilmaz, S; Yildiz, I; Yalcin, I; Aki, E

    2012-01-01

    Etoposide is effective as an anti-tumour drug by inhibiting eukaryotic DNA topoisomerase II via establishing a covalent complex with DNA. Unfortunately, its wide therapeutic application is often hindered by multidrug resistance (MDR), low water solubility and toxicity. In our previous study, new derivatives of benzoxazoles, benzimidazoles and related fused heterocyclic compounds, which exhibited significant eukaryotic DNA topoisomerase II inhibitory activity, were synthesized and exhibited better inhibitory activity compared with the drug etoposide itself. To expose the binding interactions between the eukaryotic topoisomerase II and the active heterocyclic compounds, docking studies were performed, using the software Discovery Studio 2.1, based on the crystal structure of the Topo IIA-bound G-segment DNA (PDB ID: 2RGR). The research was conducted on a selected set of 31 fused heterocyclic compounds with variation in structure and activity. The structural analyses indicate coordinate and hydrogen bonding interactions, van der Waals interactions and hydrophobic interactions between ligands and the protein, as Topo IIA-bound G-segment DNA are responsible for the preference of inhibition and potency. Collectively, the results demonstrate that the compounds 1a, 1c, 3b, 3c, 3e and 4a are significant anti-tumour drug candidates that should be further studied.

  5. 78 FR 72901 - Draft Guidance; Pharmacy Compounding of Human Drug Products Under Section 503A of the Federal...

    Science.gov (United States)

    2013-12-04

    ... provisions of the FD&C Act remain in effect for compounded drugs, however, even if the conditions in section 503A are met. The conditions of section 503A of the FD&C Act included restrictions on the advertising... the Drug Quality and Security Act to remove the unconstitutional advertising, promotion, and...

  6. UVA-mediated down-regulation of MMP-2 and MT1-MMP coincides with impaired angiogenic phenotype of human dermal endothelial cells

    International Nuclear Information System (INIS)

    Cauchard, Jean-Hubert; Robinet, Arnaud; Poitevin, Stephane; Bobichon, Helene; Maziere, Jean-Claude; Bellon, Georges; Hornebeck, William

    2006-01-01

    UVA irradiation, dose-dependently (5-20 J/cm 2 ), was shown to impair the morphogenic differentiation of human microvascular endothelial cells (HMECs) on Matrigel. Parallely, UVA down-regulated the expression of MMP-2 and MT1-MMP, both at the protein and the mRNA levels. On the contrary, the production of MMP-1 and TIMP-1 by HMECs increased following UVA treatment. The inhibitory effect of UVA on MMP expression and pseudotubes formation was mediated by UVA-generated singlet oxygen ( 1 O 2 ). The contribution of MT1-MMP, but not TIMP-1, to the regulation of HMECs' angiogenic phenotype following UVA irradiation was suggested using elastin-derived peptides and TIMP-1 blocking antibody, respectively

  7. Effect of Phenolic Compounds from Elderflowers on Glucose- and Fatty Acid Uptake in Human Myotubes and HepG2-Cells

    Directory of Open Access Journals (Sweden)

    Giang Thanh Thi Ho

    2017-01-01

    Full Text Available Type 2 diabetes (T2D is manifested by progressive metabolic impairments in tissues such as skeletal muscle and liver, and these tissues become less responsive to insulin, leading to hyperglycemia. In the present study, stimulation of glucose and oleic acid uptake by elderflower extracts, constituents and metabolites were tested in vitro using the HepG2 hepatocellular liver carcinoma cell line and human skeletal muscle cells. Among the crude extracts, the 96% EtOH extract showed the highest increase in glucose and oleic acid uptake in human skeletal muscle cells and HepG2-cells. The flavonoids and phenolic acids contained therein were potent stimulators of glucose and fatty acid uptake in a dose-dependent manner. Most of the phenolic constituents and several of the metabolites showed high antioxidant activity and showed considerably higher α-amylase and α-glucosidase inhibition than acarbose. Elderflower might therefore be valuable as a functional food against diabetes.

  8. Impaired RNA splicing of 5'-regulatory sequences of the astroglial glutamate transporter EAAT2 in human astrocytoma

    NARCIS (Netherlands)

    Münch, C.; Penndorf, A.; Schwalenstöcker, B.; Troost, D.; Ludolph, A. C.; Ince, P.; Meyer, T.

    2001-01-01

    A loss of the glutamate transporter EAAT2 has been reported in the neoplastic transformation of astrocytic cells and astrocytoma. The RNA expression of EAAT2 and five 5'-regulatory splice variants was investigated to identify alterations of the post-transcriptional EAAT2 gene regulation in human

  9. Reduced expression of glutamate transporter EAAT2 and impaired glutamate transport in human primary astrocytes exposed to HIV-1 or gp120

    International Nuclear Information System (INIS)

    Wang Zhuying; Pekarskaya, Olga; Bencheikh, Meryem; Chao Wei; Gelbard, Harris A.; Ghorpade, Anuja; Rothstein, Jeffrey D.; Volsky, David J.

    2003-01-01

    L-Glutamate is the major excitatory neurotransmitter in the brain. Astrocytes maintain low levels of synaptic glutamate by high-affinity uptake and defects in this function may lead to neuronal cell death by excitotoxicity. We tested the effects of HIV-1 and its envelope glycoprotein gp120 upon glutamate uptake and expression of glutamate transporters EAAT1 and EAAT2 in fetal human astrocytes in vitro. Astrocytes isolated from fetal tissues between 16 and 19 weeks of gestation expressed EAAT1 and EAAT2 RNA and proteins as detected by Northern blot analysis and immunoblotting, respectively, and the cells were capable of specific glutamate uptake. Exposure of astrocytes to HIV-1 or gp120 significantly impaired glutamate uptake by the cells, with maximum inhibition within 6 h, followed by gradual decline during 3 days of observation. HIV-1-infected cells showed a 59% reduction in V max for glutamate transport, indicating a reduction in the number of active transporter sites on the cell surface. Impaired glutamate transport after HIV-1 infection or gp120 exposure correlated with a 40-70% decline in steady-state levels of EAAT2 RNA and protein. EAAT1 RNA and protein levels were less affected. Treatment of astrocytes with tumor necrosis factor-α (TNF-α) decreased the expression of both EAAT1 and EAAT2, but neither HIV-1 nor gp120 were found to induce TNF-α production by astrocytes. These findings demonstrate that HIV-1 and gp120 induce transcriptional downmodulation of the EAAT2 transporter gene in human astrocytes and coordinately attenuate glutamate transport by the cells. Reduction of the ability of HIV-1-infected astrocytes to take up glutamate may contribute to the development of neurological disease

  10. Human T-cell lymphotropic virus type 1-infected T lymphocytes impair catabolism and uptake of glutamate by astrocytes via Tax-1 and tumor necrosis factor alpha.

    Science.gov (United States)

    Szymocha, R; Akaoka, H; Dutuit, M; Malcus, C; Didier-Bazes, M; Belin, M F; Giraudon, P

    2000-07-01

    Human T-cell lymphotropic virus type 1 (HTLV-1) is the causative agent of a chronic progressive myelopathy called tropical spastic paraparesis/HTLV-1-associated myelopathy (TSP/HAM). In this disease, lesions of the central nervous system (CNS) are associated with perivascular infiltration by lymphocytes. We and others have hypothesized that these T lymphocytes infiltrating the CNS may play a prominent role in TSP/HAM. Here, we show that transient contact of human or rat astrocytes with T lymphocytes chronically infected by HTLV-1 impairs some of the major functions of brain astrocytes. Uptake of extracellular glutamate by astrocytes was significantly decreased after transient contact with infected T cells, while the expression of the glial transporters GLAST and GLT-1 was decreased. In two-compartment cultures avoiding direct cell-to-cell contact, similar results were obtained, suggesting possible involvement of soluble factors, such as cytokines and the viral protein Tax-1. Recombinant Tax-1 and tumor necrosis factor alpha (TNF-alpha) decreased glutamate uptake by astrocytes. Tax-1 probably acts by inducing TNF-alpha, as the effect of Tax-1 was abolished by anti-TNF-alpha antibody. The expression of glutamate-catabolizing enzymes in astrocytes was increased for glutamine synthetase and decreased for glutamate dehydrogenase, the magnitudes of these effects being correlated with the level of Tax-1 transcripts. In conclusion, Tax-1 and cytokines produced by HTLV-1-infected T cells impair the ability of astrocytes to manage the steady-state level of glutamate, which in turn may affect neuronal and oligodendrocytic functions and survival.

  11. Identification of pyrogallol as an antiproliferative compound present in extracts from the medicinal plant Emblica officinalis: effects on in vitro cell growth of human tumor cell lines.

    Science.gov (United States)

    Khan, Mahmud Tareq Hassan; Lampronti, Ilaria; Martello, Dino; Bianchi, Nicoletta; Jabbar, Shaila; Choudhuri, Mohammad Shahabuddin Kabir; Datta, Bidduyt Kanti; Gambari, Roberto

    2002-07-01

    In this study we compared the in vitro antiproliferative activity of extracts from medicinal plants toward human tumor cell lines, including human erythromyeloid K562, B-lymphoid Raji, T-lymphoid Jurkat, erythroleukemic HEL cell lines. Extracts from Emblica officinalis were the most active in inhibiting in vitro cell proliferation, after comparison to those from Terminalia arjuna, Aphanamixis polystachya, Oroxylum indicum, Cuscuta reflexa, Aegle marmelos, Saraca asoka, Rumex maritimus, Lagerstroemia speciosa, Red Sandalwood. Emblica officinalis extracts have been studied previously, due to their hepatoprotective, antioxidant, antifungal, antimicrobial and anti-inflammatory medicinal activities. Gas chromatography/mass spectrometry analyses allowed to identify pyrogallol as the common compound present both in unfractionated and n-butanol fraction of Emblica officinalis extracts. Antiproliferative effects of pyrogallol were therefore determined on human tumor cell lines thus identifying pyrogallol as an active component of Emblica officinalis extracts.

  12. Fast and simple screening for the simultaneous analysis of seven metabolites derived from five volatile organic compounds in human urine using on-line solid-phase extraction coupled with liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Chiang, Wen-Chieh; Chen, Chao-Yu; Lee, Ting-Chen; Lee, Hui-Ling; Lin, Yu-Wen

    2015-01-01

    Recently, the International Agency for Research on cancer classified outdoor air pollution and particulate matter from outdoor air pollution as carcinogenic to humans (IARC Group 1), based on sufficient evidence of carcinogenicity in humans and experimental animals and strong mechanistic evidence. In particular, a wide variety of volatile organic compounds (VOCs) are volatized or released into the atmosphere and can become ubiquitous, as they originate from many different natural and anthropogenic sources, such as paints, pesticides, vehicle exhausts, cooking fumes, and tobacco smoke. Humans may be exposed to VOCs through inhalation, ingestion, or dermal contact, which may increase the risk of leukemia, birth defects, neurocognitive impairment, and cancer. Therefore, the focus of this study was the development of a simple, effective and rapid sample preparation method for the simultaneous determination of seven metabolites (6 mercaptic acids+t,t-muconic acid) derived from five VOCs (acrylamide, 1,3-butadiene, acrylonitrile, benzene, and xylene) in human urine by using automated on-line solid-phase extraction (SPE) coupled with liquid chromatography-electrospray tandem mass spectrometry (LC-MS/MS). An aliquot of each diluted urinary sample was directly injected into an autosampler through a trap column to reduce contamination, and then the retained target compounds were eluted by back-flush mode into an analytical column for separation. Negative electrospray ionization tandem mass spectrometry was utilized for quantification. The coefficients of correlation (r(2)) for the calibration curves were greater than 0.995. Reproducibility was assessed by the precision and accuracy of intra-day and inter-day precision, which showed results for coefficient of variation (CV) that were low 0.9 to 6.6% and 3.7 to 8.5%, respectively, and results for recovery that ranged from 90.8 to 108.9% and 92.1 to 107.7%, respectively. The limits of detection (LOD) and limits of

  13. Binding Energy calculation of GSK-3 protein of Human against some anti-diabetic compounds of Momordica charantia linn (Bitter melon).

    Science.gov (United States)

    Hazarika, Ridip; Parida, Pratap; Neog, Bijoy; Yadav, Raj Narain Singh

    2012-01-01

    Diabetes is one of the major life threatening diseases worldwide. It creates major health problems in urban India. Glycogen Synthase Kinase-3 (GSK-3) protein of human is known for phosphorylating and inactivating glycogen synthase which also acts as a negative regulator in the hormonal control of glucose homeostasis. In traditional medicine, Momordica charantia is used as antidiabetic plant because of its hypoglycemic effect. Hence to block the active site of the GSK-3 protein three anti-diabetic compounds namely, charantin, momordenol & momordicilin were taken from Momordica charantia for docking study and calculation of binding energy. The aim of present investigation is to find the binding energy of three major insulin-like active compounds against glycogen synthase kinase-3 (GSK-3), one of the key proteins involved in carbohydrate metabolism, with the help of molecular docking using ExomeTM Horizon suite. The study recorded minimum binding energy by momordicilin in comparison to the others.

  14. Whole body hyperthermia, but not skin hyperthermia, accelerates brain and locomotor limb circulatory strain and impairs exercise capacity in humans

    DEFF Research Database (Denmark)

    Trangmar, Steven J; Chiesa, Scott T; Kalsi, Kameljit K

    2017-01-01

    Cardiovascular strain and hyperthermia are thought to be important factors limiting exercise capacity in heat-stressed humans, however, the contribution of elevations in skin (Tsk) versus whole body temperatures on exercise capacity has not been characterized. To ascertain their relationships...... was associated with a plateau in MCA and two-legged vascular conductance (VC). Mechanistically, the falling MCA VC was coupled to reductions in PaCO2, whereas the plateau in leg vascular conductance was related to markedly elevated plasma [NA] and a plateau in plasma ATP These findings reveal that whole-body...... hyperthermia, but not skin hyperthermia, compromises exercise capacity in heat-stressed humans through the early attenuation of brain and active muscle blood flow....

  15. Interferon-gamma improves impaired dentinogenic and immunosuppressive functions of irreversible pulpitis-derived human dental pulp stem cells

    OpenAIRE

    Soichiro Sonoda; Haruyoshi Yamaza; Lan Ma; Yosuke Tanaka; Erika Tomoda; Reona Aijima; Kazuaki Nonaka; Toshio Kukita; Songtao Shi; Fusanori Nishimura; Takayoshi Yamaza

    2016-01-01

    Clinically, irreversible pulpitis is treated by the complete removal of pulp tissue followed by replacement with artificial materials. There is considered to be a high potential for autologous transplantation of human dental pulp stem cells (DPSCs) in endodontic treatment. The usefulness of DPSCs isolated from healthy teeth is limited. However, DPSCs isolated from diseased teeth with irreversible pulpitis (IP-DPSCs) are considered to be suitable for dentin/pulp regeneration. In this study, we...

  16. Banana (Musa spp) from peel to pulp: ethnopharmacology, source of bioactive compounds and its relevance for human health.

    Science.gov (United States)

    Pereira, Aline; Maraschin, Marcelo

    2015-02-03

    Banana is a fruit with nutritional properties and also with acclaimed therapeutic uses, cultivated widely throughout the tropics as source of food and income for people. Banana peel is known by its local and traditional use to promote wound healing mainly from burns and to help overcome or prevent a substantial number of illnesses, as depression. This review critically assessed the phytochemical properties and biological activities of Musa spp fruit pulp and peel. A survey on the literature on banana (Musa spp, Musaceae) covering its botanical classification and nomenclature, as well as the local and traditional use of its pulp and peel was performed. Besides, the current state of art on banana fruit pulp and peel as interesting complex matrices sources of high-value compounds from secondary metabolism was also approached. Dessert bananas and plantains are systematic classified into four sections, Eumusa, Rhodochlamys, Australimusa, and Callimusa, according to the number of chromosomes. The fruits differ only in their ploidy arrangement and a single scientific name can be given to all the edible bananas, i.e., Musa spp. The chemical composition of banana's peel and pulp comprise mostly carotenoids, phenolic compounds, and biogenic amines. The biological potential of those biomasses is directly related to their chemical composition, particularly as pro-vitamin A supplementation, as potential antioxidants attributed to their phenolic constituents, as well as in the treatment of Parkinson's disease considering their contents in l-dopa and dopamine. Banana's pulp and peel can be used as natural sources of antioxidants and pro-vitamin A due to their contents in carotenoids, phenolics, and amine compounds, for instance. For the development of a phytomedicine or even an allopathic medicine, e.g., banana fruit pulp and peel could be of interest as raw materials riches in beneficial bioactive compounds. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Trioorganotin compounds, cognate ligands, of nuclear retinoid X receptors - biological effects in human breats cancer cell lines

    Czech Academy of Sciences Publication Activity Database

    Brtko, J.; Toporová, L.; Macejová, D.; Hunáková, L.; Bobálová, Janette

    2017-01-01

    Roč. 10, suppl. 1 (2017), s. 19-19 ISSN 1337-6853. [Mezioborová toxikologická konference /22./ TOXCON 2017. 21.06.2017-23.06.2017, Plzeň] Grant - others:AV ČR(CZ) SAV-15-01 Program:Bilaterální spolupráce Institutional support: RVO:68081715 Keywords : receptor * organotin compounds * cancer

  18. Impaired STING Pathway in Human Osteosarcoma U2OS Cells Contributes to the Growth of ICP0-Null Mutant Herpes Simplex Virus.

    Science.gov (United States)

    Deschamps, Thibaut; Kalamvoki, Maria

    2017-05-01

    Human herpes simplex virus 1 (HSV-1) is a widespread pathogen, with 80% of the population being latently infected. To successfully evade the host, the virus has evolved strategies to counteract antiviral responses, including the gene-silencing and innate immunity machineries. The immediately early protein of the virus, infected cell protein 0 (ICP0), plays a central role in these processes. ICP0 blocks innate immunity, and one mechanism is by degrading hostile factors with its intrinsic E3 ligase activity. ICP0 also functions as a promiscuous transactivator, and it blocks repressor complexes to enable viral gene transcription. For these reasons, the growth of a ΔICP0 virus is impaired in most cells, except cells of the human osteosarcoma cell line U2OS, and it is only partially impaired in cells of the human osteosarcoma cell line Saos-2. We found that the two human osteosarcoma cell lines that supported the growth of the ΔICP0 virus failed to activate innate immune responses upon treatment with 2'3'-cyclic GAMP (2'3'-cGAMP), the natural agonist of STING (i.e., stimulator of interferon genes) or after infection with the ΔICP0 mutant virus. Innate immune responses were restored in these cells by transient expression of the STING protein but not after overexpression of interferon-inducible protein 16 (IFI16). Restoration of STING expression resulted in suppression of ΔICP0 virus gene expression and a decrease in viral yields. Overexpression of IFI16 also suppressed ΔICP0 virus gene expression, albeit to a lesser extent than STING. These data suggest that the susceptibility of U2OS and Saos-2 cells to the ΔICP0 HSV-1 is in part due to an impaired STING pathway. IMPORTANCE The DNA sensor STING plays pivotal role in controlling HSV-1 infection both in cell culture and in mice. The HSV-1 genome encodes numerous proteins that are dedicated to combat host antiviral responses. The immediate early protein of the virus ICP0 plays major role in this process as it targets

  19. Speciation analysis of organotin compounds in human urine by headspace solid-phase micro-extraction and gas chromatography with pulsed flame photometric detection.

    Science.gov (United States)

    Valenzuela, Aníbal; Lespes, Gaëtane; Quiroz, Waldo; Aguilar, Luis F; Bravo, Manuel A

    2014-07-01

    A new headspace solid-phase micro-extraction (HS-SPME) method followed by gas chromatography with pulsed flame photometric detection (GC-PFPD) analysis has been developed for the simultaneous determination of 11 organotin compounds, including methyl-, butyl-, phenyl- and octyltin derivates, in human urine. The methodology has been validated by the analysis of urine samples fortified with all analytes at different concentration levels, and recovery rates above 87% and relative precisions between 2% and 7% were obtained. Additionally, an experimental-design approach has been used to model the storage stability of organotin compounds in human urine, demonstrating that organotins are highly degraded in this medium, although their stability is satisfactory during the first 4 days of storage at 4 °C and pH=4. Finally, this methodology was applied to urine samples collected from harbor workers exposed to antifouling paints; methyl- and butyltins were detected, confirming human exposure in this type of work environment. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Physical Impairment

    Science.gov (United States)

    Trewin, Shari

    Many health conditions can lead to physical impairments that impact computer and Web access. Musculoskeletal conditions such as arthritis and cumulative trauma disorders can make movement stiff and painful. Movement disorders such as tremor, Parkinsonism and dystonia affect the ability to control movement, or to prevent unwanted movements. Often, the same underlying health condition also has sensory or cognitive effects. People with dexterity impairments may use a standard keyboard and mouse, or any of a wide range of alternative input mechanisms. Examples are given of the diverse ways that specific dexterity impairments and input mechanisms affect the fundamental actions of Web browsing. As the Web becomes increasingly sophisticated, and physically demanding, new access features at the Web browser and page level will be necessary.

  1. Cholinergic signaling mediates the effects of xenin-25 on secretion of pancreatic polypeptide but not insulin or glucagon in humans with impaired glucose tolerance.

    Directory of Open Access Journals (Sweden)

    Songyan Wang

    Full Text Available We previously demonstrated that infusion of an intestinal peptide called xenin-25 (Xen amplifies the effects of glucose-dependent insulinotropic polypeptide (GIP on insulin secretion rates (ISRs and plasma glucagon levels in humans. However, these effects of Xen, but not GIP, were blunted in humans with type 2 diabetes. Thus, Xen rather than GIP signaling to islets fails early during development of type 2 diabetes. The current crossover study determines if cholinergic signaling relays the effects of Xen on insulin and glucagon release in humans as in mice. Fasted subjects with impaired glucose tolerance were studied. On eight separate occasions, each person underwent a single graded glucose infusion- two each with infusion of albumin, Xen, GIP, and GIP plus Xen. Each infusate was administered ± atropine. Heart rate and plasma glucose, insulin, C-peptide, glucagon, and pancreatic polypeptide (PP levels were measured. ISRs were calculated from C-peptide levels. All peptides profoundly increased PP responses. From 0 to 40 min, peptide(s infusions had little effect on plasma glucose concentrations. However, GIP, but not Xen, rapidly and transiently increased ISRs and glucagon levels. Both responses were further amplified when Xen was co-administered with GIP. From 40 to 240 min, glucose levels and ISRs continually increased while glucagon concentrations declined, regardless of infusate. Atropine increased resting heart rate and blocked all PP responses but did not affect ISRs or plasma glucagon levels during any of the peptide infusions. Thus, cholinergic signaling mediates the effects of Xen on insulin and glucagon release in mice but not humans.

  2. Human amyloid β peptide and tau co-expression impairs behavior and causes specific gene expression changes in Caenorhabditis elegans.

    Science.gov (United States)

    Wang, Chenyin; Saar, Valeria; Leung, Ka Lai; Chen, Liang; Wong, Garry

    2018-01-01

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by the presence of extracellular amyloid plaques consisting of Amyloid-β peptide (Aβ) aggregates and neurofibrillary tangles formed by aggregation of hyperphosphorylated microtubule-associated protein tau. We generated a novel invertebrate model of AD by crossing Aβ1-42 (strain CL2355) with either pro-aggregating tau (strain BR5270) or anti-aggregating tau (strain BR5271) pan-neuronal expressing transgenic Caenorhabditis elegans. The lifespan and progeny viability of the double transgenic strains were significantly decreased compared with wild type N2 (P5E-21). RNA interference of 13 available top up-regulated genes in Aβ1-42+pro-aggregating tau animals revealed that F-box family genes and nep-4 could enhance life span deficits and chemotaxis deficits while Y39G8C.2 (TTBK2) could suppress these behaviors. Comparing the list of regulated genes from C. elegans to the top 60 genes related to human AD confirmed an overlap of 8 genes: patched homolog 1, PTCH1 (ptc-3), the Rab GTPase activating protein, TBC1D16 (tbc-16), the WD repeat and FYVE domain-containing protein 3, WDFY3 (wdfy-3), ADP-ribosylation factor guanine nucleotide exchange factor 2, ARFGEF2 (agef-1), Early B-cell Factor, EBF1 (unc-3), d-amino-acid oxidase, DAO (daao-1), glutamate receptor, metabotropic 1, GRM1 (mgl-2), prolyl 4-hydroxylase subunit alpha 2, P4HA2 (dpy-18 and phy-2). Taken together, our C. elegans double transgenic model provides insight on the fundamental neurobiologic processes underlying human AD and recapitulates selected transcriptomic changes observed in human AD brains. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Lipodystrophy in human immunodeficiency virus patients impairs insulin action and induces defects in beta-cell function

    DEFF Research Database (Denmark)

    Andersen, Ove; Haugaard, Steen B; Andersen, Ulrik B

    2003-01-01

    The pathophysiology of insulin resistance in human immunodeficiency virus (HIV)-associated lipodystrophy syndrome (HALS) is not fully clarified. We investigated 18 men with HALS and 18 HIV-positive males without lipodystrophy (control subjects). Duration and modality of antiretroviral therapy were...... that the percentage of limb fat (ie, peripheral-fat-mass/[peripheral-fat-mass + trunk-fat-mass]. 100%) was reduced in HALS patients (36% v 46%, P =.0002). Multiple linear regression analysis indicated that percentage of limb fat explained 53% of the variability of GDR and 45% of the variability of NOGM in HALS...

  4. A compound methodology to assess the impact of human and organizational factors impact on the risk level of hazardous industrial plants

    DEFF Research Database (Denmark)

    Monferini, A.; Konstandinidou, M.; Nivolianitou, Z.

    2013-01-01

    This paper presents a compound methodology devised to relate Human and Organizational Factors (HOFs) to operators’ response time in critical operations within hazardous industrial plants. The methodology has been based on a sensitivity analysis of the nine “families” of the Common Performance Con...... with the variation of one CPC at a time aiming at the detection and containment operation of a gas leakage in a pressure-reduction NG terminal. The whole case study has been run within the framework of the VIRTHUALIS EU project....

  5. Antioxidant activity of inulin and its role in the prevention of human colonic muscle cell impairment induced by lipopolysaccharide mucosal exposure.

    Directory of Open Access Journals (Sweden)

    Valentina Pasqualetti

    Full Text Available BACKGROUND: Fructans, such as inulin, are dietary fibers which stimulate gastro-intestinal (GI function acting as prebiotics. Lipopolysaccharide (LPS impairs GI motility, through production of reactive oxygen species. The antioxidant activity of various fructans was tested and the protective effect of inulin on colonic smooth muscle cell (SMC impairment, induced by exposure of human mucosa to LPS, was assessed in an ex vivo experimental model. METHODS: The antioxidant capacity of fructans was measured in an in vitro system that simulates cooking and digestion processes. Human colonic mucosa and submucosa, obtained from disease-free margins of resected segments for cancer, were sealed between two chambers, with the mucosal side facing upwards with Krebs solution with or without purified LPS from a pathogenic strain of Escherichia coli (O111:B4 and inulin (Frutafit IQ, and the submucosal side facing downwards into Krebs solution. The solutions on the submucosal side were collected following mucosal exposure to Krebs in the absence (N-undernatant or presence of LPS (LPS-undernatant or LPS+inulin (LPS+INU-undernatant. Undernatants were tested for their antioxidant activity and the effects on SMCs contractility. Inulin protective effects on mucosa and submucosa layers were assessed measuring the protein oxidation level in the experimental conditions analyzed. RESULTS: Antioxidant activity of inulin, which was significantly higher compared to simple sugars, remained unaltered despite cooking and digestion processes. Inulin protected the mucosal and submucosal layers against protein oxidation. Following exposure to LPS-undernatant, a significant decrease in maximal acetylcholine (Ach-induced contraction was observed when compared to the contraction induced in cells incubated with the N-undernatant (4±1% vs 25±5% respectively, P<0.005 and this effect was completely prevented by pre-incubation of LPS with Inulin (35±5%. CONCLUSIONS: Inulin protects

  6. Immature dendritic cells generated from cryopreserved human monocytes show impaired ability to respond to LPS and to induce allogeneic lymphocyte proliferation.

    Directory of Open Access Journals (Sweden)

    Guilherme Ferreira Silveira

    Full Text Available Dendritic cells play a key role in the immune system, in the sensing of foreign antigens and triggering of an adaptive immune response. Cryopreservation of human monocytes was investigated to understand its effect on differentiation into immature monocyte-derived dendritic cells (imdDCs, the response to inflammatory stimuli and the ability to induce allogeneic lymphocyte proliferation. Cryopreserved (crp-monocytes were able to differentiate into imdDCs, albeit to a lesser extent than freshly (frh-obtained monocytes. Furthermore, crp-imdDCs had lower rates of maturation and cytokine/chemokine secretion in response to LPS than frh-imdDCs. Lower expression of Toll-like receptor 4 (at 24 and 48 h and higher susceptibility to apoptosis in crp-imdDCs than in fresh cells would account for the impaired maturation and cytokine/chemokine secretion observed. A mixed leukocyte reaction showed that lymphocyte proliferation was lower with crp-imdDCs than with frh-imdDCs. These findings suggested that the source of monocytes used to generate human imdDCs could influence the accuracy of results observed in studies of the immune response to pathogens, lymphocyte activation, vaccination and antigen sensing. It is not always possible to work with freshly isolated monocytes but the possible effects of freezing/thawing on the biology and responsiveness of imdDCs should be taken into account.

  7. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

    Directory of Open Access Journals (Sweden)

    Juan S Ruiz-Moreno

    2018-01-01

    Full Text Available The cyclic GMP-AMP synthase (cGAS-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs. In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection.ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

  8. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

    Science.gov (United States)

    Ruiz-Moreno, Juan S; Hamann, Lutz; Shah, Javeed A; Verbon, Annelies; Mockenhaupt, Frank P; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E; Witzenrath, Martin; Cambier, John C; Suttorp, Norbert; Schumann, Ralf R; Jin, Lei; Hawn, Thomas R; Opitz, Bastian

    2018-01-01

    The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

  9. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires’ disease in humans

    Science.gov (United States)

    Hamann, Lutz; Verbon, Annelies; Mockenhaupt, Frank P.; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E.; Witzenrath, Martin; Schumann, Ralf R.; Hawn, Thomas R.

    2018-01-01

    The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires’ disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires’ disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. Trial registration ClinicalTrials.gov DRKS00005274, German Clinical Trials Register PMID:29298342

  10. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Directory of Open Access Journals (Sweden)

    Paola Di Meglio

    2011-02-01

    Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  11. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Science.gov (United States)

    Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

    2011-02-22

    IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  12. Exposure of Human CD8+ T Cells to Type-2 Cytokines Impairs Division and Differentiation and Induces Limited Polarization

    Directory of Open Access Journals (Sweden)

    Annette Fox

    2018-05-01

    Full Text Available Effector CD8+ T cells generally produce type-1 cytokines and mediators of the perforin/granzyme cytolytic pathway, yet type-2-polarized CD8+ cells (Tc2 are detected in type-2 (T2 cytokine-driven diseases such as asthma. It is unclear whether T2 cytokine exposure during activation is sufficient to polarize human CD8+ T cells. To address this question, a protocol was developed for high-efficiency activation of human CD8+ T cells in which purified single cells or populations were stimulated with plate-bound anti-CD3 and anti-CD11a mAb for up to 8 days in T2 polarizing or neutral conditions, before functional analysis. Activation of CD8+ naïve T cells (TN in T2 compared with neutral conditions decreased the size of single-cell clones, although early division kinetics were equivalent, indicating an effect on overall division number. Activation of TN in T2 conditions followed by brief anti-CD3 mAb restimulation favored expression of T2 cytokines, GATA3 and Eomes, and lowered expression of type-1 cytokines, Prf1, Gzmb, T-BET, and Prdm1. However, IL-4 was only weakly expressed, and PMA and ionomycin restimulation favored IFN-γ over IL-4 expression. Activation of TN in T2 compared with neutral conditions prevented downregulation of costimulatory (CD27, CD28 and lymph-node homing receptors (CCR7 and CD95 acquisition, which typically occur during differentiation into effector phenotypes. CD3 was rapidly and substantially induced after activation in neutral, but not T2 conditions, potentially contributing to greater division and differentiation in neutral conditions. CD8+ central memory T cells (TCM were less able to enter division upon reactivation in T2 compared with neutral conditions, and were more refractory to modulating IFN-γ and IL-4 production than CD8+ TN. In summary, while activation of TN in T2 conditions can generate T2 cytokine-biased cells, IL-4 expression is weak, T2 bias is lost upon strong restimulation, differentiation, and division

  13. Induction of apoptosis in human cervical carcinoma HeLa cells by active compounds from Hypericum ascyron L.

    Science.gov (United States)

    Li, Xiu-Mei; Luo, Xue-Gang; He, Jun-Fang; Wang, Nan; Zhou, Hao; Yang, Pei-Long; Zhang, Tong-Cun

    2018-03-01

    Hypericum ascyron L. (Great St. Johnswort), which belongs to the Hypericaceae family, has been used for the treatment of hematemesis, metrorrhagia, rheumatism, swelling, stomach ache, abscesses, dysentery and irregular menstruation for >2,000 years in China. The aim of the present study was to clarify the anticancer activity compounds from H. ascyron L. and the underlying molecular mechanism. Anticancer activity of H. ascyron L. extract was evaluated using an MTT assay. To confirm the anticancer mechanism of activity compounds, Hoechst 33258, Annexin V-fluorescein isothiocyanate/propidium iodide, 2',7'-dichlorodihydrofluorescein diacetate, rhodamine 123 staining and caspase-3 activity analysis were performed. The results demonstrated that the anti-proliferative action of the mixture of kaempferol 3-O-β-(2″-acetyl) galactopyranoside (K) and quercetin (Q) (molar ratio, 1:1) was significantly increased compared with either of these two compounds separately, and the active fraction of the H. ascyron L. extract |(HALE). HALE, indicating that the anti-proliferative function of H. ascyron L. may be a synergic effect of K and Q. Furthermore, the inhibitory effect of KQ on the growth of HeLa cells was mediated by the induction of apoptosis. To the best of our knowledge, the present study is the first to identify that KQ exhibits significant anti-proliferation activity on HeLa cells via the apoptotic pathway, and is also the first to evaluate the anticancer potential of H. ascyron L. The results of the present study may provide a rational base for the use of H. ascyron L. in the clinic, and shed light on the development of novel anticancer drugs.

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. Impaired quality of the hepatitis B virus (HBV)-specific T-cell response in human immunodeficiency virus type 1-HBV coinfection.

    Science.gov (United States)

    Chang, J Judy; Sirivichayakul, Sunee; Avihingsanon, Anchalee; Thompson, Alex J V; Revill, Peter; Iser, David; Slavin, John; Buranapraditkun, Supranee; Marks, Pip; Matthews, Gail; Cooper, David A; Kent, Stephen J; Cameron, Paul U; Sasadeusz, Joe; Desmond, Paul; Locarnini, Stephen; Dore, Gregory J; Ruxrungtham, Kiat; Lewin, Sharon R

    2009-08-01

    Hepatitis B virus (HBV)-specific T cells play a key role both in the control of HBV replication and in the pathogenesis of liver disease. Human immunodeficiency virus type 1 (HIV-1) coinfection and the presence or absence of HBV e (precore) antigen (HBeAg) significantly alter the natural history of chronic HBV infection. We examined the HBV-specific T-cell responses in treatment-naïve HBeAg-positive and HBeAg-negative HIV-1-HBV-coinfected (n = 24) and HBV-monoinfected (n = 39) Asian patients. Peripheral blood was stimulated with an overlapping peptide library for the whole HBV genome, and tumor necrosis factor alpha and gamma interferon cytokine expression in CD8+ T cells was measured by intracellular cytokine staining and flow cytometry. There was no difference in the overall magnitude of the HBV-specific T-cell responses, but the quality of the response was significantly impaired in HIV-1-HBV-coinfected patients compared with monoinfected patients. In coinfected patients, HBV-specific T cells rarely produced more than one cytokine and responded to fewer HBV proteins than in monoinfected patients. Overall, the frequency and quality of the HBV-specific T-cell responses increased with a higher CD4+ T-cell count (P = 0.018 and 0.032, respectively). There was no relationship between circulating HBV-specific T cells and liver damage as measured by activity and fibrosis scores, and the HBV-specific T-cell responses were not significantly different in patients with either HBeAg-positive or HBeAg-negative disease. The quality of the HBV-specific T-cell response is impaired in the setting of HIV-1-HBV coinfection and is related to the CD4+ T-cell count.

  16. Utilization of reconstructed cultured human skin models as an alternative skin for permeation studies of chemical compounds

    OpenAIRE

    Kano, Satoshi; 藤堂, 浩明; 杉江, 謙一; 藤本, 英哲; 中田, 圭一; 徳留, 嘉寛; 橋本, フミ惠; 杉林, 堅次

    2010-01-01

    Two reconstructed human skin models, EpiskinSM and EpiDermTM, have been approved as alternative membranes for skin corrosive/irritation experiments due to their close correlation with animal skin. Such reconstructed human skin models were evaluated as alternative membranes for skin permeation experiments. Seven drugs with different lipophilicities and almost the same molecular weight were used as test penetrants. Relationships were investigated between permeability coefficients (P values) of ...

  17. Anti-cancer effects of bioactive compounds from rose hip fruit in human breast cancer cell lines

    OpenAIRE

    Zhong, Lijie

    2017-01-01

    Rose hips have long been used in human diets as a food ingredient and supplement. Their multiple medical properties, which have been attributed to their abundant carotenoid composition, have attracted widespread scientific attention. This thesis examined the carotenoid composition in rose hips from five rose species. The anti-cancer effect of different carotenoid fractions from rose hips was investigated in human breast cancer cell lines, using the natural variation in carotenoid content in h...

  18. Plant-derived human butyrylcholinesterase, but not an organophosphorous-compound hydrolyzing variant thereof, protects rodents against nerve agents

    OpenAIRE

    Geyer, Brian C.; Kannan, Latha; Garnaud, Pierre-Emmanuel; Broomfield, Clarence A.; Cadieux, C. Linn; Cherni, Irene; Hodgins, Sean M.; Kasten, Shane A.; Kelley, Karli; Kilbourne, Jacquelyn; Oliver, Zeke P.; Otto, Tamara C.; Puffenberger, Ian; Reeves, Tony E.; Robbins, Neil

    2010-01-01

    The concept of using cholinesterase bioscavengers for prophylaxis against organophosphorous nerve agents and pesticides has progressed from the bench to clinical trial. However, the supply of the native human proteins is either limited (e.g., plasma-derived butyrylcholinesterase and erythrocytic acetylcholinesterase) or nonexisting (synaptic acetylcholinesterase). Here we identify a unique form of recombinant human butyrylcholinesterase that mimics the native enzyme assembly into tetramers; t...

  19. Testing a cue outside the training context increases attention to the contexts and impairs performance in human predictive learning.

    Science.gov (United States)

    Aristizabal, José A; Ramos-Álvarez, Manuel M; Callejas-Aguilera, José E; Rosas, Juan M

    2017-12-01

    One experiment in human predictive learning explored the impact of a context change on attention to contexts and predictive ratings controlled by the cue. In Context A: cue X was paired with an outcome four times, while cue Y was presented without an outcome four times in Context B:. In both contexts filler cues were presented without the outcome. During the test, target cues X and Y were presented either in the context where they were trained, or in the alternative context. With the context change expectation of the outcome X, expressed as predictive ratings, decreased in the presence of X and increased in the presence of Y. Looking at the contexts, expressed as a percentage of the overall gaze dwell time on a trial, was high across the four training trials, and increased with the context change. Results suggest that the presentation of unexpected information leads to increases in attention to contextual cues. Implications for contextual control of behavior are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Icariin combined with human umbilical cord mesenchymal stem cells significantly improve the impaired kidney function in chronic renal failure.

    Science.gov (United States)

    Li, Wen; Wang, Li; Chu, Xiaoqian; Cui, Huantian; Bian, Yuhong

    2017-04-01

    At present, the main therapy for chronic renal failure (CRF) is dialysis and renal transplantation, but neither obtains satisfactory results. Human umbilical cord mesenchymal stem cells (huMSCs) are isolated from the fetal umbilical cord which has a high self-renewal and multi-directional differentiation potential. Icariin (ICA), a kidney-tonifying Chinese Medicine can enhance the multipotency of huMSCs. Therefore, this work seeks to employ the use of ICA-treated huMSCs for the treatment of chronic renal failure. Blood urea nitrogen and creatinine (Cr) analyses showed amelioration of functional parameters in ICA-treated huMSCs for the treatment of CRF rats at 3, 7, and 14 days after transplantation. ICA-treated huMSCs can obviously increase the number of cells in injured renal tissues at 3, 7, and 14 days after transplantation by optical molecular imaging system. Hematoxylin-eosin staining demonstrated that ICA-treated huMSCs reduced the levels of fibrosis in CRF rats at 14 days after transplantation. Superoxide dismutase and Malondialdehyde analyses showed that ICA-treated huMSCs reduced the oxidative damage in CRF rats. Moreover, transplantation with ICA-treated huMSCs decreased inflammatory responses, promoted the expression of growth factors, and protected injured renal tissues. Taken together, our findings suggest that ICA-treated huMSCs could improve the kidney function in CRF rats.

  1. Experimental setup and analytical methods for the non-invasive determination of volatile organic compounds, formaldehyde and NOx in exhaled human breath

    International Nuclear Information System (INIS)

    Riess, Ulrich; Tegtbur, Uwe; Fauck, Christian; Fuhrmann, Frank; Markewitz, Doreen; Salthammer, Tunga

    2010-01-01

    Different analytical devices were tested and evaluated for their suitability of breath gas analysis by examining the physiological parameters and chemical substances in the exhaled breath of ten healthy probands during light cycling in dependence of methanol-rich nutrition. The probands exercised under normal breathing conditions on a bicycle ergometer. Breath air was exhaled into a glass cylinder and collected under steady-state conditions. Non-invasively measured parameters were pulse rate, breath frequency, temperature, relative humidity, NO x , total volatile organic compounds (TVOC PAS ), carbon dioxide (CO 2 ), formaldehyde, methanol, acetaldehyde, acetone, isoprene and volatile organic compounds (VOCs). Methanol rich food and beverages strongly influenced the concentration of methanol and other organic substances in human breath. On the other hand, nutrition and smoking had no clear effect on the physical conditions of the probands. The proton transfer reaction mass spectrometry (PTR-MS) method was found to be very suitable for the analysis of breath gas but the m/z 31, if assigned to formaldehyde, is sensitive to interferences. The time vs. concentration curves of nitric oxide showed sudden peaks up to 120 ppb in most of the measurements. In one case a strong interference of the NO x signal was observed. The time resolved analysis of exhaled breath gas is of high capability and significance for different applications if reliable analytical techniques are used. Some compounds like nitric oxide (NO), methanol, different VOCs as well as sum parameters like TVOC PAS are especially suitable as markers. Formaldehyde, which is rapidly metabolized in the human body, could be measured reliably as a trace component by the acetylacetone (acac) method but not by PTR-MS.

  2. Experimental setup and analytical methods for the non-invasive determination of volatile organic compounds, formaldehyde and NO{sub x} in exhaled human breath

    Energy Technology Data Exchange (ETDEWEB)

    Riess, Ulrich; Tegtbur, Uwe [Hannover Medical School, Sports Physiology and Sports Medicine, Carl-Neuberg-Str. 1, 30625 Hannover (Germany); Fauck, Christian; Fuhrmann, Frank; Markewitz, Doreen [Fraunhofer WKI, Department of Material Analysis and Indoor Chemistry, Bienroder Weg 54 E, 38108 Braunschweig (Germany); Salthammer, Tunga, E-mail: tunga.salthammer@wki.fraunhofer.de [Fraunhofer WKI, Department of Material Analysis and Indoor Chemistry, Bienroder Weg 54 E, 38108 Braunschweig (Germany)

    2010-06-11

    Different analytical devices were tested and evaluated for their suitability of breath gas analysis by examining the physiological parameters and chemical substances in the exhaled breath of ten healthy probands during light cycling in dependence of methanol-rich nutrition. The probands exercised under normal breathing conditions on a bicycle ergometer. Breath air was exhaled into a glass cylinder and collected under steady-state conditions. Non-invasively measured parameters were pulse rate, breath frequency, temperature, relative humidity, NO{sub x}, total volatile organic compounds (TVOC{sub PAS}), carbon dioxide (CO{sub 2}), formaldehyde, methanol, acetaldehyde, acetone, isoprene and volatile organic compounds (VOCs). Methanol rich food and beverages strongly influenced the concentration of methanol and other organic substances in human breath. On the other hand, nutrition and smoking had no clear effect on the physical conditions of the probands. The proton transfer reaction mass spectrometry (PTR-MS) method was found to be very suitable for the analysis of breath gas but the m/z 31, if assigned to formaldehyde, is sensitive to interferences. The time vs. concentration curves of nitric oxide showed sudden peaks up to 120 ppb in most of the measurements. In one case a strong interference of the NO{sub x} signal was observed. The time resolved analysis of exhaled breath gas is of high capability and significance for different applications if reliable analytical techniques are used. Some compounds like nitric oxide (NO), methanol, different VOCs as well as sum parameters like TVOC{sub PAS} are especially suitable as markers. Formaldehyde, which is rapidly metabolized in the human body, could be measured reliably as a trace component by the acetylacetone (acac) method but not by PTR-MS.

  3. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  4. Fluorocarbon-bonded magnetic mesoporous microspheres for the analysis of perfluorinated compounds in human serum by high-performance liquid chromatography coupled to tandem mass spectrometry

    International Nuclear Information System (INIS)

    Liu, Xiaodan; Yu, Yingjia; Li, Yan; Zhang, Haiying; Ling, Jin; Sun, Xueni; Feng, Jianan; Duan, Gengli

    2014-01-01

    Highlights: • New SPE method was developed for analysis of PFCs in human serum. • Fluorocarbon-bonded magnetic mesoporous microspheres were used as SPE absorbents. • PFCs in serum were directly extracted without any other pretreatment procedure. • The PFCs-adsorbed microspheres were simply and rapidly isolated by using a magnet. - Abstract: We report herein an extraction method for the analysis of perfluorinated compounds in human serum based on magnetic core–mesoporous shell microspheres with decyl-perfluorinated interior pore-walls (Fe 3 O 4 @mSiO 2 -F 17 ). Thanks to the unique properties of the Fe 3 O 4 @mSiO 2 -F 17 microspheres, macromolecules like proteins could be easily excluded from the mesoporous channels due to size exclusion effect, and perfluorinated compounds (PFCs) in protein-rich biosamples such as serum could thus be directly extracted with the fluorocarbon modified on the channel wall without any other pretreatment procedure. The PFCs adsorbed Fe 3 O 4 @mSiO 2 -F 17 microspheres could then be simply and rapidly isolated by using a magnet, followed by being identified and quantified by LC–MS/MS (high-performance liquid chromatography coupled to tandem mass spectrometry). Five perfluorinatedcarboxylic acids (C6, C8–C11) and perfluorooctane sulfonate (PFOS) were selected as model analytes. In order to achieve the best extraction efficiency, some important factors including the amount of Fe 3 O 4 @mSiO 2 -F 17 microspheres added, adsorption time, type of elution solvent, eluting solvent volume and elution time were investigated. The ranges of the LOD were 0.02–0.05 ng mL −1 for the six PFCs. The recovery of the optimized method varies from 83.13% to 92.42% for human serum samples

  5. Efficient internalization of mesoporous silica particles of different sizes by primary human macrophages without impairment of macrophage clearance of apoptotic or antibody-opsonized target cells

    International Nuclear Information System (INIS)

    Witasp, Erika; Kupferschmidt, Natalia; Bengtsson, Linnea; Hultenby, Kjell; Smedman, Christian; Paulie, Staffan; Garcia-Bennett, Alfonso E.; Fadeel, Bengt

    2009-01-01

    Macrophage recognition and ingestion of apoptotic cell corpses, a process referred to as programmed cell clearance, is of considerable importance for the maintenance of tissue homeostasis and in the resolution of inflammation. Moreover, macrophages are the first line of defense against microorganisms and other foreign materials including particles. However, there is sparse information on the mode of uptake of engineered nanomaterials by primary macrophages. In this study, mesoporous silica particles with cubic pore geometries and covalently fluorescein-grafted particles were synthesized through a novel route, and their interactions with primary human monocyte-derived macrophages were assessed. Efficient and active internalization of mesoporous silica particles of different sizes was observed by transmission electron microscopic and flow cytometric analysis and studies using pharmacological inhibitors suggested that uptake occurred through a process of endocytosis. Moreover, uptake of silica particles was independent of serum factors. The silica particles with very high surface areas due to their porous structure did not impair cell viability or function of macrophages, including the ingestion of different classes of apoptotic or opsonized target cells. The current findings are relevant to the development of mesoporous materials for drug delivery and other biomedical applications.

  6. Persistent organochlorine pollutants and risk for skeletal fractures and impaired bone mineral density in humans. Results from the ''COMPARE'' project

    Energy Technology Data Exchange (ETDEWEB)

    Hagmar, L.; Wallin, E.; Joensson, B.A. [Department of Occupational and Environmental Medicine, Lund (Sweden)

    2004-09-15

    Persistent organochlorine pollutants (POP) have, in animal studies, impaired normal bone metabolism and resulted in increased bone fragility. Especially considering the dramatical increase in osteoporotic fractures in western societies during the last decades, it is a pertinent question whether a high dietary intake of POP might pose a risk for deteriorated bone quality in humans. This problem has been assessed as a part of the collaborative project ''COMPARE'', funded by European Commission RD Life Science Program. As a study base we have used cohorts of Swedish fishermen's families. We have earlier shown that fishermen living at the east coast of Sweden, have a high consumption of contaminated fatty fish from the Baltic Sea and consequently relatively high exposure levels for various POPs, also compared with fishermen from the Swedish west coast. Such a discrepancy was also found for fishermen's wives. The aim of the project was to assess in epidemiological studies whether a high dietary intake of POP through fatty fish from the Baltic may result in an increased incidence of osteoporotic fractures or decreased bone mineral density (BMD). We give here an overview of the results.

  7. Lipopolysaccharide (LPS Accumulates in Neocortical Neurons of Alzheimer’s Disease (AD Brain and Impairs Transcription in Human Neuronal-Glial Primary Co-cultures

    Directory of Open Access Journals (Sweden)

    Yuhai Zhao

    2017-12-01

    Full Text Available Several independent laboratories have recently reported the detection of bacterial nucleic acid sequences or bacterial-derived neurotoxins, such as highly inflammatory lipopolysaccharide (LPS, within Alzheimer’s disease (AD affected brain tissues. Whether these bacterial neurotoxins originate from the gastrointestinal (GI tract microbiome, a possible brain microbiome or some dormant pathological microbiome is currently not well understood. Previous studies indicate that the co-localization of pro-inflammatory LPS with AD-affected brain cell nuclei suggests that there may be a contribution of this neurotoxin to genotoxic events that support inflammatory neurodegeneration and failure in homeostatic gene expression. In this report we provide evidence that in sporadic AD, LPS progressively accumulates in neuronal parenchyma and appears to preferentially associate with the periphery of neuronal nuclei. Run-on transcription studies utilizing [α-32P]-uridine triphosphate incorporation into newly synthesized total RNA further indicates that human neuronal-glial (HNG cells in primary co-culture incubated with LPS exhibit significantly reduced output of DNA transcription products. These studies suggest that in AD LPS may impair the efficient readout of neuronal genetic information normally required for the homeostatic operation of brain cell function and may contribute to a progressive disruption in the read-out of genetic information.

  8. Alternate Phosphorylation/O-GlcNAc Modification on Human Insulin IRSs: A Road towards Impaired Insulin Signaling in Alzheimer and Diabetes

    Directory of Open Access Journals (Sweden)

    Zainab Jahangir

    2014-01-01

    Full Text Available Impaired insulin signaling has been thought of as important step in both Alzheimer’s disease (AD and type 2 diabetes mellitus (T2DM. Posttranslational modifications (PTMs regulate functions and interaction of insulin with insulin receptors substrates (IRSs and activate insulin signaling downstream pathways via autophosphorylation on several tyrosine (TYR residues on IRSs. Two important insulin receptor substrates 1 and 2 are widely expressed in human, and alternative phosphorylation on their serine (Ser and threonine (Thr residues has been known to block the Tyr phosphorylation of IRSs, thus inhibiting insulin signaling and promoting insulin resistance. Like phosphorylation, O-glycosylation modification is important PTM and inhibits phosphorylation on same or neighboring Ser/Thr residues, often called Yin Yang sites. Both IRS-1 and IRS-2 have been shown to be O-glycosylated; however exact sites are not determined yet. In this study, by using neuronal network based prediction methods, we found more than 50 Ser/Thr residues that have potential to be O-glycosylated and may act as possible sites as well. Moreover, alternative phosphorylation and O-glycosylation on IRS-1 Ser-312, 984, 1037, and 1101 may act as possible therapeutic targets to minimize the risk of AD and T2DM.

  9. Pathophysiological hypoxia affects the redox state and IL-2 signalling of human CD4+ T cells and concomitantly impairs survival and proliferation.

    Science.gov (United States)

    Gaber, Timo; Tran, Cam Loan; Schellmann, Saskia; Hahne, Martin; Strehl, Cindy; Hoff, Paula; Radbruch, Andreas; Burmester, Gerd-Rüdiger; Buttgereit, Frank

    2013-06-01

    Inflamed areas are characterized by infiltration of immune cells, local hypoxia and alterations of cellular redox states. We investigated the impact of hypoxia on survival, proliferation, cytokine secretion, intracellular energy and redox state of human CD4(+) T cells. We found that pathophysiological hypoxia (<2% O2 ) significantly decreased CD4(+) T-cell survival after mitogenic stimulation. This effect was not due to an increased caspase-3/7-mediated apoptosis or adenosine-5'-triphosphate (ATP) consumption/depletion. However, the ability of stimulated T cells to proliferate was reduced under hypoxic conditions, despite increased expression of CD25. Pathophysiological hypoxia was also found to modify intracellular ROS (iROS) levels in stimulated T cells over time as compared with levels found in normoxia. Physiological hypoxia (5% O2 ) did not decrease CD4(+) T-cell survival and proliferation or modify iROS levels as compared with normoxia. We conclude that pathophysiological hypoxia affects T-cell proliferation and viability via disturbed IL-2R signalling downstream of STAT5a phosphorylation, but not as a result of impaired cellular energy homeostasis. We suggest iROS links early events in T-cell stimulation to the inhibition of the lymphoproliferative response under pathophysiological hypoxic conditions. The level of iROS may therefore act as a mediator of immune functions leading to down-regulation of long-term T-cell activity in inflamed tissues. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The single nucleotide polymorphism Gly482Ser in the PGC-1α gene impairs exercise-induced slow-twitch muscle fibre transformation in humans.

    Directory of Open Access Journals (Sweden)

    Peter Steinbacher

    Full Text Available PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2. Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak. Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.

  11. The single nucleotide polymorphism Gly482Ser in the PGC-1α gene impairs exercise-induced slow-twitch muscle fibre transformation in humans.

    Science.gov (United States)

    Steinbacher, Peter; Feichtinger, René G; Kedenko, Lyudmyla; Kedenko, Igor; Reinhardt, Sandra; Schönauer, Anna-Lena; Leitner, Isabella; Sänger, Alexandra M; Stoiber, Walter; Kofler, Barbara; Förster, Holger; Paulweber, Bernhard; Ring-Dimitriou, Susanne

    2015-01-01

    PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α) is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP) in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2). Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak). Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.

  12. Human immunodeficiency virus type 1 KK26-27 matrix mutants display impaired infectivity, circularization and integration but not nuclear import

    International Nuclear Information System (INIS)

    Mannioui, Abdelkrim; Nelson, Elisabeth; Schiffer, Cecile

    2005-01-01

    We analyzed the role of human immunodeficiency virus (HIV)-1 matrix protein (MA) during the virus replication afferent phase. Single-round infection of H9 T lymphocytes showed that the combined mutation of MA Lys residues 26-27 in MA reported nuclear localization signal (NLS)-1 [Haffar, O.K., Popov, S., Dubrovsky, L., Agostini, I., Tang, H., Pushkarsky, T., Nadler, S.G., Bukrinsky, M., 2000. Two nuclear localization signals in the HIV-1 matrix protein regulate nuclear import of the HIV-1 pre-integration complex. J. Mol. Biol. 299 (2): 359-368] impaired infectivity, abrogated 2-LTR-circle formation and significantly reduced integration. However, the mutation did not affect viral DNA docking to chromatin in either interphasic or mitotic cells, indicating that MA N-terminal basic domain should not represent a major determinant of HIV-1 nuclear import in T lymphocytes. These data point to a previously unreported role of MA in the late, post-chromatin-binding, afferent phase of HIV-1 replication cycle

  13. Doxycycline Impairs Mitochondrial Function and Protects Human Glioma Cells from Hypoxia-Induced Cell Death: Implications of Using Tet-Inducible Systems.

    Science.gov (United States)

    Luger, Anna-Luisa; Sauer, Benedikt; Lorenz, Nadja I; Engel, Anna L; Braun, Yannick; Voss, Martin; Harter, Patrick N; Steinbach, Joachim P; Ronellenfitsch, Michael W

    2018-05-17

    Inducible gene expression is an important tool in molecular biology research to study protein function. Most frequently, the antibiotic doxycycline is used for regulation of so-called tetracycline (Tet)-inducible systems. In contrast to stable gene overexpression, these systems allow investigation of acute and reversible effects of cellular protein induction. Recent reports have already called for caution when using Tet-inducible systems as the employed antibiotics can disturb mitochondrial function and alter cellular metabolism by interfering with mitochondrial translation. Reprogramming of energy metabolism has lately been recognized as an important emerging hallmark of cancer and is a central focus of cancer research. Therefore, the scope of this study was to systematically analyze dose-dependent metabolic effects of doxycycline on a panel of glioma cell lines with concomitant monitoring of gene expression from Tet-inducible systems. We report that doxycycline doses commonly used with inducible expression systems (0.01⁻1 µg/mL) substantially alter cellular metabolism: Mitochondrial protein synthesis was inhibited accompanied by reduced oxygen and increased glucose consumption. Furthermore, doxycycline protected human glioma cells from hypoxia-induced cell death. An impairment of cell growth was only detectable with higher doxycycline doses (10 µg/mL). Our findings describe settings where doxycycline exerts effects on eukaryotic cellular metabolism, limiting the employment of Tet-inducible systems.

  14. The dynamin chemical inhibitor dynasore impairs cholesterol trafficking and sterol-sensitive genes transcription in human HeLa cells and macrophages.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Girard

    Full Text Available Intracellular transport of cholesterol contributes to the regulation of cellular cholesterol homeostasis by mechanisms that are yet poorly defined. In this study, we characterized the impact of dynasore, a recently described drug that specifically inhibits the enzymatic activity of dynamin, a GTPase regulating receptor endocytosis and cholesterol trafficking. Dynasore strongly inhibited the uptake of low-density lipoprotein (LDL in HeLa cells, and to a lower extent in human macrophages. In both cell types, dynasore treatment led to the abnormal accumulation of LDL and free cholesterol (FC within the endolysosomal network. The measure of cholesterol esters (CE further showed that the delivery of regulatory cholesterol to the endoplasmic reticulum (ER was deficient. This resulted in the inhibition of the transcriptional control of the three major sterol-sensitive genes, sterol-regulatory element binding protein 2 (SREBP-2, 3-hydroxy-3-methyl-coenzymeA reductase (HMGCoAR, and low-density lipoprotein receptor (LDLR. The sequestration of cholesterol in the endolysosomal compartment impaired both the active and passive cholesterol efflux in HMDM. Our data further illustrate the importance of membrane trafficking in cholesterol homeostasis and validate dynasore as a new pharmacological tool to study the intracellular transport of cholesterol.

  15. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    Science.gov (United States)

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  16. 17-DMAG induces heat shock protein 90 functional impairment in human bladder cancer cells: knocking down the hallmark traits of malignancy.

    Science.gov (United States)

    Karkoulis, Panagiotis K; Stravopodis, Dimitrios J; Voutsinas, Gerassimos E

    2016-05-01

    Heat shock protein 90 (Hsp90) is a molecular chaperone that maintains the structural and functional integrity of various protein clients involved in multiple oncogenic signaling pathways. Hsp90 holds a prominent role in tumorigenesis, as numerous members of its broad clientele are involved in the generation of the hallmark traits of cancer. 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG) specifically targets Hsp90 and interferes with its function as a molecular chaperone, impairing its intrinsic ATPase activity and undermining proper folding of multiple protein clients. In this study, we have examined the effects of 17-DMAG on the regulation of Hsp90-dependent tumorigenic signaling pathways directly implicated in cell cycle progression, survival, and motility of human urinary bladder cancer cell lines. We have used MTT-based assays, FACS analysis, Western blotting, semiquantitative PCR (sqPCR), immunofluorescence, and scratch-wound assays in RT4 (p53(wt)), RT112 (p53(wt)), T24 (p53(mt)), and TCCSUP (p53(mt)) human urinary bladder cancer cell lines. We have demonstrated that, upon exposure to 17-DMAG, bladder cancer cells display prominent cell cycle arrest and commitment to apoptotic and autophagic cell death, in a dose-dependent manner. Furthermore, 17-DMAG administration induced pronounced downregulation of multiple Hsp90 protein clients and other downstream oncogenic effectors, therefore causing inhibition of cell proliferation and decline of cell motility due to the molecular "freezing" of critical cytoskeletal components. In toto, we have clearly demonstrated the dose-dependent and cell type-specific effects of 17-DMAG on the hallmark traits of cancer, appointing Hsp90 as a key molecular component in bladder cancer targeted therapy.

  17. The human Nav1.5 F1486 deletion associated with long QT syndrome leads to impaired sodium channel inactivation and reduced lidocaine sensitivity

    Science.gov (United States)

    Song, Weihua; Xiao, Yucheng; Chen, Hanying; Ashpole, Nicole M; Piekarz, Andrew D; Ma, Peilin; Hudmon, Andy; Cummins, Theodore R; Shou, Weinian

    2012-01-01

    The deletion of phenylalanine 1486 (F1486del) in the human cardiac voltage-gated sodium channel (hNav1.5) is associated with fatal long QT (LQT) syndrome. In this study we determined how F1486del impairs the functional properties of hNav1.5 and alters action potential firing in heterologous expression systems (human embryonic kidney (HEK) 293 cells) and their native cardiomyocyte background. Cells expressing hNav1.5-F1486del exhibited a loss-of-function alteration, reflected by an 80% reduction of peak current density, and several gain-of-function alterations, including reduced channel inactivation, enlarged window current, substantial augmentation of persistent late sodium current and an increase in ramp current. We also observed substantial action potential duration (APD) prolongation and prominent early afterdepolarizations (EADs) in neonatal cardiomyocytes expressing the F1486del channels, as well as in computer simulations of myocyte activity. In addition, lidocaine sensitivity was dramatically reduced, which probably contributed to the poor therapeutic outcome observed in the patient carrying the hNav1.5-F1486del mutation. Therefore, despite the significant reduction in peak current density, the F1486del mutation also leads to substantial gain-of-function alterations that are sufficient to cause APD prolongation and EADs, the predominant characteristic of LQTs. These data demonstrate that hNav1.5 mutations can have complex functional consequences and highlight the importance of identifying the specific molecular defect when evaluating potential treatments for individuals with prolonged QT intervals. PMID:22826127

  18. Nutraceuticals in cognitive impairment and Alzheimer's disease.

    Science.gov (United States)

    Mecocci, P; Tinarelli, C; Schulz, R J; Polidori, M C

    2014-01-01

    Several chemical substances belonging to classes of natural dietary origin display protective properties against some age-related diseases including neurodegenerative ones, particularly Alzheimer's disease (AD). These compounds, known as nutraceuticals, differ structurally, act therefore at different biochemical and metabolic levels and have shown different types of neuroprotective properties. The aim of this review is to summarize data from observational studies, clinical trials, and randomized clinical trials (RCTs) in humans on the effects of selected nutraceuticals against age-related cognitive impairment and dementia. We report results from studies on flavonoids, some vitamins and other natural substances that have been studied in AD and that might be beneficial for the maintenance of a good cognitive performance. Due to the substantial lack of high-level evidence studies there is no possibility for recommendation of nutraceuticals in dementia-related therapeutic guidelines. Nevertheless, the strong potential for their neuroprotective action warrants further studies in the field.

  19. Comparison of the vasodilator responses of isolated human and rat middle meningeal arteries to migraine related compounds

    DEFF Research Database (Denmark)

    Grände, Gustaf; Labruijere, Sieneke; Haanes, Kristian Agmund

    2014-01-01

    , telcagepant) were applied to the isolated arteries, and both induced a significant decrease of the effect of exogenously administrated CGRP. In experiments on rat middle meningeal arteries, pre-contracted with PGF2α, similar tendencies were seen. When the pre-contraction was switched to K+ in a separate...... series of experiments, CGRP and sildenafil significantly relaxed the arteries. CONCLUSIONS: Still no definite answer can be given as to why pain is experienced during an attack of migraine. No clear correlation was found between the efficacy of a substance as a meningeal artery vasodilator in human...

  20. Prototype Systems Containing Human Cytochrome P450 for High-Throughput Real-Time Detection of DNA Damage by Compounds That Form DNA-Reactive Metabolites.

    Science.gov (United States)

    Brito Palma, Bernardo; Fisher, Charles W; Rueff, José; Kranendonk, Michel

    2016-05-16

    The formation of reactive metabolites through biotransformation is the suspected cause of many adverse drug reactions. Testing for the propensity of a drug to form reactive metabolites has increasingly become an integral part of lead-optimization strategy in drug discovery. DNA reactivity is one undesirable facet of a drug or its metabolites and can lead to increased risk of cancer and reproductive toxicity. Many drugs are metabolized by cytochromes P450 in the liver and other tissues, and these reactions can generate hard electrophiles. These hard electrophilic reactive metabolites may react with DNA and may be detected in standard in vitro genotoxicity assays; however, the majority of these assays fall short due to the use of animal-derived organ extracts that inadequately represent human metabolism. The current study describes the development of bacterial systems that efficiently detect DNA-damaging electrophilic reactive metabolites generated by human P450 biotransformation. These assays use a GFP reporter system that detects DNA damage through induction of the SOS response and a GFP reporter to control for cytotoxicity. Two human CYP1A2-competent prototypes presented here have appropriate characteristics for the detection of DNA-damaging reactive metabolites in a high-throughput manner. The advantages of this approach include a short assay time (120-180 min) with real-time measurement, sensitivity to small amounts of compound, and adaptability to a microplate format. These systems are suitable for high-throughput assays and can serve as prototypes for the development of future enhanced versions.

  1. Vitamin A deficiency impairs adaptive B and T cell responses to a prototype monovalent attenuated human rotavirus vaccine and virulent human rotavirus challenge in a gnotobiotic piglet model.

    Directory of Open Access Journals (Sweden)

    Kuldeep S Chattha

    Full Text Available Rotaviruses (RV are a major cause of gastroenteritis in children. Widespread vitamin A deficiency is associated with reduced efficacy of vaccines and higher incidence of diarrheal infections in children in developing countries. We established a vitamin A deficient (VAD gnotobiotic piglet model that mimics subclinical vitamin A deficiency in children to study its effects on an oral human rotavirus (HRV vaccine and virulent HRV challenge. Piglets derived from VAD and vitamin A sufficient (VAS sows were orally vaccinated with attenuated HRV or mock, with/without supplemental vitamin A and challenged with virulent HRV. Unvaccinated VAD control piglets had significantly lower hepatic vitamin A, higher severity and duration of diarrhea and HRV fecal shedding post-challenge as compared to VAS control pigs. Reduced protection coincided with significantly higher innate (IFNα cytokine and CD8 T cell frequencies in the blood and intestinal tissues, higher pro-inflammatory (IL12 and 2-3 fold lower anti-inflammatory (IL10 cytokines, in VAD compared to VAS control pigs. Vaccinated VAD pigs had higher diarrhea severity scores compared to vaccinated VAS pigs, which coincided with lower serum IgA HRV antibody titers and significantly lower intestinal IgA antibody secreting cells post-challenge in the former groups suggesting lower anamnestic responses. A trend for higher serum HRV IgG antibodies was observed in VAD vs VAS vaccinated groups post-challenge. The vaccinated VAD (non-vitamin A supplemented pigs had significantly higher serum IL12 (PID2 and IFNγ (PID6 compared to vaccinated VAS groups suggesting higher Th1 responses in VAD conditions. Furthermore, regulatory T-cell responses were compromised in VAD pigs. Supplemental vitamin A in VAD pigs did not fully restore the dysregulated immune responses to AttHRV vaccine or moderate virulent HRV diarrhea. Our findings suggest that that VAD in children in developing countries may partially contribute to more

  2. In silico screening of potent natural inhibitor compounds against Human DOPA Decarboxylase for management of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Surya Narayan Rath

    2017-12-01

    Full Text Available Loss of dopaminergic neurons of the substantia nigra of the mid brain is a well studied pathophysiology of Parkinson’s disease (PD, is the second most common neurodegenerative disorder. To compensate dopamine levels at the Central Nervous System (CNS exogenous L-Dopa is generally administered. But the major part of the L-Dopa is metabolized by Dopa decarboxylase (DDC, E.C. 4.1.1.28, a pyridoxal 5’ –phosphate (PLP enzyme, which is abundant in CNS and hence, only 1-5% of L-Dopa reaches to dopaminergic neurons. In this context, co-administration of peripheral DDC inhibitors (carbidopa or benserazide has been successfully used for the symptomatic treatment of PD patients. But, due to use of synthetic drugs many adverse effects have been reported during treatment. Therefore, the current study is planned to discover some plant based potent natural inhibitors against human DDC as an alternative way for the management of PD. This study was conducted through virtual screening and molecular docking of DDC enzyme with phytochemicals like withania somnifera (ashwagandha, glycine max (soybean, vicia faba (broad bean, and marsilea quadrifolia (sunsunia etc to evaluate their inhibition properties. In silico study results shown a good binding affinity and predicted some of the phytochemicals as potent natural inhibitors against human DDC. This work could be validated further through experimental procedures.

  3. Crispoic acid, a new compound from Laelia marginata (Orchidaceae), and biological evaluations against parasites, human cancer cell lines and Zika virus.

    Science.gov (United States)

    Belloto, Andrezza C; Souza, Gredson K; Perin, Paula C; Schuquel, Ivania T A; Santin, Silvana M O; Chiavelli, Lucas U R; Garcia, Francielle P; Kaplum, Vanessa; Rodrigues, Jean H S; Scariot, Débora B; Delvecchio, Rodrigo; Machado-Ferreira, Erik; Santana Aguiar, Renato; Soares, Carlos A G; Nakamura, Celso V; Pomini, Armando M

    2017-11-08

    The phytochemical study of Laelia marginata (Lindl.) L. O. Williams (Orchidaceae) led to the isolation of a new natural product named crispoic acid (1), together with six other known compounds (2-7). The new natural product was identified as a dimer of eucomic acid and was structurally characterised based upon 1D and 2D NMR and HRMS data. Biological assays with plant crude extract, fractions and isolated compounds were performed against two human cancer cell lines (Hela and Siha), and the tropical parasites Trypanosoma cruzi and Leishmania (Leishmania) amazonensis. The phenantrenoid 9,10-dihydro-4-methoxyphenanthren-2,7-diol 2 was active against Hela and Siha cells (CC 50 5.86 ± 0.19 and 20.78 ± 2.72 μg/mL, respectively). Sub-lethal concentrations of the flavone rhamnazin 4 were not able to rescue the viability of the Vero cells infected by Zika virus.

  4. Binding affinity toward human prion protein of some anti-prion compounds - Assessment based on QSAR modeling, molecular docking and non-parametric ranking.

    Science.gov (United States)

    Kovačević, Strahinja; Karadžić, Milica; Podunavac-Kuzmanović, Sanja; Jevrić, Lidija

    2018-01-01

    The present study is based on the quantitative structure-activity relationship (QSAR) analysis of binding affinity toward human prion protein (huPrP C ) of quinacrine, pyridine dicarbonitrile, diphenylthiazole and diphenyloxazole analogs applying different linear and non-linear chemometric regression techniques, including univariate linear regression, multiple linear regression, partial least squares regression and artificial neural networks. The QSAR analysis distinguished molecular lipophilicity as an important factor that contributes to the binding affinity. Principal component analysis was used in order to reveal similarities or dissimilarities among the studied compounds. The analysis of in silico absorption, distribution, metabolism, excretion and toxicity (ADMET) parameters was conducted. The ranking of the studied analogs on the basis of their ADMET parameters was done applying the sum of ranking differences, as a relatively new chemometric method. The main aim of the study was to reveal the most important molecular features whose changes lead to the changes in the binding affinities of the studied compounds. Another point of view on the binding affinity of the most promising analogs was established by application of molecular docking analysis. The results of the molecular docking were proven to be in agreement with the experimental outcome. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Repeatability of two-dimensional chemical shift imaging multivoxel proton magnetic resonance spectroscopy for measuring human cerebral choline-containing compounds.

    Science.gov (United States)

    Puri, Basant K; Egan, Mary; Wallis, Fintan; Jakeman, Philip

    2018-03-22

    To investigate the repeatability of proton magnetic resonance spectroscopy in the in vivo measurement of human cerebral levels of choline-containing compounds (Cho). Two consecutive scans were carried out in six healthy resting subjects at a magnetic field strength of 1.5 T. On each occasion, neurospectroscopy data were collected from 64 voxels using the same 2D chemical shift imaging (CSI) sequence. The data were analyzed in the same way, using the same software, to obtain the values for each voxel of the ratio of Cho to creatine. The Wilcoxon related-samples signed-rank test, coefficient of variation (CV), repeatability coefficient (RC), and intraclass correlation coefficient (ICC) were used to assess the repeatability. The CV ranged from 2.75% to 33.99%, while the minimum RC was 5.68%. There was excellent reproducibility, as judged by significant ICC values, in 26 voxels. Just three voxels showed significant differences according to the Wilcoxon related-samples signed-rank test. It is therefore concluded that when CSI multivoxel proton neurospectroscopy is used to measure cerebral choline-containing compounds at 1.5 T, the reproducibility is highly acceptable.

  6. Small-molecule screening using a human primary cell model of HIV latency identifies compounds that reverse latency without cellular activation

    Science.gov (United States)

    Yang, Hung-Chih; Xing, Sifei; Shan, Liang; O’Connell, Karen; Dinoso, Jason; Shen, Anding; Zhou, Yan; Shrum, Cynthia K.; Han, Yefei; Liu, Jun O.; Zhang, Hao; Margolick, Joseph B.; Siliciano, Robert F.

    2009-01-01

    The development of highly active antiretroviral therapy (HAART) to treat individuals infected with HIV-1 has dramatically improved patient outcomes, but HAART still fails to cure the infection. The latent viral reservoir in resting CD4+ T cells is a major barrier to virus eradication. Elimination of this reservoir requires reactivation of the latent virus. However, strategies for reactivating HIV-1 through nonspecific T cell activation have clinically unacceptable toxicities. We describe here the development of what we believe to be a novel in vitro model of HIV-1 latency that we used to search for compounds that can reverse latency. Human primary CD4+ T cells were transduced with the prosurvival molecule Bcl-2, and the resulting cells were shown to recapitulate the quiescent state of resting CD4+ T cells in vivo. Using this model system, we screened small-molecule libraries and identified a compound that reactivated latent HIV-1 without inducing global T cell activation, 5-hydroxynaphthalene-1,4-dione (5HN). Unlike previously described latency-reversing agents, 5HN activated latent HIV-1 through ROS and NF-κB without affecting nuclear factor of activated T cells (NFAT) and PKC, demonstrating that TCR pathways can be dissected and utilized to purge latent virus. Our study expands the number of classes of latency-reversing therapeutics and demonstrates the utility of this in vitro model for finding strategies to eradicate HIV-1 infection. PMID:19805909

  7. Use of Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes (hiPSC-CMs) to Monitor Compound Effects on Cardiac Myocyte Signaling Pathways.

    Science.gov (United States)

    Guo, Liang; Eldridge, Sandy; Furniss, Mike; Mussio, Jodie; Davis, Myrtle

    2015-09-01

    There is a need to develop mechanism-based assays to better inform risk of cardiotoxicity. Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are rapidly gaining acceptance as a biologically relevant in vitro model for use in drug discovery and cardiotoxicity screens. Utilization of hiPSC-CMs for mechanistic investigations would benefit from confirmation of the expression and activity of cellular pathways that are known to regulate cardiac myocyte viability and function. This unit describes an approach to demonstrate the presence and function of signaling pathways in hiPSC-CMs and the effects of treatments on these pathways. We present a workflow that employs protocols to demonstrate protein expression and functional integrity of signaling pathway(s) of interest and to characterize biological consequences of signaling modulation. These protocols utilize a unique combination of structural, functional, and biochemical endpoints to interrogate compound effects on cardiomyocytes. Copyright © 2015 John Wiley & Sons, Inc.

  8. The ethanol extract of Scutellaria baicalensis and the active compounds induce cell cycle arrest and apoptosis including upregulation of p53 and Bax in human lung cancer cells

    International Nuclear Information System (INIS)

    Gao Jiayu; Morgan, Winston A.; Sanchez-Medina, Alberto; Corcoran, Olivia

    2011-01-01

    Despite a lack of scientific authentication, Scutellaria baicalensis is clinically used in Chinese medicine as a traditional adjuvant to chemotherapy of lung cancer. In this study, cytotoxicity assays demonstrated that crude ethanolic extracts of S. baicalensis were selectively toxic to human lung cancer cell lines A549, SK-LU-1 and SK-MES-1 compared with normal human lung fibroblasts. The active compounds baicalin, baicalein and wogonin did not exhibit such selectivity. Following exposure to the crude extracts, cellular protein expression in the cancer cell lines was assessed using 2D gel electrophoresis coupled with MALDI-TOF-MS/Protein Fingerprinting. The altered protein expression indicated that cell growth arrest and apoptosis were potential mechanisms of cytotoxicity. These observations were supported by PI staining cell cycle analysis using flow cytometry and Annexin-V apoptotic analysis by fluorescence microscopy of cancer cells treated with the crude extract and pure active compounds. Moreover, specific immunoblotting identification showed the decreased expression of cyclin A results in the S phase arrest of A549 whereas the G 0 /G 1 phase arrest in SK-MES-1 cells results from the decreased expression of cyclin D1. Following treatment, increased expression in the cancer cells of key proteins related to the enhancement of apoptosis was observed for p53 and Bax. These results provide further insight into the molecular mechanisms underlying the clinical use of this herb as an adjuvant to lung cancer therapy. - Research highlights: → Scutellaria baicalensis is a clinical adjuvant to lung cancer chemotherapy in China. → Scutellaria ethanol extracts selectively toxic to A549, SK-LU-1 and SK-MES-1. → Baicalin, baicalein and wogonin were toxic to all lung cancer cell lines. → Proteomics identified increased p53 and BAX in response to Scutellaria extracts.

  9. Occurrence and potential human-health relevance of volatile organic compounds in drinking water from domestic wells in the United States

    Science.gov (United States)

    Rowe, B.L.; Toccalino, P.L.; Moran, M.J.; Zogorski, J.S.; Price, C.V.

    2011-01-01

    BACKGROUND: As the population and demand for safe drinking water from domestic wells increase, it is important to examine water quality and contaminant occurrence. A national assessment in 2006 by the U.S. Geological Survey reported findings for 55 volatile organic compounds (VOCs) based on 2,401 domestic wells sampled during 1985-2002. OBJECTIVES: We examined the occurrence of individual and multiple VOCs and assessed the potential human-health relevance of VOC concentrations. We also identified hydrogeologic and anthropogenic variables that influence the probability of VOC occurrence. METHODS: The domestic well samples were collected at the wellhead before treatment of water and analyzed for 55 VOCs. Results were used to examine VOC occurrence and identify associations of multiple explanatory variables using logistic regression analyses. We used a screening-level assessment to compare VOC concentrations to U.S. Environmental Protection Agency maximum contaminant levels (MCLs) and health-based screening levels. RESULTS: We detected VOCs in 65% of the samples; about one-half of these samples contained VOC mixtures. Frequently detected VOCs included chloroform, toluene, 1,2,4-trimethylbenzene, and perchloroethene. VOC concentrations generally were < 1 ??g/L. One or more VOC concentrations were greater than MCLs in 1.2% of samples, including dibromochloropropane, 1,2-dichloropropane, and ethylene dibromide (fumigants); perchloroethene and trichloroethene (solvents); and 1,1-dichloroethene (organic synthesis compound). CONCLUSIONS: Drinking water supplied by domestic wells is vulnerable to low-level VOC contamination. About 1% of samples had concentrations of potential human-health concern. Identifying factors associated with VOC occurrence may aid in understanding the sources, transport, and fate of VOCs in groundwater.

  10. Hypoxia compounds exercise-induced free radical formation in humans; partitioning contributions from the cerebral and femoral circulation

    DEFF Research Database (Denmark)

    Bailey, Damian M; Rasmussen, Peter; Evans, Kevin A

    2018-01-01

    This study examined to what extent the human cerebral and femoral circulation contribute to free radical formation during basal and exercise-induced responses to hypoxia. Healthy participants (5♂, 5♀) were randomly assigned single-blinded to normoxic (21% O2) and hypoxic (10% O2) trials...... hypoxia (P free radical-mediated lipid peroxidation subsequent to inadequate antioxidant defense. This was pronounced during exercise across the femoral circulation in proportion to the increase in local O2 uptake (r = -0.397 to -0.459, P = 0.037 to 0...... with measurements taken at rest and 30min after cycling at 70% of maximal power output in hypoxia and equivalent relative and absolute intensities in normoxia. Blood was sampled from the brachial artery (a), internal jugular and femoral veins (v) for non-enzymatic antioxidants (HPLC), ascorbate radical (A...

  11. Exploratory Metabolomic Analyses Reveal Compounds Correlated with Lutein Concentration in Frontal Cortex, Hippocampus, and Occipital Cortex of Human Infant Brain.

    Directory of Open Access Journals (Sweden)

    Jacqueline C Lieblein-Boff

    Full Text Available Lutein is a dietary carotenoid well known for its role as an antioxidant in the macula, and recent reports implicate a role for lutein in cognitive function. Lutein is the dominant carotenoid in both pediatric and geriatric brain tissue. In addition, cognitive function in older adults correlated with macular and postmortem brain lutein concentrations. Furthermore, lutein was found to preferentially accumulate in the infant brain in comparison to other carotenoids that are predominant in diet. While lutein is consistently related to cognitive function, the mechanisms by which lutein may influence cognition are not clear. In an effort to identify potential mechanisms through which lutein might influence neurodevelopment, an exploratory study relating metabolite signatures and lutein was completed. Post-mortem metabolomic analyses were performed on human infant brain tissues in three regions important for learning and memory: the frontal cortex, hippocampus, and occipital cortex. Metabolomic profiles were compared to lutein concentration, and correlations were identified and reported here. A total of 1276 correlations were carried out across all brain regions. Of 427 metabolites analyzed, 257 were metabolites of known identity. Unidentified metabolite correlations (510 were excluded. In addition, moderate correlations with xenobiotic relationships (2 or those driven by single outliers (3 were excluded from further study. Lutein concentrations correlated with lipid pathway metabolites, energy pathway metabolites, brain osmolytes, amino acid neurotransmitters, and the antioxidant homocarnosine. These correlations were often brain region-specific. Revealing relationships between lutein and metabolic pathways may help identify potential candidates on which to complete further analyses and may shed light on important roles of lutein in the human brain during development.

  12. Chloric organic compound

    International Nuclear Information System (INIS)

    Moalem, F.

    2000-01-01

    Since many years ago, hazardous and toxic refuses which are results of human activities has been carelessly without any Biological and Engineering facts and knowledge discharged into our land and water. The effects of discharging those materials in environment are different. Some of refuse materials shows short and other has long-time adverse effects in our environment, Among hazardous organic chemical materials, chlorine, consider, to be the main element. Organic materials with chlorine is called chlorine hydrocarbon as a hazardous compound. This paper discuss the hazardous materials especially chloric organic compound and their misuse effects in environment and human being

  13. The analytical utility of thermally desorbed polydimethylsilicone membranes for in-vivo sampling of volatile organic compounds in and on human skin.

    Science.gov (United States)

    Riazanskaia, S; Blackburn, G; Harker, M; Taylor, D; Thomas, C L P

    2008-08-01

    A thermally-desorbed polydimethylsilicone (PDMS) membrane approach with analysis by gas chromatography-mass spectrometry has been developed and characterised, to enable the VOC arising in, and on skin, from glandular secretions, exogenous materials, products of perfusion from blood, and microbiological metabolites to be sampled in a single procedure. In-vitro studies using a series of volatile fatty acid standards indicated that the recovery efficiency of the technique increased with decreasing volatility; for example, the recovery of hexanoic acid was 3.3 times greater than that for 2-methylpropanoic acid. The relative standard deviation of the methodology decreased with decreasing volatility; RSD = 19% for 2-methylpropanoic acid and RSD = 7% for hexanoic acid. Sampled-mass vs. response relationships were modelled satisfactorily using linear regression analysis with regression coefficients in the range 0.95 to 0.998. In-vivo reproducibility was assessed though the analysis of the responses of 1-dodecane, 3,7-dimethyloct-1-ene, 2-propenoic acid, 2-ethylhexyl ester, 2-ethylhexan-1-ol, butanoic, 2-ethylhexylester, and junipen (1,4-methanoazulene, decahydro-4,8,8-trimethyl-9-methylene-); six compounds selected at random retention times from a GC-MS chromatographic VOC profile of human skin containing several hundred resolved and partially resolved compounds. Five samples were obtained simultaneously from the forearm of a healthy male participant. The in-vivo sample masses were estimated to be in the range 50 pg to 100 ng per sample with observed RSD falling between 15% and 32%; in line with a Horwitz trend. Increasing the sample time from 5 min to 120 min generally resulted in an enrichment of the VOC recovered, and for many VOC substantial increases in sensitivity (x7) were observed over this time range as the PDMS sampling-patch approached equilibrium with the underlying skin. Nevertheless, more volatile components, 2,4,6-trimethylcarbazole for instance, were

  14. The bamboo-eating giant panda (Ailuropoda melanoleuca) has a sweet tooth: behavioral and molecular responses to compounds that taste sweet to humans.

    Science.gov (United States)

    Jiang, Peihua; Josue-Almqvist, Jesusa; Jin, Xuelin; Li, Xia; Brand, Joseph G; Margolskee, Robert F; Reed, Danielle R; Beauchamp, Gary K

    2014-01-01

    A growing body of behavioral and genetic information indicates that taste perception and food sources are highly coordinated across many animal species. For example, sweet taste perception is thought to serve to detect and motivate consumption of simple sugars in plants that provide calories. Supporting this is the observation that most plant-eating mammals examined exhibit functional sweet perception, whereas many obligate carnivores have independently lost function of their sweet taste receptors and exhibit no avidity for simple sugars that humans describe as tasting sweet. As part of a larger effort to compare taste structure/function among species, we examined both the behavioral and the molecular nature of sweet taste in a plant-eating animal that does not consume plants with abundant simple sugars, the giant panda (Ailuropoda melanoleuca). We evaluated two competing hypotheses: as plant-eating mammals, they should have a well-developed sweet taste system; however, as animals that do not normally consume plants with simple sugars, they may have lost sweet taste function, as has occurred in strict carnivores. In behavioral tests, giant pandas avidly consumed most natural sugars and some but not all artificial sweeteners. Cell-based assays revealed similar patterns of sweet receptor responses toward many of the sweeteners. Using mixed pairs of human and giant panda sweet taste receptor units (hT1R2+gpT1R3 and gpT1R2+hT1R3) we identified regions of the sweet receptor that may account for behavioral differences in giant pandas versus humans toward various sugars and artificial sweeteners. Thus, despite the fact that the giant panda's main food, bamboo, is very low in simple sugars, the species has a marked preference for several compounds that taste sweet to humans. We consider possible explanations for retained sweet perception in this species, including the potential extra-oral functions of sweet taste receptors that may be required for animals that consume

  15. The human body odor compound androstadienone leads to anger-dependent effects in an emotional Stroop but not dot-probe task using human faces.

    Science.gov (United States)

    Hornung, Jonas; Kogler, Lydia; Wolpert, Stephan; Freiherr, Jessica; Derntl, Birgit

    2017-01-01

    The androgen derivative androstadienone is a substance found in human sweat and thus is a putative human chemosignal. Androstadienone has been studied with respect to effects on mood states, attractiveness ratings, physiological and neural activation. With the current experiment, we aimed to explore in which way androstadienone affects attention to social cues (human faces). Moreover, we wanted to test whether effects depend on specific emotions, the participants' sex and individual sensitivity to smell androstadienone. To do so, we investigated 56 healthy individuals (thereof 29 females taking oral contraceptives) with two attention tasks on two consecutive days (once under androstadienone, once under placebo exposure in pseudorandomized order). With an emotional dot-probe task we measured visuo-spatial cueing while an emotional Stroop task allowed us to investigate interference control. Our results suggest that androstadienone acts in a sex, task and emotion-specific manner as a reduction in interference processes in the emotional Stroop task was only apparent for angry faces in men under androstadienone exposure. More specifically, men showed a smaller difference in reaction times for congruent compared to incongruent trials. At the same time also women were slightly affected by smelling androstadienone as they classified angry faces more often correctly under androstadienone. For the emotional dot-probe task no modulation by androstadienone was observed. Furthermore, in both attention paradigms individual sensitivity to androstadienone was neither correlated with reaction times nor error rates in men and women. To conclude, exposure to androstadienone seems to potentiate the relevance of angry faces in both men and women in connection with interference control, while processes of visuo-spatial cueing remain unaffected.

  16. Spectroscopic study of interaction between osthole and human serum albumin: Identification of possible binding site of the compound

    Energy Technology Data Exchange (ETDEWEB)

    Bijari, Nooshin [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Shokoohinia, Yalda [Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Ashrafi-Kooshk, Mohammad Reza; Ranjbar, Samira; Parvaneh, Shahram [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Moieni-Arya, Maryam [Student Research Committee, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Khodarahmi, Reza, E-mail: rkhodarahmi@mbrc.ac.ir [Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of); Department of Pharmacognosy and Biotechnology, Faculty of Pharmacy, Kermanshah University of Medical Sciences, Kermanshah (Iran, Islamic Republic of)

    2013-11-15

    The studies on the interaction between human serum albumin (HSA) and drugs have been an interesting research field in life science, chemistry and clinical medicine. Osthole possesses a variety of pharmacological activities including anti-tumor, anti-inflammation, anti-seizure, anti-hyperlipidemic and anti-osteoporosis effects. The interaction of osthole with HSA and its binding site in HSA by spectroscopic methods is the subject of this work. By monitoring the intrinsic fluorescence of the single Trp{sub 214} residue and performing site markers displacement measurements, the specific binding of osthole in the vicinity of Sudlow's site I of HSA has been clarified. The changes in the secondary structure of HSA after its complexation with ligand were studied with CD spectroscopy, which indicate that osthole induced only a slight decrease in the helix structural content of the protein. In addition, the mean distance between osthole and HSA fluorophores is estimated to be 4.96 nm using Föster's equation on the basis of the fluorescence energy transfer. Furthermore, the synchronous fluorescence spectra show that the microenvironment of the tryptophan residues does not have obvious changes. Osthole can quench the intrinsic fluorescence of HSA by dynamic quenching, and analysis of the thermodynamic parameters of binding showed that hydrophobic interactions play an important role in the stabilizing of the complex. Increase of protein surface hydrophobicity (PSH) was also observed upon the osthole binding. -- Highlights: • Hydrophobic interactions play an important role in osthole–HSA interaction. • Sudlow's I site is possible binding site of osthole. • Osthole inhibits esterase activity of HSA. • Osthole binding induces no gross protein structural changes.

  17. Cytotoxicity of S-conjugates of the sevoflurane degradation product fluoromethyl-2,2-difluoro-1-(trifluoromethyl) vinyl ether (Compound A) in a human proximal tubular cell line

    International Nuclear Information System (INIS)

    Altuntas, T. Gul; Zager, Richard A.; Kharasch, Evan D.

    2003-01-01

    Fluoromethyl-2,2-difluoro-1-(trifluoromethyl)vinyl ether (FDVE) is a fluorinated alkene formed by degradation of the volatile anesthetic sevoflurane in anesthesia machines. FDVE is nephrotoxic in rats but not humans. Rat FDVE nephrotoxicity is attributed to FDVE glutathione conjugation and bioactivation of subsequent FDVE-cysteine S-conjugates, in part by renal β-lyase. Although FDVE conjugation and metabolism occur in both rats and humans, the mechanism for selective toxicity in rats and lack of effect in humans is incompletely elucidated. This investigation measured FDVE S-conjugate cytotoxicity in cultured human proximal tubular HK-2 cells, and compared this with known cytotoxic S-conjugates. HK-2 cells were incubated with FDVE and its GSH, cysteine S-mercapturic acid, cysteine S-sulfoxide, and mercapturic acid sulfoxide conjugates (0.1-2.7 mM) for 24 h. Cytotoxicity was determined by lactate dehydrogenase (LDH) release, total LDH, and the ability of viable cells to reduce a tetrazolium-based compound (MTT). FDVE was cytotoxic only at concentrations ≥0.9 mM. No increase in LDH release was observed with either FDVE-GSH conjugate. The FDVE-cysteine conjugates S-(1,1-difluoro-2-fluoromethoxy-2-(trifluoromethyl) ethyl)-L-cysteine (DFEC) and (Z)-S-(1-fluoro-2-fluoromethoxy-2-(trifluoromethyl) vinyl)-L-cysteine ((Z)-FFVC) caused significant differences in LDH release and MTT reduction only at 2.7 mM; (Z)-FFVC was slightly more cytotoxic. Both S-(1,1-difluoro-2-fluoromethoxy-2-(trifluoromethyl) ethyl)-L-cysteine sulfoxide (DFEC-SO) and (Z)-N-acetyl-S-(1-fluoro-2-fluoromethoxy-2-(trifluoromethyl) vinyl)-L-cysteine sulfoxide ((Z)-N-Ac-FFVC-SO) caused slightly greater changes in LDH release or total LDH than the corresponding equimolar DFEC and (Z)-N-acetyl-S-(1-fluoro-2-fluoromethoxy-2-(trifluoromethyl) vinyl)-L-cysteine ((Z)-N-Ac-FFVC) conjugates. In contrast to FDVE S-conjugates, S-(1,2-dichlorovinyl)-L-cysteine was markedly cytotoxic, at concentrations as low as 0

  18. Probing the binding of an endocrine disrupting compound-Bisphenol F to human serum albumin: insights into the interactions of harmful chemicals with functional biomacromolecules.

    Science.gov (United States)

    Pan, Fang; Xu, Tianci; Yang, Lijun; Jiang, Xiaoqing; Zhang, Lei

    2014-11-11

    Bisphenol F (BPF) as an endocrine disrupting compounds (EDCs) pollutant in the environment poses a great threat to human health. To evaluate the toxicity of BPF at the protein level, the effects of BPF on human serum albumin (HSA) were investigated at three temperatures 283, 298, and 308 K by multiple spectroscopic techniques. The experimental results showed that BPF effectively quenched the intrinsic fluorescence of HSA via static quenching. The number of binding sites, the binding constant, the thermodynamic parameters and the binding subdomain were measured, and indicated that BPF could spontaneously bind with HSA on subdomain IIA through H-bond and van der Waals interactions. Furthermore, the conformation of HSA was demonstrably changed in the presence of BPF. The work provides accurate and full basic data for clarifying the binding mechanisms of BPF with HSA in vivo and is helpful for understanding its effect on protein function during its transportation and distribution in blood. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Organolanthanoid compounds

    International Nuclear Information System (INIS)

    Schumann, H.

    1984-01-01

    Up to little more than a decade ago organolanthanoid compounds were still a curiosity. Apart from the description of an isolated number of cyclopentadienyl and indenyl derivatives, very few significant contributions had been made to this interesting sector of organometallic chemistry. However, subsequent systematic studies using modern preparative and analytical techniques, together with X-ray single crystal structure determinations, enabled the isolation and characterization of a large number of very interesting homoleptic and heteroleptic compounds in which the lanthanoid is bound to hydrogen, to substituted or unsubstituted cyclopentadienyl groups, to allyl or alkynyl groups, or even to phosphorus ylides, trimethylsilyl, and carbonylmetal groups. These compounds, which are all extremely sensitive to oxygen and water, open up new possibilities in the field of catalysis and have great potential in organic synthesis - as recent studies with pentamethylcyclopentadienyl derivatives, organolanthanoid(II) compounds, and hexamethyllanthanoid complexes have already shown. (orig.) [de

  20. 'Non-vocalization': a phonological error process in the speech of severely and profoundly hearing impaired adults, from the point of view of the theory of phonology as human behaviour.

    Science.gov (United States)

    Halpern, Orly; Tobin, Yishai

    2008-01-01

    'Non-vocalization' (N-V) is a newly described phonological error process in hearing impaired speakers. In N-V the hearing impaired person actually articulates the phoneme but without producing a voice. The result is an error process looking as if it is produced but sounding as if it is omitted. N-V was discovered by video recording the speech of two groups, profoundly and severely hearing impaired adults in four elicitation tasks of varying difficulty, and analysing 2065 phonological error processes (substitutions, omissions, and N-V) according to 24 criteria resulting in 49,560 data points. Results, which are discussed in view of the theory 'Phonology as Human Behaviour' (PHB), indicate that: (a) The more communicative the error process was; the more effort was made for its production and the more frequent its distribution; (b) The easier the elicitation task was, the more frequent the use of communicative error processes; c) The more difficult the elicitation task was, the more frequent the use of the relatively less communicative and easier to produce error processes; and d) The process of N-V functioned like a communicative error process for the group of profoundly hearing impaired adults.

  1. The bamboo-eating giant panda (Ailuropoda melanoleuca has a sweet tooth: behavioral and molecular responses to compounds that taste sweet to humans.

    Directory of Open Access Journals (Sweden)

    Peihua Jiang

    Full Text Available A growing body of behavioral and genetic information indicates that taste perception and food sources are highly coordinated across many animal species. For example, sweet taste perception is thought to serve to detect and motivate consumption of simple sugars in plants that provide calories. Supporting this is the observation that most plant-eating mammals examined exhibit functional sweet perception, whereas many obligate carnivores have independently lost function of their sweet taste receptors and exhibit no avidity for simple sugars that humans describe as tasting sweet. As part of a larger effort to compare taste structure/function among species, we examined both the behavioral and the molecular nature of sweet taste in a plant-eating animal that does not consume plants with abundant simple sugars, the giant panda (Ailuropoda melanoleuca. We evaluated two competing hypotheses: as plant-eating mammals, they should have a well-developed sweet taste system; however, as animals that do not normally consume plants with simple sugars, they may have lost sweet taste function, as has occurred in strict carnivores. In behavioral tests, giant pandas avidly consumed most natural sugars and some but not all artificial sweeteners. Cell-based assays revealed similar patterns of sweet receptor responses toward many of the sweeteners. Using mixed pairs of human and giant panda sweet taste receptor units (hT1R2+gpT1R3 and gpT1R2+hT1R3 we identified regions of the sweet receptor that may account for behavioral differences in giant pandas versus humans toward various sugars and artificial sweeteners. Thus, despite the fact that the giant panda's main food, bamboo, is very low in simple sugars, the species has a marked preference for several compounds that taste sweet to humans. We consider possible explanations for retained sweet perception in this species, including the potential extra-oral functions of sweet taste receptors that may be required for animals

  2. Elevated Atmospheric Levels of Benzene and Benzene-Related Compounds from Unconventional Shale Extraction and Processing: Human Health Concern for Residential Communities.

    Science.gov (United States)

    Rich, Alisa L; Orimoloye, Helen T

    2016-01-01

    The advancement of natural gas (NG) extraction across the United States (U.S.) raises concern for potential exposure to hazardous air pollutants (HAPs). Benzene, a HAP and a primary chemical of concern due to its classification as a known human carcinogen, is present in petroleum-rich geologic formations and is formed during the combustion of bypass NG. It is a component in solvents, paraffin breakers, and fuels used in NG extraction and processing (E&P). The objectives of this study are to confirm the presence of benzene and benzene-related compounds (benzene[s]) in residential areas, where unconventional shale E&P is occurring, and to determine if benzene[s] exists in elevated atmospheric concentrations when compared to national background levels. Ambient air sampling was conducted in six counties in the Dallas/Fort Worth Metroplex with passive samples collected in evacuated 6-L Summa canisters. Samples were analyzed by gas chromatography/mass spectrometry, with sampling performed at variable distances from the facility fence line. Elevated concentrations of benzene[s] in the atmosphere were identified when compared to U.S. Environmental Protection Agency's Urban Air Toxics Monitoring Program. The 24-hour benzene concentrations ranged from 0.6 parts per billion by volume (ppbv) to 592 ppbv, with 1-hour concentrations from 2.94 ppbv to 2,900.20 ppbv. Benzene is a known human carcinogen capable of multisystem health effects. Exposure to benzene is correlated with bone marrow and blood-forming organ damage and immune system depression. Sensitive populations (children, pregnant women, elderly, immunocompromised) and occupational workers are at increased risk for adverse health effects from elevated atmospheric levels of benzene[s] in residential areas with unconventional shale E&P.

  3. Human Metabolite Lamotrigine-N(2)-glucuronide Is the Principal Source of Lamotrigine-Derived Compounds in Wastewater Treatment Plants and Surface Water.

    Science.gov (United States)

    Zonja, Bozo; Pérez, Sandra; Barceló, Damià

    2016-01-05

    Wastewater and surface water samples, extracted with four solid-phase extraction cartridges of different chemistries, were suspect-screened for the anticonvulsant lamotrigine (LMG), its metabolites, and related compounds. LMG, three human metabolites, and a LMG synthetic impurity (OXO-LMG) were detected. Preliminary results showed significantly higher concentrations of OXO-LMG in wastewater effluent, suggesting its formation in the wastewater treatment plants (WWTPs). However, biodegradation experiments with activated sludge demonstrated that LMG is resistant to degradation and that its human metabolite lamotrigine-N(2)-glucuronide (LMG-N2-G) is the actual source of OXO-LMG in WWTPs. In batch reactors, LMG-N2-G was transformed, following pseudo-first-order kinetics to OXO-LMG and LMG, but kinetic experiments suggested an incomplete mass balance. A fragment ion search applied to batch-reactor and environmental samples revealed another transformation product (TP), formed by LMG-N2-G oxidation, which was identified by high-resolution mass spectrometry. Accounting for all TPs detected, a total mass balance at two concentration levels in batch reactors was closed at 86% and 102%, respectively. In three WWTPs, the total mass balance of LMG-N2-G ranged from 71 to 102%. Finally, LMG-N2-G and its TPs were detected in surface water samples with median concentration ranges of 23-139 ng L(-1). The results of this study suggest that glucuronides of pharmaceuticals might also be sources of yet undiscovered, but environmentally relevant, transformation products.

  4. Small-molecule synthetic compound norcantharidin reverses multi-drug resistance by regulating Sonic hedgehog signaling in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Yu-Jen Chen

    Full Text Available Multi-drug resistance (MDR, an unfavorable factor compromising treatment efficacy of anticancer drugs, involves upregulated ATP binding cassette (ABC transporters and activated Sonic hedgehog (Shh signaling. By preparing human breast cancer MCF-7 cells resistant to doxorubicin (DOX, we examined the effect and mechanism of norcantharidin (NCTD, a small-molecule synthetic compound, on reversing multidrug resistance. The DOX-prepared MCF-7R cells also possessed resistance to vinorelbine, characteristic of MDR. At suboptimal concentration, NCTD significantly inhibited the viability of DOX-sensitive (MCF-7S and DOX-resistant (MCF-7R cells and reversed the resistance to DOX and vinorelbine. NCTD increased the intracellular accumulation of DOX in MCF-7R cells and suppressed the upregulated the mdr-1 mRNA, P-gp and BCRP protein expression, but not the MRP-1. The role of P-gp was strengthened by partial reversal of the DOX and vinorelbine resistance by cyclosporine A. NCTD treatment suppressed the upregulation of Shh expression and nuclear translocation of Gli-1, a hallmark of Shh signaling activation in the resistant clone. Furthermore, the Shh ligand upregulated the expression of P-gp and attenuated the growth inhibitory effect of NCTD. The knockdown of mdr-1 mRNA had not altered the expression of Shh and Smoothened in both MCF-7S and MCF-7R cells. This indicates that the role of Shh signaling in MDR might be upstream to mdr-1/P-gp, and similar effect was shown in breast cancer MDA-MB-231 and BT-474 cells. This study demonstrated that NCTD may overcome multidrug resistance through inhibiting Shh signaling and expression of its downstream mdr-1/P-gp expression in human breast cancer cells.

  5. A New Synthetic Compound, 2-OH, Enhances Interleukin-2 and Interferon-γ Gene Expression in Human Peripheral Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Woan-Fang Tzeng

    2009-07-01

    Full Text Available A new synthetic compound, 6-hydroxy-2-tosylisoquinolin-1(2H-one (2-OH, was selected for immunopharmacological activity tests. The effects of 2-OH on human peripheral blood mononuclear cell (PBMC proliferation were determined by tritiated thymidine uptake. Compared to phytohemagglutinin (PHA; 5 μg/mL stimulation, 2-OH significantly enhanced PBMC proliferation in a dose-dependent manner. The 50% enhancement activity (EC50 for 2-OH was 4.4±0.1 μM. In addition, effects of 2-OH on interleukin-2 (IL-2 and interferon-γ (IFN-γ production in PBMC were determined by enzyme immunoassay. Results demonstrated that 2-OH stimulated IL-2 and IFN-γ production in PBMC. Data from reverse transcription-polymerase chain reaction (RT-PCR and real-time PCR indicated that IL-2 and IFN-γ mRNA expression in PBMC could be induced by 2-OH. Therefore, 2-OH enhanced IL-2 and IFN-γ production in PBMC by modulation their gene expression. We suggest that 2-OH may be an immunomodulatory agent.

  6. 15,16-Dihydrotanshinone I, a Compound of Salvia miltiorrhiza Bunge, Induces Apoptosis through Inducing Endoplasmic Reticular Stress in Human Prostate Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Mao-Te Chuang

    2011-01-01

    Full Text Available 5,16-dihydrotanshinone I (DHTS is extracted from Salvia miltiorrhiza Bunge (tanshen root and was found to be the most effective compound of tanshen extracts against breast cancer cells in our previous studies. However, whether DHTS can induce apoptosis through an endoplasmic reticular (ER stress pathway was examined herein. In this study, we found that DHTS significantly inhibited the proliferation of human prostate DU145 carcinoma cells and induced apoptosis. DHTS was able to induce ER stress as evidenced by the upregulation of glucose regulation protein 78 (GRP78/Bip and CAAT/enhancer binding protein homologous protein/growth arrest- and DNA damage-inducible gene 153 (CHOP/GADD153, as well as increases in phosphorylated eukaryotic initiation factor 2α (eIF2α, c-jun N-terminal kinase (JNK, and X-box-binding protein 1 (XBP1 mRNA splicing forms. DHTS treatment also caused significant accumulation of polyubiquitinated proteins and hypoxia-inducible factor (HIF-1α, indicating that DHTS might be a proteasome inhibitor that is known to induce ER stress or enhance apoptosis caused by the classic ER stress-dependent mechanism. Moreover, DHTS-induced apoptosis was reversed by salubrinal, an ER stress inhibitor. Results suggest that DHTS can induce apoptosis of prostate carcinoma cells via induction of ER stress and/or inhibition of proteasome activity, and may have therapeutic potential for prostate cancer patients.

  7. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  8. Polymer compound

    NARCIS (Netherlands)

    1995-01-01

    A Polymer compound comprising a polymer (a) that contains cyclic imidesgroups and a polymer (b) that contains monomer groups with a 2,4-diamino-1,3,5-triazine side group. According to the formula (see formula) whereby themole percentage ratio of the cyclic imides groups in the polymer compoundwith

  9. Mesoionic Compounds

    Indian Academy of Sciences (India)

    Organic Chemistry. Kamatak University,. Dharwad. Her research interests are synthesis, reactions and synthetic utility of sydnones. She is currently working on electrochemical and insecticidal/antifungal activities for some of these compounds. Keywords. Aromaticity, mesoionic hetero- cycles, sydnones, tandem re- actions.

  10. Compound odontoma

    Directory of Open Access Journals (Sweden)

    Monica Yadav

    2012-01-01

    Full Text Available Odontomas have been extensively reported in the dental literature, and the term refers to tumors of odontogenic origin. Though the exact etiology is still unknown, the postulated causes include: local trauma, infection, inheritance and genetic mutation. The majority of the lesions are asymptomatic; however, may be accompanied with pain and swelling as secondary complaints in some cases. Here, we report a case of a compound odontome in a 14 year old patient.

  11. Affective Education for Visually Impaired Children.

    Science.gov (United States)

    Locke, Don C.; Gerler, Edwin R., Jr.

    1981-01-01

    Evaluated the effectiveness of the Human Development Program (HDP) and the Developing Understanding of Self and Others (DUSO) program used with visually impaired children. Although HDP and DUSO affected the behavior of visually impaired children, they did not have any effect on children's attitudes toward school. (RC)

  12. SEURAT-1 liver gold reference compounds: a mechanism-based review.

    Science.gov (United States)

    Jennings, Paul; Schwarz, Michael; Landesmann, Brigitte; Maggioni, Silvia; Goumenou, Marina; Bower, David; Leonard, Martin O; Wiseman, Jeffrey S

    2014-12-01

    There is an urgent need for the development of alternative methods to replace animal testing for the prediction of repeat dose chemical toxicity. To address this need, the European Commission and Cosmetics Europe have jointly funded a research program for 'Safety Evaluation Ultimately Replacing Animal Testing.' The goal of this program was the development of in vitro cellular systems and associated computational capabilities for the prediction of hepatic, cardiac, renal, neuronal, muscle, and skin toxicities. An essential component of this effort is the choice of appropriate reference compounds that can be used in the development and validation of assays. In this review, we focus on the selection of reference compounds for liver pathologies in the broad categories of cytotoxicity and lipid disorders. Mitochondrial impairment, oxidative stress, and apoptosis are considered under the category of cytotoxicity, while steatosis, cholestasis, and phospholipidosis are considered under the category of lipid dysregulation. We focused on four compound classes capable of initiating such events, i.e., chemically reactive compounds, compounds with specific cellular targets, compounds that modulate lipid regulatory networks, and compounds that disrupt the plasma membrane. We describe the molecular mechanisms of these compounds and the cellular response networks which they elicit. This information will be helpful to both improve our understanding of mode of action and help in the selection of appropriate mechanistic biomarkers, allowing us to progress the development of animal-free models with improved predictivity to the human situation.

  13. Genotoxic and antigenotoxic properties of selenium compounds in the in vitro micronucleus assay with human whole blood lymphocytes and tk6 lymphoblastoid cells

    Directory of Open Access Journals (Sweden)

    Eduard Cemeli

    2006-01-01

    Full Text Available Selenium is known to possess both genotoxic and antigenotoxic properties. In the present study, we have evaluated the genotoxicity and antigenotoxicity of three selenium compounds (sodium selenate, sodium selenite and selenous acid by measuring in vitro micronucleus induction. Assays were conducted in whole blood lymphocytes and in the TK6 lymphoblastoid cell line, with and without co-treatment with potassium dichromate, a known genotoxic compound. In general, the compounds were more active in TK6 cells than they were in blood lymphocytes. Only 1 μM selenous acid increased the frequency of binucleated cells containing micronuclei (BNMN in blood lymphocytes, while all three selenium compounds increased BNMN in TK6 cells. In addition, combinations of selenous acid and potassium dichromate resulted in lower frequencies of BNMN than potassium dichromate alone in blood lymphocytes, while combinations of sodium selenate and potassium dichromate produced lower frequencies of BNMN than potassium dichromate alone in TK6 cells. The concentrations of selenium compounds that were used, in combination with the medium components and the biological physiology of the whole blood lymphocytes and TK6 cells, could have affected the redox potential of the compounds, switching the chemicals from a pro-oxidant to antioxidant status and vice-versa. The lower activities of the compounds in blood lymphocytes may be due to the protective effects of blood components. The results indicate that the genotoxic and antigenotoxic properties of selenium compounds are highly dependent upon the conditions under which they are evaluated.

  14. Toxicology of perfluorinated compounds

    Energy Technology Data Exchange (ETDEWEB)

    Stahl, Thorsten [Hessian State Laboratory, Wiesbaden (Germany); Mattern, Daniela; Brunn, Hubertus [Hessian State Laboratory, Giessen (Germany)

    2011-12-15

    Perfluorinated compounds [PFCs] have found a wide use in industrial products and processes and in a vast array of consumer products. PFCs are molecules made up of carbon chains to which fluorine atoms are bound. Due to the strength of the carbon/fluorine bond, the molecules are chemically very stable and are highly resistant to biological degradation; therefore, they belong to a class of compounds that tend to persist in the environment. These compounds can bioaccumulate and also undergo biomagnification. Within the class of PFC chemicals, perfluorooctanoic acid and perfluorosulphonic acid are generally considered reference substances. Meanwhile, PFCs can be detected almost ubiquitously, e.g., in water, plants, different kinds of foodstuffs, in animals such as fish, birds, in mammals, as well as in human breast milk and blood. PFCs are proposed as a new class of 'persistent organic pollutants'. Numerous publications allude to the negative effects of PFCs on human health. The following review describes both external and internal exposures to PFCs, the toxicokinetics (uptake, distribution, metabolism, excretion), and the toxicodynamics (acute toxicity, subacute and subchronic toxicities, chronic toxicity including carcinogenesis, genotoxicity and epigenetic effects, reproductive and developmental toxicities, neurotoxicity, effects on the endocrine system, immunotoxicity and potential modes of action, combinational effects, and epidemiological studies on perfluorinated compounds). (orig.)

  15. Ukrain, a plant derived semi-synthetic compound, exerts antitumor effects against murine and human breast cancer and induce protective antitumor immunity in mice.

    Science.gov (United States)

    Bozeman, E N; Srivatsan, S; Mohammadi, H; Daniels, D; Shashidharamurthy, R; Selvaraj, P

    2012-12-01

    Despite the recent advances in anti-cancer therapies, breast cancer accounts for the highest percentage of estimated new cases among female cancer patients. The anti-cancer drug Ukrain, a plant-derived semi-synthetic compound, has been shown to be effective in a variety of tumor models including colon, brain, ovarian, melanoma and lymphoma. However, the direct cytotoxic effects of Ukrain have yet to be investigated in breast cancer models. Herein, we investigated the in vitro and in vivo cytotoxicity of Ukrain using murine (4T07 and TUBO) and human (SKBR-3) breast cancer cell lines. Cells were treated with varying concentrations of Ukrain for up to 72 h and analyzed for viability by trypan blue exclusion, apoptosis by intracellular caspase 3 and Annexin V staining, and proliferative potential by a clonogenic assay. Female BALB/c mice were challenged subcutaneously (s.c.) with 4T07-RG cells and administered 5 mg/kg or 12.5 mg/kg body weight Ukrain intravenously (i.v.) on the same day and 3 days later. Protective immune responses were determined following re-challenge of tumor-free mice 35 days post primary challenge. Ukrain exposure induced apoptosis in a dose and time-dependent manner with 50 µg/mL Ukrain leading to >50% cell death after 48 h exposure for all three breast cancer cell lines. Ukrain administration (12.5 mg/kg) led to significant inhibition of 4T07 tumor growth in vivo and sustained protective anti-tumor immunity following secondary challenge. Our findings demonstrate the in vitro and in vivo cytotoxic effects of Ukrain on breast cancer cells and may provide insight into designing Ukrain-based therapies for breast cancer patients.

  16. Gamma ray induced oxidative damage to human red blood cells proteins under hypotonic conditions and its prevention by natural phenolic malabaricone compounds

    International Nuclear Information System (INIS)

    Meenakshi, K.; Chattopadhyay, Subrata

    2015-01-01

    As an oxygen shuttle, Human RBCs must continue to perform the task while being exposed to a wide range of environments for each vascular circuit and to a variety of xenobiotics across its life time. The inability to synthesise new protein makes them uniquely vulnerable to oxidative stress. Antioxidants can help in protecting the RBCs from oxidative insults. Currently herbal antioxidants gained worldwide popularity as drugs and food/drug supplements for the treatment of various diseases. The present effort was aimed at formulating some natural phenolic compounds isolated from M.malabarica (mal B and mal C) to prevent the biochemical parameters which are considered as biomarkers of redox balance primarily contribute to alterations in red blood cells proteins during gamma radiation induced oxidative stress. Compared to control gamma ray treatment with hypotonic stress resulted in significant haemolysis, associated with increased MDA (3.3 fold, p<0.001) and met-haemoglobin (7.0 fold, p<0.001). The structural deformation due to membrane damage was confirmed from SEM images and Heinz body formation, while the cell permeability was evident from the K + efflux (30.4%, p<0.05) and increased intracellular Na + concentration (5.2%, p<0.05). The membrane damage, due to the reduction of the cholesterol/phospholipids ratio and depletion (p<0.001) of ATP, 2,3-DPG by 54.7% and Na + -K + ATPase activity (48.%) indicated loss of RBC functionally. Pre-treatment of the RBCs with mal B (5μM), mal C (2.5 μM) or vitamin E (50 μM) for 1 h reversed these adverse effects of gamma radiation under hypotonic conditions on all these parameters and provided significant protection against oxidative haemolysis. (author)

  17. Human recombinant interleukin-1 beta- and tumor necrosis factor alpha-mediated suppression of heparin-like compounds on cultured porcine aortic endothelial cells

    International Nuclear Information System (INIS)

    Kobayashi, M.; Shimada, K.; Ozawa, T.

    1990-01-01

    Cytokines are known to tip the balance of the coagulant-anticoagulant molecules on the endothelial cell surface toward intravascular coagulation. Their effects on endothelial cell surface-associated heparin-like compounds have not been examined yet. Incorporation of [35S]sulfate into heparan sulfate on cultured porcine aortic endothelial cells was suppressed by human recombinant interleukin-1 beta (rIL-1 beta) or tumor necrosis factor alpha (rTNF alpha) in a dose- and time-dependent manner with little effect on cell number, protein content, and [3H]leucine incorporation of cells. Maximal inhibition was achieved by incubation of cells with 100 ng/ml of rIL-1 beta or 5 ng/ml of rTNF alpha for 12-24 hours, resulting in a reduction of the synthesis of heparan sulfate on the cell surface by approximately 50%. The dose dependency was consistent with that seen in the stimulation of endothelial cell procoagulant activity by each cytokine. The suppression of heparan sulfate synthesis was sustained for at least 48 hours after pretreatment of cells with cytokines and was unchanged after the addition of indomethacin or polymyxin B. The rate of degradation of prelabeled 35S-heparan sulfate on the cell surface was not altered by cytokine treatments. Neither the size, the net negative charge, nor the proportion of the molecule with high affinity for antithrombin III of endothelial cell heparan sulfate was changed by cytokines. Furthermore, specific binding of 125I-labeled antithrombin III to the endothelial cell surface was reduced to 40-60% of control by cytokines. In parallel with reduction in binding, antithrombin III cofactor activity was partially diminished in cytokine-treated endothelial cells. Thus, cytokine-mediated suppression of heparin-like substance on endothelial cells appears to be another cytokine-inducible endothelial effects affecting coagulation

  18. Perfluorinated compounds in human breast milk from several Asian countries, and in infant formula and dairy milk from the United States.

    Science.gov (United States)

    Tao, Lin; Ma, Jing; Kunisue, Tatsuya; Libelo, E Laurence; Tanabe, Shinsuke; Kannan, Kurunthachalam

    2008-11-15

    The occurrence of perfluorinated compounds (PFCs) in human blood is known to be widespread; nevertheless, the sources of exposure to humans, including infants, are not well understood. In this study, breast milk collected from seven countries in Asia was analyzed (n=184) for nine PFCs, including perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA). In addition, five brands of infant formula (n=21) and 11 brands of dairy milk (n=12) collected from retail stores in the United States were analyzed, for comparison with PFC concentrations previously reported for breast milk from the U.S. PFOS was the predominant PFC detected in almost all Asian breast milk samples, followed by perfluorohexanesulfonate (PFHxS) and PFOA. Median concentrations of PFOS in breast milk from Asian countries varied significantly;the lowest concentration of 39.4 pg/mL was found in India, and the highest concentration of 196 pg/mL was found in Japan. The measured concentrations were similarto or less than the concentrations previously reported from Sweden, the United States, and Germany (median, 106-166 pg/mL). PFHxS was found in more than 70% of the samples analyzed from Japan, Malaysia, Philippines, and Vietnam, at mean concentrations ranging from 6.45 (Malaysia) to 15.8 (Philippines) pg/mL PFOA was found frequently only in samples from Japan; the mean concentration for that country was 77.7 pg/mL. None of the PFCs were detected in the infant-formula or dairy-milk samples from the U.S. except a few samples that contained concentrations close to the limit of detection. The estimated average daily intake of PFOS by infants from seven Asian countries, via breastfeeding, was 11.8 +/- 10.6 ng/kg bw/ day; this value is 7-12 times higher than the estimated adult dietary intakes previously reported from Germany, Canada, and Spain. The average daily intake of PFOA by Japanese infants was 9.6 +/- 4.9 ng/kg bw/day, a value 3-10 times greater than the estimated adult dietary intakes reported from

  19. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park

    2015-10-01

    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  20. Polyphenol Compound as a Transcription Factor Inhibitor.

    Science.gov (United States)

    Park, Seyeon

    2015-10-30

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).

  1. Cortical visual impairment

    OpenAIRE

    Koželj, Urša

    2013-01-01

    In this thesis we discuss cortical visual impairment, diagnosis that is in the developed world in first place, since 20 percent of children with blindness or low vision are diagnosed with it. The objectives of the thesis are to define cortical visual impairment and the definition of characters suggestive of the cortical visual impairment as well as to search for causes that affect the growing diagnosis of cortical visual impairment. There are a lot of signs of cortical visual impairment. ...

  2. Magnesium compounds

    Science.gov (United States)

    Kramer, D.A.

    2007-01-01

    Seawater and natural brines accounted for about 52 percent of U.S. magnesium compounds production in 2006. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from sea-water by Premier Chemicals in Florida; from well brines in Michigan by Martin Marietta and Rohm and Haas; and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from brucite by Applied Chemical Magnesias in Texas, from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta and Rohm and Haas from their operations mentioned above. About 59 percent of the magnesium compounds consumed in the United States was used for refractories that are used mainly to line steelmaking furnaces. The remaining 41 percent was consumed in agricultural, chemical, construction, environmental and industrial applications.

  3. Proactive Interference in Human Predictive Learning

    OpenAIRE

    Castro, Leyre; Ortega, Nuria; Matute, Helena

    2002-01-01

    The impairment in responding to a secondly trained association because of the prior training of another (i.e., proactive interference) is a well-established effect in human and animal research, and it has been demonstrated in many paradigms. However, learning theories have been concerned with proactive interference only when the competing stimuli have been presented in compound at some moment of the training phase. In this experiment we investigated the possibility of proactive interference b...

  4. Cognitive impairments, HCI and daily living

    DEFF Research Database (Denmark)

    Keates, Simeon; Kozloski, James; Varker, Philip

    2009-01-01

    As computer systems become increasingly more pervasive in everyday life, it is simultaneously becoming ever more important that the concept of universal access is accepted as a design mantra. While many physical impairments and their implications for human-computer interaction are well understood......, cognitive impairments have received comparatively little attention. One of the reasons for this is the general lack of sufficiently detailed cognitive models. This paper examines how cognitive impairments can affect human-computer interaction in everyday life and the issues involved in trying to make...

  5. Compound odontoma

    Directory of Open Access Journals (Sweden)

    José Marcelo Vargas Pinto

    2008-01-01

    Full Text Available Odontomas are the most common types of odontogenic tumors, as they are considered more as a developmental anomaly (hamartoma than as a true neoplasia. The aim of the present study is to describe a clinical case of compound odontoma, analyzing its most commonsigns, its region of location, the decade of life and patient’s gender, disorders that may occur as well as the treatment proposed. In order to attain this objective, the method was description of the present clinical case and bibliographic revision, arriving at the result that the treatment for this type of lesion invariably is surgical removal (enucleation and curettage and the prognosis is excellent. The surgical result was followed up in the post-operative period by radiographic exam, and it was possible to conclude that there was complete cicatrization and tissue repair.

  6. Magnesium compounds

    Science.gov (United States)

    Kramer, D.A.

    2012-01-01

    Seawater and natural brines accounted for about 57 percent of magnesium compounds produced in the United States in 2011. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties LLC from well brines in Michigan. Caustic-calcined magnesia was recovered from seawater by Premier Magnesia LLC in Florida, from well brines in Michigan by Martin Marietta and from magnesite in Nevada by Premier Magnesia. Intrepid Potash Wendover LLC and Great Salt Lake Minerals Corp. recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from seawater by SPI Pharma Inc. in Delaware and Premier Magnesia in Florida, and by Martin Marietta from its brine operation in Michigan.

  7. Impaired NFAT and NFκB activation are involved in suppression of CD40 ligand expression by Δ{sup 9}-tetrahydrocannabinol in human CD4{sup +} T cells

    Energy Technology Data Exchange (ETDEWEB)

    Ngaotepprutaram, Thitirat [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Kaplan, Barbara L.F. [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Neuroscience Program, Michigan State University (United States); Kaminski, Norbert E., E-mail: kamins11@msu.edu [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States)

    2013-11-15

    We have previously reported that Δ{sup 9}-tetrahydrocannabinol (Δ{sup 9}-THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4{sup +} T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ{sup 9}-THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ{sup 9}-THC attenuated CD40L expression in human CD4{sup +} T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ{sup 9}-THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ{sup 9}-THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ{sup 9}-THC suppresses human T cell function. - Highlights: • Δ{sup 9}-THC attenuated CD40L expression in activated human CD4+ T cells. • Δ{sup 9}-THC suppressed DNA-binding activity of NFAT and NFκB. • Δ{sup 9}-THC impaired elevation of intracellular Ca2+. • Δ{sup 9}-THC did not affect phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β.

  8. Fluorescence studies by quenching and protein unfolding on the interaction of bioactive compounds in water extracts of kiwi fruit cultivars with human serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Seo Park, Yong, E-mail: ypark@mokpo.ac.kr [Department of Horticultural Science, Mokpo National University, Muan, Jeonnam (Korea, Republic of); Polovka, Martin [National Agricultural and Food Centre VUP, Food Research Institute, SK-824 75 Bratislava (Slovakia); Leticia Martinez-Ayala, Alma [Centro de Desarrollo de Productos Bioticos, Instituto Politécnico Nacional, Carretera Yautepec-Jojutla, Km. 6, calle CEPROBI No. 8, Col. San Isidro, Yautepec, Morelos 62731 (Mexico); González-Aguilar, Gustavo A. [Research Center for Food & Development, A.C. (CIAD), Carretera a Ejido La Victoria, Km 0.6, Hermosillo, Sonora 83304 (Mexico); Ham, Kyung-Sik; Kang, Seong-Gook; Park, Yang-Kyun [Department of Food Engineering, Mokpo National University, Muan, Jeonnam (Korea, Republic of); Heo, Buk-Gu [Naju Foundation of Natural Dyeing Culture, Naju 520-931 (Korea, Republic of); Namiesnik, Jacek [Department of Analytical Chemistry, Chemical Faculty, Gdańsk University of Technology, 80 952 Gdańsk (Poland); Gorinstein, Shela, E-mail: shela.gorin@mail.huji.ac.il [The Institute for Drug Research, School of Pharmacy, The Hebrew University, Hadassah Medical School, Jerusalem 91120 (Israel)

    2015-04-15

    The main aim of this investigation was to characterize new kiwi fruit cultivars after cold storage treatment and to determine the similarities and differences between them, using spectroscopic methods. The chemometric comparison of kiwi fruit cultivars based on physicochemical indices during cold storage was carried out. All kiwi fruit cultivars showed a high level of correlation between the contents of phenolic compounds (polyphenols, tannins and flavonoids) and their antioxidant capacities. The interactions of soluble polyphenols of different kiwi fruit cultivars with human serum albumin (HSA) were investigated by fluorescence. The obtained statistical and fluorescence results allow to classify the investigated kiwi fruit cultivars according to their properties. The antioxidant properties of different cultivars monitored by β-carotene assay showed that the highest percentage of antioxidant activity (%AA) at the end of the cold storage was detected for ‘SKK-12’ (27.61±2.44) %AA with the lowest shelf life (8 weeks) and the lowest was found for ‘Hayward’ variety (8.33±0.74) %AA with the highest shelf life (24 weeks). The averaged amount of polyphenols in ‘Bidan’ and ‘SKK-12’ 13.97±1.95 mg GAE/g was much higher than in other cultivars 3.93±3.26 mg GAE/g, without respect on time of cold storage. The HSA-binding capacities of these cultivars were the highest and correlated with their antioxidant capacities. To our knowledge this is the first report showing differences and similarities in new kiwi fruit cultivars, using spectroscopic techniques. The fact that fluorescence spectral methods are applied as a powerful tool to show the photophysical properties of intrinsic fluorophores in protein molecules in the presence of fruit extracts is important in this study. In conclusion, the obtained knowledge would contribute to the pharmaceutical development and clinical application of kiwi fruit extracts. - Highlights: • Different kiwi fruit cultivars

  9. Oleic acid and docosahexaenoic acid cause an increase in the paracellular absorption of hydrophilic compounds in an experimental model of human absorptive enterocytes

    International Nuclear Information System (INIS)

    Aspenstroem-Fagerlund, Bitte; Ring, Linda; Aspenstroem, Pontus; Tallkvist, Jonas; Ilbaeck, Nils-Gunnar; Glynn, Anders W.

    2007-01-01

    Surface active compounds present in food possibly have the ability to enhance the absorption of water soluble toxic agents. Therefore, we investigated whether fatty acids such as oleic acid and docosahexaenoic acid (DHA), both commonly present in food, negatively affect the integrity of tight junctions (TJ) in the intestinal epithelium and thereby increase the absorption of poorly absorbed hydrophilic substances. Caco-2 cells, which are derived from human absorptive enterocytes, were grown on permeable filters for 20-25 days. Differentiated cell monolayers were apically exposed for 90 min to mannitol in emulsions of oleic acid (5, 15 or 30 mM) or DHA (5, 15 or 30 mM) in an experimental medium with or without Ca 2+ and Mg 2+ . Absorption of 14 C-mannitol increased and trans-epithelial electrical resistance (TEER) decreased in cell monolayers exposed to oleic acid and DHA, compared to controls. Cytotoxicity, measured as leakage of LDH, was higher in groups exposed to 30 mM oleic acid and all concentrations of DHA. Morphology of the cell monolayers was studied by using fluorescence microscopy. Exposure of cell monolayers to 5 mM DHA for 90 min resulted in a profound alteration of the cell-cell contacts as detected by staining the cells for β-catenin. Oleic acid (30 mM) treatment also induced dissolution of the cell-cell contacts but the effect was not as pronounced as with DHA. Cell monolayers were also exposed for 180 min to 250 nM cadmium (Cd) in emulsions of oleic acid (5 or 30 mM) or DHA (1 or 5 mM), in an experimental medium with Ca 2+ and Mg 2+ . Retention of Cd in Caco-2 cells was higher after exposure to 5 mM oleic acid but lower after exposure to 30 mM oleic acid and DHA. Absorption of Cd through the monolayers increased after DHA exposure but not after exposure to oleic acid. Our results indicate that fatty acids may compromise the integrity of the intestinal epithelium and that certain lipids in food may enhance the paracellular absorption of poorly

  10. Toxic compounds in honey.

    Science.gov (United States)

    Islam, Md Nazmul; Khalil, Md Ibrahim; Islam, Md Asiful; Gan, Siew Hua

    2014-07-01

    There is a wealth of information about the nutritional and medicinal properties of honey. However, honey may contain compounds that may lead to toxicity. A compound not naturally present in honey, named 5-hydroxymethylfurfural (HMF), may be formed during the heating or preservation processes of honey. HMF has gained much interest, as it is commonly detected in honey samples, especially samples that have been stored for a long time. HMF is a compound that may be mutagenic, carcinogenic and cytotoxic. It has also been reported that honey can be contaminated with heavy metals such as lead, arsenic, mercury and cadmium. Honey produced from the nectar of Rhododendron ponticum contains alkaloids that can be poisonous to humans, while honey collected from Andromeda flowers contains grayanotoxins, which can cause paralysis of limbs in humans and eventually leads to death. In addition, Melicope ternata and Coriaria arborea from New Zealand produce toxic honey that can be fatal. There are reports that honey is not safe to be consumed when it is collected from Datura plants (from Mexico and Hungary), belladonna flowers and Hyoscamus niger plants (from Hungary), Serjania lethalis (from Brazil), Gelsemium sempervirens (from the American Southwest), Kalmia latifolia, Tripetalia paniculata and Ledum palustre. Although the symptoms of poisoning due to honey consumption may differ depending on the source of toxins, most common symptoms generally include dizziness, nausea, vomiting, convulsions, headache, palpitations or even death. It has been suggested that honey should not be considered a completely safe food. Copyright © 2013 John Wiley & Sons, Ltd.

  11. Endocrine disrupting compounds

    DEFF Research Database (Denmark)

    Bøgh, I B; Christensen, P; Dantzer, V

    2001-01-01

    of alkylphenols, these are disseminated in the environment with sewage sludge, and domestic animals and humans are likely to be exposed via the food chain. Using the pig as an in vivo model, we studied the effect of intrauterine exposure to tertiary octylphenol (OP) on essential reproductive parameters over 3......With the growing concern that environmental chemicals might impair human and animal fertility, it is important to investigate the possible influence of these substances on sexual differentiation and genital development of mammals. Many of these substances are suspected to interfere with endocrine...... processes, and exposure during critical periods of prenatal development might affect reproductive performance over several generations. Alkylphenols and their metabolites are lipophilic substances exerting apparent estrogenic action in in vitro and in vivo testing systems. With the widespread industrial use...

  12. Mild Cognitive Impairment (MCI)

    Science.gov (United States)

    Mild cognitive impairment (MCI) Overview Mild cognitive impairment (MCI) is an intermediate stage between the expected cognitive decline of normal aging and the more-serious decline of dementia. It ...

  13. Arterial stiffness and cognitive impairment.

    Science.gov (United States)

    Li, Xiaoxuan; Lyu, Peiyuan; Ren, Yanyan; An, Jin; Dong, Yanhong

    2017-09-15

    Arterial stiffness is one of the earliest indicators of changes in vascular wall structure and function and may be assessed using various indicators, such as pulse-wave velocity (PWV), the cardio-ankle vascular index (CAVI), the ankle-brachial index (ABI), pulse pressure (PP), the augmentation index (AI), flow-mediated dilation (FMD), carotid intima media thickness (IMT) and arterial stiffness index-β. Arterial stiffness is generally considered an independent predictor of cardiovascular and cerebrovascular diseases. To date, a significant number of studies have focused on the relationship between arterial stiffness and cognitive impairment. To investigate the relationships between specific arterial stiffness parameters and cognitive impairment, elucidate the pathophysiological mechanisms underlying the relationship between arterial stiffness and cognitive impairment and determine how to interfere with arterial stiffness to prevent cognitive impairment, we searched PUBMED for studies regarding the relationship between arterial stiffness and cognitive impairment that were published from 2000 to 2017. We used the following key words in our search: "arterial stiffness and cognitive impairment" and "arterial stiffness and cognitive impairment mechanism". Studies involving human subjects older than 30years were included in the review, while irrelevant studies (i.e., studies involving subjects with comorbid kidney disease, diabetes and cardiac disease) were excluded from the review. We determined that arterial stiffness severity was positively correlated with cognitive impairment. Of the markers used to assess arterial stiffness, a higher PWV, CAVI, AI, IMT and index-β and a lower ABI and FMD were related to cognitive impairment. However, the relationship between PP and cognitive impairment remained controversial. The potential mechanisms linking arterial stiffness and cognitive impairment may be associated with arterial pulsatility, as greater arterial pulsatility

  14. Adapting for Impaired Patrons.

    Science.gov (United States)

    Schuyler, Michael

    1999-01-01

    Describes how a library, with an MCI Corporation grant, approached the process of setting up computers for the visually impaired. Discusses preparations, which included hiring a visually-impaired user as a consultant and contacting the VIP (Visually Impaired Persons) group; equipment; problems with the graphical user interface; and training.…

  15. Melandrii Herba Extract Attenuates H2O2-Induced Neurotoxicity in Human Neuroblastoma SH-SY5Y Cells and Scopolamine-Induced Memory Impairment in Mice

    Directory of Open Access Journals (Sweden)

    Kwang Min Lee

    2017-09-01

    Full Text Available Oxidative stress plays a significant role in the etiology of a variety of neurodegenerative diseases. In this study, we found that Melandrii Herba extract (ME attenuated oxidative-induced damage in cells. Mechanistically, ME exhibited protection from H2O2-induced neurotoxicity via caspase-3 inactivation, Bcl-2 downregulation, Bax upregulation, and MAPK activation (ERK 1/2, JNK 1/2, and p38 MAPK in vitro. Moreover, our in vivo data showed that ME was able to attenuate scopolamine-induced cognitive impairment. These results provide in vitro and in vivo evidence that ME exhibits neuroprotective properties against oxidative stress, which suggests that ME is worthy of further investigation as a complementary, or even as an alternative, product for preventing and treating neurodegenerative disorders.

  16. Two new acetylenic compounds from Asparagus officinalis.

    Science.gov (United States)

    Li, Xue-Mei; Cai, Jin-Long; Wang, Wen-Xiang; Ai, Hong-Lian; Mao, Zi-Chao

    2016-01-01

    Two new acetylenic compounds, asparoffins A (1) and B (2), together with two known compounds, nyasol (3) and 3″-methoxynyasol (4), were isolated from stems of Asparagus officinalis. The structures of two new compounds were elucidated on the basis of detailed spectroscopic analyses (UV, IR, MS, 1D, and 2D NMR). All compounds were evaluated for their cytotoxicities against three human cancer cell lines.

  17. Nutraceuticals in cognitive impairment and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Patrizia eMecocci

    2014-06-01

    Full Text Available Several chemical substances belonging to classes of natural dietary origin display protective properties against some age-related diseases including neurodegenerative ones, particularly Alzheimer’s disease (AD. These compounds, known as nutraceuticals, differ structurally, act therefore at different biochemical and metabolic levels and have shown different types of neuroprotective properties. The aim of this review is to summarize data from observational studies, clinical trials and randomized clinical trials (RCTs in humans on the effects of selected nutraceuticals against age-related cognitive impairment and dementia. We report results from studies on flavonoids, some vitamins and other natural substances that have been studied in AD and that might be beneficial for the maintenance of a good cognitive performance. Due to the substantial lack of high-level evidence studies there is no possibility for recommendation of nutraceuticals in dementia-related therapeutic guidelines. Nevertheless, the strong potential for their neuroprotective action warrants further studies in the field.

  18. Biologically Active Compounds of Plant Foods: Prospective Impact ...

    African Journals Online (AJOL)

    On the other hand, other biologically active compounds impair health by ... of essential elements through different mechanisms and giving astringent taste, odor, ... The health benefits of selected substances from Ethiopian food crops need to ...

  19. Isotopically modified compounds

    International Nuclear Information System (INIS)

    Kuruc, J.

    2009-01-01

    In this chapter the nomenclature of isotopically modified compounds in Slovak language is described. This chapter consists of following parts: (1) Isotopically substituted compounds; (2) Specifically isotopically labelled compounds; (3) Selectively isotopically labelled compounds; (4) Non-selectively isotopically labelled compounds; (5) Isotopically deficient compounds.

  20. Memory Impairment in Children with Language Impairment

    Science.gov (United States)

    Baird, Gillian; Dworzynski, Katharina; Slonims, Vicky; Simonoff, Emily

    2010-01-01

    Aim: The aim of this study was to assess whether any memory impairment co-occurring with language impairment is global, affecting both verbal and visual domains, or domain specific. Method: Visual and verbal memory, learning, and processing speed were assessed in children aged 6 years to 16 years 11 months (mean 9y 9m, SD 2y 6mo) with current,…

  1. Exposure to brominated flame retardants, perfluorinated compounds, phthalates and phenols in European birth cohorts: ENRIECO evaluation, first human biomonitoring results, and recommendations

    NARCIS (Netherlands)

    Casas, M.; Chevrier, C.; Hond, E.D.; Fernandez, M.F.; Pierik, F.; Philippat, C.; Slama, R.; Toft, G.; Vandentorren, S.; Wilhelm, M.; Vrijheid, M.

    2013-01-01

    There are emerging concerns about potential effects on child health and development of early-life exposure to substances such as brominated flame retardants (BFRs), perfluorinated compounds (PFCs), phthalates and phenols (including bisphenol A (BPA)); pregnancy and birth cohort studies are ideally

  2. THE 2005 WORLD HEALTH ORGANIZATION RE-EVALUATION OF HUMAN AND MAMMALIAN TOXIC EQUIVALENCY FACTORS FOR DIOXINS AND DIOXIN-LIKE COMPOUNDS

    Science.gov (United States)

    In June 2005 a WHO-IPCS expert meeting was held in Geneva during which the toxic equivalency factors (TEFs) for dioxin like compounds, including some polychlorinated biphenyls (PCBs), were re-evaluated. For this re-evaluation process the refined TEF database recently published by...

  3. Differential transport of platinum compounds by the human organic cation transporter hOCT2 (hSLC22A2)

    NARCIS (Netherlands)

    H. Burger (Herman); A. Zoumaro-Djayoon (Adja); A.W.M. Boersma (Anton); J. Helleman (Jozien); P.M.J.J. Berns (Els); A.H.J. Mathijssen (Ron); W.J. Loos (Walter); E.A.C. Wiemer (Erik)

    2010-01-01

    textabstractAbstract BACKGROUND: Solute carriers (SLCs), in particular organic cation transporters (OCTs), have been implicated in the cellular uptake of platinum-containing anticancer compounds. The activity of these carriers may determine the pharmacokinetics and the severity of side effects,

  4. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    Directory of Open Access Journals (Sweden)

    Anita Collavoli

    2011-01-01

    Full Text Available By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB. This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  5. Sleep deprivation impairs object recognition in mice

    NARCIS (Netherlands)

    Palchykova, S; Winsky-Sommerer, R; Meerlo, P; Durr, R; Tobler, Irene

    2006-01-01

    Many studies in animals and humans suggest that sleep facilitates learning, memory consolidation, and retrieval. Moreover, sleep deprivation (SD) incurred after learning, impaired memory in humans, mice, rats, and hamsters. We investigated the importance of sleep and its timing in in object

  6. Toxicology of alkylmercury compounds.

    Science.gov (United States)

    Aschner, Michael; Onishchenko, Natalia; Ceccatelli, Sandra

    2010-01-01

    Methylmercury is a global pollutant and potent neurotoxin whose abundance in the food chain mandates additional studies on the consequences and mechanisms of its toxicity to the central nervous system. Formulation of our new hypotheses was predicated on our appreciation for (a) the remarkable affinity of mercurials for the anionic form of sulfhydryl (-SH) groups, and (b) the essential role of thiols in protein biochemistry. The present chapter addresses pathways to human exposure of various mercury compounds, highlighting their neurotoxicity and potential involvement in neurotoxic injury and neurodegenerative changes, both in the developing and senescent brain. Mechanisms that trigger these effects are discussed in detail.

  7. Effects of exercise training and diet on lipid kinetics during free fatty acid-induced insulin resistance in older obese humans with impaired glucose tolerance

    DEFF Research Database (Denmark)

    Solomon, Thomas; Haus, Jacob M; Marchetti, Christine M

    2009-01-01

    Elevated free fatty acids (FFA) are implicated with insulin resistance at the cellular level. However, the contribution of whole body lipid kinetics to FFA-induced insulin resistance is not well understood, and the effect of exercise and diet on this metabolic defect is not known. We investigated...... the effect of 12 wk of exercise training with and without caloric restriction on FFA turnover and oxidation (FFA(ox)) during acute FFA-induced insulin resistance. Sixteen obese subjects with impaired glucose tolerance were randomized to either a hypocaloric (n = 8; -598 +/- 125 kcal/day, 66 +/- 1 yr, 32.......8 +/- 1.8 kg/m(2)) or a eucaloric (n = 8; 67 +/- 2 yr, 35.3 +/- 2.1 kg/m(2)) diet and aerobic exercise (1 h/day at 65% of maximal oxygen uptake) regimen. Lipid kinetics ([1-(14)C]palmitate) were assessed throughout a 7-h, 40 mU x m(-2) x min(-1) hyperinsulinemic euglycemic clamp, during which insulin...

  8. Inhibition of TAK1 and/or JAK Can Rescue Impaired Chondrogenic Differentiation of Human Mesenchymal Stem Cells in Osteoarthritis-Like Conditions

    NARCIS (Netherlands)

    Beuningen, H.M. van; Vries-van Melle, M.L. de; Vitters, E.L.; Schreurs, W.; Berg, W.B. van den; Osch, G.J. van; Kraan, P.M. van der

    2014-01-01

    OBJECTIVE: To rescue chondrogenic differentiation of human mesenchymal stem cells (hMSCs) in osteoarthritic conditions by inhibition of protein kinases. METHODS: hMSCs were cultured in pellets. During early chondrogenic differentiation, these were exposed to osteoarthritic synovium-conditioned

  9. Impaired Odor Recognition Memory in Patients with Hippocampal Lesions

    Science.gov (United States)

    Levy, Daniel A.; Squire, Larry R.; Hopkins, Ramona O.

    2004-01-01

    In humans, impaired recognition memory following lesions thought to be limited to the hippocampal region has been demonstrated for a wide variety of tasks. However, the importance of the human hippocampus for olfactory recognition memory has scarcely been explored. We evaluated the ability of memory-impaired patients with damage thought to be…

  10. Fatty Acid Incubation of Myotubues from Humans with Type 2 Diabetes Leads to Enhanced Release of Beta Oxidation Products Due to Impaired Fatty Acid Oxidation

    DEFF Research Database (Denmark)

    Wensaas, Andreas J; Rustan, Arild C; Just, Marlene

    2008-01-01

    Objective: Increased availability of fatty acids is important for accumulation of intracellular lipids and development of insulin resistance in human myotubes. It is unknown whether different types of fatty acids like eicosapentaenoic acid (EPA) or tetradecylthioacetic acid (TTA) influence...... these processes. Research Design and Methods: We examined fatty acid and glucose metabolism, and gene expression in cultured human skeletal muscle cells from control and T2D individuals after four days preincubation with EPA or TTA. Results: T2D myotubes exhibited reduced formation of CO(2) from palmitic acid (PA....... EPA markedly enhanced TAG accumulation in myotubes, more pronounced in T2D cells. TAG accumulation and fatty acid oxidation were inversely correlated only after EPA preincubation, and total level of acyl-CoA was reduced. Glucose oxidation (CO(2) formation) was enhanced and lactate production decreased...

  11. Phenolic Compounds in Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Pablo Velasco

    2010-12-01

    Full Text Available Phenolic compounds are a large group of phytochemicals widespread in the plant kingdom. Depending on their structure they can be classified into simple phenols, phenolic acids, hydroxycinnamic acid derivatives and flavonoids. Phenolic compounds have received considerable attention for being potentially protective factors against cancer and heart diseases, in part because of their potent antioxidative properties and their ubiquity in a wide range of commonly consumed foods of plant origin. The Brassicaceae family includes a wide range of horticultural crops, some of them with economic significance and extensively used in the diet throughout the world. The phenolic composition of Brassica vegetables has been recently investigated and, nowadays, the profile of different Brassica species is well established. Here, we review the significance of phenolic compounds as a source of beneficial compounds for human health and the influence of environmental conditions and processing mechanisms on the phenolic composition of Brassica vegetables.

  12. Towards a unified biological hypothesis for the BDNF Val66Met-associated memory deficits in humans: a model of impaired dendritic mRNA trafficking

    Directory of Open Access Journals (Sweden)

    Gabriele eBaj

    2013-10-01

    Full Text Available Brain-derived neurotrophic factor (BDNF represents promotesa key molecule for the survival and differentiation of specific populations of neurons in the central nervous system. BDNF also regulates plasticity-related processes underlying memory and learning. A common single nucleotide polymorphism (SNP rs6265 has been identified on the coding sequence of human BDNF located at 11p13. The SNP rs6265 is a single base mutation with an adenine instead of a guanine at position 196 (G196A, resulting in the amino acid substitution Val66Met. This polymorphism only exists in humans and has been associated with a plethora of effects ranging from molecular, cellular and brain structural modifications in association with deficits in social and cognitive functions. To date, the literature on Val66Met polymorphism describes a complex and often conflicting pattern of effects. In this review, we attempt to provide a unifying model of the Val66Met effects. We discuss the clinical evidence of the association between Val66Met and memory deficits, as well as the molecular mechanisms involved including the reduced transport of BDNF mRNA to the dendrites as well as the reduced processing and secretion of BDNF protein through the regulated secretory pathway.

  13. Synaptic contacts impaired by styrene-7,8-oxide toxicity

    International Nuclear Information System (INIS)

    Corsi, P.; D'Aprile, A.; Nico, B.; Costa, G.L.; Assennato, G.

    2007-01-01

    Styrene-7,8-oxide (SO), a chemical compound widely used in industrial applications, is a potential hazard for humans, particularly in occupational settings. Neurobehavioral changes are consistently observed in occupationally exposed individuals and alterations of neurotransmitters associated with neuronal loss have been reported in animal models. Although the toxic effects of styrene have been extensively documented, the molecular mechanisms responsible for SO-induced neurotoxicity are still unclear. A possible dopamine-mediated effect of styrene neurotoxicity has been previously demonstrated, since styrene oxide alters dopamine neurotransmission in the brain. Thus, the present study hypothesizes that styrene neurotoxicity may involve synaptic contacts. Primary striatal neurons were exposed to styrene oxide at different concentrations (0.1-1 mM) for different time periods (8, 16, and 24 h) to evaluate the dose able to induce synaptic impairments. The expression of proteins crucial for synaptic transmission such as Synapsin, Synaptophysin, and RAC-1 were considered. The levels of Synaptophysin and RAC-1 decreased in a dose-dependent manner. Accordingly, morphological alterations, observed at the ultrastructural level, primarily involved the pre-synaptic compartment. In SO-exposed cultures, the biochemical cascade of caspases was activated affecting the cytoskeleton components as their target. Thus the impairments in synaptic contacts observed in SO-exposed cultures might reflect a primarily morphological alteration of neuronal cytoskeleton. In addition, our data support the hypothesis developed by previous authors of reactive oxygen species (ROS) initiating events of SO cytotoxicity

  14. Interactive effects of morphine and dopaminergic compounds on spatial working memory in rhesus monkeys

    Institute of Scientific and Technical Information of China (English)

    Jian-Hong Wang; Joshua Dominie Rizak; Yan-Mei Chen; Liang Li; Xin-Tian Hu; Yuan-Ye Ma

    2013-01-01

    Opiates and dopamine (DA) play key roles in learning and memory in humans and animals.Although interactions between these neurotransmitters have been found,their functional roles remain to be fully elucidated,and their dysfunction may contribute to human diseases and addiction.Here we investigated the interactions of morphine and dopaminergic neurotransmitter systems with respect to learning and memory in rhesus monkeys by using the Wisconsin General Test Apparatus (WGTA) delayed-response task.Morphine and DA agonists (SKF-38393,apomorphine and bromocriptine) or DA antagonists (SKF-83566,haloperidol and sulpiride) were co-administered to the monkeys 30 min prior to the task.We found that dose-patterned co-administration of morphine with D1 or D2 antagonists or agonists reversed the impaired spatial working memory induced by morphine or the compounds alone.For example,morphine at 0.01 mg/kg impaired spatial working memory,while morphine (0.01 mg/kg) and apomorphine (0.01 or 0.06 mg/kg) co-treatment ameliorated this effect.Our findings suggest that the interactions between morphine and dopaminergic compounds influence spatial working memory in rhesus monkeys.A better understanding of these interactive relationships may provide insights into human addiction.

  15. Various MRS application tools for Alzheimer disease and mild cognitive impairment.

    Science.gov (United States)

    Gao, F; Barker, P B

    2014-06-01

    MR spectroscopy is a noninvasive technique that allows the detection of several naturally occurring compounds (metabolites) from well-defined regions of interest within the human brain. Alzheimer disease, a progressive neurodegenerative disorder, is the most common cause of dementia in the elderly. During the past 20 years, multiple studies have been performed on MR spectroscopy in patients with both mild cognitive impairment and Alzheimer disease. Generally, MR spectroscopy studies have found decreased N-acetylaspartate and increased myo-inositol in both patients with mild cognitive impairment and Alzheimer disease, with greater changes in Alzheimer disease than in mild cognitive impairment. This review summarizes the information content of proton brain MR spectroscopy and its related technical aspects, as well as applications of MR spectroscopy to mild cognitive impairment and Alzheimer disease. While MR spectroscopy may have some value in the differential diagnosis of dementias and assessing prognosis, more likely its role in the near future will be predominantly as a tool for monitoring disease response or progression in treatment trials. More work is needed to evaluate the role of MR spectroscopy as a biomarker in Alzheimer disease and its relationship to other imaging modalities. © 2014 by American Journal of Neuroradiology.

  16. Rubber compounding and processing

    CSIR Research Space (South Africa)

    John, MJ

    2014-06-01

    Full Text Available This chapter presents an overview on the compounding and processing techniques of natural rubber compounds. The introductory portion deals with different types of rubbers and principles of rubber compounding. The primary and secondary fillers used...

  17. MicroRNA-29b-1 impairs in vitro cell proliferation, self‑renewal and chemoresistance of human osteosarcoma 3AB-OS cancer stem cells.

    Science.gov (United States)

    Di Fiore, Riccardo; Drago-Ferrante, Rosa; Pentimalli, Francesca; Di Marzo, Domenico; Forte, Iris Maria; D'Anneo, Antonella; Carlisi, Daniela; De Blasio, Anna; Giuliano, Michela; Tesoriere, Giovanni; Giordano, Antonio; Vento, Renza

    2014-11-01

    Osteosarcoma (OS) is the most common type of bone cancer, with a peak incidence in the early childhood. Emerging evidence suggests that treatments targeting cancer stem cells (CSCs) within a tumor can halt cancer and improve patient survival. MicroRNAs (miRNAs) have been implicated in the maintenance of the CSC phenotype, thus, identification of CSC-related miRNAs would provide information for a better understanding of CSCs. Downregulation of miRNA-29 family members (miR-29a/b/c; miR‑29s) was observed in human OS, however, little is known about the functions of miR-29s in human OS CSCs. Previously, during the characterization of 3AB-OS cells, a CSC line selected from human OS MG63 cells, we showed a potent downregulation of miR-29b. In this study, after stable transfection of 3AB-OS cells with miR-29b-1, we investigated the role of miR-29b-1 in regulating cell proliferation, sarcosphere-forming ability, clonogenic growth, chemosensitivity, migration and invasive ability of 3AB-OS cells, in vitro. We found that, miR-29b-1 overexpression consistently reduced both, 3AB-OS CSCs growth in two- and three-dimensional culture systems and their sarcosphere- and colony-forming ability. In addition, while miR-29b-1 overexpression sensitized 3AB-OS cells to chemotherapeutic drug-induced apoptosis, it did not influence their migratory and invasive capacities, thus suggesting a context-depending role of miR-29b-1. Using publicly available databases, we proceeded to identify potential miR-29b target genes, known to play a role in the above reported functions. Among these targets we analyzed CD133, N-Myc, CCND2, E2F1 and E2F2, Bcl-2 and IAP-2. We also analyzed the most important stemness markers as Oct3/4, Sox2 and Nanog. Real-time RT-PCR and western-blot analyses showed that miR-29b-1 negatively regulated the expression of these markers. Overall, the results show that miR-29b-1 suppresses stemness properties of 3AB-OS CSCs and suggest that developing miR-29b-1 as a novel

  18. Nuclear blebbing of biologically active organoselenium compound towards human cervical cancer cell (HeLa): in vitro DNA/HSA binding, cleavage and cell imaging studies.

    Science.gov (United States)

    Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj

    2015-01-27

    New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Peroxides and radiation impairment of oxidative phosphorylation

    Energy Technology Data Exchange (ETDEWEB)

    Dovgii, I E; Akoev, I G

    1975-09-01

    An increase in the peroxidase activity of the mitochondria and a simultaneous rise in the amount of peroxide compounds, which are half lipid-like substances, are detected within the first 10 minutes after irradiation (1000 r). A mechanism of radiation impairment of oxidative phosphorylation is connected with the penetration of its inhibitors to the mitochondria due to the disturbed permeability of membranes affected by peroxides.

  20. Clinical impact of (11)C-Pittsburgh compound-B positron emission tomography carried out in addition to magnetic resonance imaging and single-photon emission computed tomography on the diagnosis of Alzheimer's disease in patients with dementia and mild cognitive impairment.

    Science.gov (United States)

    Omachi, Yoshie; Ito, Kimiteru; Arima, Kunimasa; Matsuda, Hiroshi; Nakata, Yasuhiro; Sakata, Masuhiro; Sato, Noriko; Nakagome, Kazuyuki; Motohashi, Nobutaka

    2015-12-01

    The purpose of this study was to evaluate the clinical impact of addition of [(11)C]Pittsburgh compound-B positron emission tomography ((11)C-PiB PET) on routine clinical diagnosis of Alzheimer's disease (AD) dementia and mild cognitive impairment (MCI), and to assess diagnostic agreement between clinical criteria and research criteria of the National Institute on Aging-Alzheimer's Association. The diagnosis in 85 patients was made according to clinical criteria. Imaging examinations, including both magnetic resonance imaging and single-photon emission computed tomography/computed tomography to identify neuronal injury (NI), and (11)C-PiB PET to identify amyloid were performed, and all subjects were re-categorized according to the research criteria. Among 40 patients with probable AD dementia (ProAD), 37 were NI-positive, 29 were (11)C-PiB-positive, and 27 who were both NI- and (11C-PiB-positive were categorized as having 'ProAD dementia with a high level of evidence of the AD pathophysiological process'. Among 20 patients with possible AD dementia (PosAD), 17 were NI-positive, and six who were both NI- and (11)C-PiB-positive were categorized as having 'PosAD with evidence of the AD pathophysiological process'. Among 25 patients with MCI, 18 were NI-positive, 13 were (11)C-PiB-positive, and 10 who were both NI- and (11)C-PiB-positive were categorized as having 'MCI due to AD-high likelihood'. Diagnostic concordance between clinical criteria and research criteria may not be high in this study. (11)C-PiB PET may be of value in making the diagnosis of dementia and MCI in cases with high diagnostic uncertainty. © 2015 The Authors. Psychiatry and Clinical Neurosciences © 2015 Japanese Society of Psychiatry and Neurology.

  1. Criteria for driver impairment

    NARCIS (Netherlands)

    Brookhuis, K.A.; De Waard, D.; Fairclough, S.H

    2003-01-01

    Most traffic accidents can be attributed to driver impairment, e.g. inattention, fatigue, intoxication, etc. It is now technically feasible to monitor and diagnose driver behaviour with respect to impairment with the aid of a limited number of in-vehicle sensors. However, a valid framework for the

  2. Restoring the IL-1β/NF-κB-induced impaired chondrogenesis by diallyl disulfide in human adipose-derived mesenchymal stem cells via attenuation of reactive oxygen species and elevation of antioxidant enzymes.

    Science.gov (United States)

    Bahrampour Juybari, Kobra; Kamarul, Tunku; Najafi, Mohammad; Jafari, Davood; Sharifi, Ali Mohammad

    2018-03-26

    Strategies based on mesenchymal stem cell (MSC) therapy for restoring injured articular cartilage are not effective enough in osteoarthritis (OA). Due to the enhanced inflammation and oxidative stress in OA microenvironment, differentiation of MSCs into chondrocytes would be impaired. This study aims to explore the effects of diallyl disulfide (DADS) on IL-1β-mediated inflammation and oxidative stress in human adipose derived mesenchymal stem cells (hADSCs) during chondrogenesis. MTT assay was employed to examine the effects of various concentrations of DADS on the viability of hADSCs at different time scales to obtain non-cytotoxic concentration range of DADS. The effects of DADS on IL-1β-induced intracellular ROS generation and lipid peroxidation were evaluated in hADSCs. Western blotting was used to analyze the protein expression levels of IκBα (np), IκBα (p), NF-κB (np) and NF-κB (p). Furthermore, the gene expression levels of antioxidant enzymes in hADSCs and chondrogenic markers at days 7, 14 and 21 of differentiation were measured using qRT-PCR. The results showed that addition of DADS significantly enhanced the mRNA expression levels of antioxidant enzymes as well as reduced ROS elevation, lipid peroxidation, IκBα activation and NF-κB nuclear translocation in hADSCs treated with IL-1β. In addition, DADS could significantly increase the expression levels of IL-1β-induced impaired chondrogenic marker genes in differentiated hADSCs. Treatment with DADS may provide an effective approach to prevent the pro-inflammatory cytokines and oxidative stress as catabolic causes of chondrocyte cell death and enhance the protective anabolic effects by promoting chondrogenesis associated gene expressions in hADSCs exposed to OA condition.

  3. Quantification of selected volatile organic compounds in human urine by gas chromatography selective reagent ionization time of flight mass spectrometry (GC-SRI-TOF-MS) coupled with head-space solid-phase microextraction (HS-SPME).

    Science.gov (United States)

    Mochalski, Paweł; Unterkofler, Karl

    2016-08-07

    Selective reagent ionization time of flight mass spectrometry with NO(+) as the reagent ion (SRI-TOF-MS(NO(+))) in conjunction with gas chromatography (GC) and head-space solid-phase microextraction (HS-SPME) was used to determine selected volatile organic compounds in human urine. A total of 16 volatiles exhibiting high incidence rates were quantified in the urine of 19 healthy volunteers. Amongst them there were ten ketones (acetone, 2-butanone, 3-methyl-2-butanone, 2-pentanone, 3-methyl-2-pentanone, 4-methyl-2-pentanone, 2-hexanone, 3-hexanone, 2-heptanone, and 4-heptanone), three volatile sulphur compounds (dimethyl sulfide, allyl methyl sulfide, and methyl propyl sulfide), and three heterocyclic compounds (furan, 2-methylfuran, 3-methylfuran). The concentrations of the species under study varied between 0.55 nmol L(-1) (0.05 nmol mmol(-1)creatinine) for allyl methyl sulfide and 11.6 μmol L(-1) (1.54 μmol mmol(-1)creatinine) for acetone considering medians. Limits of detection (LODs) ranged from 0.08 nmol L(-1) for allyl methyl sulfide to 1.0 nmol L(-1) for acetone and furan (with RSDs ranging from 5 to 9%). The presented experimental setup assists both real-time and GC analyses of volatile organic compounds, which can be performed consecutively using the same analytical system. Such an approach supports the novel concept of hybrid volatolomics, an approach which combines VOC profiles obtained from two or more body fluids to improve and complement the chemical information on the physiological status of an individual.

  4. Efficient generation of fully reprogrammed human iPS cells via polycistronic retroviral vector and a new cocktail of chemical compounds.

    Directory of Open Access Journals (Sweden)

    Zhonghui Zhang

    Full Text Available Direct reprogramming of human somatic cells into induced pluripotent stem (iPS cells by defined transcription factors (TFs provides great potential for regenerative medicine and biomedical research. This procedure has many challenges, including low reprogramming effic