WorldWideScience

Sample records for complex reveals ribosomal

  1. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  2. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  3. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  4. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  5. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  6. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  7. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  8. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  9. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  10. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  11. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  12. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  13. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  14. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  15. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  16. RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2010-01-01

    Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130

  17. CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2011-01-01

    Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

  18. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  19. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  20. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Complex long-distance effects of mutations that confer linezolid resistance in the large ribosomal subunit

    Science.gov (United States)

    Fulle, Simone; Saini, Jagmohan S.; Homeyer, Nadine; Gohlke, Holger

    2015-01-01

    The emergence of multidrug-resistant pathogens will make current antibiotics ineffective. For linezolid, a member of the novel oxazolidinone class of antibiotics, 10 nucleotide mutations in the ribosome have been described conferring resistance. Hypotheses for how these mutations affect antibiotics binding have been derived based on comparative crystallographic studies. However, a detailed description at the atomistic level of how remote mutations exert long-distance effects has remained elusive. Here, we show that the G2032A-C2499A double mutation, located > 10 Å away from the antibiotic, confers linezolid resistance by a complex set of effects that percolate to the binding site. By molecular dynamics simulations and free energy calculations, we identify U2504 and C2452 as spearheads among binding site nucleotides that exert the most immediate effect on linezolid binding. Structural reorganizations within the ribosomal subunit due to the mutations are likely associated with mutually compensating changes in the effective energy. Furthermore, we suggest two main routes of information transfer from the mutation sites to U2504 and C2452. Between these, we observe cross-talk, which suggests that synergistic effects observed for the two mutations arise in an indirect manner. These results should be relevant for the development of oxazolidinone derivatives that are active against linezolid-resistant strains. PMID:26202966

  2. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  3. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  4. Small subunit ribosomal metabarcoding reveals extraordinary trypanosomatid diversity in Brazilian bats.

    Directory of Open Access Journals (Sweden)

    Maria Augusta Dario

    2017-07-01

    Full Text Available Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonoses. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail.Total DNA was extracted from the blood of 90 bat individuals (17 species captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil. 18S ribosomal RNA was amplified by standard and/or nested PCR, then deep sequenced to recover and identify Operational Taxonomic Units (OTUs for phylogenetic analysis. Blood samples from 34 bat individuals (13 species tested positive for infection by 18S rRNA amplification. Amplicon sequences clustered to 14 OTUs, of which five were identified as Trypanosoma cruzi I, T. cruzi III/V, Trypanosoma cruzi marinkellei, Trypanosoma rangeli, and Trypanosoma dionisii, and seven were identified as novel genotypes monophyletic to basal T. cruzi clade types of the New World. Another OTU was identified as a trypanosome like those found in reptiles. Surprisingly, the remaining OTU was identified as Bodo saltans-closest non-parasitic relative of the trypanosomatid order. While three blood samples featured just one OTU (T. dionisii, all others resolved as mixed infections of up to eight OTUs.This study demonstrates the utility of next-generation barcoding methods to screen parasite diversity in mammalian reservoir hosts. We exposed high rates of local bat parasitism by multiple trypanosome species, some known to cause fatal human disease, others non-pathogenic, novel or yet little understood. Our results highlight bats as a long-standing nexus among host-parasite interactions of multiple niches, sustained in part by opportunistic and incidental infections of consequence to evolutionary theory as much as to

  5. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  6. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  7. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  8. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  9. Role for ribosome-associated complex and stress-seventy subfamily B (RAC-Ssb) in integral membrane protein translation.

    Science.gov (United States)

    Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D

    2017-12-01

    Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  11. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  12. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  13. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  14. Reproductive biology and variation of nuclear ribosomal ITS and ETS sequences in the Calligonum mongolicum complex (Polygonaceae

    Directory of Open Access Journals (Sweden)

    Wei Shi

    2017-01-01

    Full Text Available To explore the biosystematics of the Calligonum mongolicum complex (Polygonaceae, the flowering phenological period, breeding and pollination characters and seed set of the complex (C. Mongolicum Turze, C. chinense A. Los., C. gobicum A. Los., C. pumilum A. Los. and C. zaidamense A. Los. were documented in the Turpan Eremophyte Botanical Garden, China. The sequences of the nuclear ribosomal ITS and ETS region were employed to differentiate the C. mongolicum complex and other species in sect. Medusae. The results showed species of the C. mongolicum complex occupied overlapping flowering periods and had consistent pollination agents. Their breeding systems are all self-compatible, tend to be out-crossing and they interbreed amongst each other (out-crossing index, OCI = 4.The crosses within and amongst species had high seed sets (44 - 65%. Phylogenetic analyses of Calligonum sect. Medusae and the network analysis of nrDNA (ITS and ETS in the complex suggest interbreeding amongst “species” within the complex and provide evidence for taxonomically merging the five species in the complex. The detected hybridisation, occurring within the complex, suggests the need to improve traditional methods of ex situ plant conservation in botanical gardens for maintaining genetic diversity of Calligonum within and amongst species from different geographic areas.

  15. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2004-03-01

    Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

  16. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Science.gov (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  18. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman

    2017-07-01

    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  19. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    Science.gov (United States)

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899.

  20. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  1. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  2. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  4. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chengliang [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Zhang, Qiongdi [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Hang, Tianrong [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Tao, Yue [Shanghai Children’s Medical Center, 1678 Dongfang Road, Pudong, Shanghai 200120, People’s Republic of (China); Ma, Xukai [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Wu, Minhao; Zhang, Xuan, E-mail: xuanzbin@ustc.edu.cn; Zang, Jianye, E-mail: xuanzbin@ustc.edu.cn [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China)

    2015-08-28

    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.

  5. Phosphorylation of Ribosomal Protein S6 Mediates Mammalian Target of Rapamycin Complex 1-Induced Parathyroid Cell Proliferation in Secondary Hyperparathyroidism.

    Science.gov (United States)

    Volovelsky, Oded; Cohen, Gili; Kenig, Ariel; Wasserman, Gilad; Dreazen, Avigail; Meyuhas, Oded; Silver, Justin; Naveh-Many, Tally

    2016-04-01

    Secondary hyperparathyroidism is characterized by increased serum parathyroid hormone (PTH) level and parathyroid cell proliferation. However, the molecular pathways mediating the increased parathyroid cell proliferation remain undefined. Here, we found that the mTOR pathway was activated in the parathyroid of rats with secondary hyperparathyroidism induced by either chronic hypocalcemia or uremia, which was measured by increased phosphorylation of ribosomal protein S6 (rpS6), a downstream target of the mTOR pathway. This activation correlated with increased parathyroid cell proliferation. Inhibition of mTOR complex 1 by rapamycin decreased or prevented parathyroid cell proliferation in secondary hyperparathyroidism rats and in vitro in uremic rat parathyroid glands in organ culture. Knockin rpS6(p-/-) mice, in which rpS6 cannot be phosphorylated because of substitution of all five phosphorylatable serines with alanines, had impaired PTH secretion after experimental uremia- or folic acid-induced AKI. Uremic rpS6(p-/-) mice had no increase in parathyroid cell proliferation compared with a marked increase in uremic wild-type mice. These results underscore the importance of mTOR activation and rpS6 phosphorylation for the pathogenesis of secondary hyperparathyroidism and indicate that mTORC1 is a significant regulator of parathyroid cell proliferation through rpS6. Copyright © 2016 by the American Society of Nephrology.

  6. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  8. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  9. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  10. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  11. Effective in silico prediction of new oxazolidinone antibiotics: force field simulations of the antibiotic–ribosome complex supervised by experiment and electronic structure methods

    Directory of Open Access Journals (Sweden)

    Jörg Grunenberg

    2016-03-01

    Full Text Available We propose several new and promising antibacterial agents for the treatment of serious Gram-positive infections. Our predictions rely on force field simulations, supervised by first principle calculations and available experimental data. Different force fields were tested in order to reproduce linezolid's conformational space in terms of a the isolated and b the ribosomal bound state. In a first step, an all-atom model of the bacterial ribosome consisting of nearly 1600 atoms was constructed and evaluated. The conformational space of 30 different ribosomal/oxazolidinone complexes was scanned by stochastic methods, followed by an evaluation of their enthalpic penalties or rewards and the mechanical strengths of the relevant hydrogen bonds (relaxed force constants; compliance constants. The protocol was able to reproduce the experimentally known enantioselectivity favoring the S-enantiomer. In a second step, the experimentally known MIC values of eight linezolid analogues were used in order to crosscheck the robustness of our model. In a final step, this benchmarking led to the prediction of several new and promising lead compounds. Synthesis and biological evaluation of the new compounds are on the way.

  12. Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor

    Science.gov (United States)

    Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane

    2013-01-01

    We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118

  13. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  14. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  15. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  16. Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

    International Nuclear Information System (INIS)

    Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

    2010-01-01

    We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

  17. Mistletoe lectin I in complex with galactose and lactose reveals distinct sugar-binding properties

    International Nuclear Information System (INIS)

    Mikeska, Ruth; Wacker, Roland; Arni, Raghuvir; Singh, Tej P.; Mikhailov, Albert; Gabdoulkhakov, Azat; Voelter, Wolfgang; Betzel, Christian

    2004-01-01

    The structures of mistletoe lectin I in complex with lactose and galactose reveal differences in binding by the two known sites in subdomains α1 and γ2 and suggest the presence of a third low-affinity site in subdomain β1. The structures of mistletoe lectin I (ML-I) from Viscum album complexed with lactose and galactose have been determined at 2.3 Å resolution and refined to R factors of 20.9% (R free = 23.6%) and 20.9 (R free = 24.6%), respectively. ML-I is a heterodimer and belongs to the class of ribosome-inactivating proteins of type II, which consist of two chains. The A-chain has rRNA N-glycosidase activity and irreversibly inhibits eukaryotic ribosomes. The B-chain is a lectin and preferentially binds to galactose-terminated glycolipids and glycoproteins on cell membranes. Saccharide binding is performed by two binding sites in subdomains α1 and γ2 of the ML-I B-chain separated by ∼62 Å from each other. The favoured binding of galactose in subdomain α1 is achieved via hydrogen bonds connecting the 4-hydroxyl and 3-hydroxyl groups of the sugar moiety with the side chains of Asp23B, Gln36B and Lys41B and the main chain of 26B. The aromatic ring of Trp38B on top of the preferred binding pocket supports van der Waals packing of the apolar face of galactose and stabilizes the sugar–lectin complex. In the galactose-binding site II of subdomain γ2, Tyr249B provides the hydrophobic stacking and the side chains of Asp235B, Gln238B and Asn256B are hydrogen-bonding partners for galactose. In the case of the galactose-binding site I, the 2-hydroxyl group also stabilizes the sugar–protein complex, an interaction thus far rarely detected in galactose-specific lectins. Finally, a potential third low-affinity galactose-binding site in subunit β1 was identified in the present ML-I structures, in which a glycerol molecule from the cryoprotectant buffer has bound, mimicking the sugar compound

  18. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  19. Proteomic amino-termini profiling reveals targeting information for protein import into complex plastids.

    Directory of Open Access Journals (Sweden)

    Pitter F Huesgen

    Full Text Available In organisms with complex plastids acquired by secondary endosymbiosis from a photosynthetic eukaryote, the majority of plastid proteins are nuclear-encoded, translated on cytoplasmic ribosomes, and guided across four membranes by a bipartite targeting sequence. In-depth understanding of this vital import process has been impeded by a lack of information about the transit peptide part of this sequence, which mediates transport across the inner three membranes. We determined the mature N-termini of hundreds of proteins from the model diatom Thalassiosira pseudonana, revealing extensive N-terminal modification by acetylation and proteolytic processing in both cytosol and plastid. We identified 63 mature N-termini of nucleus-encoded plastid proteins, deduced their complete transit peptide sequences, determined a consensus motif for their cleavage by the stromal processing peptidase, and found evidence for subsequent processing by a plastid methionine aminopeptidase. The cleavage motif differs from that of higher plants, but is shared with other eukaryotes with complex plastids.

  20. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  1. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  2. Adaptation to High Ethanol Reveals Complex Evolutionary Pathways.

    Directory of Open Access Journals (Sweden)

    Karin Voordeckers

    2015-11-01

    Full Text Available Tolerance to high levels of ethanol is an ecologically and industrially relevant phenotype of microbes, but the molecular mechanisms underlying this complex trait remain largely unknown. Here, we use long-term experimental evolution of isogenic yeast populations of different initial ploidy to study adaptation to increasing levels of ethanol. Whole-genome sequencing of more than 30 evolved populations and over 100 adapted clones isolated throughout this two-year evolution experiment revealed how a complex interplay of de novo single nucleotide mutations, copy number variation, ploidy changes, mutator phenotypes, and clonal interference led to a significant increase in ethanol tolerance. Although the specific mutations differ between different evolved lineages, application of a novel computational pipeline, PheNetic, revealed that many mutations target functional modules involved in stress response, cell cycle regulation, DNA repair and respiration. Measuring the fitness effects of selected mutations introduced in non-evolved ethanol-sensitive cells revealed several adaptive mutations that had previously not been implicated in ethanol tolerance, including mutations in PRT1, VPS70 and MEX67. Interestingly, variation in VPS70 was recently identified as a QTL for ethanol tolerance in an industrial bio-ethanol strain. Taken together, our results show how, in contrast to adaptation to some other stresses, adaptation to a continuous complex and severe stress involves interplay of different evolutionary mechanisms. In addition, our study reveals functional modules involved in ethanol resistance and identifies several mutations that could help to improve the ethanol tolerance of industrial yeasts.

  3. Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

    Science.gov (United States)

    Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

    2018-04-06

    The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  6. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  7. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...

  8. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  9. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  10. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  11. Beyond Contagion: Reality Mining Reveals Complex Patterns of Social Influence.

    Science.gov (United States)

    Alshamsi, Aamena; Pianesi, Fabio; Lepri, Bruno; Pentland, Alex; Rahwan, Iyad

    2015-01-01

    Contagion, a concept from epidemiology, has long been used to characterize social influence on people's behavior and affective (emotional) states. While it has revealed many useful insights, it is not clear whether the contagion metaphor is sufficient to fully characterize the complex dynamics of psychological states in a social context. Using wearable sensors that capture daily face-to-face interaction, combined with three daily experience sampling surveys, we collected the most comprehensive data set of personality and emotion dynamics of an entire community of work. From this high-resolution data about actual (rather than self-reported) face-to-face interaction, a complex picture emerges where contagion (that can be seen as adaptation of behavioral responses to the behavior of other people) cannot fully capture the dynamics of transitory states. We found that social influence has two opposing effects on states: adaptation effects that go beyond mere contagion, and complementarity effects whereby individuals' behaviors tend to complement the behaviors of others. Surprisingly, these effects can exhibit completely different directions depending on the stable personality or emotional dispositions (stable traits) of target individuals. Our findings provide a foundation for richer models of social dynamics, and have implications on organizational engineering and workplace well-being.

  12. Beyond Contagion: Reality Mining Reveals Complex Patterns of Social Influence.

    Directory of Open Access Journals (Sweden)

    Aamena Alshamsi

    Full Text Available Contagion, a concept from epidemiology, has long been used to characterize social influence on people's behavior and affective (emotional states. While it has revealed many useful insights, it is not clear whether the contagion metaphor is sufficient to fully characterize the complex dynamics of psychological states in a social context. Using wearable sensors that capture daily face-to-face interaction, combined with three daily experience sampling surveys, we collected the most comprehensive data set of personality and emotion dynamics of an entire community of work. From this high-resolution data about actual (rather than self-reported face-to-face interaction, a complex picture emerges where contagion (that can be seen as adaptation of behavioral responses to the behavior of other people cannot fully capture the dynamics of transitory states. We found that social influence has two opposing effects on states: adaptation effects that go beyond mere contagion, and complementarity effects whereby individuals' behaviors tend to complement the behaviors of others. Surprisingly, these effects can exhibit completely different directions depending on the stable personality or emotional dispositions (stable traits of target individuals. Our findings provide a foundation for richer models of social dynamics, and have implications on organizational engineering and workplace well-being.

  13. The Smc5-Smc6 complex and SUMO modification of Rad52 regulates recombinational repair at the ribosomal gene locus

    DEFF Research Database (Denmark)

    Torres-Rosell, Jordi; Sunjevaric, Ivana; De Piccoli, Giacomo

    2007-01-01

    at an extranucleolar site. The nucleolar exclusion of Rad52 recombination foci entails Mre11 and Smc5-Smc6 complexes and depends on Rad52 SUMO (small ubiquitin-related modifier) modification. Remarkably, mutations that abrogate these activities result in the formation of Rad52 foci within the nucleolus and cause r...

  14. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

    Science.gov (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

    2018-01-01

    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  16. Geometric Mechanics Reveals Optimal Complex Terrestrial Undulation Patterns

    Science.gov (United States)

    Gong, Chaohui; Astley, Henry; Schiebel, Perrin; Dai, Jin; Travers, Matthew; Goldman, Daniel; Choset, Howie; CMU Team; GT Team

    Geometric mechanics offers useful tools for intuitively analyzing biological and robotic locomotion. However, utility of these tools were previously restricted to systems that have only two internal degrees of freedom and in uniform media. We show kinematics of complex locomotors that make intermittent contacts with substrates can be approximated as a linear combination of two shape bases, and can be represented using two variables. Therefore, the tools of geometric mechanics can be used to analyze motions of locomotors with many degrees of freedom. To demonstrate the proposed technique, we present studies on two different types of snake gaits which utilize combinations of waves in the horizontal and vertical planes: sidewinding (in the sidewinder rattlesnake C. cerastes) and lateral undulation (in the desert specialist snake C. occipitalis). C. cerastes moves by generating posteriorly traveling body waves in the horizontal and vertical directions, with a relative phase offset equal to +/-π/2 while C. occipitalismaintains a π/2 offset of a frequency doubled vertical wave. Geometric analysis reveals these coordination patterns enable optimal movement in the two different styles of undulatory terrestrial locomotion. More broadly, these examples demonstrate the utility of geometric mechanics in analyzing realistic biological and robotic locomotion.

  17. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  18. Intersubject information mapping: revealing canonical representations of complex natural stimuli

    Directory of Open Access Journals (Sweden)

    Nikolaus Kriegeskorte

    2015-03-01

    Full Text Available Real-world time-continuous stimuli such as video promise greater naturalism for studies of brain function. However, modeling the stimulus variation is challenging and introduces a bias in favor of particular descriptive dimensions. Alternatively, we can look for brain regions whose signal is correlated between subjects, essentially using one subject to model another. Intersubject correlation mapping (ICM allows us to find brain regions driven in a canonical manner across subjects by a complex natural stimulus. However, it requires a direct voxel-to-voxel match between the spatiotemporal activity patterns and is thus only sensitive to common activations sufficiently extended to match up in Talairach space (or in an alternative, e.g. cortical-surface-based, common brain space. Here we introduce the more general approach of intersubject information mapping (IIM. For each brain region, IIM determines how much information is shared between the subjects' local spatiotemporal activity patterns. We estimate the intersubject mutual information using canonical correlation analysis applied to voxels within a spherical searchlight centered on each voxel in turn. The intersubject information estimate is invariant to linear transforms including spatial rearrangement of the voxels within the searchlight. This invariance to local encoding will be crucial in exploring fine-grained brain representations, which cannot be matched up in a common space and, more fundamentally, might be unique to each individual – like fingerprints. IIM yields a continuous brain map, which reflects intersubject information in fine-grained patterns. Performed on data from functional magnetic resonance imaging (fMRI of subjects viewing the same television show, IIM and ICM both highlighted sensory representations, including primary visual and auditory cortices. However, IIM revealed additional regions in higher association cortices, namely temporal pole and orbitofrontal cortex. These

  19. Quantitative genome-wide genetic interaction screens reveal global epistatic relationships of protein complexes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Mohan Babu

    2014-02-01

    Full Text Available Large-scale proteomic analyses in Escherichia coli have documented the composition and physical relationships of multiprotein complexes, but not their functional organization into biological pathways and processes. Conversely, genetic interaction (GI screens can provide insights into the biological role(s of individual gene and higher order associations. Combining the information from both approaches should elucidate how complexes and pathways intersect functionally at a systems level. However, such integrative analysis has been hindered due to the lack of relevant GI data. Here we present a systematic, unbiased, and quantitative synthetic genetic array screen in E. coli describing the genetic dependencies and functional cross-talk among over 600,000 digenic mutant combinations. Combining this epistasis information with putative functional modules derived from previous proteomic data and genomic context-based methods revealed unexpected associations, including new components required for the biogenesis of iron-sulphur and ribosome integrity, and the interplay between molecular chaperones and proteases. We find that functionally-linked genes co-conserved among γ-proteobacteria are far more likely to have correlated GI profiles than genes with divergent patterns of evolution. Overall, examining bacterial GIs in the context of protein complexes provides avenues for a deeper mechanistic understanding of core microbial systems.

  20. Natural Product Screening Reveals Naphthoquinone Complex I Bypass Factors.

    Directory of Open Access Journals (Sweden)

    Scott B Vafai

    Full Text Available Deficiency of mitochondrial complex I is encountered in both rare and common diseases, but we have limited therapeutic options to treat this lesion to the oxidative phosphorylation system (OXPHOS. Idebenone and menadione are redox-active molecules capable of rescuing OXPHOS activity by engaging complex I-independent pathways of entry, often referred to as "complex I bypass." In the present study, we created a cellular model of complex I deficiency by using CRISPR genome editing to knock out Ndufa9 in mouse myoblasts, and utilized this cell line to develop a high-throughput screening platform for novel complex I bypass factors. We screened a library of ~40,000 natural product extracts and performed bioassay-guided fractionation on a subset of the top scoring hits. We isolated four plant-derived 1,4-naphthoquinone complex I bypass factors with structural similarity to menadione: chimaphilin and 3-chloro-chimaphilin from Chimaphila umbellata and dehydro-α-lapachone and dehydroiso-α-lapachone from Stereospermum euphoroides. We also tested a small number of structurally related naphthoquinones from commercial sources and identified two additional compounds with complex I bypass activity: 2-methoxy-1,4-naphthoquinone and 2-methoxy-3-methyl-1,4,-naphthoquinone. The six novel complex I bypass factors reported here expand this class of molecules and will be useful as tool compounds for investigating complex I disease biology.

  1. iTRAQ Protein Profile Differential Analysis of Dormant and Germinated Grassbur Twin Seeds Reveals that Ribosomal Synthesis and Carbohydrate Metabolism Promote Germination Possibly Through the PI3K Pathway.

    Science.gov (United States)

    Zhang, Guo-Liang; Zhu, Yue; Fu, Wei-Dong; Wang, Peng; Zhang, Rui-Hai; Zhang, Yan-Lei; Song, Zhen; Xia, Gui-Xian; Wu, Jia-He

    2016-06-01

    Grassbur is a destructive and invasive weed in pastures, and its burs can cause gastric damage to animals. The strong adaptability and reproductive potential of grassbur are partly due to a unique germination mechanism whereby twin seeds develop in a single bur: one seed germinates, but the other remains dormant. To investigate the molecular mechanism of seed germination in twin seeds, we used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a dynamic proteomic analysis of germination and dormancy. A total of 1,984 proteins were identified, 161 of which were considered to be differentially accumulated. The differentially accumulated proteins comprised 102 up-regulated and 59 down-regulated proteins. These proteins were grouped into seven functional categories, ribosomal proteins being the predominant group. The authenticity and accuracy of the results were confirmed by enzyme-linked immunosorbent assay (ELISA) and quantitative real-time reverse transcription-PCR (qPCR). A dynamic proteomic analysis revealed that ribosome synthesis and carbohydrate metabolism affect seed germination possibly through the phosphoinositide 3-kinase (PI3K) pathway. As the PI3K pathway is generally activated by insulin, analyses of seeds treated with exogenous insulin by qPCR, ELISA and iTRAQ confirmed that the PI3K pathway can be activated, which suppresses dormancy and promotes germination in twin grassbur seeds. Together, these results show that the PI3K pathway may play roles in stimulating seed germination in grassbur by modulating ribosomal synthesis and carbohydrate metabolism. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  3. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  4. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  5. A theoretical lens for revealing the complexity of chronic care

    NARCIS (Netherlands)

    Borgermans, L.; de Maeseneer, J.; Wollersheim, H.; Vrijhoef, H.J.M.; Devroey, D.

    2013-01-01

    The increasing prevalence of co-occurring multiple chronic conditions in an aging population has influenced the debate on complexity in chronic care and nowadays provides an impetus to the reform of numerous health systems. This article presents a theoretical lens for understanding the complexity of

  6. Principles of assembly reveal a periodic table of protein complexes.

    Science.gov (United States)

    Ahnert, Sebastian E; Marsh, Joseph A; Hernández, Helena; Robinson, Carol V; Teichmann, Sarah A

    2015-12-11

    Structural insights into protein complexes have had a broad impact on our understanding of biological function and evolution. In this work, we sought a comprehensive understanding of the general principles underlying quaternary structure organization in protein complexes. We first examined the fundamental steps by which protein complexes can assemble, using experimental and structure-based characterization of assembly pathways. Most assembly transitions can be classified into three basic types, which can then be used to exhaustively enumerate a large set of possible quaternary structure topologies. These topologies, which include the vast majority of observed protein complex structures, enable a natural organization of protein complexes into a periodic table. On the basis of this table, we can accurately predict the expected frequencies of quaternary structure topologies, including those not yet observed. These results have important implications for quaternary structure prediction, modeling, and engineering. Copyright © 2015, American Association for the Advancement of Science.

  7. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  8. Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit.

    Science.gov (United States)

    Rohrmoser, Michaela; Hölzel, Michael; Grimm, Thomas; Malamoussi, Anastassia; Harasim, Thomas; Orban, Mathias; Pfisterer, Iris; Gruber-Eber, Anita; Kremmer, Elisabeth; Eick, Dirk

    2007-05-01

    The PeBoW complex is essential for cell proliferation and maturation of the large ribosomal subunit in mammalian cells. Here we examined the role of PeBoW-specific proteins Pes1, Bop1, and WDR12 in complex assembly and stability, nucleolar transport, and pre-ribosome association. Recombinant expression of the three subunits is sufficient for complex formation. The stability of all three subunits strongly increases upon incorporation into the complex. Only overexpression of Bop1 inhibits cell proliferation and rRNA processing, and its negative effects could be rescued by coexpression of WDR12, but not Pes1. Elevated levels of Bop1 induce Bop1/WDR12 and Bop1/Pes1 subcomplexes. Knockdown of Bop1 abolishes the copurification of Pes1 with WDR12, demonstrating Bop1 as the integral component of the complex. Overexpressed Bop1 substitutes for endogenous Bop1 in PeBoW complex assembly, leading to the instability of endogenous Bop1. Finally, indirect immunofluorescence, cell fractionation, and sucrose gradient centrifugation experiments indicate that transport of Bop1 from the cytoplasm to the nucleolus is Pes1 dependent, while Pes1 can migrate to the nucleolus and bind to preribosomal particles independently of Bop1. We conclude that the assembly and integrity of the PeBoW complex are highly sensitive to changes in Bop1 protein levels.

  9. Quantum coherence spectroscopy reveals complex dynamics in bacterial light-harvesting complex 2 (LH2).

    Science.gov (United States)

    Harel, Elad; Engel, Gregory S

    2012-01-17

    Light-harvesting antenna complexes transfer energy from sunlight to photosynthetic reaction centers where charge separation drives cellular metabolism. The process through which pigments transfer excitation energy involves a complex choreography of coherent and incoherent processes mediated by the surrounding protein and solvent environment. The recent discovery of coherent dynamics in photosynthetic light-harvesting antennae has motivated many theoretical models exploring effects of interference in energy transfer phenomena. In this work, we provide experimental evidence of long-lived quantum coherence between the spectrally separated B800 and B850 rings of the light-harvesting complex 2 (LH2) of purple bacteria. Spectrally resolved maps of the detuning, dephasing, and the amplitude of electronic coupling between excitons reveal that different relaxation pathways act in concert for optimal transfer efficiency. Furthermore, maps of the phase of the signal suggest that quantum mechanical interference between different energy transfer pathways may be important even at ambient temperature. Such interference at a product state has already been shown to enhance the quantum efficiency of transfer in theoretical models of closed loop systems such as LH2.

  10. 454 sequencing reveals extreme complexity of the class II Major Histocompatibility Complex in the collared flycatcher

    Directory of Open Access Journals (Sweden)

    Gustafsson Lars

    2010-12-01

    Full Text Available Abstract Background Because of their functional significance, the Major Histocompatibility Complex (MHC class I and II genes have been the subject of continuous interest in the fields of ecology, evolution and conservation. In some vertebrate groups MHC consists of multiple loci with similar alleles; therefore, the multiple loci must be genotyped simultaneously. In such complex systems, understanding of the evolutionary patterns and their causes has been limited due to challenges posed by genotyping. Results Here we used 454 amplicon sequencing to characterize MHC class IIB exon 2 variation in the collared flycatcher, an important organism in evolutionary and immuno-ecological studies. On the basis of over 152,000 sequencing reads we identified 194 putative alleles in 237 individuals. We found an extreme complexity of the MHC class IIB in the collared flycatchers, with our estimates pointing to the presence of at least nine expressed loci and a large, though difficult to estimate precisely, number of pseudogene loci. Many similar alleles occurred in the pseudogenes indicating either a series of recent duplications or extensive concerted evolution. The expressed alleles showed unambiguous signals of historical selection and the occurrence of apparent interlocus exchange of alleles. Placing the collared flycatcher's MHC sequences in the context of passerine diversity revealed transspecific MHC class II evolution within the Muscicapidae family. Conclusions 454 amplicon sequencing is an effective tool for advancing our understanding of the MHC class II structure and evolutionary patterns in Passeriformes. We found a highly dynamic pattern of evolution of MHC class IIB genes with strong signals of selection and pronounced sequence divergence in expressed genes, in contrast to the apparent sequence homogenization in pseudogenes. We show that next generation sequencing offers a universal, affordable method for the characterization and, in perspective

  11. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  13. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  14. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  15. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  17. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  18. The Capsaspora genome reveals a complex unicellular prehistory of animals.

    Science.gov (United States)

    Suga, Hiroshi; Chen, Zehua; de Mendoza, Alex; Sebé-Pedrós, Arnau; Brown, Matthew W; Kramer, Eric; Carr, Martin; Kerner, Pierre; Vervoort, Michel; Sánchez-Pons, Núria; Torruella, Guifré; Derelle, Romain; Manning, Gerard; Lang, B Franz; Russ, Carsten; Haas, Brian J; Roger, Andrew J; Nusbaum, Chad; Ruiz-Trillo, Iñaki

    2013-01-01

    To reconstruct the evolutionary origin of multicellular animals from their unicellular ancestors, the genome sequences of diverse unicellular relatives are essential. However, only the genome of the choanoflagellate Monosiga brevicollis has been reported to date. Here we completely sequence the genome of the filasterean Capsaspora owczarzaki, the closest known unicellular relative of metazoans besides choanoflagellates. Analyses of this genome alter our understanding of the molecular complexity of metazoans' unicellular ancestors showing that they had a richer repertoire of proteins involved in cell adhesion and transcriptional regulation than previously inferred only with the choanoflagellate genome. Some of these proteins were secondarily lost in choanoflagellates. In contrast, most intercellular signalling systems controlling development evolved later concomitant with the emergence of the first metazoans. We propose that the acquisition of these metazoan-specific developmental systems and the co-option of pre-existing genes drove the evolutionary transition from unicellular protists to metazoans.

  19. Complex deformation in western Tibet revealed by anisotropic tomography

    Science.gov (United States)

    Zhang, Heng; Zhao, Junmeng; Zhao, Dapeng; Yu, Chunquan; Liu, Hongbing; Hu, Zhaoguo

    2016-10-01

    The mechanism and pattern of deformation beneath western Tibet are still an issue of debate. In this work we present 3-D P- and S-wave velocity tomography as well as P-wave radial and azimuthal anisotropy along the ANTILOPE-I profile and surrounding areas in western Tibet, which are determined by using a large number of P and S arrival-time data of local earthquakes and teleseismic events. Our results show that low-velocity (low-V) zones exist widely in the middle crust, whereas low-V zones are only visible in the lower crust beneath northwestern Tibet, indicating the existence of significant heterogeneities and complex flow there. In the upper mantle, a distinct low-V gap exists between the Indian and Asian plates. Considering the P- and S-wave tomography and P-wave azimuthal and radial anisotropy results, we interpret the gap to be caused mainly by shear heating. Depth-independent azimuthal anisotropy and high-velocity zones exist beneath the northern part of the study region, suggesting a vertically coherent deformation beneath the Tarim Basin. In contrast, tomographic and anisotropic features change with depth beneath the central and southern parts of the study region, which reflects depth-dependent (or decoupled) deformations there. At the northern edge of the Indian lithospheric mantle (ILM), P-wave azimuthal anisotropy shows a nearly east-west fast-velocity direction, suggesting that the ILM was re-built by mantle materials flowing to the north.

  20. Fractal analysis reveals reduced complexity of retinal vessels in CADASIL.

    Directory of Open Access Journals (Sweden)

    Michele Cavallari

    2011-04-01

    Full Text Available The Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL affects mainly small cerebral arteries and leads to disability and dementia. The relationship between clinical expression of the disease and progression of the microvessel pathology is, however, uncertain as we lack tools for imaging brain vessels in vivo. Ophthalmoscopy is regarded as a window into the cerebral microcirculation. In this study we carried out an ophthalmoscopic examination in subjects with CADASIL. Specifically, we performed fractal analysis of digital retinal photographs. Data are expressed as mean fractal dimension (mean-D, a parameter that reflects complexity of the retinal vessel branching. Ten subjects with genetically confirmed diagnosis of CADASIL and 10 sex and age-matched control subjects were enrolled. Fractal analysis of retinal digital images was performed by means of a computer-based program, and the data expressed as mean-D. Brain MRI lesion volume in FLAIR and T1-weighted images was assessed using MIPAV software. Paired t-test was used to disclose differences in mean-D between CADASIL and control groups. Spearman rank analysis was performed to evaluate potential associations between mean-D values and both disease duration and disease severity, the latter expressed as brain MRI lesion volumes, in the subjects with CADASIL. The results showed that mean-D value of patients (1.42±0.05; mean±SD was lower than control (1.50±0.04; p = 0.002. Mean-D did not correlate with disease duration nor with MRI lesion volumes of the subjects with CADASIL. The findings suggest that fractal analysis is a sensitive tool to assess changes of retinal vessel branching, likely reflecting early brain microvessel alterations, in CADASIL patients.

  1. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  2. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  4. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  5. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  6. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  7. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  8. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  9. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  10. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  11. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  12. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  13. Small-angle X-ray Solution Scattering Study of the Multi-aminoacyl-tRNA Synthetase Complex Reveals an Elongated and Multi-armed particle*

    Science.gov (United States)

    Dias, José; Renault, Louis; Pérez, Javier; Mirande, Marc

    2013-01-01

    In animal cells, nine aminoacyl-tRNA synthetases are associated with the three auxiliary proteins p18, p38, and p43 to form a stable and conserved large multi-aminoacyl-tRNA synthetase complex (MARS), whose molecular mass has been proposed to be between 1.0 and 1.5 MDa. The complex acts as a molecular hub for coordinating protein synthesis and diverse regulatory signal pathways. Electron microscopy studies defined its low resolution molecular envelope as an overall rather compact, asymmetric triangular shape. Here, we have analyzed the composition and homogeneity of the native mammalian MARS isolated from rabbit liver and characterized its overall internal structure, size, and shape at low resolution by hydrodynamic methods and small-angle x-ray scattering in solution. Our data reveal that the MARS exhibits a much more elongated and multi-armed shape than expected from previous reports. The hydrodynamic and structural features of the MARS are large compared with other supramolecular assemblies involved in translation, including ribosome. The large dimensions and non-compact structural organization of MARS favor a large protein surface accessibility for all its components. This may be essential to allow structural rearrangements between the catalytic and cis-acting tRNA binding domains of the synthetases required for binding the bulky tRNA substrates. This non-compact architecture may also contribute to the spatiotemporal controlled release of some of its components, which participate in non-canonical functions after dissociation from the complex. PMID:23836901

  14. Conjunctival lymphangioma in a 4-year-old girl revealed tuberous sclerosis complex

    Directory of Open Access Journals (Sweden)

    Freiberg, Florentina Joyce

    2016-09-01

    Full Text Available Background: To present a case of conjunctival lymphangioma in a girl with tuberous sclerosis complex.Methods/results: A 4-year-old girl presented with a relapsing cystic lesion of the bulbar conjunctiva in the right eye with string-of-pearl-like dilation of lymphatic vessels and right-sided facial swelling with mild pain. Best-corrected vision was not impaired. Examination of the skin revealed three hypomelanotic macules and a lumbal Shagreen patch. Magnetic resonance imaging (MRI findings displayed minimal enhancement of buccal fat on the right side. Cranial and orbital MRI showed signal enhancement in the right cortical and subcortical areas. Genetic analysis revealed a heterozygous deletion encompassing exon 1 and 2 of the gene (tuberous sclerosis complex 1 gene, confirming the diagnosis of tuberous sclerosis complex.Conclusion: In conjunctival lymphangioma, tuberous sclerosis complex should be considered as the primary disease.

  15. Substrate recognition by complement convertases revealed in the C5-cobra venom factor complex

    DEFF Research Database (Denmark)

    Laursen, Nick Stub; Andersen, Kasper Røjkjær; Braren, Ingke

    2011-01-01

    with a protease subunit (Bb or C2a). We determined the crystal structures of the C3b homologue cobra venom factor (CVF) in complex with C5, and in complex with C5 and the inhibitor SSL7 at 4.3 Å resolution. The structures reveal a parallel two-point attachment between C5 and CVF, where the presence of SSL7 only...

  16. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  17. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  18. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  19. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  20. Combining complexity measures of EEG data: multiplying measures reveal previously hidden information.

    Science.gov (United States)

    Burns, Thomas; Rajan, Ramesh

    2015-01-01

    Many studies have noted significant differences among human electroencephalograph (EEG) results when participants or patients are exposed to different stimuli, undertaking different tasks, or being affected by conditions such as epilepsy or Alzheimer's disease. Such studies often use only one or two measures of complexity and do not regularly justify their choice of measure beyond the fact that it has been used in previous studies. If more measures were added to such studies, however, more complete information might be found about these reported differences. Such information might be useful in confirming the existence or extent of such differences, or in understanding their physiological bases. In this study we analysed publically-available EEG data using a range of complexity measures to determine how well the measures correlated with one another. The complexity measures did not all significantly correlate, suggesting that different measures were measuring unique features of the EEG signals and thus revealing information which other measures were unable to detect. Therefore, the results from this analysis suggests that combinations of complexity measures reveal unique information which is in addition to the information captured by other measures of complexity in EEG data. For this reason, researchers using individual complexity measures for EEG data should consider using combinations of measures to more completely account for any differences they observe and to ensure the robustness of any relationships identified.

  1. Comparison of Escherichia coli tRNAPhe in the free state, in the ternary complex and in the ribosomal A and P sites by chemical probing

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A; Wagner, R

    1983-01-01

    tRNAPheE.coli was modified at accessible guanosine, cytidine, and adenosine residues using the chemical modification method described by Peattie and Gilbert [Proc. Natl Acad. Sci. USA, 77, 4679-4689 (1980)]. Modification characteristics of the tRNA in the free state, in the ternary complex...

  2. COMBINED DELAY AND GRAPH EMBEDDING OF EPILEPTIC DISCHARGES IN EEG REVEALS COMPLEX AND RECURRENT NONLINEAR DYNAMICS.

    Science.gov (United States)

    Erem, B; Hyde, D E; Peters, J M; Duffy, F H; Brooks, D H; Warfield, S K

    2015-04-01

    The dynamical structure of the brain's electrical signals contains valuable information about its physiology. Here we combine techniques for nonlinear dynamical analysis and manifold identification to reveal complex and recurrent dynamics in interictal epileptiform discharges (IEDs). Our results suggest that recurrent IEDs exhibit some consistent dynamics, which may only last briefly, and so individual IED dynamics may need to be considered in order to understand their genesis. This could potentially serve to constrain the dynamics of the inverse source localization problem.

  3. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans

    OpenAIRE

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C. G.; Benavente, Ricardo

    2012-01-01

    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed...

  4. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  5. Deep Neural Networks Reveal a Gradient in the Complexity of Neural Representations across the Ventral Stream.

    Science.gov (United States)

    Güçlü, Umut; van Gerven, Marcel A J

    2015-07-08

    Converging evidence suggests that the primate ventral visual pathway encodes increasingly complex stimulus features in downstream areas. We quantitatively show that there indeed exists an explicit gradient for feature complexity in the ventral pathway of the human brain. This was achieved by mapping thousands of stimulus features of increasing complexity across the cortical sheet using a deep neural network. Our approach also revealed a fine-grained functional specialization of downstream areas of the ventral stream. Furthermore, it allowed decoding of representations from human brain activity at an unsurpassed degree of accuracy, confirming the quality of the developed approach. Stimulus features that successfully explained neural responses indicate that population receptive fields were explicitly tuned for object categorization. This provides strong support for the hypothesis that object categorization is a guiding principle in the functional organization of the primate ventral stream. Copyright © 2015 the authors 0270-6474/15/3510005-10$15.00/0.

  6. Cytomolecular analysis of ribosomal DNA evolution in a natural allotetraploid Brachypodium hybridum and its putative ancestors – dissecting complex repetitive structure of intergenic spacers

    Directory of Open Access Journals (Sweden)

    Natalia Borowska-Zuchowska

    2016-10-01

    Full Text Available Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n=30, which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n=10 and B. stacei (2n=20. Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 kb and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level.

  7. Substrate recognition by complement convertases revealed in the C5-cobra venom factor complex

    DEFF Research Database (Denmark)

    Laursen, Nick Stub; Andersen, Kasper Røjkjær; Braren, Ingke

    2011-01-01

    with a protease subunit (Bb or C2a). We determined the crystal structures of the C3b homologue cobra venom factor (CVF) in complex with C5, and in complex with C5 and the inhibitor SSL7 at 4.3 Å resolution. The structures reveal a parallel two-point attachment between C5 and CVF, where the presence of SSL7 only...... slightly affects the C5-CVF interface, explaining the IgA dependence for SSL7-mediated inhibition of C5 cleavage. CVF functions as a relatively rigid binding scaffold inducing a conformational change in C5, which positions its cleavage site in proximity to the serine protease Bb. A general model...

  8. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies.

    Directory of Open Access Journals (Sweden)

    Masakazu Kohda

    2016-01-01

    Full Text Available Mitochondrial disorders have the highest incidence among congenital metabolic disorders characterized by biochemical respiratory chain complex deficiencies. It occurs at a rate of 1 in 5,000 births, and has phenotypic and genetic heterogeneity. Mutations in about 1,500 nuclear encoded mitochondrial proteins may cause mitochondrial dysfunction of energy production and mitochondrial disorders. More than 250 genes that cause mitochondrial disorders have been reported to date. However exact genetic diagnosis for patients still remained largely unknown. To reveal this heterogeneity, we performed comprehensive genomic analyses for 142 patients with childhood-onset mitochondrial respiratory chain complex deficiencies. The approach includes whole mtDNA and exome analyses using high-throughput sequencing, and chromosomal aberration analyses using high-density oligonucleotide arrays. We identified 37 novel mutations in known mitochondrial disease genes and 3 mitochondria-related genes (MRPS23, QRSL1, and PNPLA4 as novel causative genes. We also identified 2 genes known to cause monogenic diseases (MECP2 and TNNI3 and 3 chromosomal aberrations (6q24.3-q25.1, 17p12, and 22q11.21 as causes in this cohort. Our approaches enhance the ability to identify pathogenic gene mutations in patients with biochemically defined mitochondrial respiratory chain complex deficiencies in clinical settings. They also underscore clinical and genetic heterogeneity and will improve patient care of this complex disorder.

  10. Quantitative Multiplex Immunohistochemistry Reveals Myeloid-Inflamed Tumor-Immune Complexity Associated with Poor Prognosis

    Directory of Open Access Journals (Sweden)

    Takahiro Tsujikawa

    2017-04-01

    Full Text Available Here, we describe a multiplexed immunohistochemical platform with computational image processing workflows, including image cytometry, enabling simultaneous evaluation of 12 biomarkers in one formalin-fixed paraffin-embedded tissue section. To validate this platform, we used tissue microarrays containing 38 archival head and neck squamous cell carcinomas and revealed differential immune profiles based on lymphoid and myeloid cell densities, correlating with human papilloma virus status and prognosis. Based on these results, we investigated 24 pancreatic ductal adenocarcinomas from patients who received neoadjuvant GVAX vaccination and revealed that response to therapy correlated with degree of mono-myelocytic cell density and percentages of CD8+ T cells expressing T cell exhaustion markers. These data highlight the utility of in situ immune monitoring for patient stratification and provide digital image processing pipelines to the community for examining immune complexity in precious tissue sections, where phenotype and tissue architecture are preserved to improve biomarker discovery and assessment.

  11. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans.

    Science.gov (United States)

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C G; Benavente, Ricardo

    2012-10-09

    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed no sequence homology. This discrepancy challenged the hypothesis that the SC arose only once in evolution. To pursue this matter we focused on the evolution of SYCP1 and SYCP3, the two major structural SC proteins of mammals. Remarkably, our comparative bioinformatic and expression studies revealed that SYCP1 and SYCP3 are also components of the SC in the basal metazoan Hydra. In contrast to previous assumptions, we therefore conclude that SYCP1 and SYCP3 form monophyletic groups of orthologous proteins across metazoans.

  12. Predictive ethoinformatics reveals the complex migratory behaviour of a pelagic seabird, the Manx Shearwater

    Science.gov (United States)

    Freeman, Robin; Dean, Ben; Kirk, Holly; Leonard, Kerry; Phillips, Richard A.; Perrins, Chris M.; Guilford, Tim

    2013-01-01

    Understanding the behaviour of animals in the wild is fundamental to conservation efforts. Advances in bio-logging technologies have offered insights into the behaviour of animals during foraging, migration and social interaction. However, broader application of these systems has been limited by device mass, cost and longevity. Here, we use information from multiple logger types to predict individual behaviour in a highly pelagic, migratory seabird, the Manx Shearwater (Puffinus puffinus). Using behavioural states resolved from GPS tracking of foraging during the breeding season, we demonstrate that individual behaviours can be accurately predicted during multi-year migrations from low cost, lightweight, salt-water immersion devices. This reveals a complex pattern of migratory stopovers: some involving high proportions of foraging, and others of rest behaviour. We use this technique to examine three consecutive years of global migrations, revealing the prominence of foraging behaviour during migration and the importance of highly productive waters during migratory stopover. PMID:23635496

  13. Complex (Nonstandard) Six-Layer Polytypes of Lizardite Revealed from Oblique-Texture Electron Diffraction Patterns

    International Nuclear Information System (INIS)

    Zhukhlistov, A.P.; Zinchuk, N.N.; Kotel'nikov, D.D.

    2004-01-01

    Association of simple (1T and 3R) and two complex (nonstandard) orthogonal polytypes of the serpentine mineral lizardite from the Catoca kimberlite pipe (West Africa) association is revealed from oblique-texture electron diffraction patterns. A six-layer polytype with an ordered superposition of equally oriented layers (notation 3 2 3 2 3 4 3 4 3 6 3 6 or ++ - -00) belonging to the structural group A and a three-layer (336 or I,I,II) or a six-layer (336366 or I,I,II,I,II,II) polytype with alternating oppositely oriented layers and semi-disordered structure are identified using polytype analysis

  14. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  15. Development and evaluation of a 16S ribosomal DNA array-based approach for describing complex microbial communities in ready-to-eat vegetable salads packed in a modified atmosphere.

    Science.gov (United States)

    Rudi, Knut; Flateland, Signe L; Hanssen, Jon Fredrik; Bengtsson, Gunnar; Nissen, Hilde

    2002-03-01

    There is a clear need for new approaches in the field of microbial community analyses, since the methods used can be severely biased. We have developed a DNA array-based method that targets 16S ribosomal DNA (rDNA), enabling the direct detection and quantification of microorganisms from complex communities without cultivation. The approach is based on the construction of specific probes from the 16S rDNA sequence data retrieved directly from the communities. The specificity of the assay is obtained through a combination of DNA array hybridization and enzymatic labeling of the constructed probes. Cultivation-dependent assays (enrichment and plating) and cultivation-independent assays (direct fluorescence microscopy and scanning electron microscopy) were used as reference methods in the development and evaluation of the method. The description of microbial communities in ready-to-eat vegetable salads in a modified atmosphere was used as the experimental model. Comparisons were made with respect to the effect of storage at different temperatures for up to 12 days and with respect to the geographic origin of the crisphead lettuce (Spanish or Norwegian), the main salad component. The conclusion drawn from the method comparison was that the DNA array-based method gave an accurate description of the microbial communities. Pseudomonas spp. dominated both of the salad batches, containing either Norwegian or Spanish lettuce, before storage and after storage at 4 degrees C. The Pseudomonas population also dominated the batch containing Norwegian lettuce after storage at 10 degrees C. On the contrary, Enterobacteriaceae and lactic acid bacteria dominated the microbial community of the batch containing Spanish lettuce after storage at 10 degrees C. In that batch, the Enterobacteriaceae also were abundant after storage at 4 degrees C as well as before storage. The practical implications of these results are that microbial communities in ready-to-eat vegetable salads can be

  16. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Transmitter receptors reveal segregation of the arcopallium/amygdala complex in pigeons (Columba livia).

    Science.gov (United States)

    Herold, Christina; Paulitschek, Christina; Palomero-Gallagher, Nicola; Güntürkün, Onur; Zilles, Karl

    2018-02-15

    At the beginning of the 20th century it was suggested that a complex group of nuclei in the avian posterior ventral telencephalon is comparable to the mammalian amygdala. Subsequent findings, however, revealed that most of these structures share premotor characteristics, while some indeed constitute the avian amygdala. These developments resulted in 2004 in a change of nomenclature of these nuclei, which from then on were named arcopallial or amygdala nuclei and referred to as the arcopallium/amygdala complex. The structural basis for the similarities between avian and mammalian arcopallial and amygdala subregions is poorly understood. Therefore, we analyzed binding site densities for glutamatergic AMPA, NMDA and kainate, GABAergic GABA A , muscarinic M 1 , M 2 and nicotinic acetylcholine (nACh; α 4 β 2 subtype), noradrenergic α 1 and α 2 , serotonergic 5-HT 1A and dopaminergic D 1/5 receptors using quantitative in vitro receptor autoradiography combined with a detailed analysis of the cyto- and myelo-architecture. Our approach supports a segregation of the pigeon's arcopallium/amygdala complex into the following subregions: the arcopallium anterius (AA), the arcopallium ventrale (AV), the arcopallium dorsale (AD), the arcopallium intermedium (AI), the arcopallium mediale (AM), the arcopallium posterius (AP), the nucleus posterioris amygdalopallii pars basalis (PoAb) and pars compacta (PoAc), the nucleus taeniae amgygdalae (TnA) and the area subpallialis amygdalae (SpA). Some of these subregions showed further subnuclei and each region of the arcopallium/amygdala complex are characterized by a distinct multi-receptor density expression. Here we provide a new detailed map of the pigeon's arcopallium/amygdala complex and compare the receptor architecture of the subregions to their possible mammalian counterparts. © 2017 Wiley Periodicals, Inc.

  18. Lipid clustering correlates with membrane curvature as revealed by molecular simulations of complex lipid bilayers.

    Directory of Open Access Journals (Sweden)

    Heidi Koldsø

    2014-10-01

    Full Text Available Cell membranes are complex multicomponent systems, which are highly heterogeneous in the lipid distribution and composition. To date, most molecular simulations have focussed on relatively simple lipid compositions, helping to inform our understanding of in vitro experimental studies. Here we describe on simulations of complex asymmetric plasma membrane model, which contains seven different lipids species including the glycolipid GM3 in the outer leaflet and the anionic lipid, phosphatidylinositol 4,5-bisphophate (PIP2, in the inner leaflet. Plasma membrane models consisting of 1500 lipids and resembling the in vivo composition were constructed and simulations were run for 5 µs. In these simulations the most striking feature was the formation of nano-clusters of GM3 within the outer leaflet. In simulations of protein interactions within a plasma membrane model, GM3, PIP2, and cholesterol all formed favorable interactions with the model α-helical protein. A larger scale simulation of a model plasma membrane containing 6000 lipid molecules revealed correlations between curvature of the bilayer surface and clustering of lipid molecules. In particular, the concave (when viewed from the extracellular side regions of the bilayer surface were locally enriched in GM3. In summary, these simulations explore the nanoscale dynamics of model bilayers which mimic the in vivo lipid composition of mammalian plasma membranes, revealing emergent nanoscale membrane organization which may be coupled both to fluctuations in local membrane geometry and to interactions with proteins.

  19. Protein-carbohydrate complex reveals circulating metastatic cells in a microfluidic assay

    KAUST Repository

    Simone, Giuseppina

    2013-02-11

    Advances in carbohydrate sequencing technologies reveal the tremendous complexity of the glycome and the role that glycomics might have to bring insight into the biological functions. Carbohydrate-protein interactions, in particular, are known to be crucial to most mammalian physiological processes as mediators of cell adhesion and metastasis, signal transducers, and organizers of protein interactions. An assay is developed here to mimic the multivalency of biological complexes that selectively and sensitively detect carbohydrate-protein interactions. The binding of β-galactosides and galectin-3 - a protein that is correlated to the progress of tumor and metastasis - is examined. The efficiency of the assay is related to the expression of the receptor while anchoring to the interaction\\'s strength. Comparative binding experiments reveal molecular binding preferences. This study establishes that the assay is robust to isolate metastatic cells from colon affected patients and paves the way to personalized medicine. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Protein-carbohydrate complex reveals circulating metastatic cells in a microfluidic assay

    KAUST Repository

    Simone, Giuseppina; Malara, Natalia Maria; Trunzo, Valentina; Perozziello, Gerardo; Neužil, Pavel; Francardi, Marco; Roveda, Laura; Renne, Maria; Prati, Ubaldo; Mollace, Vincenzo; Manz, Andreas; Di Fabrizio, Enzo M.

    2013-01-01

    Advances in carbohydrate sequencing technologies reveal the tremendous complexity of the glycome and the role that glycomics might have to bring insight into the biological functions. Carbohydrate-protein interactions, in particular, are known to be crucial to most mammalian physiological processes as mediators of cell adhesion and metastasis, signal transducers, and organizers of protein interactions. An assay is developed here to mimic the multivalency of biological complexes that selectively and sensitively detect carbohydrate-protein interactions. The binding of β-galactosides and galectin-3 - a protein that is correlated to the progress of tumor and metastasis - is examined. The efficiency of the assay is related to the expression of the receptor while anchoring to the interaction's strength. Comparative binding experiments reveal molecular binding preferences. This study establishes that the assay is robust to isolate metastatic cells from colon affected patients and paves the way to personalized medicine. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  2. Single-molecule spectroscopy reveals photosynthetic LH2 complexes switch between emissive states.

    Science.gov (United States)

    Schlau-Cohen, Gabriela S; Wang, Quan; Southall, June; Cogdell, Richard J; Moerner, W E

    2013-07-02

    Photosynthetic organisms flourish under low light intensities by converting photoenergy to chemical energy with near unity quantum efficiency and under high light intensities by safely dissipating excess photoenergy and deleterious photoproducts. The molecular mechanisms balancing these two functions remain incompletely described. One critical barrier to characterizing the mechanisms responsible for these processes is that they occur within proteins whose excited-state properties vary drastically among individual proteins and even within a single protein over time. In ensemble measurements, these excited-state properties appear only as the average value. To overcome this averaging, we investigate the purple bacterial antenna protein light harvesting complex 2 (LH2) from Rhodopseudomonas acidophila at the single-protein level. We use a room-temperature, single-molecule technique, the anti-Brownian electrokinetic trap, to study LH2 in a solution-phase (nonperturbative) environment. By performing simultaneous measurements of fluorescence intensity, lifetime, and spectra of single LH2 complexes, we identify three distinct states and observe transitions occurring among them on a timescale of seconds. Our results reveal that LH2 complexes undergo photoactivated switching to a quenched state, likely by a conformational change, and thermally revert to the ground state. This is a previously unobserved, reversible quenching pathway, and is one mechanism through which photosynthetic organisms can adapt to changes in light intensities.

  3. Genetic networking of the Bemisia tabaci cryptic species complex reveals pattern of biological invasions.

    Directory of Open Access Journals (Sweden)

    Paul De Barro

    Full Text Available BACKGROUND: A challenge within the context of cryptic species is the delimitation of individual species within the complex. Statistical parsimony network analytics offers the opportunity to explore limits in situations where there are insufficient species-specific morphological characters to separate taxa. The results also enable us to explore the spread in taxa that have invaded globally. METHODOLOGY/PRINCIPAL FINDINGS: Using a 657 bp portion of mitochondrial cytochrome oxidase 1 from 352 unique haplotypes belonging to the Bemisia tabaci cryptic species complex, the analysis revealed 28 networks plus 7 unconnected individual haplotypes. Of the networks, 24 corresponded to the putative species identified using the rule set devised by Dinsdale et al. (2010. Only two species proposed in Dinsdale et al. (2010 departed substantially from the structure suggested by the analysis. The analysis of the two invasive members of the complex, Mediterranean (MED and Middle East - Asia Minor 1 (MEAM1, showed that in both cases only a small number of haplotypes represent the majority that have spread beyond the home range; one MEAM1 and three MED haplotypes account for >80% of the GenBank records. Israel is a possible source of the globally invasive MEAM1 whereas MED has two possible sources. The first is the eastern Mediterranean which has invaded only the USA, primarily Florida and to a lesser extent California. The second are western Mediterranean haplotypes that have spread to the USA, Asia and South America. The structure for MED supports two home range distributions, a Sub-Saharan range and a Mediterranean range. The MEAM1 network supports the Middle East - Asia Minor region. CONCLUSION/SIGNIFICANCE: The network analyses show a high level of congruence with the species identified in a previous phylogenetic analysis. The analysis of the two globally invasive members of the complex support the view that global invasion often involve very small portions of

  4. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  5. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  7. Simultaneous measurement of amyloid fibril formation by dynamic light scattering and fluorescence reveals complex aggregation kinetics.

    Directory of Open Access Journals (Sweden)

    Aaron M Streets

    Full Text Available An apparatus that combines dynamic light scattering and Thioflavin T fluorescence detection is used to simultaneously probe fibril formation in polyglutamine peptides, the aggregating subunit associated with Huntington's disease, in vitro. Huntington's disease is a neurodegenerative disorder in a class of human pathologies that includes Alzheimer's and Parkinson's disease. These pathologies are all related by the propensity of their associated protein or polypeptide to form insoluble, β-sheet rich, amyloid fibrils. Despite the wide range of amino acid sequence in the aggregation prone polypeptides associated with these diseases, the resulting amyloids display strikingly similar physical structure, an observation which suggests a physical basis for amyloid fibril formation. Thioflavin T fluorescence reports β-sheet fibril content while dynamic light scattering measures particle size distributions. The combined techniques allow elucidation of complex aggregation kinetics and are used to reveal multiple stages of amyloid fibril formation.

  8. Connected magma plumbing system between Cerro Negro and El Hoyo Complex, Nicaragua revealed by gravity survey

    Science.gov (United States)

    MacQueen, Patricia; Zurek, Jeffrey; Williams-Jones, Glyn

    2016-11-01

    Cerro Negro, near León, Nicaragua is a young, relatively small basaltic cinder cone volcano that has been unusually active during its short lifespan. Multiple explosive eruptions have deposited significant amounts of ash on León and the surrounding rural communities. While a number of studies investigate the geochemistry and stress regime of the volcano, subsurface structures have only been studied by diffuse soil gas surveys. These studies have raised several questions as to the proper classification of Cerro Negro and its relation to neighboring volcanic features. To address these questions, we collected 119 gravity measurements around Cerro Negro volcano in an attempt to delineate deep structures at the volcano. The resulting complete Bouguer anomaly map revealed local positive gravity anomalies (wavelength 0.5 to 2 km, magnitude +4 mGal) and regional positive (10 km wavelength, magnitudes +10 and +8 mGal) and negative (12 and 6 km wavelength, magnitudes -18 and -13 mGal) Bouguer anomalies. Further analysis of these gravity data through inversion has revealed both local and regional density anomalies that we interpret as intrusive complexes at Cerro Negro and in the Nicaraguan Volcanic Arc. The local density anomalies at Cerro Negro have a density of 2700 kg m-3 (basalt) and are located between -250 and -2000 m above sea level. The distribution of recovered density anomalies suggests that eruptions at Cerro Negro may be tapping an interconnected magma plumbing system beneath El Hoyo, Cerro La Mula, and Cerro Negro, and more than seven other proximal volcanic features, implying that Cerro Negro should be considered the newest cone of a Cerro Negro-El Hoyo volcanic complex.

  9. Revealing the Structural Complexity of Component Interactions of Topic-Specific PCK when Planning to Teach

    Science.gov (United States)

    Mavhunga, Elizabeth

    2018-04-01

    Teaching pedagogical content knowledge (PCK) at a topic-specific level requires clarity on the content-specific nature of the components employed, as well as the specific features that bring about the desirable depth in teacher explanations. Such understanding is often hazy; yet, it influences the nature of teacher tasks and learning opportunities afforded to pre-service teachers in a teaching program. The purpose of this study was twofold: firstly, to illuminate the emerging complexity when content-specific components of PCK interact when planning to teach a chemistry topic; and secondly, to identify the kinds of teacher tasks that promote the emergence of such complexity. Data collected were content representations (CoRes) in chemical equilibrium accompanied by expanded lesson outlines from 15 pre-service teachers in their final year of study towards a first degree in teaching (B Ed). The analysis involved extraction of episodes that exhibited component interaction by using a qualitative in-depth analysis method. The results revealed the structure in which the components of PCK in a topic interact among each other to be linear, interwoven, or a combination of the two. The interwoven interactions contained multiple components that connected explanations on different aspects of a concept, all working in a complementary manner. The most sophisticated component interactions emerged from teacher tasks on descriptions of a lesson sequence and a summary of a lesson. Recommendations in this study highlight core practices for making pedagogical transformation of topic content knowledge more accessible.

  10. Differential network analysis reveals evolutionary complexity in secondary metabolism of Rauvolfia serpentina over Catharanthus roseus

    Directory of Open Access Journals (Sweden)

    Shivalika Pathania

    2016-08-01

    Full Text Available Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Towards these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These mechanisms may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of Rauvolfia serpentina, and key genes that contribute towards diversification of specific metabolites.

  11. Differential Network Analysis Reveals Evolutionary Complexity in Secondary Metabolism of Rauvolfia serpentina over Catharanthus roseus.

    Science.gov (United States)

    Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S

    2016-01-01

    Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.

  12. Multilayer Stochastic Block Models Reveal the Multilayer Structure of Complex Networks

    Directory of Open Access Journals (Sweden)

    Toni Vallès-Català

    2016-03-01

    Full Text Available In complex systems, the network of interactions we observe between systems components is the aggregate of the interactions that occur through different mechanisms or layers. Recent studies reveal that the existence of multiple interaction layers can have a dramatic impact in the dynamical processes occurring on these systems. However, these studies assume that the interactions between systems components in each one of the layers are known, while typically for real-world systems we do not have that information. Here, we address the issue of uncovering the different interaction layers from aggregate data by introducing multilayer stochastic block models (SBMs, a generalization of single-layer SBMs that considers different mechanisms of layer aggregation. First, we find the complete probabilistic solution to the problem of finding the optimal multilayer SBM for a given aggregate-observed network. Because this solution is computationally intractable, we propose an approximation that enables us to verify that multilayer SBMs are more predictive of network structure in real-world complex systems.

  13. A complex scenario of tuberculosis transmission is revealed through genetic and epidemiological surveys in Porto.

    Science.gov (United States)

    Rito, Teresa; Matos, Carlos; Carvalho, Carlos; Machado, Henrique; Rodrigues, Gabriela; Oliveira, Olena; Ferreira, Eduarda; Gonçalves, Jorge; Maio, Lurdes; Morais, Clara; Ramos, Helena; Guimarães, João Tiago; Santos, Catarina L; Duarte, Raquel; Correia-Neves, Margarida

    2018-01-25

    Tuberculosis (TB) incidence is decreasing worldwide and eradication is becoming plausible. In low-incidence countries, intervention on migrant populations is considered one of the most important strategies for elimination. However, such measures are inappropriate in European areas where TB is largely endemic, such as Porto in Portugal. We aim to understand transmission chains in Porto through a genetic characterization of Mycobacterium tuberculosis strains and through a detailed epidemiological evaluation of cases. We genotyped the M. tuberculosis strains using the MIRU-VNTR system. We performed an evolutionary reconstruction of the genotypes with median networks, used in this context for the first time. TB cases from a period of two years were evaluated combining genetic, epidemiological and georeferencing information. The data reveal a unique complex scenario in Porto where the autochthonous population acts as a genetic reservoir of M. tuberculosis diversity with discreet episodes of transmission, mostly undetected using classical epidemiology alone. Although control policies have been successful in decreasing incidence in Porto, the discerned complexity suggests that, for elimination to be a realistic goal, strategies need to be adjusted and coupled with a continuous genetic characterization of strains and detailed epidemiological evaluation, in order to successfully identify and interrupt transmission chains.

  14. Revealing the hidden networks of interaction in mobile animal groups allows prediction of complex behavioral contagion.

    Science.gov (United States)

    Rosenthal, Sara Brin; Twomey, Colin R; Hartnett, Andrew T; Wu, Hai Shan; Couzin, Iain D

    2015-04-14

    Coordination among social animals requires rapid and efficient transfer of information among individuals, which may depend crucially on the underlying structure of the communication network. Establishing the decision-making circuits and networks that give rise to individual behavior has been a central goal of neuroscience. However, the analogous problem of determining the structure of the communication network among organisms that gives rise to coordinated collective behavior, such as is exhibited by schooling fish and flocking birds, has remained almost entirely neglected. Here, we study collective evasion maneuvers, manifested through rapid waves, or cascades, of behavioral change (a ubiquitous behavior among taxa) in schooling fish (Notemigonus crysoleucas). We automatically track the positions and body postures, calculate visual fields of all individuals in schools of ∼150 fish, and determine the functional mapping between socially generated sensory input and motor response during collective evasion. We find that individuals use simple, robust measures to assess behavioral changes in neighbors, and that the resulting networks by which behavior propagates throughout groups are complex, being weighted, directed, and heterogeneous. By studying these interaction networks, we reveal the (complex, fractional) nature of social contagion and establish that individuals with relatively few, but strongly connected, neighbors are both most socially influential and most susceptible to social influence. Furthermore, we demonstrate that we can predict complex cascades of behavioral change at their moment of initiation, before they actually occur. Consequently, despite the intrinsic stochasticity of individual behavior, establishing the hidden communication networks in large self-organized groups facilitates a quantitative understanding of behavioral contagion.

  15. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  16. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  17. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  18. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  19. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  20. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  1. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  2. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  3. Global terrestrial water storage connectivity revealed using complex climate network analyses

    Science.gov (United States)

    Sun, A. Y.; Chen, J.; Donges, J.

    2015-07-01

    Terrestrial water storage (TWS) exerts a key control in global water, energy, and biogeochemical cycles. Although certain causal relationship exists between precipitation and TWS, the latter quantity also reflects impacts of anthropogenic activities. Thus, quantification of the spatial patterns of TWS will not only help to understand feedbacks between climate dynamics and the hydrologic cycle, but also provide new insights and model calibration constraints for improving the current land surface models. This work is the first attempt to quantify the spatial connectivity of TWS using the complex network theory, which has received broad attention in the climate modeling community in recent years. Complex networks of TWS anomalies are built using two global TWS data sets, a remote sensing product that is obtained from the Gravity Recovery and Climate Experiment (GRACE) satellite mission, and a model-generated data set from the global land data assimilation system's NOAH model (GLDAS-NOAH). Both data sets have 1° × 1° grid resolutions and cover most global land areas except for permafrost regions. TWS networks are built by first quantifying pairwise correlation among all valid TWS anomaly time series, and then applying a cutoff threshold derived from the edge-density function to retain only the most important features in the network. Basinwise network connectivity maps are used to illuminate connectivity of individual river basins with other regions. The constructed network degree centrality maps show the TWS anomaly hotspots around the globe and the patterns are consistent with recent GRACE studies. Parallel analyses of networks constructed using the two data sets reveal that the GLDAS-NOAH model captures many of the spatial patterns shown by GRACE, although significant discrepancies exist in some regions. Thus, our results provide further measures for constraining the current land surface models, especially in data sparse regions.

  4. Forced-rupture of cell-adhesion complexes reveals abrupt switch between two brittle states

    Science.gov (United States)

    Toan, Ngo Minh; Thirumalai, D.

    2018-03-01

    Cell adhesion complexes (CACs), which are activated by ligand binding, play key roles in many cellular functions ranging from cell cycle regulation to mediation of cell extracellular matrix adhesion. Inspired by single molecule pulling experiments using atomic force spectroscopy on leukocyte function-associated antigen-1 (LFA-1), expressed in T-cells, bound to intercellular adhesion molecules (ICAM), we performed constant loading rate (rf) and constant force (F) simulations using the self-organized polymer model to describe the mechanism of ligand rupture from CACs. The simulations reproduce the major experimental finding on the kinetics of the rupture process, namely, the dependence of the most probable rupture forces (f*s) on ln rf (rf is the loading rate) exhibits two distinct linear regimes. The first, at low rf, has a shallow slope, whereas the slope at high rf is much larger, especially for a LFA-1/ICAM-1 complex with the transition between the two occurring over a narrow rf range. Locations of the two transition states (TSs) extracted from the simulations show an abrupt change from a high value at low rf or constant force, F, to a low value at high rf or F. This unusual behavior in which the CACs switch from one brittle (TS position is a constant over a range of forces) state to another brittle state is not found in forced-rupture in other protein complexes. We explain this novel behavior by constructing the free energy profiles, F(Λ)s, as a function of a collective reaction coordinate (Λ), involving many key charged residues and a critical metal ion (Mg2+). The TS positions in F(Λ), which quantitatively agree with the parameters extracted using the Bell-Evans model, change abruptly at a critical force, demonstrating that it, rather than the molecular extension, is a good reaction coordinate. Our combined analyses using simulations performed in both the pulling modes (constant rf and F) reveal a new mechanism for the two loading regimes observed in the

  5. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  6. Perched Lava Pond Complex on South Rift of Axial Volcano Revealed in AUV Mapping

    Science.gov (United States)

    Paduan, J. B.; Clague, D. A.; Caress, D. W.; Thomas, H. J.

    2013-12-01

    An extraordinary lava pond complex is located on Axial Volcano's distal south rift. It was discovered in EM300 multibeam bathymetry collected in 1998, and explored and sampled with ROVs Tiburon in 2005 and Doc Ricketts in 2013. It was surveyed with the MBARI Mapping AUV D. Allan B. in 2011, in a complicated mission first flying above the levees at constant depth, then skimming ~5 m over the levees at a different constant depth to survey the floors, then twice switching to constant altitude mode to map outside the ponds. The AUV navigation was adjusted using the MB-System tool mbnavadjust so that bathymetric features match in overlapping and crossing swaths. The ~1-m resolution AUV bathymetry reveals extremely rough terrain, where low-resolution EM300 data had averaged acoustic returns and obscured details of walls, floors, a breach and surrounding flows, and gives context to the ROV observations and samples. The 6 x 1.5 km pond complex has 4 large and several smaller drained ponds with rims 67 to 106 m above the floors. The combined volume before draining was 0.56 km3. The ponds overflowed to build lobate-flow levees with elongate pillows draping outer flanks, then drained, leaving lava veneer on vertical inner walls. Levee rim depths vary by only 10 m and are deeper around the southern ponds. Deep collapse-pits in the levees suggest porosity of pond walls. The eastern levee of the northeastern pond breached, draining the interconnected ponds, and fed thick, rapidly-emplaced, sheet-flows along the complex's east side. These flows travelled at least 5.5 km down-rift and have 19-33 m deep drained ponds. They extended up-rift as well, forming a 10 x 2.5 km ponded flow with level 'bathtub rings' as high as 35 m above the floor marking that flow's high-stand. Despite the breach, at least 0.066 km3 of the molten interior of the large ponds also drained back down the eruptive fissures, as the pond floors are deeper than the sill and sea floor outside the complex. Tumulus

  7. Nanoscale stiffness topography reveals structure and mechanics of the transport barrier in intact nuclear pore complexes

    Science.gov (United States)

    Bestembayeva, Aizhan; Kramer, Armin; Labokha, Aksana A.; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V.; Ford, Ian J.; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W.

    2015-01-01

    The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ∼5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC. Although the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins, and is therefore not well understood. Here, we show that stiffness topography with sharp atomic force microscopy tips can generate nanoscale cross-sections of the NPC. The cross-sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel.

  8. Meditation effects within the hippocampal complex revealed by voxel-based morphometry and cytoarchitectonic probabilistic mapping

    Directory of Open Access Journals (Sweden)

    Eileen eLuders

    2013-07-01

    Full Text Available Scientific studies addressing anatomical variations in meditators’ brains have emerged rapidly over the last few years, where significant links are most frequently reported with respect to gray matter (GM. To advance prior work, this study examined GM characteristics in a large sample of 100 subjects (50 meditators, 50 controls, where meditators have been practicing close to twenty years, on average. A standard, whole-brain voxel-based morphometry approach was applied and revealed significant meditation effects in the vicinity of the hippocampus, showing more GM in meditators than in controls as well as positive correlations with the number of years practiced. However, the hippocampal complex is regionally segregated by architecture, connectivity, and functional relevance. Thus, to establish differential effects within the hippocampal formation (cornu ammonis, fascia dentate, entorhinal cortex, subiculum as well as the hippocampal-amygdaloid transition area, we utilized refined cytoarchitectonic probabilistic maps of (peri- hippocampal subsections. Significant meditation effects were observed within the subiculum specifically. Since the subiculum is known to play a key role in stress regulation and meditation is an established form of stress reduction, these GM findings may reflect neuronal preservation in long-term meditators – perhaps due to an attenuated release of stress hormones and decreased neurotoxicity.

  9. Meditation effects within the hippocampal complex revealed by voxel-based morphometry and cytoarchitectonic probabilistic mapping

    Science.gov (United States)

    Luders, Eileen; Kurth, Florian; Toga, Arthur W.; Narr, Katherine L.; Gaser, Christian

    2013-01-01

    Scientific studies addressing anatomical variations in meditators' brains have emerged rapidly over the last few years, where significant links are most frequently reported with respect to gray matter (GM). To advance prior work, this study examined GM characteristics in a large sample of 100 subjects (50 meditators, 50 controls), where meditators have been practicing close to 20 years, on average. A standard, whole-brain voxel-based morphometry approach was applied and revealed significant meditation effects in the vicinity of the hippocampus, showing more GM in meditators than in controls as well as positive correlations with the number of years practiced. However, the hippocampal complex is regionally segregated by architecture, connectivity, and functional relevance. Thus, to establish differential effects within the hippocampal formation (cornu ammonis, fascia dentata, entorhinal cortex, subiculum) as well as the hippocampal-amygdaloid transition area, we utilized refined cytoarchitectonic probabilistic maps of (peri-) hippocampal subsections. Significant meditation effects were observed within the subiculum specifically. Since the subiculum is known to play a key role in stress regulation and meditation is an established form of stress reduction, these GM findings may reflect neuronal preservation in long-term meditators—perhaps due to an attenuated release of stress hormones and decreased neurotoxicity. PMID:23847572

  10. Crystal structure of Clostridium botulinum whole hemagglutinin reveals a huge triskelion-shaped molecular complex.

    Science.gov (United States)

    Amatsu, Sho; Sugawara, Yo; Matsumura, Takuhiro; Kitadokoro, Kengo; Fujinaga, Yukako

    2013-12-06

    Clostridium botulinum HA is a component of the large botulinum neurotoxin complex and is critical for its oral toxicity. HA plays multiple roles in toxin penetration in the gastrointestinal tract, including protection from the digestive environment, binding to the intestinal mucosal surface, and disruption of the epithelial barrier. At least two properties of HA contribute to these roles: the sugar-binding activity and the barrier-disrupting activity that depends on E-cadherin binding of HA. HA consists of three different proteins, HA1, HA2, and HA3, whose structures have been partially solved and are made up mainly of β-strands. Here, we demonstrate structural and functional reconstitution of whole HA and present the complete structure of HA of serotype B determined by x-ray crystallography at 3.5 Å resolution. This structure reveals whole HA to be a huge triskelion-shaped molecule. Our results suggest that whole HA is functionally and structurally separable into two parts: HA1, involved in recognition of cell-surface carbohydrates, and HA2-HA3, involved in paracellular barrier disruption by E-cadherin binding.

  11. Mitochondrial genomes reveal recombination in the presumed asexual Fusarium oxysporum species complex.

    Science.gov (United States)

    Brankovics, Balázs; van Dam, Peter; Rep, Martijn; de Hoog, G Sybren; J van der Lee, Theo A; Waalwijk, Cees; van Diepeningen, Anne D

    2017-09-18

    The Fusarium oxysporum species complex (FOSC) contains several phylogenetic lineages. Phylogenetic studies identified two to three major clades within the FOSC. The mitochondrial sequences are highly informative phylogenetic markers, but have been mostly neglected due to technical difficulties. A total of 61 complete mitogenomes of FOSC strains were de novo assembled and annotated. Length variations and intron patterns support the separation of three phylogenetic species. The variable region of the mitogenome that is typical for the genus Fusarium shows two new variants in the FOSC. The variant typical for Fusarium is found in members of all three clades, while variant 2 is found in clades 2 and 3 and variant 3 only in clade 2. The extended set of loci analyzed using a new implementation of the genealogical concordance species recognition method support the identification of three phylogenetic species within the FOSC. Comparative analysis of the mitogenomes in the FOSC revealed ongoing mitochondrial recombination within, but not between phylogenetic species. The recombination indicates the presence of a parasexual cycle in F. oxysporum. The obstacles hindering the usage of the mitogenomes are resolved by using next generation sequencing and selective genome assemblers, such as GRAbB. Complete mitogenome sequences offer a stable basis and reference point for phylogenetic and population genetic studies.

  12. Complex evolutionary patterns revealed by mitochondrial genomes of the domestic horse.

    Science.gov (United States)

    Ning, T; Li, J; Lin, K; Xiao, H; Wylie, S; Hua, S; Li, H; Zhang, Y-P

    2014-01-01

    The domestic horse is the most widely used and important stock and recreational animal, valued for its strength and endurance. The energy required by the domestic horse is mainly supplied by mitochondria via oxidative phosphorylation. Thus, selection may have played an essential role in the evolution of the horse mitochondria. Besides, demographic events also affect the DNA polymorphic pattern on mitochondria. To understand the evolutionary patterns of the mitochondria of the domestic horse, we used a deep sequencing approach to obtain the complete sequences of 15 mitochondrial genomes, and four mitochondrial gene sequences, ND6, ATP8, ATP6 and CYTB, collected from 509, 363, 363 and 409 domestic horses, respectively. Evidence of strong substitution rate heterogeneity was found at nonsynonymous sites across the genomes. Signatures of recent positive selection on mtDNA of domestic horse were detected. Specifically, five amino acids in the four mitochondrial genes were identified as the targets of positive selection. Coalescentbased simulations imply that recent population expansion is the most probable explanation for the matrilineal population history for domestic horse. Our findings reveal a complex pattern of non-neutral evolution of the mitochondrial genome in the domestic horses.

  13. Proteomic analysis reveals the diversity and complexity of membrane proteins in chickpea (Cicer arietinum L.

    Directory of Open Access Journals (Sweden)

    Jaiswal Dinesh Kumar

    2012-10-01

    Full Text Available Abstract Background Compartmentalization is a unique feature of eukaryotes that helps in maintaining cellular homeostasis not only in intra- and inter-organellar context, but also between the cells and the external environment. Plant cells are highly compartmentalized with a complex metabolic network governing various cellular events. The membranes are the most important constituents in such compartmentalization, and membrane-associated proteins play diverse roles in many cellular processes besides being part of integral component of many signaling cascades. Results To obtain valuable insight into the dynamic repertoire of membrane proteins, we have developed a proteome reference map of a grain legume, chickpea, using two-dimensional gel electrophoresis. MALDI-TOF/TOF and LC-ESI-MS/MS analysis led to the identification of 91 proteins involved in a variety of cellular functions viz., bioenergy, stress-responsive and signal transduction, metabolism, protein synthesis and degradation, among others. Significantly, 70% of the identified proteins are putative integral membrane proteins, possessing transmembrane domains. Conclusions The proteomic analysis revealed many resident integral membrane proteins as well as membrane-associated proteins including those not reported earlier. To our knowledge, this is the first report of membrane proteome from aerial tissues of a crop plant. The findings may provide a better understanding of the biochemical machinery of the plant membranes at the molecular level that might help in functional genomics studies of different developmental pathways and stress-responses.

  14. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  15. Genome sequencing reveals complex secondary metabolome in themarine actinomycete Salinispora tropica

    Energy Technology Data Exchange (ETDEWEB)

    Udwary, Daniel W.; Zeigler, Lisa; Asolkar, Ratnakar; Singan,Vasanth; Lapidus, Alla; Fenical, William; Jensen, Paul R.; Moore, BradleyS.

    2007-05-01

    Recent fermentation studies have identified actinomycetes ofthe marine-dwelling genus Salinispora as prolific natural productproducers. To further evaluate their biosynthetic potential, we analyzedall identifiable secondary natural product gene clusters from therecently sequenced 5,184,724 bp S. tropica CNB-440 circular genome. Ouranalysis shows that biosynthetic potential meets or exceeds that shown byprevious Streptomyces genome sequences as well as other naturalproduct-producing actinomycetes. The S. tropica genome features ninepolyketide synthase systems of every known formally classified family,non-ribosomal peptide synthetases and several hybrid clusters. While afew clusters appear to encode molecules previously identified inStreptomyces species,the majority of the 15 biosynthetic loci are novel.Specific chemical information about putative and observed natural productmolecules is presented and discussed. In addition, our bioinformaticanalysis was critical for the structure elucidation of the novelpolyenemacrolactam salinilactam A. This study demonstrates the potentialfor genomic analysis to complement and strengthen traditional naturalproduct isolation studies and firmly establishes the genus Salinispora asa rich source of novel drug-like molecules.

  16. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  17. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  18. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Genome-wide analyses of the Bemisia tabaci species complex reveal contrasting patterns of admixture and complex demographic histories.

    Directory of Open Access Journals (Sweden)

    S Elfekih

    Full Text Available Once considered a single species, the whitefly, Bemisia tabaci, is a complex of numerous morphologically indistinguishable species. Within the last three decades, two of its members (MED and MEAM1 have become some of the world's most damaging agricultural pests invading countries across Europe, Africa, Asia and the Americas and affecting a vast range of agriculturally important food and fiber crops through both feeding-related damage and the transmission of numerous plant viruses. For some time now, researchers have relied on a single mitochondrial gene and/or a handful of nuclear markers to study this species complex. Here, we move beyond this by using 38,041 genome-wide Single Nucleotide Polymorphisms, and show that the two invasive members of the complex are closely related species with signatures of introgression with a third species (IO. Gene flow patterns were traced between contemporary invasive populations within MED and MEAM1 species and these were best explained by recent international trade. These findings have profound implications for delineating the B. tabaci species status and will impact quarantine measures and future management strategies of this global pest.

  20. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  1. Reconstitution of active human core Mediator complex reveals a pivotal role of the MED14 subunit

    Science.gov (United States)

    Cevher, Murat A.; Shi, Yi; Li, Dan; Chait, Brian T.; Malik, Sohail; Roeder, Robert G.

    2014-01-01

    The evolutionarily conserved Mediator complex is a critical coactivator for RNA polymerase II (Pol II)-mediated transcription. Here, we report the reconstitution of a functional 15-subunit human core Mediator complex and its characterization by functional assays and chemical cross-linking coupled to mass spectrometry (CX-MS). Whereas the reconstituted head and middle modules can stably associate, only with incorporation of MED14 into the bi-modular complex does it acquire basal and coactivator functions. This results from a dramatically enhanced ability of MED14-containing complexes to associate with Pol II. Altogether, our analyses identify MED14 as both an architectural and a functional backbone of the Mediator complex. We further establish a conditional requirement for metazoan-specific MED26 that becomes evident in the presence of heterologous nuclear factors. This general approach paves the way for systematically dissecting the multiple layers of functionalities associated with the Mediator complex. PMID:25383669

  2. Reconstitution of active human core Mediator complex reveals a critical role of the MED14 subunit.

    Science.gov (United States)

    Cevher, Murat A; Shi, Yi; Li, Dan; Chait, Brian T; Malik, Sohail; Roeder, Robert G

    2014-12-01

    The evolutionarily conserved Mediator complex is a critical coactivator for RNA polymerase II (Pol II)-mediated transcription. Here we report the reconstitution of a functional 15-subunit human core Mediator complex and its characterization by functional assays and chemical cross-linking coupled to MS (CX-MS). Whereas the reconstituted head and middle modules can stably associate, basal and coactivator functions are acquired only after incorporation of MED14 into the bimodular complex. This results from a dramatically enhanced ability of MED14-containing complexes to associate with Pol II. Altogether, our analyses identify MED14 as both an architectural and a functional backbone of the Mediator complex. We further establish a conditional requirement for metazoan-specific MED26 that becomes evident in the presence of heterologous nuclear factors. This general approach paves the way for systematic dissection of the multiple layers of functionality associated with the Mediator complex.

  3. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  4. Identification of quercitrin as an inhibitor of the p90 S6 ribosomal kinase (RSK): structure of its complex with the N-terminal domain of RSK2 at 1.8 Å resolution

    Energy Technology Data Exchange (ETDEWEB)

    Derewenda, Urszula; Artamonov, Mykhaylo; Szukalska, Gabriela; Utepbergenov, Darkhan; Olekhnovich, Natalya [University of Virginia, Charlottesville, VA 22908-0736 (United States); Parikh, Hardik I.; Kellogg, Glen E. [Virginia Commonwealth University, Richmond, VA 23298-0540 (United States); Somlyo, Avril V.; Derewenda, Zygmunt S., E-mail: zsd4n@virginia.edu [University of Virginia, Charlottesville, VA 22908-0736 (United States)

    2013-02-01

    The crystal structure of quercitrin, a naturally occurring flavonol glycoside, has been determined in a complex with the N-terminal kinase domain of murine RSK2. The structure revealed that quercitrin inhibits the RSK2 kinase in the same fashion as another known inhibitor, SL0101. Members of the RSK family of kinases constitute attractive targets for drug design, but a lack of structural information regarding the mechanism of selective inhibitors impedes progress in this field. The crystal structure of the N-terminal kinase domain (residues 45–346) of mouse RSK2, or RSK2{sup NTKD}, has recently been described in complex with one of only two known selective inhibitors, a rare naturally occurring flavonol glycoside, kaempferol 3-O-(3′′,4′′-di-O-acetyl-α-l-rhamnopyranoside), known as SL0101. Based on this structure, it was hypothesized that quercitrin (quercetin 3-O-α-l-rhamnopyranoside), a related but ubiquitous and inexpensive compound, might also act as an RSK inhibitor. Here, it is demonstrated that quercitrin binds to RSK2{sup NTKD} with a dissociation constant (K{sub d}) of 5.8 µM as determined by isothermal titration calorimetry, and a crystal structure of the binary complex at 1.8 Å resolution is reported. The crystal structure reveals a very similar mode of binding to that recently reported for SL0101. Closer inspection shows a number of small but significant differences that explain the slightly higher K{sub d} for quercitrin compared with SL0101. It is also shown that quercitrin can effectively substitute for SL0101 in a biological assay, in which it significantly suppresses the contractile force in rabbit pulmonary artery smooth muscle in response to Ca{sup 2+}.

  5. Identification of quercitrin as an inhibitor of the p90 S6 ribosomal kinase (RSK): structure of its complex with the N-terminal domain of RSK2 at 1.8 Å resolution

    International Nuclear Information System (INIS)

    Derewenda, Urszula; Artamonov, Mykhaylo; Szukalska, Gabriela; Utepbergenov, Darkhan; Olekhnovich, Natalya; Parikh, Hardik I.; Kellogg, Glen E.; Somlyo, Avril V.; Derewenda, Zygmunt S.

    2013-01-01

    The crystal structure of quercitrin, a naturally occurring flavonol glycoside, has been determined in a complex with the N-terminal kinase domain of murine RSK2. The structure revealed that quercitrin inhibits the RSK2 kinase in the same fashion as another known inhibitor, SL0101. Members of the RSK family of kinases constitute attractive targets for drug design, but a lack of structural information regarding the mechanism of selective inhibitors impedes progress in this field. The crystal structure of the N-terminal kinase domain (residues 45–346) of mouse RSK2, or RSK2 NTKD , has recently been described in complex with one of only two known selective inhibitors, a rare naturally occurring flavonol glycoside, kaempferol 3-O-(3′′,4′′-di-O-acetyl-α-l-rhamnopyranoside), known as SL0101. Based on this structure, it was hypothesized that quercitrin (quercetin 3-O-α-l-rhamnopyranoside), a related but ubiquitous and inexpensive compound, might also act as an RSK inhibitor. Here, it is demonstrated that quercitrin binds to RSK2 NTKD with a dissociation constant (K d ) of 5.8 µM as determined by isothermal titration calorimetry, and a crystal structure of the binary complex at 1.8 Å resolution is reported. The crystal structure reveals a very similar mode of binding to that recently reported for SL0101. Closer inspection shows a number of small but significant differences that explain the slightly higher K d for quercitrin compared with SL0101. It is also shown that quercitrin can effectively substitute for SL0101 in a biological assay, in which it significantly suppresses the contractile force in rabbit pulmonary artery smooth muscle in response to Ca 2+

  6. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  7. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  8. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  9. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  10. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  11. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  12. The Complexome of Dehalococcoides mccartyi Reveals Its Organohalide Respiration-Complex Is Modular

    Directory of Open Access Journals (Sweden)

    Katja Seidel

    2018-06-01

    Full Text Available Dehalococcoides mccartyi strain CBDB1 is a slow growing strictly anaerobic microorganism dependent on halogenated compounds as terminal electron acceptor for anaerobic respiration. Indications have been described that the membrane-bound proteinaceous organohalide respiration complex of strain CBDB1 is functional without quinone-mediated electron transfer. We here study this multi-subunit protein complex in depth in regard to participating protein subunits and interactions between the subunits using blue native gel electrophoresis coupled to mass spectrometric label-free protein quantification. Applying three different solubilization modes to detach the respiration complex from the membrane we describe different solubilization snapshots of the organohalide respiration complex. The results demonstrate the existence of a two-subunit hydrogenase module loosely binding to the rest of the complex, tight binding of the subunit HupX to OmeA and OmeB, predicted to be the two subunits of a molybdopterin-binding redox subcomplex, to form a second module, and the presence of two distinct reductive dehalogenase module variants with different sizes. In our data we obtained biochemical evidence for the specificity between a reductive dehalogenase RdhA (CbdbA80 and its membrane anchor protein RdhB (CbdbB3. We also observed weak interactions between the reductive dehalogenase and the hydrogenase module suggesting a not yet recognized contact surface between these two modules. Especially an interaction between the two integral membrane subunits OmeB and RdhB seems to promote the integrity of the complex. With the different solubilization strengths we observe successive disintegration of the complex into its subunits. The observed architecture would allow the association of different reductive dehalogenase modules RdhA/RdhB with the other two protein complex modules when the strain is growing on different electron acceptors. In the search for other respiratory

  13. DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli.

    Science.gov (United States)

    Lemmens, Karen; De Bie, Tijl; Dhollander, Thomas; De Keersmaecker, Sigrid C; Thijs, Inge M; Schoofs, Geert; De Weerdt, Ami; De Moor, Bart; Vanderleyden, Jos; Collado-Vides, Julio; Engelen, Kristof; Marchal, Kathleen

    2009-01-01

    We present DISTILLER, a data integration framework for the inference of transcriptional module networks. Experimental validation of predicted targets for the well-studied fumarate nitrate reductase regulator showed the effectiveness of our approach in Escherichia coli. In addition, the condition dependency and modularity of the inferred transcriptional network was studied. Surprisingly, the level of regulatory complexity seemed lower than that which would be expected from RegulonDB, indicating that complex regulatory programs tend to decrease the degree of modularity.

  14. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  16. Survey of large protein complexes D. vulgaris reveals great structural diversity

    Energy Technology Data Exchange (ETDEWEB)

    Han, B.-G.; Dong, M.; Liu, H.; Camp, L.; Geller, J.; Singer, M.; Hazen, T. C.; Choi, M.; Witkowska, H. E.; Ball, D. A.; Typke, D.; Downing, K. H.; Shatsky, M.; Brenner, S. E.; Chandonia, J.-M.; Biggin, M. D.; Glaeser, R. M.

    2009-08-15

    An unbiased survey has been made of the stable, most abundant multi-protein complexes in Desulfovibrio vulgaris Hildenborough (DvH) that are larger than Mr {approx} 400 k. The quaternary structures for 8 of the 16 complexes purified during this work were determined by single-particle reconstruction of negatively stained specimens, a success rate {approx}10 times greater than that of previous 'proteomic' screens. In addition, the subunit compositions and stoichiometries of the remaining complexes were determined by biochemical methods. Our data show that the structures of only two of these large complexes, out of the 13 in this set that have recognizable functions, can be modeled with confidence based on the structures of known homologs. These results indicate that there is significantly greater variability in the way that homologous prokaryotic macromolecular complexes are assembled than has generally been appreciated. As a consequence, we suggest that relying solely on previously determined quaternary structures for homologous proteins may not be sufficient to properly understand their role in another cell of interest.

  17. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  18. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  19. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  20. Concordance of gene expression in human protein complexes reveals tissue specificity and pathology

    DEFF Research Database (Denmark)

    Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven

    2013-01-01

    Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among prot...

  1. Cilium transition zone proteome reveals compartmentalization and differential dynamics of ciliopathy complexes

    Czech Academy of Sciences Publication Activity Database

    Dean, S.; Moreira-Leite, F.; Varga, Vladimír; Gull, K.

    2016-01-01

    Roč. 113, č. 35 (2016), E5135-E5143 ISSN 0027-8424 Institutional support: RVO:68378050 Keywords : transition zone * cilium/flagellum * BBSome * MKS/B9 complex * trypanosome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.661, year: 2016

  2. How Can We Explain Poverty? Case Study of Dee Reveals the Complexities

    Science.gov (United States)

    Seccombe, Karen

    2011-01-01

    Many theories have been offered to explain why people are impoverished. This article by Karen Seccombe uses the case study of "Dee," a newly single mother, to explore four of the most common: individualism, social structuralism, the culture of poverty, and fatalism. She concludes that poverty is a highly complex phenomenon, and it is likely that…

  3. Fitness effects of a selfish gene (the Mus t complex) are revealed in an ecological context.

    Science.gov (United States)

    Carroll, Lara S; Meagher, Shawn; Morrison, Linda; Penn, Dustin J; Potts, Wayne K

    2004-06-01

    In wild house mice, genes linked to the t transmission distortion complex cause meiotic drive by sabotaging wild-type gametes. The t complex is consequently inherited at frequencies higher than 90%. Yet, for unclear reasons, in wild mouse populations this selfish DNA is found at frequencies much lower than expected. Here, we examine selection on the t complex in 10 seminatural populations of wild mice based on data from 234 founders and nearly 2000 progeny. Eight of the 10 populations decreased in t frequency over one generation, and the overall frequency of t haplotypes across all 10 populations was 48.5% below expectations based on transmission distortion and 34.3% below Mendelian (or Hardy-Weinberg) expectations. Behavioral and reproductive data were collected for 10 months for each population, and microsatellite genotyping was performed on seven of the populations to determine parentage. These combined data show t-associated fitness declines in both males and females. This is the first study to show evidence for a reduction in the ability of +/t males to maintain territories. Because females tend to mate with dominant males, impairment of territorial success can explain much of the selection against t observed in our populations. In nature, selection against heterozygote carriers of the t complex helps solve the puzzlingly low t frequencies found in wild populations. This ecological approach for determining fitness consequences of genetic variants has broad application for the discovery of gene function in general.

  4. Structural biology. Structures of the CRISPR-Cmr complex reveal mode of RNA target positioning

    NARCIS (Netherlands)

    Taylor, D.W.; Zhu, Y.; Staals, R.H.J.; Kornfeld, J.E.; Shinkai, A.; Oost, van der J.; Nogales, E.; Doudna, J.A.

    2015-01-01

    Adaptive immunity in bacteria involves RNA-guided surveillance complexes that use CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) proteins together with CRISPR RNAs (crRNAs) to target invasive nucleic acids for degradation. Whereas type I and type II CRISPR-Cas

  5. Peeling Back the Layers of Policy and School Reform: Revealing the Structural and Social Complexities within

    Science.gov (United States)

    Woodside-Jiron, Haley; Gehsmann, Kristin M.

    2009-01-01

    This article explores the complex process of school change over a six-year period in one high-poverty, urban elementary school in a northeastern city of the United States. The school included in this instrumental case study was identified by its State Department of Education as "being in need of improvement" in March 2000. Findings…

  6. Revealing the Differences Between Free and Complexed Enzyme Mechanisms and Factors Contributing to Cell Wall Recalcitrance

    Energy Technology Data Exchange (ETDEWEB)

    Resch, Michael G.; Donohoe, Byron; Ciesielski, Peter; Nill, Jennifer; McKinney, Kellene; Mittal, Ashutosh; Katahira, Rui; Himmel, Michael; Biddy, Mary; Beckham, Gregg; Decker, Steve

    2014-09-08

    Enzymatic depolymerization of polysaccharides is a key step in the production of fuels and chemicals from lignocellulosic biomass, and discovery of synergistic biomass-degrading enzyme paradigms will enable improved conversion processes. Historically, revealing insights into enzymatic saccharification mechanisms on plant cell walls has been hindered by uncharacterized substrates and low resolution.

  7. Stem cankers on sunflower (Helianthus annuus) in Australia reveal a complex of pathogenic Diaporthe (Phomopsis) species

    NARCIS (Netherlands)

    Thompson, S.M.; Tan, Y.P.; Young, A.J.; Neate, S.M.; Aitken, E.A.B.; Shivas, R.G.

    2012-01-01

    The identification of Diaporthe (anamorph Phomopsis) species associated with stem canker of sunflower (Helianthus annuus) in Australia was studied using morphology, DNA sequence analysis and pathology. Phylogenetic analysis revealed three clades that did not correspond with known taxa, and these are

  8. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  9. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  10. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  11. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  12. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  13. Comparative transcriptome analysis within the Lolium/Festuca species complex reveals high sequence conservation

    DEFF Research Database (Denmark)

    Czaban, Adrian; Sharma, Sapna; Byrne, Stephen

    2015-01-01

    species from the Lolium-Festuca complex, ranging from 52,166 to 72,133 transcripts per assembly. We have also predicted a set of proteins and validated it with a high-confidence protein database from three closely related species (H. vulgare, B. distachyon and O. sativa). We have obtained gene family...... clusters for the four species using OrthoMCL and analyzed their inferred phylogenetic relationships. Our results indicate that VRN2 is a candidate gene for differentiating vernalization and non-vernalization types in the Lolium-Festuca complex. Grouping of the gene families based on their BLAST identity...... enabled us to divide ortholog groups into those that are very conserved and those that are more evolutionarily relaxed. The ratio of the non-synonumous to synonymous substitutions enabled us to pinpoint protein sequences evolving in response to positive selection. These proteins may explain some...

  14. Structures of Adnectin/Protein Complexes Reveal an Expanded Binding Footprint

    Energy Technology Data Exchange (ETDEWEB)

    Ramamurthy, Vidhyashankar; Krystek, Jr., Stanley R.; Bush, Alexander; Wei, Anzhi; Emanuel, Stuart L.; Gupta, Ruchira Das; Janjua, Ahsen; Cheng, Lin; Murdock, Melissa; Abramczyk, Bozena; Cohen, Daniel; Lin, Zheng; Morin, Paul; Davis, Jonathan H.; Dabritz, Michael; McLaughlin, Douglas C.; Russo, Katie A.; Chao, Ginger; Wright, Martin C.; Jenny, Victoria A.; Engle, Linda J.; Furfine, Eric; Sheriff, Steven (BMS)

    2014-10-02

    Adnectins are targeted biologics derived from the tenth type III domain of human fibronectin ({sup 10}Fn3), a member of the immunoglobulin superfamily. Target-specific binders are selected from libraries generated by diversifying the three {sup 10}Fn3 loops that are analogous to the complementarity determining regions of antibodies. The crystal structures of two Adnectins were determined, each in complex with its therapeutic target, EGFR or IL-23. Both Adnectins bind different epitopes than those bound by known monoclonal antibodies. Molecular modeling suggests that some of these epitopes might not be accessible to antibodies because of the size and concave shape of the antibody combining site. In addition to interactions from the Adnectin diversified loops, residues from the N terminus and/or the {beta} strands interact with the target proteins in both complexes. Alanine-scanning mutagenesis confirmed the calculated binding energies of these {beta} strand interactions, indicating that these nonloop residues can expand the available binding footprint.

  15. A Single-Cell Biochemistry Approach Reveals PAR Complex Dynamics during Cell Polarization.

    Science.gov (United States)

    Dickinson, Daniel J; Schwager, Francoise; Pintard, Lionel; Gotta, Monica; Goldstein, Bob

    2017-08-21

    Regulated protein-protein interactions are critical for cell signaling, differentiation, and development. For the study of dynamic regulation of protein interactions in vivo, there is a need for techniques that can yield time-resolved information and probe multiple protein binding partners simultaneously, using small amounts of starting material. Here we describe a single-cell protein interaction assay. Single-cell lysates are generated at defined time points and analyzed using single-molecule pull-down, yielding information about dynamic protein complex regulation in vivo. We established the utility of this approach by studying PAR polarity proteins, which mediate polarization of many animal cell types. We uncovered striking regulation of PAR complex composition and stoichiometry during Caenorhabditis elegans zygote polarization, which takes place in less than 20 min. PAR complex dynamics are linked to the cell cycle by Polo-like kinase 1 and govern the movement of PAR proteins to establish polarity. Our results demonstrate an approach to study dynamic biochemical events in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Structures of RNA Polymerase Closed and Intermediate Complexes Reveal Mechanisms of DNA Opening and Transcription Initiation.

    Science.gov (United States)

    Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong

    2017-07-06

    Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Complex structure of the fission yeast SREBP-SCAP binding domains reveals an oligomeric organization.

    Science.gov (United States)

    Gong, Xin; Qian, Hongwu; Shao, Wei; Li, Jingxian; Wu, Jianping; Liu, Jun-Jie; Li, Wenqi; Wang, Hong-Wei; Espenshade, Peter; Yan, Nieng

    2016-11-01

    Sterol regulatory element-binding protein (SREBP) transcription factors are master regulators of cellular lipid homeostasis in mammals and oxygen-responsive regulators of hypoxic adaptation in fungi. SREBP C-terminus binds to the WD40 domain of SREBP cleavage-activating protein (SCAP), which confers sterol regulation by controlling the ER-to-Golgi transport of the SREBP-SCAP complex and access to the activating proteases in the Golgi. Here, we biochemically and structurally show that the carboxyl terminal domains (CTD) of Sre1 and Scp1, the fission yeast SREBP and SCAP, form a functional 4:4 oligomer and Sre1-CTD forms a dimer of dimers. The crystal structure of Sre1-CTD at 3.5 Å and cryo-EM structure of the complex at 5.4 Å together with in vitro biochemical evidence elucidate three distinct regions in Sre1-CTD required for Scp1 binding, Sre1-CTD dimerization and tetrameric formation. Finally, these structurally identified domains are validated in a cellular context, demonstrating that the proper 4:4 oligomeric complex formation is required for Sre1 activation.

  18. Species delimitation in the Stenocereus griseus (Cactaceae) species complex reveals a new species, S. huastecorum.

    Science.gov (United States)

    Alvarado-Sizzo, Hernán; Casas, Alejandro; Parra, Fabiola; Arreola-Nava, Hilda Julieta; Terrazas, Teresa; Sánchez, Cristian

    2018-01-01

    The Stenocereus griseus species complex (SGSC) has long been considered taxonomically challenging because the number of taxa belonging to the complex and their geographical boundaries remain poorly understood. Bayesian clustering and genetic distance-based methods were used based on nine microsatellite loci in 377 individuals of three main putative species of the complex. The resulting genetic clusters were assessed for ecological niche divergence and areolar morphology, particularly spination patterns. We based our species boundaries on concordance between genetic, ecological, and morphological data, and were able to resolve four species, three of them corresponding to S. pruinosus from central Mexico, S. laevigatus from southern Mexico, and S. griseus from northern South America. A fourth species, previously considered to be S. griseus and commonly misidentified as S. pruinosus in northern Mexico showed significant genetic, ecological, and morphological differentiation suggesting that it should be considered a new species, S. huastecorum, which we describe here. We show that population genetic analyses, ecological niche modeling, and morphological studies are complementary approaches for delimiting species in taxonomically challenging plant groups such as the SGSC.

  19. Species delimitation in the Stenocereus griseus (Cactaceae species complex reveals a new species, S. huastecorum.

    Directory of Open Access Journals (Sweden)

    Hernán Alvarado-Sizzo

    Full Text Available The Stenocereus griseus species complex (SGSC has long been considered taxonomically challenging because the number of taxa belonging to the complex and their geographical boundaries remain poorly understood. Bayesian clustering and genetic distance-based methods were used based on nine microsatellite loci in 377 individuals of three main putative species of the complex. The resulting genetic clusters were assessed for ecological niche divergence and areolar morphology, particularly spination patterns. We based our species boundaries on concordance between genetic, ecological, and morphological data, and were able to resolve four species, three of them corresponding to S. pruinosus from central Mexico, S. laevigatus from southern Mexico, and S. griseus from northern South America. A fourth species, previously considered to be S. griseus and commonly misidentified as S. pruinosus in northern Mexico showed significant genetic, ecological, and morphological differentiation suggesting that it should be considered a new species, S. huastecorum, which we describe here. We show that population genetic analyses, ecological niche modeling, and morphological studies are complementary approaches for delimiting species in taxonomically challenging plant groups such as the SGSC.

  20. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  1. Molecular systematics reveals increased diversity within the South African Laurencia complex (Rhodomelaceae, Rhodophyta).

    Science.gov (United States)

    Francis, Caitlynne; Bolton, John J; Mattio, Lydiane; Mandiwana-Neudani, Tshifhiwa G; Anderson, Robert J

    2017-08-01

    Previous publications list ten species in the Laurencia complex from South Africa with all ascribed to the genus Laurencia sensu stricto. However, the diversity of the complex in South Africa has not yet been re-assessed following the numerous recent taxonomic changes. This study investigated the phylogenetic relationships and taxonomy of this group in South Africa using recent collections. Methods included molecular phylogenetic analyses of plastid rbcL gene sequences (a total of 146; including eleven outgroup taxa) using Maximum Likelihood and Bayesian Inference, and the examination of morphological and anatomical characters, including the number of corps en cerise when present. The seven genera of the Laurencia complex formed monophyletic clades with high posterior probabilities. Seventeen morphotypes were identified: 14 in the genus Laurencia sensu stricto, among which eight corresponded to Laurencia species currently recognized from South Africa and one each to species of Palisada, Chondrophycus, and Laurenciella. The six remaining morphotypes in Laurencia sensu stricto did not match any descriptions and are described here as five new species: Laurencia alfredensis sp. nov., Laurencia dichotoma sp. nov., Laurencia digitata sp. nov., Laurencia multiclavata sp. nov. and Laurencia sodwaniensis sp. nov. and a new variety: Laurencia pumila var. dehoopiensis var. nov. Laurencia stegengae nom. nov. is established to replace Laurencia peninsularis Stegenga, Bolton and Anderson nom. illeg. The diversity is likely greater, with six additional unidentified specimens found in this molecular investigation. These findings place South Africa alongside Australia in having one of the most diverse floras of this group in the world. © 2017 Phycological Society of America.

  2. Complex nuclear-structure phenomena revealed from the nuclide production in fragmentation reactions

    International Nuclear Information System (INIS)

    Ricciardi, M.V.; Kelic, A.; Napolitani, P.; Schmidt, K.H.; Yordanov, O.; Ignatyuk, A.V.; Rejmund, F.

    2003-12-01

    Complex structural effects in the nuclide production from the projectile fragmentation of 1 A GeV 238 U nuclei in a titanium target are reported. The structure seems to be insensitive to the excitation energy induced in the reaction. This is in contrast to the prominent structural features found in nuclear fission and in transfer reactions, which gradually disappear with increasing excitation energy. Using the statistical model of nuclear reactions, relations to structural effects in nuclear binding and in the nuclear level density are demonstrated. (orig.)

  3. Crystal structures of the CPAP/STIL complex reveal its role in centriole assembly and human microcephaly

    Science.gov (United States)

    Cottee, Matthew A; Muschalik, Nadine; Wong, Yao Liang; Johnson, Christopher M; Johnson, Steven; Andreeva, Antonina; Oegema, Karen; Lea, Susan M; Raff, Jordan W; van Breugel, Mark

    2013-01-01

    Centrioles organise centrosomes and template cilia and flagella. Several centriole and centrosome proteins have been linked to microcephaly (MCPH), a neuro-developmental disease associated with small brain size. CPAP (MCPH6) and STIL (MCPH7) are required for centriole assembly, but it is unclear how mutations in them lead to microcephaly. We show that the TCP domain of CPAP constitutes a novel proline recognition domain that forms a 1:1 complex with a short, highly conserved target motif in STIL. Crystal structures of this complex reveal an unusual, all-β structure adopted by the TCP domain and explain how a microcephaly mutation in CPAP compromises complex formation. Through point mutations, we demonstrate that complex formation is essential for centriole duplication in vivo. Our studies provide the first structural insight into how the malfunction of centriole proteins results in human disease and also reveal that the CPAP–STIL interaction constitutes a conserved key step in centriole biogenesis. DOI: http://dx.doi.org/10.7554/eLife.01071.001 PMID:24052813

  4. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  5. DNA Barcode Analysis of Thrips (Thysanoptera) Diversity in Pakistan Reveals Cryptic Species Complexes.

    Science.gov (United States)

    Iftikhar, Romana; Ashfaq, Muhammad; Rasool, Akhtar; Hebert, Paul D N

    2016-01-01

    Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode) region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN) system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27%) at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%). BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci), and one predatory thrips (Aeolothrips intermedius) showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips.

  6. Molecular phylogeny of Glossodoris (Ehrenberg, 1831) nudibranchs and related genera reveals cryptic and pseudocryptic species complexes

    KAUST Repository

    Matsuda, Shayle B.; Gosliner, Terrence M.

    2017-01-01

    Chromodorid nudibranchs (Chromodorididae) are brightly coloured sea slugs that live in some of the most biodiverse and threatened coral reefs on the planet. However, the evolutionary relationships within this family have not been well understood, especially in the genus Glossodoris. Members of Glossodoris have experienced large-scale taxonomic instability over the last century and have been the subject of repeated taxonomic changes, in part due to morphological characters being the sole traditional taxonomic sources of data. Changing concepts of traditional generic boundaries based on morphology also have contributed to this instability. Despite recent advances in molecular systematics, many aspects of chromodorid taxonomy remain poorly understood, particularly at the traditional species and generic levels. In this study, 77 individuals comprising 32 previously defined species were used to build the most robust phylogenetic tree of Glossodoris and related genera using mitochondrial genes cytochrome c oxidase subunit I and 16S, and the nuclear gene 28S. Bayesian inference, maximum likelihood, and maximum parsimony analyses verify the most recent hypothesized evolutionary relationships within Glossodoris. Additionally, a pseudocryptic and cryptic species complex within Glossodoris cincta and a pseudocryptic complex within Glossodoris pallida emerged, and three new species of Doriprismatica are identified.

  7. Distinct configurations of protein complexes and biochemical pathways revealed by epistatic interaction network motifs

    LENUS (Irish Health Repository)

    Casey, Fergal

    2011-08-22

    Abstract Background Gene and protein interactions are commonly represented as networks, with the genes or proteins comprising the nodes and the relationship between them as edges. Motifs, or small local configurations of edges and nodes that arise repeatedly, can be used to simplify the interpretation of networks. Results We examined triplet motifs in a network of quantitative epistatic genetic relationships, and found a non-random distribution of particular motif classes. Individual motif classes were found to be associated with different functional properties, suggestive of an underlying biological significance. These associations were apparent not only for motif classes, but for individual positions within the motifs. As expected, NNN (all negative) motifs were strongly associated with previously reported genetic (i.e. synthetic lethal) interactions, while PPP (all positive) motifs were associated with protein complexes. The two other motif classes (NNP: a positive interaction spanned by two negative interactions, and NPP: a negative spanned by two positives) showed very distinct functional associations, with physical interactions dominating for the former but alternative enrichments, typical of biochemical pathways, dominating for the latter. Conclusion We present a model showing how NNP motifs can be used to recognize supportive relationships between protein complexes, while NPP motifs often identify opposing or regulatory behaviour between a gene and an associated pathway. The ability to use motifs to point toward underlying biological organizational themes is likely to be increasingly important as more extensive epistasis mapping projects in higher organisms begin.

  8. Comparative analysis of carbohydrate active enzymes in Clostridium termitidis CT1112 reveals complex carbohydrate degradation ability.

    Directory of Open Access Journals (Sweden)

    Riffat I Munir

    Full Text Available Clostridium termitidis strain CT1112 is an anaerobic, gram positive, mesophilic, cellulolytic bacillus isolated from the gut of the wood-feeding termite, Nasutitermes lujae. It produces biofuels such as hydrogen and ethanol from cellulose, cellobiose, xylan, xylose, glucose, and other sugars, and therefore could be used for biofuel production from biomass through consolidated bioprocessing. The first step in the production of biofuel from biomass by microorganisms is the hydrolysis of complex carbohydrates present in biomass. This is achieved through the presence of a repertoire of secreted or complexed carbohydrate active enzymes (CAZymes, sometimes organized in an extracellular organelle called cellulosome. To assess the ability and understand the mechanism of polysaccharide hydrolysis in C. termitidis, the recently sequenced strain CT1112 of C. termitidis was analyzed for both CAZymes and cellulosomal components, and compared to other cellulolytic bacteria. A total of 355 CAZyme sequences were identified in C. termitidis, significantly higher than other Clostridial species. Of these, high numbers of glycoside hydrolases (199 and carbohydrate binding modules (95 were identified. The presence of a variety of CAZymes involved with polysaccharide utilization/degradation ability suggests hydrolysis potential for a wide range of polysaccharides. In addition, dockerin-bearing enzymes, cohesion domains and a cellulosomal gene cluster were identified, indicating the presence of potential cellulosome assembly.

  9. eQTL Networks Reveal Complex Genetic Architecture in the Immature Soybean Seed

    Directory of Open Access Journals (Sweden)

    Yung-Tsi Bolon

    2014-03-01

    Full Text Available The complex network of regulatory factors and interactions involved in transcriptional regulation within the seed is not well understood. To evaluate gene expression regulation in the immature seed, we utilized a genetical genomics approach on a soybean [ (L. Merr.] recombinant inbred line (RIL population and produced a genome-wide expression quantitative trait loci (eQTL dataset. The validity of the dataset was confirmed by mapping the eQTL hotspot for flavonoid biosynthesis-related genes to a region containing repeats of chalcone synthase (CHS genes known to correspond to the soybean inhibitor locus that regulates seed color. We then identified eQTL for genes with seed-specific expression and discovered striking eQTL hotspots at distinct genomic intervals on chromosomes (Chr 20, 7, and 13. The main eQTL hotspot for transcriptional regulation of fatty acid biosynthesis genes also coincided with regulation of oleosin genes. Transcriptional upregulation of genesets from eQTL with opposite allelic effects were also found. Gene–eQTL networks were constructed and candidate regulatory genes were identified from these three key loci specific to seed expression and enriched in genes involved in seed oil accumulation. Our data provides new insight into the complex nature of gene networks in the immature soybean seed and the genetic architecture that contributes to seed development.

  10. Molecular phylogeny of Glossodoris (Ehrenberg, 1831) nudibranchs and related genera reveals cryptic and pseudocryptic species complexes

    KAUST Repository

    Matsuda, Shayle B.

    2017-03-01

    Chromodorid nudibranchs (Chromodorididae) are brightly coloured sea slugs that live in some of the most biodiverse and threatened coral reefs on the planet. However, the evolutionary relationships within this family have not been well understood, especially in the genus Glossodoris. Members of Glossodoris have experienced large-scale taxonomic instability over the last century and have been the subject of repeated taxonomic changes, in part due to morphological characters being the sole traditional taxonomic sources of data. Changing concepts of traditional generic boundaries based on morphology also have contributed to this instability. Despite recent advances in molecular systematics, many aspects of chromodorid taxonomy remain poorly understood, particularly at the traditional species and generic levels. In this study, 77 individuals comprising 32 previously defined species were used to build the most robust phylogenetic tree of Glossodoris and related genera using mitochondrial genes cytochrome c oxidase subunit I and 16S, and the nuclear gene 28S. Bayesian inference, maximum likelihood, and maximum parsimony analyses verify the most recent hypothesized evolutionary relationships within Glossodoris. Additionally, a pseudocryptic and cryptic species complex within Glossodoris cincta and a pseudocryptic complex within Glossodoris pallida emerged, and three new species of Doriprismatica are identified.

  11. Phylogeographic analyses of the pampas cat (Leopardus colocola; Carnivora, Felidae) reveal a complex demographic history

    Science.gov (United States)

    da Silva Santos, Anelisie; Trigo, Tatiane Campos; de Oliveira, Tadeu Gomes; Silveira, Leandro

    2018-01-01

    Abstract The pampas cat is a small felid that occurs in open habitats throughout much of South America. Previous studies have revealed intriguing patterns of morphological differentiation and genetic structure among its populations, as well as molecular evidence for hybridization with the closely related L. tigrinus. Here we report phylogeographic analyses encompassing most of its distribution (focusing particularly on Brazilian specimens, which had been poorly sampled in previous studies), using a novel dataset comprising 2,143 bp of the mitogenome, along with previously reported mtDNA sequences. Our data revealed strong population strutucture and supported a west-to-east colonization process in this species’ history. We detected two population expansion events, one older (ca. 200 thousand years ago [kya]) in western South America and another more recent (ca. 60-50 kya) in eastern areas, coinciding with the expansion of savanna environments in Brazil. Analyses including L. tigrinus individuals bearing introgressed mtDNA from L. colocola showed a complete lack of shared haplotypes between species, indicating that their hybridization was ancient. Finally, we observed a close relationship between Brazilian/Uruguayan L. colocola haplotypes and those sampled in L. tigrinus, indicating that their hybridization was likely related to the demographic expansion of L. colocola into eastern South America. PMID:29668017

  12. RNA-Seq reveals complex genetic response to deepwater horizon oil release in Fundulus grandis

    Directory of Open Access Journals (Sweden)

    Garcia Tzintzuni I

    2012-09-01

    Full Text Available Abstract Background The release of oil resulting from the blowout of the Deepwater Horizon (DH drilling platform was one of the largest in history discharging more than 189 million gallons of oil and subject to widespread application of oil dispersants. This event impacted a wide range of ecological habitats with a complex mix of pollutants whose biological impact is still not yet fully understood. To better understand the effects on a vertebrate genome, we studied gene expression in the salt marsh minnow Fundulus grandis, which is local to the northern coast of the Gulf of Mexico and is a sister species of the ecotoxicological model Fundulus heteroclitus. To assess genomic changes, we quantified mRNA expression using high throughput sequencing technologies (RNA-Seq in F. grandis populations in the marshes and estuaries impacted by DH oil release. This application of RNA-Seq to a non-model, wild, and ecologically significant organism is an important evaluation of the technology to quickly assess similar events in the future. Results Our de novo assembly of RNA-Seq data produced a large set of sequences which included many duplicates and fragments. In many cases several of these could be associated with a common reference sequence using blast to query a reference database. This reduced the set of significant genes to 1,070 down-regulated and 1,251 up-regulated genes. These genes indicate a broad and complex genomic response to DH oil exposure including the expected AHR-mediated response and CYP genes. In addition a response to hypoxic conditions and an immune response are also indicated. Several genes in the choriogenin family were down-regulated in the exposed group; a response that is consistent with AH exposure. These analyses are in agreement with oligonucleotide-based microarray analyses, and describe only a subset of significant genes with aberrant regulation in the exposed set. Conclusion RNA-Seq may be successfully applied to feral and

  13. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  14. Generalised power graph compression reveals dominant relationship patterns in complex networks.

    Science.gov (United States)

    Ahnert, Sebastian E

    2014-03-25

    We introduce a framework for the discovery of dominant relationship patterns in complex networks, by compressing the networks into power graphs with overlapping power nodes. When paired with enrichment analysis of node classification terms, the most compressible sets of edges provide a highly informative sketch of the dominant relationship patterns that define the network. In addition, this procedure also gives rise to a novel, link-based definition of overlapping node communities in which nodes are defined by their relationships with sets of other nodes, rather than through connections within the community. We show that this completely general approach can be applied to undirected, directed, and bipartite networks, yielding valuable insights into the large-scale structure of real-world networks, including social networks and food webs. Our approach therefore provides a novel way in which network architecture can be studied, defined and classified.

  15. Antidiabetic phospholipid-nuclear receptor complex reveals the mechanism for phospholipid-driven gene regulation

    Energy Technology Data Exchange (ETDEWEB)

    Musille, Paul M; Pathak, Manish C; Lauer, Janelle L; Hudson, William H; Griffin, Patrick R; Ortlund, Eric A [Emory-MED; (Scripps)

    2013-01-31

    The human nuclear receptor liver receptor homolog-1 (LRH-1) has an important role in controlling lipid and cholesterol homeostasis and is a potential target for the treatment of diabetes and hepatic diseases. LRH-1 is known to bind phospholipids, but the role of phospholipids in controlling LRH-1 activation remains highly debated. Here we describe the structure of both apo LRH-1 and LRH-1 in complex with the antidiabetic phospholipid dilauroylphosphatidylcholine (DLPC). Together with hydrogen-deuterium exchange MS and functional data, our studies show that DLPC binding is a dynamic process that alters co-regulator selectivity. We show that the lipid-free receptor undergoes previously unrecognized structural fluctuations, allowing it to interact with widely expressed co-repressors. These observations enhance our understanding of LRH-1 regulation and highlight its importance as a new therapeutic target for controlling diabetes.

  16. Molecular data reveal complex hybridization and a cryptic species of neotropical wild cat.

    Science.gov (United States)

    Trigo, Tatiane C; Schneider, Alexsandra; de Oliveira, Tadeu G; Lehugeur, Livia M; Silveira, Leandro; Freitas, Thales R O; Eizirik, Eduardo

    2013-12-16

    Hybridization among animal species has recently become more recognized as an important phenomenon, especially in the context of recent radiations. Here we show that complex hybridization has led to contrasting patterns of genomic composition among closely related species of the Neotropical cat genus Leopardus. We show strong evidence of ancient hybridization and introgression between the pampas cat (L. colocolo) and northeastern populations of tigrina (L. tigrinus), leading to remarkable cytonuclear discordance in the latter. In contrast, southern tigrina populations show recent and continuing hybridization with Geoffroy's cat (L. geoffroyi), leading to extreme levels of interspecific admixture at their contact zone. Finally, we demonstrate that two seemingly continuous Brazilian tigrina populations show no evidence of ongoing gene flow between them, leading us to support their formal recognition as distinct species, namely L. tigrinus in the northeast and L. guttulus in the south. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Time irreversibility and intrinsics revealing of series with complex network approach

    Science.gov (United States)

    Xiong, Hui; Shang, Pengjian; Xia, Jianan; Wang, Jing

    2018-06-01

    In this work, we analyze time series on the basis of the visibility graph algorithm that maps the original series into a graph. By taking into account the all-round information carried by the signals, the time irreversibility and fractal behavior of series are evaluated from a complex network perspective, and considered signals are further classified from different aspects. The reliability of the proposed analysis is supported by numerical simulations on synthesized uncorrelated random noise, short-term correlated chaotic systems and long-term correlated fractal processes, and by the empirical analysis on daily closing prices of eleven worldwide stock indices. Obtained results suggest that finite size has a significant effect on the evaluation, and that there might be no direct relation between the time irreversibility and long-range correlation of series. Similarity and dissimilarity between stock indices are also indicated from respective regional and global perspectives, showing the existence of multiple features of underlying systems.

  18. A Polychaete's powerful punch: venom gland transcriptomics of Glycera reveals a complex cocktail of toxin homologs.

    Science.gov (United States)

    von Reumont, Björn M; Campbell, Lahcen I; Richter, Sandy; Hering, Lars; Sykes, Dan; Hetmank, Jörg; Jenner, Ronald A; Bleidorn, Christoph

    2014-09-05

    Glycerids are marine annelids commonly known as bloodworms. Bloodworms have an eversible proboscis adorned with jaws connected to venom glands. Bloodworms prey on invertebrates, and it is known that the venom glands produce compounds that can induce toxic effects in animals. Yet, none of these putative toxins has been characterized on a molecular basis. Here we present the transcriptomic profiles of the venom glands of three species of bloodworm, Glycera dibranchiata, Glycera fallax and Glycera tridactyla, as well as the body tissue of G. tridactyla. The venom glands express a complex mixture of transcripts coding for putative toxin precursors. These transcripts represent 20 known toxin classes that have been convergently recruited into animal venoms, as well as transcripts potentially coding for Glycera-specific toxins. The toxins represent five functional categories: Pore-forming and membrane-disrupting toxins, neurotoxins, protease inhibitors, other enzymes, and CAP domain toxins. Many of the transcripts coding for putative Glycera toxins belong to classes that have been widely recruited into venoms, but some are homologs of toxins previously only known from the venoms of scorpaeniform fish and monotremes (stonustoxin-like toxin), turrid gastropods (turripeptide-like peptides), and sea anemones (gigantoxin I-like neurotoxin). This complex mixture of toxin homologs suggests that bloodworms employ venom while predating on macroscopic prey, casting doubt on the previously widespread opinion that G. dibranchiata is a detritivore. Our results further show that researchers should be aware that different assembly methods, as well as different methods of homology prediction, can influence the transcriptomic profiling of venom glands. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    Directory of Open Access Journals (Sweden)

    Thomas Spaller

    Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  1. Protein dynamics revealed in the excitonic spectra of single LH2 complexes

    International Nuclear Information System (INIS)

    Valkunas, Leonas; Janusonis, Julius; Rutkauskas, Danielis; Grondelle, Rienk van

    2007-01-01

    The fluorescence emission spectrum of single peripheral light-harvesting (LH2) complexes of the photosynthetic purple bacterium Rhodopseudomonas acidophila exhibits remarkable dynamics on a time scale of several minutes. Often the spectral properties are quasi-stable; sometimes large spectral jumps to the blue or to the red are observed. To explain the dynamics, every pigment is proposed to be in two conformational substates with different excitation energies, which originate from the conformational state of the protein as a result of pigment-protein interaction. Due to the excitonic coupling in the ring of 18 pigments, the two-state assumption generates a substantial amount of distinct spectroscopic states, which reflect part of the inhomogeneous distributed spectral properties of LH2. To describe the observed dynamics, spontaneous and light-induced transitions are introduced between the two states. For each 'realization of the disorder', the spectral properties are calculated using a disordered exciton model combined with the modified Redfield theory to obtain realistic spectral line shapes. The single-molecule fluorescence peak (FLP) distribution, the distribution dependence on the excitation intensity, and the FLP time traces are well described within the framework of this model

  2. Crystal structure of equine serum albumin in complex with cetirizine reveals a novel drug binding site.

    Science.gov (United States)

    Handing, Katarzyna B; Shabalin, Ivan G; Szlachta, Karol; Majorek, Karolina A; Minor, Wladek

    2016-03-01

    Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1Å. Cetirizine is bound in two sites--a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizine binding sites. We show that the residues forming the binding pockets in ESA are highly conserved in human serum albumin (HSA), and suggest that binding of cetirizine to HSA will be similar. In support of that hypothesis, we show that the dissociation constants for cetirizine binding to CBS2 in ESA and HSA are identical using tryptophan fluorescence quenching. Presence of lysine and arginine residues that have been previously reported to undergo nonenzymatic glycosylation in CBS1 and CBS2 suggests that cetirizine transport in patients with diabetes could be altered. A review of all available SA structures from the PDB shows that in addition to the novel drug binding site we present here (CBS1), there are two pockets on SA capable of binding drugs that do not overlap with fatty acid binding sites and have not been discussed in published reviews. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Revealing complex function, process and pathway interactions with high-throughput expression and biological annotation data.

    Science.gov (United States)

    Singh, Nitesh Kumar; Ernst, Mathias; Liebscher, Volkmar; Fuellen, Georg; Taher, Leila

    2016-10-20

    The biological relationships both between and within the functions, processes and pathways that operate within complex biological systems are only poorly characterized, making the interpretation of large scale gene expression datasets extremely challenging. Here, we present an approach that integrates gene expression and biological annotation data to identify and describe the interactions between biological functions, processes and pathways that govern a phenotype of interest. The product is a global, interconnected network, not of genes but of functions, processes and pathways, that represents the biological relationships within the system. We validated our approach on two high-throughput expression datasets describing organismal and organ development. Our findings are well supported by the available literature, confirming that developmental processes and apoptosis play key roles in cell differentiation. Furthermore, our results suggest that processes related to pluripotency and lineage commitment, which are known to be critical for development, interact mainly indirectly, through genes implicated in more general biological processes. Moreover, we provide evidence that supports the relevance of cell spatial organization in the developing liver for proper liver function. Our strategy can be viewed as an abstraction that is useful to interpret high-throughput data and devise further experiments.

  4. Nonexplicit change detection in complex dynamic settings: what eye movements reveal.

    Science.gov (United States)

    Vachon, François; Vallières, Benoît R; Jones, Dylan M; Tremblay, Sébastien

    2012-12-01

    We employed a computer-controlled command-and-control (C2) simulation and recorded eye movements to examine the extent and nature of the inability to detect critical changes in dynamic displays when change detection is implicit (i.e., requires no explicit report) to the operator's task. Change blindness-the failure to notice significant changes to a visual scene-may have dire consequences on performance in C2 and surveillance operations. Participants performed a radar-based risk-assessment task involving multiple subtasks. Although participants were not required to explicitly report critical changes to the operational display, change detection was critical in informing decision making. Participants' eye movements were used as an index of visual attention across the display. Nonfixated (i.e., unattended) changes were more likely to be missed than were fixated (i.e., attended) changes, supporting the idea that focused attention is necessary for conscious change detection. The finding of significant pupil dilation for changes undetected but fixated suggests that attended changes can nonetheless be missed because of a failure of attentional processes. Change blindness in complex dynamic displays takes the form of failures in establishing task-appropriate patterns of attentional allocation. These findings have implications in the design of change-detection support tools for dynamic displays and work procedure in C2 and surveillance.

  5. New levels of language processing complexity and organization revealed by Granger causation

    Directory of Open Access Journals (Sweden)

    David W Gow

    2012-11-01

    Full Text Available Granger causation analysis of high spatiotemporal resolution reconstructions of brain activation offers a new window on the dynamic interactions between brain areas that support language processing. Premised on the observation that causes both precede and uniquely predict their effects, this approach provides an intuitive, model-free means of identifying directed causal interactions in the brain. It requires the analysis of all nonredundant potentially interacting signals, and has shown that even early processes such as speech perception involve interactions of many areas in a strikingly large network that extends well beyond traditional left hemisphere perisylvian cortex that play out over hundreds of milliseconds. In this paper we describe this technique and review several general findings that reframe the way we think about language processing and brain function in general. These include the extent and complexity of language processing networks, the central role of interactive processing dynamics, the role of processing hubs where the input from many distinct brain regions are integrated, and the degree to which task requirements and stimulus properties influence processing dynamics and inform our understanding of language-specific localized processes.

  6. An atlas of the thioredoxin fold class reveals the complexity of function-enabling adaptations.

    Science.gov (United States)

    Atkinson, Holly J; Babbitt, Patricia C

    2009-10-01

    The group of proteins that contain a thioredoxin (Trx) fold is huge and diverse. Assessment of the variation in catalytic machinery of Trx fold proteins is essential in providing a foundation for understanding their functional diversity and predicting the function of the many uncharacterized members of the class. The proteins of the Trx fold class retain common features-including variations on a dithiol CxxC active site motif-that lead to delivery of function. We use protein similarity networks to guide an analysis of how structural and sequence motifs track with catalytic function and taxonomic categories for 4,082 representative sequences spanning the known superfamilies of the Trx fold. Domain structure in the fold class is varied and modular, with 2.8% of sequences containing more than one Trx fold domain. Most member proteins are bacterial. The fold class exhibits many modifications to the CxxC active site motif-only 56.8% of proteins have both cysteines, and no functional groupings have absolute conservation of the expected catalytic motif. Only a small fraction of Trx fold sequences have been functionally characterized. This work provides a global view of the complex distribution of domains and catalytic machinery throughout the fold class, showing that each superfamily contains remnants of the CxxC active site. The unifying context provided by this work can guide the comparison of members of different Trx fold superfamilies to gain insight about their structure-function relationships, illustrated here with the thioredoxins and peroxiredoxins.

  7. Complex biogeographic scenarios revealed in the diversification of the largest woodpecker radiation in the New World.

    Science.gov (United States)

    Navarro-Sigüenza, Adolfo G; Vázquez-Miranda, Hernán; Hernández-Alonso, Germán; García-Trejo, Erick A; Sánchez-González, Luis A

    2017-07-01

    Phylogenetic relationships and patterns of evolution within Melanerpes, one of the most diverse groups of New World woodpeckers (22-23 lineages), have been complicated due to complex plumages and morphological adaptations. In an attempt to resolve these issues, we obtained sequence data from four nuclear introns and two mitochondrial protein-coding genes for 22 of the 24 currently recognized species in the genus. We performed phylogenetic analyses involving Maximum Likelihood and Bayesian Inference, species-tree divergence dating, and biogeographic reconstructions. Tree topologies from the concatenated and species-tree analyses of the mtDNA and nDNA showed broadly similar patterns, with three relatively well-supported groups apparent: (a) the Sphyrapicus clade (four species); (b) the typical Melanerpes clade, which includes temperate and subtropical dry forest black-backed species; and (c) the mostly barred-backed species, here referred to as the "Centurus" clade. The phylogenetic position of Melanerpes superciliaris regarding the rest of Melanerpes is ambiguous as it is recovered as sister to the rest of Melanerpes or as sister to a group including Sphyrapicus+Melanerpes. Our species tree estimations recovered the same well-delimited highly-supported clades. Geographic range evolution (estimated in BioGeoBEARS) was best explained by a DIVALIKE+j model, which includes vicariance, founder effect speciation, and anagenetic dispersal (range expansion) as important processes involved in the diversification of the largest radiation of woodpeckers in the New World. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Complex cytogeographical patterns reveal a dynamic tetraploid–octoploid contact zone

    Science.gov (United States)

    Castro, Mariana; Castro, Sílvia; Figueiredo, Albano; Husband, Brian; Loureiro, João

    2018-01-01

    Abstract The distribution of cytotypes in mixed-ploidy species is crucial for evaluating ecological processes involved in the establishment and evolution of polyploid taxa. Here, we use flow cytometry and chromosome counts to explore cytotype diversity and distributions within a tetraploid–octoploid contact zone. We then use niche modelling and ploidy seed screening to assess the roles of niche differentiation among cytotypes and reproductive interactions, respectively, in promoting cytotype coexistence. Two cytotypes, tetraploids and octoploids, were dominant within the contact zone. They were most often distributed parapatrically or allopatrically, resulting in high geographic isolation. Still, 16.7 % of localities comprised two or more cytotypes, including the intermediate hexaploid cytotype. Tetraploids and octoploids had high environmental niche overlap and associated with similar climatic environments, suggesting they have similar ecological requirements. Given the geographical separation and habitat similarity among cytotypes, mixed-ploidy populations may be transitional and subject to the forces of minority cytotype exclusion which lead to pure-ploidy populations. However, seed ploidy analysis suggests that strong reproductive barriers may enforce assortative mating which favours stable cytotype coexistence. High cytogenetic diversity detected in the field suggests that unreduced gamete formation and hybridization events seem frequent in the studied polyploid complex and might be involved with the recurrent polyploid formation, governing, as well, the gene flow between cytogenetic entities. PMID:29593853

  9. Single-particle fusion of influenza viruses reveals complex interactions with target membranes

    Science.gov (United States)

    van der Borg, Guus; Braddock, Scarlett; Blijleven, Jelle S.; van Oijen, Antoine M.; Roos, Wouter H.

    2018-05-01

    The first step in infection of influenza A virus is contact with the host cell membrane, with which it later fuses. The composition of the target bilayer exerts a complex influence on both fusion efficiency and time. Here, an in vitro, single-particle approach is used to study this effect. Using total internal reflection fluorescence (TIRF) microscopy and a microfluidic flow cell, the hemifusion of single virions is visualized. Hemifusion efficiency and kinetics are studied while altering target bilayer cholesterol content and sialic-acid donor. Cholesterol ratios tested were 0%, 10%, 20%, and 40%. Sialic-acid donors GD1a and GYPA were used. Both cholesterol ratio and sialic-acid donors proved to have a significant effect on hemifusion efficiency. Furthermore, comparison between GD1a and GYPA conditions shows that the cholesterol dependence of the hemifusion time is severely affected by the sialic-acid donor. Only GD1a shows a clear increasing trend in hemifusion efficiency and time with increasing cholesterol concentration of the target bilayer with maximum rates for GD1A and 40% cholesterol. Overall our results show that sialic acid donor and target bilayer composition should be carefully chosen, depending on the desired hemifusion time and efficiency in the experiment.

  10. New levels of language processing complexity and organization revealed by granger causation.

    Science.gov (United States)

    Gow, David W; Caplan, David N

    2012-01-01

    Granger causation analysis of high spatiotemporal resolution reconstructions of brain activation offers a new window on the dynamic interactions between brain areas that support language processing. Premised on the observation that causes both precede and uniquely predict their effects, this approach provides an intuitive, model-free means of identifying directed causal interactions in the brain. It requires the analysis of all non-redundant potentially interacting signals, and has shown that even "early" processes such as speech perception involve interactions of many areas in a strikingly large network that extends well beyond traditional left hemisphere perisylvian cortex that play out over hundreds of milliseconds. In this paper we describe this technique and review several general findings that reframe the way we think about language processing and brain function in general. These include the extent and complexity of language processing networks, the central role of interactive processing dynamics, the role of processing hubs where the input from many distinct brain regions are integrated, and the degree to which task requirements and stimulus properties influence processing dynamics and inform our understanding of "language-specific" localized processes.

  11. Dynamic Modelling Reveals 'Hotspots' on the Pathway to Enzyme-Substrate Complex Formation.

    Directory of Open Access Journals (Sweden)

    Shane E Gordon

    2016-03-01

    Full Text Available Dihydrodipicolinate synthase (DHDPS catalyzes the first committed step in the diaminopimelate pathway of bacteria, yielding amino acids required for cell wall and protein biosyntheses. The essentiality of the enzyme to bacteria, coupled with its absence in humans, validates DHDPS as an antibacterial drug target. Conventional drug design efforts have thus far been unsuccessful in identifying potent DHDPS inhibitors. Here, we make use of contemporary molecular dynamics simulation and Markov state models to explore the interactions between DHDPS from the human pathogen Staphylococcus aureus and its cognate substrate, pyruvate. Our simulations recover the crystallographic DHDPS-pyruvate complex without a priori knowledge of the final bound structure. The highly conserved residue Arg140 was found to have a pivotal role in coordinating the entry of pyruvate into the active site from bulk solvent, consistent with previous kinetic reports, indicating an indirect role for the residue in DHDPS catalysis. A metastable binding intermediate characterized by multiple points of intermolecular interaction between pyruvate and key DHDPS residue Arg140 was found to be a highly conserved feature of the binding trajectory when comparing alternative binding pathways. By means of umbrella sampling we show that these binding intermediates are thermodynamically metastable, consistent with both the available experimental data and the substrate binding model presented in this study. Our results provide insight into an important enzyme-substrate interaction in atomistic detail that offers the potential to be exploited for the discovery of more effective DHDPS inhibitors and, in a broader sense, dynamic protein-drug interactions.

  12. Complex surface deformation of Akutan volcano, Alaska revealed from InSAR time series

    Science.gov (United States)

    Wang, Teng; DeGrandpre, Kimberly; Lu, Zhong; Freymueller, Jeffrey T.

    2018-02-01

    Akutan volcano is one of the most active volcanoes in the Aleutian arc. An intense swarm of volcano-tectonic earthquakes occurred across the island in 1996. Surface deformation after the 1996 earthquake sequence has been studied using Interferometric Synthetic Aperture Radar (InSAR), yet it is hard to determine the detailed temporal behavior and spatial extent of the deformation due to decorrelation and the sparse temporal sampling of SAR data. Atmospheric delay anomalies over Akutan volcano are also strong, bringing additional technical challenges. Here we present a time series InSAR analysis from 2003 to 2016 to reveal the surface deformation in more detail. Four tracks of Envisat data acquired from 2003 to 2010 and one track of TerraSAR-X data acquired from 2010 to 2016 are processed to produce high-resolution surface deformation, with a focus on studying two transient episodes of inflation in 2008 and 2014. For the TerraSAR-X data, the atmospheric delay is estimated and removed using the common-master stacking method. These derived deformation maps show a consistently uplifting area on the northeastern flank of the volcano. From the TerraSAR-X data, we quantify the velocity of the subsidence inside the caldera to be as high as 10 mm/year, and identify another subsidence area near the ground cracks created during the 1996 swarm.

  13. Neolithic and Medieval virus genomes reveal complex evolution of Hepatitis B.

    Science.gov (United States)

    Krause-Kyora, Ben; Susat, Julian; Key, Felix M; Kühnert, Denise; Bosse, Esther; Immel, Alexander; Rinne, Christoph; Kornell, Sabin-Christin; Yepes, Diego; Franzenburg, Sören; Heyne, Henrike O; Meier, Thomas; Lösch, Sandra; Meller, Harald; Friederich, Susanne; Nicklisch, Nicole; Alt, Kurt W; Schreiber, Stefan; Tholey, Andreas; Herbig, Alexander; Nebel, Almut; Krause, Johannes

    2018-05-10

    The hepatitis B virus (HBV) is one of the most widespread human pathogens known today, yet its origin and evolutionary history are still unclear and controversial. Here, we report the analysis of three ancient HBV genomes recovered from human skeletons found at three different archaeological sites in Germany. We reconstructed two Neolithic and one medieval HBV genomes by de novo assembly from shotgun DNA sequencing data. Additionally, we observed HBV-specific peptides using paleo-proteomics. Our results show that HBV circulates in the European population for at least 7000 years. The Neolithic HBV genomes show a high genomic similarity to each other. In a phylogenetic network, they do not group with any human-associated HBV genome and are most closely related to those infecting African non-human primates. These ancient virus forms appear to represent distinct lineages that have no close relatives today and possibly went extinct. Our results reveal the great potential of ancient DNA from human skeletons in order to study the long-time evolution of blood borne viruses. © 2018, Krause-Kyora et al.

  14. Simulation of Deepwater Horizon oil plume reveals substrate specialization within a complex community of hydrocarbon degraders.

    Science.gov (United States)

    Hu, Ping; Dubinsky, Eric A; Probst, Alexander J; Wang, Jian; Sieber, Christian M K; Tom, Lauren M; Gardinali, Piero R; Banfield, Jillian F; Atlas, Ronald M; Andersen, Gary L

    2017-07-11

    The Deepwater Horizon (DWH) accident released an estimated 4.1 million barrels of oil and 10 10 mol of natural gas into the Gulf of Mexico, forming deep-sea plumes of dispersed oil droplets and dissolved gases that were largely degraded by bacteria. During the course of this 3-mo disaster a series of different bacterial taxa were enriched in succession within deep plumes, but the metabolic capabilities of the different populations that controlled degradation rates of crude oil components are poorly understood. We experimentally reproduced dispersed plumes of fine oil droplets in Gulf of Mexico seawater and successfully replicated the enrichment and succession of the principal oil-degrading bacteria observed during the DWH event. We recovered near-complete genomes, whose phylogeny matched those of the principal biodegrading taxa observed in the field, including the DWH Oceanospirillales (now identified as a Bermanella species), multiple species of Colwellia , Cycloclasticus , and other members of Gammaproteobacteria, Flavobacteria, and Rhodobacteria. Metabolic pathway analysis, combined with hydrocarbon compositional analysis and species abundance data, revealed substrate specialization that explained the successional pattern of oil-degrading bacteria. The fastest-growing bacteria used short-chain alkanes. The analyses also uncovered potential cooperative and competitive relationships, even among close relatives. We conclude that patterns of microbial succession following deep ocean hydrocarbon blowouts are predictable and primarily driven by the availability of liquid petroleum hydrocarbons rather than natural gases.

  15. Complexity of CNC transcription factors as revealed by gene targeting of the Nrf3 locus.

    Science.gov (United States)

    Derjuga, Anna; Gourley, Tania S; Holm, Teresa M; Heng, Henry H Q; Shivdasani, Ramesh A; Ahmed, Rafi; Andrews, Nancy C; Blank, Volker

    2004-04-01

    Cap'n'collar (CNC) family basic leucine zipper transcription factors play crucial roles in the regulation of mammalian gene expression and development. To determine the in vivo function of the CNC protein Nrf3 (NF-E2-related factor 3), we generated mice deficient in this transcription factor. We performed targeted disruption of two Nrf3 exons coding for CNC homology, basic DNA-binding, and leucine zipper dimerization domains. Nrf3 null mice developed normally and revealed no obvious phenotypic differences compared to wild-type animals. Nrf3(-/-) mice were fertile, and gross anatomy as well as behavior appeared normal. The mice showed normal age progression and did not show any apparent additional phenotype during their life span. We observed no differences in various blood parameters and chemistry values. We infected wild-type and Nrf3(-/-) mice with acute lymphocytic choriomeningitis virus and found no differences in these animals with respect to their number of virus-specific CD8 and CD4 T cells as well as their B-lymphocyte response. To determine whether the mild phenotype of Nrf3 null animals is due to functional redundancy, we generated mice deficient in multiple CNC factors. Contrary to our expectations, an absence of Nrf3 does not seem to cause additional lethality in compound Nrf3(-/-)/Nrf2(-/-) and Nrf3(-/-)/p45(-/-) mice. We hypothesize that the role of Nrf3 in vivo may become apparent only after appropriate challenge to the mice.

  16. Latent physiological factors of complex human diseases revealed by independent component analysis of clinarrays

    Directory of Open Access Journals (Sweden)

    Chen David P

    2010-10-01

    Full Text Available Abstract Background Diagnosis and treatment of patients in the clinical setting is often driven by known symptomatic factors that distinguish one particular condition from another. Treatment based on noticeable symptoms, however, is limited to the types of clinical biomarkers collected, and is prone to overlooking dysfunctions in physiological factors not easily evident to medical practitioners. We used a vector-based representation of patient clinical biomarkers, or clinarrays, to search for latent physiological factors that underlie human diseases directly from clinical laboratory data. Knowledge of these factors could be used to improve assessment of disease severity and help to refine strategies for diagnosis and monitoring disease progression. Results Applying Independent Component Analysis on clinarrays built from patient laboratory measurements revealed both known and novel concomitant physiological factors for asthma, types 1 and 2 diabetes, cystic fibrosis, and Duchenne muscular dystrophy. Serum sodium was found to be the most significant factor for both type 1 and type 2 diabetes, and was also significant in asthma. TSH3, a measure of thyroid function, and blood urea nitrogen, indicative of kidney function, were factors unique to type 1 diabetes respective to type 2 diabetes. Platelet count was significant across all the diseases analyzed. Conclusions The results demonstrate that large-scale analyses of clinical biomarkers using unsupervised methods can offer novel insights into the pathophysiological basis of human disease, and suggest novel clinical utility of established laboratory measurements.

  17. System-wide analysis reveals a complex network of tumor-fibroblast interactions involved in tumorigenicity.

    Directory of Open Access Journals (Sweden)

    Megha Rajaram

    Full Text Available Many fibroblast-secreted proteins promote tumorigenicity, and several factors secreted by cancer cells have in turn been proposed to induce these proteins. It is not clear whether there are single dominant pathways underlying these interactions or whether they involve multiple pathways acting in parallel. Here, we identified 42 fibroblast-secreted factors induced by breast cancer cells using comparative genomic analysis. To determine what fraction was active in promoting tumorigenicity, we chose five representative fibroblast-secreted factors for in vivo analysis. We found that the majority (three out of five played equally major roles in promoting tumorigenicity, and intriguingly, each one had distinct effects on the tumor microenvironment. Specifically, fibroblast-secreted amphiregulin promoted breast cancer cell survival, whereas the chemokine CCL7 stimulated tumor cell proliferation while CCL2 promoted innate immune cell infiltration and angiogenesis. The other two factors tested had minor (CCL8 or minimally (STC1 significant effects on the ability of fibroblasts to promote tumor growth. The importance of parallel interactions between fibroblasts and cancer cells was tested by simultaneously targeting fibroblast-secreted amphiregulin and the CCL7 receptor on cancer cells, and this was significantly more efficacious than blocking either pathway alone. We further explored the concept of parallel interactions by testing the extent to which induction of critical fibroblast-secreted proteins could be achieved by single, previously identified, factors produced by breast cancer cells. We found that although single factors could induce a subset of genes, even combinations of factors failed to induce the full repertoire of functionally important fibroblast-secreted proteins. Together, these results delineate a complex network of tumor-fibroblast interactions that act in parallel to promote tumorigenicity and suggest that effective anti

  18. In Situ Tagged nsp15 Reveals Interactions with Coronavirus Replication/Transcription Complex-Associated Proteins

    Directory of Open Access Journals (Sweden)

    Jeremiah Athmer

    2017-01-01

    Full Text Available Coronavirus (CoV replication and transcription are carried out in close proximity to restructured endoplasmic reticulum (ER membranes in replication/transcription complexes (RTC. Many of the CoV nonstructural proteins (nsps are required for RTC function; however, not all of their functions are known. nsp15 contains an endoribonuclease domain that is conserved in the CoV family. While the enzymatic activity and crystal structure of nsp15 are well defined, its role in replication remains elusive. nsp15 localizes to sites of RNA replication, but whether it acts independently or requires additional interactions for its function remains unknown. To begin to address these questions, we created an in situ tagged form of nsp15 using the prototypic CoV, mouse hepatitis virus (MHV. In MHV, nsp15 contains the genomic RNA packaging signal (P/S, a 95-bp RNA stem-loop structure that is not required for viral replication or nsp15 function. Utilizing this knowledge, we constructed an internal hemagglutinin (HA tag that replaced the P/S. We found that nsp15-HA was localized to discrete perinuclear puncta and strongly colocalized with nsp8 and nsp12, both well-defined members of the RTC, but not the membrane (M protein, involved in virus assembly. Finally, we found that nsp15 interacted with RTC-associated proteins nsp8 and nsp12 during infection, and this interaction was RNA independent. From this, we conclude that nsp15 localizes and interacts with CoV proteins in the RTC, suggesting it plays a direct or indirect role in virus replication. Furthermore, the use of in situ epitope tags could be used to determine novel nsp-nsp interactions in coronaviruses.

  19. An atlas of the thioredoxin fold class reveals the complexity of function-enabling adaptations.

    Directory of Open Access Journals (Sweden)

    Holly J Atkinson

    2009-10-01

    Full Text Available The group of proteins that contain a thioredoxin (Trx fold is huge and diverse. Assessment of the variation in catalytic machinery of Trx fold proteins is essential in providing a foundation for understanding their functional diversity and predicting the function of the many uncharacterized members of the class. The proteins of the Trx fold class retain common features-including variations on a dithiol CxxC active site motif-that lead to delivery of function. We use protein similarity networks to guide an analysis of how structural and sequence motifs track with catalytic function and taxonomic categories for 4,082 representative sequences spanning the known superfamilies of the Trx fold. Domain structure in the fold class is varied and modular, with 2.8% of sequences containing more than one Trx fold domain. Most member proteins are bacterial. The fold class exhibits many modifications to the CxxC active site motif-only 56.8% of proteins have both cysteines, and no functional groupings have absolute conservation of the expected catalytic motif. Only a small fraction of Trx fold sequences have been functionally characterized. This work provides a global view of the complex distribution of domains and catalytic machinery throughout the fold class, showing that each superfamily contains remnants of the CxxC active site. The unifying context provided by this work can guide the comparison of members of different Trx fold superfamilies to gain insight about their structure-function relationships, illustrated here with the thioredoxins and peroxiredoxins.

  20. Long-term changes in abundances of Sonoran Desert lizards reveal complex responses to climatic variation.

    Science.gov (United States)

    Flesch, Aaron D; Rosen, Philip C; Holm, Peter

    2017-12-01

    Understanding how climatic variation affects animal populations and communities is essential for addressing threats posed by climate change, especially in systems where impacts are projected to be high. We evaluated abundance dynamics of five common species of diurnal lizards over 25 years in a Sonoran Desert transition zone where precipitation decreased and temperature increased across time, and assessed hypotheses for the influence of climatic flux on spatiotemporal variation in abundances. We repeatedly surveyed lizards in spring and summer of each year at up to 32 sites, and used hierarchical mixture models to estimate detection probabilities, abundances, and population growth rates. Among terrestrial species, abundances of a short-lived, winter-spring breeder increased markedly by an estimated 237%-285% across time, while two larger spring-summer breeders with higher thermal preferences declined by up to 64%. Abundances of two arboreal species that occupy shaded and thus sheltered microhabitats fluctuated but did not decline systematically. Abundances of all species increased with precipitation at short lag times (1-1.5 years) likely due to enhanced food availability, but often declined after periods of high precipitation at longer lag times (2-4 years) likely due to predation and other biotic pressures. Although rising maximum daily temperatures (T max ) are expected to drive global declines of lizards, associations with T max were variable and weak for most species. Instead, abundances of all species declined with rising daily minimum temperatures, suggesting degradation of cool refugia imposed widespread metabolic or other costs. Our results suggest climate warming and drying are having major impacts on lizard communities by driving declines in species with traits that augment exposure to abiotic extremes and by modifying species interactions. The complexity of patterns we report indicates that evaluating and responding to the influence of climate change

  1. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  2. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  3. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  4. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  5. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  6. Structure of a yeast 40S-eIF1-eIF1A-eIF3-eIF3j initiation complex.

    Science.gov (United States)

    Aylett, Christopher H S; Boehringer, Daniel; Erzberger, Jan P; Schaefer, Tanja; Ban, Nenad

    2015-03-01

    Eukaryotic translation initiation requires cooperative assembly of a large protein complex at the 40S ribosomal subunit. We have resolved a budding yeast initiation complex by cryo-EM, allowing placement of prior structures of eIF1, eIF1A, eIF3a, eIF3b and eIF3c. Our structure highlights differences in initiation-complex binding to the ribosome compared to that of mammalian eIF3, demonstrates a direct contact between eIF3j and eIF1A and reveals the network of interactions between eIF3 subunits.

  7. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  8. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  9. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  10. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  11. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  12. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  13. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  14. Tracking Glideosome-associated protein 50 reveals the development and organization of the inner membrane complex of Plasmodium falciparum.

    Science.gov (United States)

    Yeoman, Jeffrey A; Hanssen, Eric; Maier, Alexander G; Klonis, Nectarios; Maco, Bohumil; Baum, Jake; Turnbull, Lynne; Whitchurch, Cynthia B; Dixon, Matthew W A; Tilley, Leann

    2011-04-01

    The most deadly of the human malaria parasites, Plasmodium falciparum, has different stages specialized for invasion of hepatocytes, erythrocytes, and the mosquito gut wall. In each case, host cell invasion is powered by an actin-myosin motor complex that is linked to an inner membrane complex (IMC) via a membrane anchor called the glideosome-associated protein 50 (PfGAP50). We generated P. falciparum transfectants expressing green fluorescent protein (GFP) chimeras of PfGAP50 (PfGAP50-GFP). Using immunoprecipitation and fluorescence photobleaching, we show that C-terminally tagged PfGAP50-GFP can form a complex with endogenous copies of the linker protein PfGAP45 and the myosin A tail domain-interacting protein (MTIP). Full-length PfGAP50-GFP is located in the endoplasmic reticulum in early-stage parasites and then redistributes to apical caps during the formation of daughter merozoites. In the final stage of schizogony, the PfGAP50-GFP profile extends further around the merozoite surface. Three-dimensional (3D) structured illumination microscopy reveals the early-stage IMC as a doubly punctured flat ellipsoid that separates to form claw-shaped apposed structures. A GFP fusion of PfGAP50 lacking the C-terminal membrane anchor is misdirected to the parasitophorous vacuole. Replacement of the acid phosphatase homology domain of PfGAP50 with GFP appears to allow correct trafficking of the chimera but confers a growth disadvantage.

  15. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  16. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  17. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  18. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  19. Structure of the Human FANCL RING-Ube2T Complex Reveals Determinants of Cognate E3-E2 Selection

    Science.gov (United States)

    Hodson, Charlotte; Purkiss, Andrew; Miles, Jennifer Anne; Walden, Helen

    2014-01-01

    Summary The combination of an E2 ubiquitin-conjugating enzyme with an E3 ubiquitin-ligase is essential for ubiquitin modification of a substrate. Moreover, the pairing dictates both the substrate choice and the modification type. The molecular details of generic E3-E2 interactions are well established. Nevertheless, the determinants of selective, specific E3-E2 recognition are not understood. There are ∼40 E2s and ∼600 E3s giving rise to a possible ∼24,000 E3-E2 pairs. Using the Fanconi Anemia pathway exclusive E3-E2 pair, FANCL-Ube2T, we report the atomic structure of the FANCL RING-Ube2T complex, revealing a specific and extensive network of additional electrostatic and hydrophobic interactions. Furthermore, we show that these specific interactions are required for selection of Ube2T over other E2s by FANCL. PMID:24389026

  20. Conformational Complexity in the LH2 Antenna of the Purple Sulfur Bacterium Allochromatium vinosum Revealed by Hole-Burning Spectroscopy.

    Science.gov (United States)

    Kell, Adam; Jassas, Mahboobe; Acharya, Khem; Hacking, Kirsty; Cogdell, Richard J; Jankowiak, Ryszard

    2017-06-15

    This work discusses the protein conformational complexity of the B800-850 LH2 complexes from the purple sulfur bacterium Allochromatium vinosum, focusing on the spectral characteristics of the B850 chromophores. Low-temperature B850 absorption and the split B800 band shift blue and red, respectively, at elevated temperatures, revealing isosbestic points. The latter indicates the presence of two (unresolved) conformations of B850 bacteriochlorophylls (BChls), referred to as conformations 1 and 2, and two conformations of B800 BChls, denoted as B800 R and B800 B . The energy differences between average site energies of conformations 1 and 2, and B800 R and B800 B are similar (∼200 cm -1 ), suggesting weak and strong hydrogen bonds linking two major subpopulations of BChls and the protein scaffolding. Although conformations 1 and 2 of the B850 chromophores, and B800 R and B800 B , exist in the ground state, selective excitation leads to 1 → 2 and B800 R → B800 B phototransformations. Different static inhomogeneous broadening is revealed for the lowest energy exciton states of B850 (fwhm ∼195 cm -1 ) and B800 R (fwhm ∼140 cm -1 ). To describe the 5 K absorption spectrum and the above-mentioned conformations, we employ an exciton model with dichotomous protein conformation disorder. We show that both experimental data and the modeling study support a two-site model with strongly and weakly hydrogen-bonded B850 and B800 BChls, which under illumination undergo conformational changes, most likely caused by proton dynamics.

  1. A holistic approach to dissecting SPARC family protein complexity reveals FSTL-1 as an inhibitor of pancreatic cancer cell growth.

    Science.gov (United States)

    Viloria, Katrina; Munasinghe, Amanda; Asher, Sharan; Bogyere, Roberto; Jones, Lucy; Hill, Natasha J

    2016-11-25

    SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory interactions suggests the importance of a holistic approach to their study. We show that Hevin, SPOCKs, and SMOCs are strongly expressed within islets, ducts, and blood vessels, suggesting important roles for these proteins in the normal pancreas, while FSTL-1 expression is localised to the stromal compartment reminiscent of SPARC. In direct contrast to SPARC, however, FSTL-1 expression is reduced in pancreatic cancer. Consistent with this, FSTL-1 inhibited pancreatic cancer cell proliferation. The complexity of SPARC family proteins is further revealed by the detection of multiple cell-type specific isoforms that arise due to a combination of post-translational modification and alternative splicing. Identification of splice variants lacking a signal peptide suggests the existence of novel intracellular isoforms. This study underlines the importance of addressing the complexity of the SPARC family and provides a new framework to explain their controversial and contradictory effects. We also demonstrate for the first time that FSTL-1 suppresses pancreatic cancer cell growth.

  2. Crystal Structure of the FGFR4/LY2874455 Complex Reveals Insights into the Pan-FGFR Selectivity of LY2874455.

    Science.gov (United States)

    Wu, Daichao; Guo, Ming; Philips, Michael A; Qu, Lingzhi; Jiang, Longying; Li, Jun; Chen, Xiaojuan; Chen, Zhuchu; Chen, Lin; Chen, Yongheng

    2016-01-01

    Aberrant FGFR4 signaling has been documented abundantly in various human cancers. The majority of FGFR inhibitors display significantly reduced potency toward FGFR4 compared to FGFR1-3. However, LY2874455 has similar inhibition potency for FGFR1-4 with IC50 less than 6.4 nM. To date, there is no published crystal structure of LY2874455 in complex with any kinase. To better understand the pan-FGFR selectivity of LY2874455, we have determined the crystal structure of the FGFR4 kinase domain bound to LY2874455 at a resolution of 2.35 Å. LY2874455, a type I inhibitor for FGFR4, binds to the ATP-binding pocket of FGFR4 in a DFG-in active conformation with three hydrogen bonds and a number of van der Waals contacts. After alignment of the kinase domain sequence of 4 FGFRs, and superposition of the ATP binding pocket of 4 FGFRs, our structural analyses reveal that the interactions of LY2874455 to FGFR4 are largely conserved in 4 FGFRs, explaining at least partly, the broad inhibitory activity of LY2874455 toward 4 FGFRs. Consequently, our studies reveal new insights into the pan-FGFR selectivity of LY2874455 and provide a structural basis for developing novel FGFR inhibitors that target FGFR1-4 broadly.

  3. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis

    2008-07-01

    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  4. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  5. Complex within a Complex: Integrative Taxonomy Reveals Hidden Diversity in Cicadetta brevipennis (Hemiptera: Cicadidae) and Unexpected Relationships with a Song Divergent Relative

    Science.gov (United States)

    Hertach, Thomas; Puissant, Stéphane; Gogala, Matija; Trilar, Tomi; Hagmann, Reto; Baur, Hannes; Kunz, Gernot; Wade, Elizabeth J.; Loader, Simon P.; Simon, Chris; Nagel, Peter

    2016-01-01

    Multiple sources of data in combination are essential for species delimitation and classification of difficult taxonomic groups. Here we investigate a cicada taxon with unusual cryptic diversity and we attempt to resolve seemingly contradictory data sets. Cicada songs act as species-specific premating barriers and have been used extensively to reveal hidden taxonomic diversity in morphologically similar species. The Palaearctic Cicadetta montana species complex is an excellent example where distinct song patterns have disclosed multiple recently described species. Indeed, two taxa turned out to be especially diverse in that they form a “complex within the complex”: the Cicadetta cerdaniensis song group (four species studied previously) and Cicadetta brevipennis (examined in details here). Based on acoustic, morphological, molecular, ecological and spatial data sampled throughout their broad European distribution, we find that Cicadetta brevipennis s. l. comprises five lineages. The most distinct lineage is identified as Cicadetta petryi Schumacher, 1924, which we re-assign to the species level. Cicadetta brevipennis litoralis Puissant & Hertach ssp. n. and Cicadetta brevipennis hippolaidica Hertach ssp. n. are new to science. The latter hybridizes with Cicadetta brevipennis brevipennis Fieber, 1876 at a zone inferred from intermediate song patterns. The fifth lineage requires additional investigation. The C. cerdaniensis and the C. brevipennis song groups exhibit characteristic, clearly distinct basic song patterns that act as reproductive barriers. However, they remain completely intermixed in the Bayesian and maximum likelihood COI and COII mitochondrial DNA phylogenies. The closest relative of each of the four cerdaniensis group species is a brevipennis group taxon. In our favoured scenario the phylogenetic pairs originated in common Pleistocene glacial refuges where the taxa speciated and experienced sporadic inter-group hybridization leading to extensive

  6. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  7. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  8. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    OpenAIRE

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  11. Whole exome sequencing in 342 congenital cardiac left sided lesion cases reveals extensive genetic heterogeneity and complex inheritance patterns

    Directory of Open Access Journals (Sweden)

    Alexander H. Li

    2017-10-01

    Full Text Available Abstract Background Left-sided lesions (LSLs account for an important fraction of severe congenital cardiovascular malformations (CVMs. The genetic contributions to LSLs are complex, and the mutations that cause these malformations span several diverse biological signaling pathways: TGFB, NOTCH, SHH, and more. Here, we use whole exome sequence data generated in 342 LSL cases to identify likely damaging variants in putative candidate CVM genes. Methods Using a series of bioinformatics filters, we focused on genes harboring population-rare, putative loss-of-function (LOF, and predicted damaging variants in 1760 CVM candidate genes constructed a priori from the literature and model organism databases. Gene variants that were not observed in a comparably sequenced control dataset of 5492 samples without severe CVM were then subjected to targeted validation in cases and parents. Whole exome sequencing data from 4593 individuals referred for clinical sequencing were used to bolster evidence for the role of candidate genes in CVMs and LSLs. Results Our analyses revealed 28 candidate variants in 27 genes, including 17 genes not previously associated with a human CVM disorder, and revealed diverse patterns of inheritance among LOF carriers, including 9 confirmed de novo variants in both novel and newly described human CVM candidate genes (ACVR1, JARID2, NR2F2, PLRG1, SMURF1 as well as established syndromic CVM genes (KMT2D, NF1, TBX20, ZEB2. We also identified two genes (DNAH5, OFD1 with evidence of recessive and hemizygous inheritance patterns, respectively. Within our clinical cohort, we also observed heterozygous LOF variants in JARID2 and SMAD1 in individuals with cardiac phenotypes, and collectively, carriers of LOF variants in our candidate genes had a four times higher odds of having CVM (odds ratio = 4.0, 95% confidence interval 2.5–6.5. Conclusions Our analytical strategy highlights the utility of bioinformatic resources, including human

  12. Structure of the CaMKIIdelta/calmodulin complex reveals the molecular mechanism of CaMKII kinase activation.

    Directory of Open Access Journals (Sweden)

    Peter Rellos

    2010-07-01

    Full Text Available Long-term potentiation (LTP, a long-lasting enhancement in communication between neurons, is considered to be the major cellular mechanism underlying learning and memory. LTP triggers high-frequency calcium pulses that result in the activation of Calcium/Calmodulin (CaM-dependent kinase II (CaMKII. CaMKII acts as a molecular switch because it remains active for a long time after the return to basal calcium levels, which is a unique property required for CaMKII function. Here we describe the crystal structure of the human CaMKIIdelta/Ca2+/CaM complex, structures of all four human CaMKII catalytic domains in their autoinhibited states, as well as structures of human CaMKII oligomerization domains in their tetradecameric and physiological dodecameric states. All four autoinhibited human CaMKIIs were monomeric in the determined crystal structures but associated weakly in solution. In the CaMKIIdelta/Ca2+/CaM complex, the inhibitory region adopted an extended conformation and interacted with an adjacent catalytic domain positioning T287 into the active site of the interacting protomer. Comparisons with autoinhibited CaMKII structures showed that binding of calmodulin leads to the rearrangement of residues in the active site to a conformation suitable for ATP binding and to the closure of the binding groove for the autoinhibitory helix by helix alphaD. The structural data, together with biophysical interaction studies, reveals the mechanism of CaMKII activation by calmodulin and explains many of the unique regulatory properties of these two essential signaling molecules.This article can also be viewed as an enhanced version in which the text of the article is integrated with interactive 3-D representations and animated transitions. Please note that a web plugin is required to access this enhanced functionality. Instructions for the installation and use of the Web plugin are available in Text S1.

  13. Molecular Epidemiology Reveals Genetic Diversity amongst Isolates of the Cryptococcus neoformans/C. gattii Species Complex in Thailand

    Science.gov (United States)

    Kaocharoen, Sirada; Ngamskulrungroj, Popchai; Firacative, Carolina; Trilles, Luciana; Piyabongkarn, Dumrongdej; Banlunara, Wijit; Poonwan, Natteewan; Chaiprasert, Angkana; Meyer, Wieland; Chindamporn, Ariya

    2013-01-01

    To gain a more detailed picture of cryptococcosis in Thailand, a retrospective study of 498 C. neoformans and C. gattii isolates has been conducted. Among these, 386, 83 and 29 strains were from clinical, environmental and veterinary sources, respectively. A total of 485 C. neoformans and 13 C. gattii strains were studied. The majority of the strains (68.9%) were isolated from males (mean age of 37.97 years), 88.5% of C. neoformans and only 37.5% of C. gattii strains were from HIV patients. URA5-RFLP and/or M13 PCR-fingerprinting analysis revealed that the majority of the isolates were C. neoformans molecular type VNI regardless of their sources (94.8%; 94.6% of the clinical, 98.8% of the environmental and 86.2% of the veterinary isolates). In addition, the molecular types VNII (2.4%; 66.7% of the clinical and 33.3% of the veterinary isolates), VNIV (0.2%; 100% environmental isolate), VGI (0.2%; 100% clinical isolate) and VGII (2.4%; 100% clinical isolates) were found less frequently. Multilocus Sequence Type (MLST) analysis using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex identified a total of 20 sequence types (ST) in Thailand combining current and previous data. The Thai isolates are an integrated part of the global cryptococcal population genetic structure, with ST30 for C. gattii and ST82, ST83, ST137, ST141, ST172 and ST173 for C. neoformans being unique to Thailand. Most of the C. gattii isolates were ST7 = VGIIb, which is identical to the less virulent minor Vancouver island outbreak genotype, indicating Thailand as a stepping stone in the global spread of this outbreak strain. The current study revealed a greater genetic diversity and a wider range of major molecular types being present amongst Thai cryptococcal isolates than previously reported. PMID:23861989

  14. Phylogenetic diversity and genotypical complexity of H9N2 influenza A viruses revealed by genomic sequence analysis.

    Directory of Open Access Journals (Sweden)

    Guoying Dong

    Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.

  15. Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

    Energy Technology Data Exchange (ETDEWEB)

    Newberry, K.J.; Huffman, J.L.; Miller, M.C.; Vazquez-Laslop, N.; Neyfakh, A.A.; Brennan, R.G.

    2009-05-22

    BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets, that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.

  16. Transcriptome, carbohydrate, and phytohormone analysis of Petunia hybrida reveals a complex disturbance of plant functional integrity under mild chilling stress

    Science.gov (United States)

    Bauerfeind, Martin Andreas; Winkelmann, Traud; Franken, Philipp; Druege, Uwe

    2015-01-01

    Cultivation of chilling-tolerant ornamental crops at lower temperature could reduce the energy demands of heated greenhouses. To provide a better understanding of how sub-optimal temperatures (12°C vs. 16°C) affect growth of the sensitive Petunia hybrida cultivar ‘SweetSunshine Williams’, the transcriptome, carbohydrate metabolism, and phytohormone homeostasis were monitored in aerial plant parts over 4 weeks by use of a microarray, enzymatic assays and GC-MS/MS. The data revealed three consecutive phases of chilling response. The first days were marked by a strong accumulation of sugars, particularly in source leaves, preferential up-regulation of genes in the same tissue and down-regulation of several genes in the shoot apex, especially those involved in the abiotic stress response. The midterm phase featured a partial normalization of carbohydrate levels and gene expression. After 3 weeks of chilling exposure, a new stabilized balance was established. Reduced hexose levels in the shoot apex, reduced ratios of sugar levels between the apex and source leaves and a higher apical sucrose/hexose ratio, associated with decreased activity and expression of cell wall invertase, indicate that prolonged chilling induced sugar accumulation in source leaves at the expense of reduced sugar transport to and reduced sucrose utilization in the shoot. This was associated with reduced levels of indole-3-acetic acid and abscisic acid in the apex and high numbers of differentially, particularly up-regulated genes, especially in the source leaves, including those regulating histones, ethylene action, transcription factors, and a jasmonate-ZIM-domain protein. Transcripts of one Jumonji C domain containing protein and one expansin accumulated in source leaves throughout the chilling period. The results reveal a dynamic and complex disturbance of plant function in response to mild chilling, opening new perspectives for the comparative analysis of differently tolerant cultivars

  17. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  18. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  19. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  20. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  1. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  2. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  3. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  4. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis Flowers[W][OPEN

    Science.gov (United States)

    Ginglinger, Jean-François; Boachon, Benoit; Höfer, René; Paetz, Christian; Köllner, Tobias G.; Miesch, Laurence; Lugan, Raphael; Baltenweck, Raymonde; Mutterer, Jérôme; Ullmann, Pascaline; Beran, Franziska; Claudel, Patricia; Verstappen, Francel; Fischer, Marc J.C.; Karst, Francis; Bouwmeester, Harro; Miesch, Michel; Schneider, Bernd; Gershenzon, Jonathan; Ehlting, Jürgen; Werck-Reichhart, Danièle

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus predicted to be involved in monoterpenoid metabolism. We show that all four selected genes, the two terpene synthases (TPS10 and TPS14) and the two cytochrome P450s (CYP71B31 and CYP76C3), are simultaneously expressed at anthesis, mainly in upper anther filaments and in petals. Upon transient expression in Nicotiana benthamiana, the TPS enzymes colocalize in vesicular structures associated with the plastid surface, whereas the P450 proteins were detected in the endoplasmic reticulum. Whether they were expressed in Saccharomyces cerevisiae or in N. benthamiana, the TPS enzymes formed two different enantiomers of linalool: (−)-(R)-linalool for TPS10 and (+)-(S)-linalool for TPS14. Both P450 enzymes metabolize the two linalool enantiomers to form different but overlapping sets of hydroxylated or epoxidized products. These oxygenated products are not emitted into the floral headspace, but accumulate in floral tissues as further converted or conjugated metabolites. This work reveals complex linalool metabolism in Arabidopsis flowers, the ecological role of which remains to be determined. PMID:24285789

  5. Genome re-sequencing of semi-wild soybean reveals a complex Soja population structure and deep introgression.

    Directory of Open Access Journals (Sweden)

    Jie Qiu

    Full Text Available Semi-wild soybean is a unique type of soybean that retains both wild and domesticated characteristics, which provides an important intermediate type for understanding the evolution of the subgenus Soja population in the Glycine genus. In this study, a semi-wild soybean line (Maliaodou and a wild line (Lanxi 1 collected from the lower Yangtze regions were deeply sequenced while nine other semi-wild lines were sequenced to a 3-fold genome coverage. Sequence analysis revealed that (1 no independent phylogenetic branch covering all 10 semi-wild lines was observed in the Soja phylogenetic tree; (2 besides two distinct subpopulations of wild and cultivated soybean in the Soja population structure, all semi-wild lines were mixed with some wild lines into a subpopulation rather than an independent one or an intermediate transition type of soybean domestication; (3 high heterozygous rates (0.19-0.49 were observed in several semi-wild lines; and (4 over 100 putative selective regions were identified by selective sweep analysis, including those related to the development of seed size. Our results suggested a hybridization origin for the semi-wild soybean, which makes a complex Soja population structure.

  6. Cryo-EM Structure of a KCNQ1/CaM Complex Reveals Insights into Congenital Long QT Syndrome.

    Science.gov (United States)

    Sun, Ji; MacKinnon, Roderick

    2017-06-01

    KCNQ1 is the pore-forming subunit of cardiac slow-delayed rectifier potassium (I Ks ) channels. Mutations in the kcnq1 gene are the leading cause of congenital long QT syndrome (LQTS). Here, we present the cryoelectron microscopy (cryo-EM) structure of a KCNQ1/calmodulin (CaM) complex. The conformation corresponds to an "uncoupled," PIP 2 -free state of KCNQ1, with activated voltage sensors and a closed pore. Unique structural features within the S4-S5 linker permit uncoupling of the voltage sensor from the pore in the absence of PIP 2 . CaM contacts the KCNQ1 voltage sensor through a specific interface involving a residue on CaM that is mutated in a form of inherited LQTS. Using an electrophysiological assay, we find that this mutation on CaM shifts the KCNQ1 voltage-activation curve. This study describes one physiological form of KCNQ1, depolarized voltage sensors with a closed pore in the absence of PIP 2 , and reveals a regulatory interaction between CaM and KCNQ1 that may explain CaM-mediated LQTS. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. A comprehensive custom panel design for routine hereditary cancer testing: preserving control, improving diagnostics and revealing a complex variation landscape.

    Science.gov (United States)

    Castellanos, Elisabeth; Gel, Bernat; Rosas, Inma; Tornero, Eva; Santín, Sheila; Pluvinet, Raquel; Velasco, Juan; Sumoy, Lauro; Del Valle, Jesús; Perucho, Manuel; Blanco, Ignacio; Navarro, Matilde; Brunet, Joan; Pineda, Marta; Feliubadaló, Lidia; Capellá, Gabi; Lázaro, Conxi; Serra, Eduard

    2017-01-04

    We wanted to implement an NGS strategy to globally analyze hereditary cancer with diagnostic quality while retaining the same degree of understanding and control we had in pre-NGS strategies. To do this, we developed the I2HCP panel, a custom bait library covering 122 hereditary cancer genes. We improved bait design, tested different NGS platforms and created a clinically driven custom data analysis pipeline. The I2HCP panel was developed using a training set of hereditary colorectal cancer, hereditary breast and ovarian cancer and neurofibromatosis patients and reached an accuracy, analytical sensitivity and specificity greater than 99%, which was maintained in a validation set. I2HCP changed our diagnostic approach, involving clinicians and a genetic diagnostics team from panel design to reporting. The new strategy improved diagnostic sensitivity, solved uncertain clinical diagnoses and identified mutations in new genes. We assessed the genetic variation in the complete set of hereditary cancer genes, revealing a complex variation landscape that coexists with the disease-causing mutation. We developed, validated and implemented a custom NGS-based strategy for hereditary cancer diagnostics that improved our previous workflows. Additionally, the existence of a rich genetic variation in hereditary cancer genes favors the use of this panel to investigate their role in cancer risk.

  8. GlcNAc-1-P-transferase–tunicamycin complex structure reveals basis for inhibition of N-glycosylation

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jiho; Mashalidis, Ellene H.; Kuk, Alvin C. Y.; Yamamoto, Kazuki; Kaeser, Benjamin; Ichikawa, Satoshi; Lee, Seok-Yong

    2018-02-19

    N-linked glycosylation is a predominant post-translational modification of protein in eukaryotes, and its dysregulation is the etiology of several human disorders. The enzyme UDP-N-acetylglucosamine:dolichyl-phosphate N-acetylglucosaminephosphotransferase (GlcNAc-1-P-transferase or GPT) catalyzes the first and committed step of N-linked glycosylation in the endoplasmic reticulum membrane, and it is the target of the natural product tunicamycin. Tunicamycin has potent antibacterial activity, inhibiting the bacterial cell wall synthesis enzyme MraY, but its usefulness as an antibiotic is limited by off-target inhibition of human GPT. Our understanding of how tunicamycin inhibits N-linked glycosylation and efforts to selectively target MraY are hampered by a lack of structural information. Here we present crystal structures of human GPT in complex with tunicamycin. In conclusion, structural and functional analyses reveal the difference between GPT and MraY in their mechanisms of inhibition by tunicamycin. We demonstrate that this difference could be exploited to design MraY-specific inhibitors as potential antibiotics.

  9. High-Resolution Imaging Reveals New Features of Nuclear Export of mRNA through the Nuclear Pore Complexes

    Directory of Open Access Journals (Sweden)

    Joseph M. Kelich

    2014-08-01

    Full Text Available The nuclear envelope (NE of eukaryotic cells provides a physical barrier for messenger RNA (mRNA and the associated proteins (mRNPs traveling from sites of transcription in the nucleus to locations of translation processing in the cytoplasm. Nuclear pore complexes (NPCs embedded in the NE serve as a dominant gateway for nuclear export of mRNA. However, the fundamental characterization of export dynamics of mRNPs through the NPC has been hindered by several technical limits. First, the size of NPC that is barely below the diffraction limit of conventional light microscopy requires a super-resolution microscopy imaging approach. Next, the fast transit of mRNPs through the NPC further demands a high temporal resolution by the imaging approach. Finally, the inherent three-dimensional (3D movements of mRNPs through the NPC demand the method to provide a 3D mapping of both transport kinetics and transport pathways of mRNPs. This review will highlight the recently developed super-resolution imaging techniques advanced from 1D to 3D for nuclear export of mRNPs and summarize the new features in the dynamic nuclear export process of mRNPs revealed from these technical advances.

  10. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  11. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  12. Complex and extensive post-transcriptional regulation revealed by integrative proteomic and transcriptomic analysis of metabolite stress response in Clostridium acetobutylicum.

    Science.gov (United States)

    Venkataramanan, Keerthi P; Min, Lie; Hou, Shuyu; Jones, Shawn W; Ralston, Matthew T; Lee, Kelvin H; Papoutsakis, E Terry

    2015-01-01

    Clostridium acetobutylicum is a model organism for both clostridial biology and solvent production. The organism is exposed to its own toxic metabolites butyrate and butanol, which trigger an adaptive stress response. Integrative analysis of proteomic and RNAseq data may provide novel insights into post-transcriptional regulation. The identified iTRAQ-based quantitative stress proteome is made up of 616 proteins with a 15 % genome coverage. The differentially expressed proteome correlated poorly with the corresponding differential RNAseq transcriptome. Up to 31 % of the differentially expressed proteins under stress displayed patterns opposite to those of the transcriptome, thus suggesting significant post-transcriptional regulation. The differential proteome of the translation machinery suggests that cells employ a different subset of ribosomal proteins under stress. Several highly upregulated proteins but with low mRNA levels possessed mRNAs with long 5'UTRs and strong RBS scores, thus supporting the argument that regulatory elements on the long 5'UTRs control their translation. For example, the oxidative stress response rubrerythrin was upregulated only at the protein level up to 40-fold without significant mRNA changes. We also identified many leaderless transcripts, several displaying different transcriptional start sites, thus suggesting mRNA-trimming mechanisms under stress. Downregulation of Rho and partner proteins pointed to changes in transcriptional elongation and termination under stress. The integrative proteomic-transcriptomic analysis demonstrated complex expression patterns of a large fraction of the proteome. Such patterns could not have been detected with one or the other omic analyses. Our analysis proposes the involvement of specific molecular mechanisms of post-transcriptional regulation to explain the observed complex stress response.

  13. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M

    1988-11-21

    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  14. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin

    2015-03-01

    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  15. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  16. Molecular Epidemiology and Phylogeny Reveal Complex Spatial Dynamics in Areas Where Canine Parvovirus Is Endemic ▿†

    Science.gov (United States)

    Clegg, S. R.; Coyne, K. P.; Parker, J.; Dawson, S.; Godsall, S. A.; Pinchbeck, G.; Cripps, P. J.; Gaskell, R. M.; Radford, A. D.

    2011-01-01

    -sectional study of national and global CPV phylogeographic segregation reveals a substantially more complex epidemic structure than previously described. PMID:21593180

  17. Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

    Directory of Open Access Journals (Sweden)

    Matthias Merker

    Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

  18. Morphological and Molecular Data Reveal Three Distinct Populations of Indian Wild Rice Oryza rufipogon Griff. Species Complex.

    Science.gov (United States)

    Singh, Balwant; Singh, Nisha; Mishra, Shefali; Tripathi, Kabita; Singh, Bikram P; Rai, Vandna; Singh, Ashok K; Singh, Nagendra K

    2018-01-01

    Wild relatives of crops possess adaptive mutations for agronomically important traits, which could play significant role in crop improvement for sustainable agriculture. However, global climate change and human activities pose serious threats to the natural habitats leading to erosion of genetic diversity of wild rice populations. The purpose of this study was to explore and characterize India's huge untapped wild rice diversity in Oryza rufipogon Griff. species complex from a wide range of ecological niches. We made strategic expeditions around diversity hot spots in 64 districts of nine different agro-climatic zones of the country and collected 418 wild rice accessions. Significant variation was observed among the accessions for 46 morphological descriptors, allowing classification into O. nivara, O. rufipogon , and O. sativa f. spontanea morpho-taxonomic groups. Genome-specific pSINE1 markers confirmed all the accessions having AA genome, which were further classified using ecotype-specific pSINE1 markers into annual, perennial, intermediate, and an unknown type. Principal component analysis revealed continuous variation for the morphological traits in each ecotype group. Genetic diversity analysis based on multi-allelic SSR markers clustered these accessions into three major groups and analysis of molecular variance for nine agro-climatic zones showed that 68% of the genetic variation was inherent amongst individuals while only 11% of the variation separated the zones, though there was significant correlation between genetic and spatial distances of the accessions. Model based population structure analysis using genome wide bi-allelic SNP markers revealed three sub-populations designated 'Pro-Indica,' 'Pro-Aus,' and 'Mid-Gangetic,' which showed poor correspondence with the morpho - taxonomic classification or pSINE1 ecotypes. There was Pan-India distribution of the 'Pro-Indica' and 'Pro-Aus' sub-populations across agro-climatic zones, indicating a more

  19. Multilocus phylogeny of the avian family Alaudidae (larks) reveals complex morphological evolution, non-monophyletic genera and hidden species diversity.

    Science.gov (United States)

    Alström, Per; Barnes, Keith N; Olsson, Urban; Barker, F Keith; Bloomer, Paulette; Khan, Aleem Ahmed; Qureshi, Masood Ahmed; Guillaumet, Alban; Crochet, Pierre-André; Ryan, Peter G

    2013-12-01

    The Alaudidae (larks) is a large family of songbirds in the superfamily Sylvioidea. Larks are cosmopolitan, although species-level diversity is by far largest in Africa, followed by Eurasia, whereas Australasia and the New World have only one species each. The present study is the first comprehensive phylogeny of the Alaudidae. It includes 83.5% of all species and representatives from all recognised genera, and was based on two mitochondrial and three nuclear loci (in total 6.4 kbp, although not all loci were available for all species). In addition, a larger sample, comprising several subspecies of some polytypic species was analysed for one of the mitochondrial loci. There was generally good agreement in trees inferred from different loci, although some strongly supported incongruences were noted. The tree based on the concatenated multilocus data was overall well resolved and well supported by the data. We stress the importance of performing single gene as well as combined data analyses, as the latter may obscure significant incongruence behind strong nodal support values. The multilocus tree revealed many unpredicted relationships, including some non-monophyletic genera (Calandrella, Mirafra, Melanocorypha, Spizocorys). The tree based on the extended mitochondrial data set revealed several unexpected deep divergences between taxa presently treated as conspecific (e.g. within Ammomanes cinctura, Ammomanes deserti, Calandrella brachydactyla, Eremophila alpestris), as well as some shallow splits between currently recognised species (e.g. Certhilauda brevirostris-C. semitorquata-C. curvirostris; Calendulauda barlowi-C. erythrochlamys; Mirafra cantillans-M. javanica). Based on our results, we propose a revised generic classification, and comment on some species limits. We also comment on the extraordinary morphological adaptability in larks, which has resulted in numerous examples of parallel evolution (e.g. in Melanocorypha mongolica and Alauda leucoptera [both

  20. Morphological and Molecular Data Reveal Three Distinct Populations of Indian Wild Rice Oryza rufipogon Griff. Species Complex

    Science.gov (United States)

    Singh, Balwant; Singh, Nisha; Mishra, Shefali; Tripathi, Kabita; Singh, Bikram P.; Rai, Vandna; Singh, Ashok K.; Singh, Nagendra K.

    2018-01-01

    Wild relatives of crops possess adaptive mutations for agronomically important traits, which could play significant role in crop improvement for sustainable agriculture. However, global climate change and human activities pose serious threats to the natural habitats leading to erosion of genetic diversity of wild rice populations. The purpose of this study was to explore and characterize India’s huge untapped wild rice diversity in Oryza rufipogon Griff. species complex from a wide range of ecological niches. We made strategic expeditions around diversity hot spots in 64 districts of nine different agro-climatic zones of the country and collected 418 wild rice accessions. Significant variation was observed among the accessions for 46 morphological descriptors, allowing classification into O. nivara, O. rufipogon, and O. sativa f. spontanea morpho-taxonomic groups. Genome-specific pSINE1 markers confirmed all the accessions having AA genome, which were further classified using ecotype-specific pSINE1 markers into annual, perennial, intermediate, and an unknown type. Principal component analysis revealed continuous variation for the morphological traits in each ecotype group. Genetic diversity analysis based on multi-allelic SSR markers clustered these accessions into three major groups and analysis of molecular variance for nine agro-climatic zones showed that 68% of the genetic variation was inherent amongst individuals while only 11% of the variation separated the zones, though there was significant correlation between genetic and spatial distances of the accessions. Model based population structure analysis using genome wide bi-allelic SNP markers revealed three sub-populations designated ‘Pro-Indica,’ ‘Pro-Aus,’ and ‘Mid-Gangetic,’ which showed poor correspondence with the morpho-taxonomic classification or pSINE1 ecotypes. There was Pan-India distribution of the ‘Pro-Indica’ and ‘Pro-Aus’ sub-populations across agro-climatic zones

  1. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  2. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  3. ALMA Reveals Sequential High-mass Star Formation in the G9.62+0.19 Complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Tie; Kim, Kee-Tae [Korea Astronomy and Space Science Institute 776, Daedeokdae-ro, Yuseong-gu, Daejeon, Korea 34055 (Korea, Republic of); Lacy, John [Department of Astronomy, University of Texas at Austin, Austin, TX 78712 (United States); Li, Pak Shing [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Wang, Ke [European Southern Observatory, Karl-Schwarzschild-Str.2, D-85748 Garching bei München (Germany); Qin, Sheng-Li [Department of Astronomy, Yunnan University, and Key Laboratory of Astroparticle Physics of Yunnan Province, Kunming, 650091 (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Garay, Guido; Mardones, Diego [Departamento de Astronomía, Universidad de Chile, Casilla 36-D, Santiago (Chile); Wu, Yuefang [Department of Astronomy, Peking University, Beijing 100871 (China); Zhu, Qingfeng [Astronomy Department, University of Science and Technology, Chinese Academy of Sciences, Hefei 210008 (China); Tatematsu, Ken’ichi; Hirota, Tomoya [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Ren, Zhiyuan; Li, Di [National Astronomical Observatories, Chinese Academy of Science, A20 Datun Road, Chaoyang District, Beijing 100012 (China); Liu, Sheng-Yuan; Chen, Huei-Ru; Su, Yu-Nung, E-mail: liutiepku@gmail.com [Academia Sinica, Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 106, Taiwan (China)

    2017-11-01

    Stellar feedback from high-mass stars (e.g., H ii regions) can strongly influence the surrounding interstellar medium and regulate star formation. Our new ALMA observations reveal sequential high-mass star formation taking place within one subvirial filamentary clump (the G9.62 clump) in the G9.62+0.19 complex. The 12 dense cores (MM1–MM12) detected by ALMA are at very different evolutionary stages, from the starless core phase to the UC H ii region phase. Three dense cores (MM6, MM7/G, MM8/F) are associated with outflows. The mass–velocity diagrams of the outflows associated with MM7/G and MM8/F can be well-fit by broken power laws. The mass–velocity diagram of the SiO outflow associated with MM8/F breaks much earlier than other outflow tracers (e.g., CO, SO, CS, HCN), suggesting that SiO traces newly shocked gas, while the other molecular lines (e.g., CO, SO, CS, HCN) mainly trace the ambient gas continuously entrained by outflow jets. Five cores (MM1, MM3, MM5, MM9, MM10) are massive starless core candidates whose masses are estimated to be larger than 25 M {sub ☉}, assuming a dust temperature of ≤20 K. The shocks from the expanding H ii regions (“B” and “C”) to the west may have a great impact on the G9.62 clump by compressing it into a filament and inducing core collapse successively, leading to sequential star formation. Our findings suggest that stellar feedback from H ii regions may enhance the star formation efficiency and suppress low-mass star formation in adjacent pre-existing massive clumps.

  4. Ecomorph or endangered coral? DNA and microstructure reveal hawaiian species complexes: Montipora dilatata/flabellata/turgescens & M. patula/verrilli.

    Directory of Open Access Journals (Sweden)

    Zac H Forsman

    2010-12-01

    Full Text Available M. dilatata, M. flabellata, and M. patula and 80 other scleractinian corals were petitioned to be listed under the US Endangered Species Act (ESA, which would have major conservation implications. One of the difficulties with this evaluation is that reproductive boundaries between morphologically defined coral species are often permeable, and morphology can be wildly variable. We examined genetic and morphological variation in Hawaiian Montipora with a suite of molecular markers (mitochondrial: COI, CR, Cyt-B, 16S, ATP6; nuclear: ATPsβ, ITS and microscopic skeletal measurements. Mitochondrial markers and the ITS region revealed four distinct clades: I M. patula/M. verrilli, II M. cf. incrassata, III M. capitata, IV M. dilatata/M. flabellata/M. cf. turgescens. These clades are likely to occur outside of Hawai'i according to mitochondrial control region haplotypes from previous studies. The ATPsβ intron data showed a pattern often interpreted as resulting from hybridization and introgression; however, incomplete lineage sorting may be more likely since the multicopy nuclear ITS region was consistent with the mitochondrial data. Furthermore, principal components analysis (PCA of skeletal microstructure was concordant with the mitochondrial clades, while nominal taxa overlapped. The size and shape of verrucae or papillae contributed most to identifying groups, while colony-level morphology was highly variable. It is not yet clear if these species complexes represent population-level variation or incipient speciation (CA<1MYA, two alternatives that have very different conservation implications. This study highlights the difficulty in understanding the scale of genetic and morphological variation that corresponds to species as opposed to population-level variation, information that is essential for conservation and for understanding coral biodiversity.

  5. Using neutral theory to reveal the contribution of meta-community processes to assembly in complex landscapes

    Directory of Open Access Journals (Sweden)

    Dominique Gravel

    2014-04-01

    Full Text Available The metacommunity perspective appears as an appropriate conceptual framework to make ecology more predictive. It is particularly relevant to limnology, where exchanges of organisms and nutrients affect community and ecosystem properties from the local to the regional scales. The recent development of neutral theory appears as a step back in that direction because of the assumption of ecological equivalence and the absence of any effect of the environment on community organization. A remarkable strength of neutral theory is nonetheless to provide a general theory of diversity that accounts for a wide range of empirical observations. In this paper, we argue that neutral theory can be useful to understand the impact of dispersal on community assembly in landscapes of various complexities. Our analysis focus on spatially explicit landscapes conceptualized as networks of local communities (e.g., lakes connected to each other by dispersal channels (e.g., rivers. The main objective of the paper is to use neutral theory to stress the importance of landscape structure on the distribution of diversity. We refer to the landscape organization as a spatial contingency that could potentially affect the coexistence mechanisms at play. We briefly review the main approaches to describe spatial networks and describe three simple toy models of metacommunity dynamics. We take this opportunity to review their assumptions and main predictions. We then conduct simulations of these models to reveal with simple examples the impact of spatial network structure on diversity distribution. The simulation results show that competitive interactions buffer the potential impact of landscape structure. The strongest relationship between node position in the landscape and species richness was observed for the patch dynamics model without any interactions. On the other hand, strong and unequal competitive interactions minimized the effect of node position. We conclude that the

  6. Regulatory complexity revealed by integrated cytological and RNA-seq analyses of meiotic substages in mouse spermatocytes.

    Science.gov (United States)

    Ball, Robyn L; Fujiwara, Yasuhiro; Sun, Fengyun; Hu, Jianjun; Hibbs, Matthew A; Handel, Mary Ann; Carter, Gregory W

    2016-08-12

    The continuous and non-synchronous nature of postnatal male germ-cell development has impeded stage-specific resolution of molecular events of mammalian meiotic prophase in the testis. Here the juvenile onset of spermatogenesis in mice is analyzed by combining cytological and transcriptomic data in a novel computational analysis that allows decomposition of the transcriptional programs of spermatogonia and meiotic prophase substages. Germ cells from testes of individual mice were obtained at two-day intervals from 8 to 18 days post-partum (dpp), prepared as surface-spread chromatin and immunolabeled for meiotic stage-specific protein markers (STRA8, SYCP3, phosphorylated H2AFX, and HISTH1T). Eight stages were discriminated cytologically by combinatorial antibody labeling, and RNA-seq was performed on the same samples. Independent principal component analyses of cytological and transcriptomic data yielded similar patterns for both data types, providing strong evidence for substage-specific gene expression signatures. A novel permutation-based maximum covariance analysis (PMCA) was developed to map co-expressed transcripts to one or more of the eight meiotic prophase substages, thereby linking distinct molecular programs to cytologically defined cell states. Expression of meiosis-specific genes is not substage-limited, suggesting regulation of substage transitions at other levels. This integrated analysis provides a general method for resolving complex cell populations. Here it revealed not only features of meiotic substage-specific gene expression, but also a network of substage-specific transcription factors and relationships to potential target genes.

  7. A complex regulatory network coordinating cell cycles during C. elegans development is revealed by a genome-wide RNAi screen.

    Science.gov (United States)

    Roy, Sarah H; Tobin, David V; Memar, Nadin; Beltz, Eleanor; Holmen, Jenna; Clayton, Joseph E; Chiu, Daniel J; Young, Laura D; Green, Travis H; Lubin, Isabella; Liu, Yuying; Conradt, Barbara; Saito, R Mako

    2014-02-28

    The development and homeostasis of multicellular animals requires precise coordination of cell division and differentiation. We performed a genome-wide RNA interference screen in Caenorhabditis elegans to reveal the components of a regulatory network that promotes developmentally programmed cell-cycle quiescence. The 107 identified genes are predicted to constitute regulatory networks that are conserved among higher animals because almost half of the genes are represented by clear human orthologs. Using a series of mutant backgrounds to assess their genetic activities, the RNA interference clones displaying similar properties were clustered to establish potential regulatory relationships within the network. This approach uncovered four distinct genetic pathways controlling cell-cycle entry during intestinal organogenesis. The enhanced phenotypes observed for animals carrying compound mutations attest to the collaboration between distinct mechanisms to ensure strict developmental regulation of cell cycles. Moreover, we characterized ubc-25, a gene encoding an E2 ubiquitin-conjugating enzyme whose human ortholog, UBE2Q2, is deregulated in several cancers. Our genetic analyses suggested that ubc-25 acts in a linear pathway with cul-1/Cul1, in parallel to pathways employing cki-1/p27 and lin-35/pRb to promote cell-cycle quiescence. Further investigation of the potential regulatory mechanism demonstrated that ubc-25 activity negatively regulates CYE-1/cyclin E protein abundance in vivo. Together, our results show that the ubc-25-mediated pathway acts within a complex network that integrates the actions of multiple molecular mechanisms to control cell cycles during development. Copyright © 2014 Roy et al.

  8. Proteomic analysis of the crayfish gastrolith chitinous extracellular matrix reveals putative protein complexes and a central role for GAP 65.

    Science.gov (United States)

    Glazer, Lilah; Roth, Ziv; Weil, Simy; Aflalo, Eliahu D; Khalaila, Isam; Sagi, Amir

    2015-10-14

    Chitin is a major component of arthropod cuticles, where it forms a three-dimensional network that constitutes the scaffold upon which cuticles form. The chitin fibers that form this network are closely associated with specific structural proteins, while the cuticular matrix contains many additional structural, enzymatic and other proteins. We study the crayfish gastrolith as a simple model for the assembly of calcified cuticular structures, with particular focus on the proteins involved in this process. The present study integrates a gastrolith-forming epithelium transcriptomic library with data from mass spectrometry analysis of proteins extracted from the gastrolith matrix to obtain a near-complete picture of gastrolith protein content. Using native protein separation we identified 24 matrix proteins, of which 14 are novel. Further analysis led to discovery of three putative protein complexes, all containing GAP 65 the most abundant gastrolith structural protein. Using immunological methods we further studied the role of GAP 65 in the gastrolith matrix and forming epithelium, as well as in the newly identified protein complexes. We propose that gastrolith matrix construction is a sequential process in which protein complexes are dynamically assembled and disassembled around GAP 65, thus changing their functional properties to perform each step in the construction process. The scientific interest on which this study is based arises from three main features of gastroliths: (1) Gastroliths possess partial analogy to cuticles both in structural and molecular properties, and may be regarded, with the appropriate reservations (see Introduction), as simple models for cuticle assembly. At the same time, gastroliths are terminally assembled during a well-defined period, which can be controlled in the laboratory, making them significantly easier to study than cuticles. (2) Gastroliths, like the crayfish exoskeleton, contain stable amorphous calcium carbonate (ACC) rather

  9. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  10. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  11. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  13. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  14. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  15. Molecular fingerprinting of complex grass allergoids: size assessments reveal new insights in epitope repertoires and functional capacities.

    Science.gov (United States)

    Starchenka, S; Bell, A J; Mwange, J; Skinner, M A; Heath, M D

    2017-01-01

    Subcutaneous allergen immunotherapy (SCIT) is a well-documented treatment for allergic disease which involves injections of native allergen or modified (allergoid) extracts. The use of allergoid vaccines is a growing sector of the allergy immunotherapy market, associated with shorter-course therapy. The aim of this study was the structural and immunological characterisation of group 1 (Lol p 1) IgG-binding epitopes within a complex mix grass allergoid formulation containing rye grass. HP-SEC was used to resolve a mix grass allergoid preparation of high molecular weight into several distinct fractions with defined molecular weight and elution profiles. Allergen verification of the HP-SEC allergoid fractions was confirmed by mass spectrometry analysis. IgE and IgG immunoreactivity of the allergoid preparations was explored and Lol p 1 specific IgG-binding epitopes mapped by SPOT synthesis technology (PepSpot™) with structural analysis based on a Lol p 1 homology model. Grass specific IgE reactivity of the mix grass modified extract (allergoid) was diminished in comparison with the mix grass native extract. A difference in IgG profiles was observed between an intact mix grass allergoid preparation and HP-SEC allergoid fractions, which indicated enhancement of accessible reactive IgG epitopes across size distribution profiles of the mix grass allergoid formulation. Detailed analysis of the epitope specificity showed retention of six Lol p 1 IgG-binding epitopes in the mix grass modified extract. The structural and immunological changes which take place following the grass allergen modification process was further unravelled revealing distinct IgG immunological profiles. All epitopes were mapped on the solvent exposed area of Lol p 1 homology model accessible for IgG binding. One of the epitopes was identified as an 'immunodominant' Lol p 1 IgG-binding epitope (62-IFKDGRGCGSCFEIK-76) and classified as a novel epitope. The results from this study support the concept

  16. Deciphering the Cryptic Genome: Genome-wide Analyses of the Rice Pathogen Fusarium fujikuroi Reveal Complex Regulation of Secondary Metabolism and Novel Metabolites

    Science.gov (United States)

    Studt, Lena; Niehaus, Eva-Maria; Espino, Jose J.; Huß, Kathleen; Michielse, Caroline B.; Albermann, Sabine; Wagner, Dominik; Bergner, Sonja V.; Connolly, Lanelle R.; Fischer, Andreas; Reuter, Gunter; Kleigrewe, Karin; Bald, Till; Wingfield, Brenda D.; Ophir, Ron; Freeman, Stanley; Hippler, Michael; Smith, Kristina M.; Brown, Daren W.; Proctor, Robert H.; Münsterkötter, Martin; Freitag, Michael; Humpf, Hans-Ulrich; Güldener, Ulrich; Tudzynski, Bettina

    2013-01-01

    The fungus Fusarium fujikuroi causes “bakanae” disease of rice due to its ability to produce gibberellins (GAs), but it is also known for producing harmful mycotoxins. However, the genetic capacity for the whole arsenal of natural compounds and their role in the fungus' interaction with rice remained unknown. Here, we present a high-quality genome sequence of F. fujikuroi that was assembled into 12 scaffolds corresponding to the 12 chromosomes described for the fungus. We used the genome sequence along with ChIP-seq, transcriptome, proteome, and HPLC-FTMS-based metabolome analyses to identify the potential secondary metabolite biosynthetic gene clusters and to examine their regulation in response to nitrogen availability and plant signals. The results indicate that expression of most but not all gene clusters correlate with proteome and ChIP-seq data. Comparison of the F. fujikuroi genome to those of six other fusaria revealed that only a small number of gene clusters are conserved among these species, thus providing new insights into the divergence of secondary metabolism in the genus Fusarium. Noteworthy, GA biosynthetic genes are present in some related species, but GA biosynthesis is limited to F. fujikuroi, suggesting that this provides a selective advantage during infection of the preferred host plant rice. Among the genome sequences analyzed, one cluster that includes a polyketide synthase gene (PKS19) and another that includes a non-ribosomal peptide synthetase gene (NRPS31) are unique to F. fujikuroi. The metabolites derived from these clusters were identified by HPLC-FTMS-based analyses of engineered F. fujikuroi strains overexpressing cluster genes. In planta expression studies suggest a specific role for the PKS19-derived product during rice infection. Thus, our results indicate that combined comparative genomics and genome-wide experimental analyses identified novel genes and secondary metabolites that contribute to the evolutionary success of F

  17. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  18. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

    Science.gov (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

    2017-07-25

    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  19. Architecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and mass spectrometry

    DEFF Research Database (Denmark)

    Chen, Zhuo Angel; Jawhari, Anass; Fischer, Lutz

    2010-01-01

    Higher-order multi-protein complexes such as RNA polymerase II (Pol II) complexes with transcription initiation factors are often not amenable to X-ray structure determination. Here, we show that protein cross-linking coupled to mass spectrometry (MS) has now sufficiently advanced as a tool to ex...

  20. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  1. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  2. Characterization of the mycobacterial acyl-CoA carboxylase holo complexes reveals their functional expansion into amino acid catabolism.

    Directory of Open Access Journals (Sweden)

    Matthias T Ehebauer

    2015-02-01

    Full Text Available Biotin-mediated carboxylation of short-chain fatty acid coenzyme A esters is a key step in lipid biosynthesis that is carried out by multienzyme complexes to extend fatty acids by one methylene group. Pathogenic mycobacteria have an unusually high redundancy of carboxyltransferase genes and biotin carboxylase genes, creating multiple combinations of protein/protein complexes of unknown overall composition and functional readout. By combining pull-down assays with mass spectrometry, we identified nine binary protein/protein interactions and four validated holo acyl-coenzyme A carboxylase complexes. We investigated one of these--the AccD1-AccA1 complex from Mycobacterium tuberculosis with hitherto unknown physiological function. Using genetics, metabolomics and biochemistry we found that this complex is involved in branched amino-acid catabolism with methylcrotonyl coenzyme A as the substrate. We then determined its overall architecture by electron microscopy and found it to be a four-layered dodecameric arrangement that matches the overall dimensions of a distantly related methylcrotonyl coenzyme A holo complex. Our data argue in favor of distinct structural requirements for biotin-mediated γ-carboxylation of α-β unsaturated acid esters and will advance the categorization of acyl-coenzyme A carboxylase complexes. Knowledge about the underlying structural/functional relationships will be crucial to make the target category amenable for future biomedical applications.

  3. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  4. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  5. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  6. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  7. Characterization and 454 pyrosequencing of Major Histocompatibility Complex class I genes in the great tit reveal complexity in a passerine system

    Directory of Open Access Journals (Sweden)

    Sepil Irem

    2012-05-01

    Full Text Available Abstract Background The critical role of Major Histocompatibility Complex (Mhc genes in disease resistance and their highly polymorphic nature make them exceptional candidates for studies investigating genetic effects on survival, mate choice and conservation. Species that harbor many Mhc loci and high allelic diversity are particularly intriguing as they are potentially under strong selection and studies of such species provide valuable information as to the mechanisms maintaining Mhc diversity. However comprehensive genotyping of complex multilocus systems has been a major challenge to date with the result that little is known about the consequences of this complexity in terms of fitness effects and disease resistance. Results In this study, we genotyped the Mhc class I exon 3 of the great tit (Parus major from two nest-box breeding populations near Oxford, UK that have been monitored for decades. Characterization of Mhc class I exon 3 was adopted and bidirectional sequencing was carried using the 454 sequencing platform. Full analysis of sequences through a stepwise variant validation procedure allowed reliable typing of more than 800 great tits based on 214,357 reads; from duplicates we estimated the repeatability of typing as 0.94. A total of 862 alleles were detected, and the presence of at least 16 functional loci was shown - the highest number characterized in a wild bird species. Finally, the functional alleles were grouped into 17 supertypes based on their antigen binding affinities. Conclusions We found extreme complexity at the Mhc class I of the great tit both in terms of allelic diversity and gene number. The presence of many functional loci was shown, together with a pseudogene family and putatively non-functional alleles; there was clear evidence that functional alleles were under strong balancing selection. This study is the first step towards an in-depth analysis of this gene complex in this species, which will help

  8. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  9. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  10. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  11. Quantitative Proteomics Reveals Dynamic Interactions of the Minichromosome Maintenance Complex (MCM) in the Cellular Response to Etoposide Induced DNA Damage.

    Science.gov (United States)

    Drissi, Romain; Dubois, Marie-Line; Douziech, Mélanie; Boisvert, François-Michel

    2015-07-01

    The minichromosome maintenance complex (MCM) proteins are required for processive DNA replication and are a target of S-phase checkpoints. The eukaryotic MCM complex consists of six proteins (MCM2-7) that form a heterohexameric ring with DNA helicase activity, which is loaded on chromatin to form the pre-replication complex. Upon entry in S phase, the helicase is activated and opens the DNA duplex to recruit DNA polymerases at the replication fork. The MCM complex thus plays a crucial role during DNA replication, but recent work suggests that MCM proteins could also be involved in DNA repair. Here, we employed a combination of stable isotope labeling with amino acids in cell culture (SILAC)-based quantitative proteomics with immunoprecipitation of green fluorescent protein-tagged fusion proteins to identify proteins interacting with the MCM complex, and quantify changes in interactions in response to DNA damage. Interestingly, the MCM complex showed very dynamic changes in interaction with proteins such as Importin7, the histone chaperone ASF1, and the Chromodomain helicase DNA binding protein 3 (CHD3) following DNA damage. These changes in interactions were accompanied by an increase in phosphorylation and ubiquitination on specific sites on the MCM proteins and an increase in the co-localization of the MCM complex with γ-H2AX, confirming the recruitment of these proteins to sites of DNA damage. In summary, our data indicate that the MCM proteins is involved in chromatin remodeling in response to DNA damage. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  13. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  14. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  15. Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)?: Dating, diversification and biogeographic evidence revealed.

    Science.gov (United States)

    Boykin, Laura M; Bell, Charles D; Evans, Gregory; Small, Ian; De Barro, Paul J

    2013-10-18

    Humans and insect herbivores are competing for the same food crops and have been for thousands of years. Despite considerable advances in crop pest management, losses due to insects remain considerable. The global homogenisation of agriculture has supported the range expansion of numerous insect pests and has been driven in part by human-assisted dispersal supported through rapid global trade and low-cost air passenger transport. One of these pests, is the whitefly, Bemisia tabaci, a cryptic species complex that contains some of the world's most damaging pests of agriculture. The complex shows considerable genetic diversity and strong phylogeographic relationships. One consequence of the considerable impact that members of the B. tabaci complex have on agriculture, is the view that human activity, particularly in relation to agricultural practices, such as use of insecticides, has driven the diversification found within the species complex. This has been particularly so in the case of two members of the complex, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED), which have become globally distributed invasive species. An alternative hypothesis is that diversification is due to paleogeographic and paleoclimatological changes. The idea that human activity is driving speciation within the B. tabaci complex has never been tested, but the increased interest in fossil whiteflies and the growth in molecular data have enabled us to apply a relaxed molecular clock and so estimate divergence dates for the major lineages within the B. tabaci species complex. The divergence estimates do not support the view that human activity has been a major driver of diversification. Our analysis suggests that the major lineages within the complex arose approximately 60-30 mya and the highly invasive MED and MEAM1 split from the rest of the species complex around 12 mya well before the evolution of Homo sapiens and agriculture. Furthermore, the divergence dates coincide with a period

  16. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  17. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  18. In Planta Single-Molecule Pull-Down Reveals Tetrameric Stoichiometry of HD-ZIPIII:LITTLE ZIPPER Complexes.

    Science.gov (United States)

    Husbands, Aman Y; Aggarwal, Vasudha; Ha, Taekjip; Timmermans, Marja C P

    2016-08-01

    Deciphering complex biological processes markedly benefits from approaches that directly assess the underlying biomolecular interactions. Most commonly used approaches to monitor protein-protein interactions typically provide nonquantitative readouts that lack statistical power and do not yield information on the heterogeneity or stoichiometry of protein complexes. Single-molecule pull-down (SiMPull) uses single-molecule fluorescence detection to mitigate these disadvantages and can quantitatively interrogate interactions between proteins and other compounds, such as nucleic acids, small molecule ligands, and lipids. Here, we establish SiMPull in plants using the HOMEODOMAIN LEUCINE ZIPPER III (HD-ZIPIII) and LITTLE ZIPPER (ZPR) interaction as proof-of-principle. Colocalization analysis of fluorophore-tagged HD-ZIPIII and ZPR proteins provides strong statistical evidence of complex formation. In addition, we use SiMPull to directly quantify YFP and mCherry maturation probabilities, showing these differ substantially from values obtained in mammalian systems. Leveraging these probabilities, in conjunction with fluorophore photobleaching assays on over 2000 individual complexes, we determined HD-ZIPIII:ZPR stoichiometry. Intriguingly, these complexes appear as heterotetramers, comprising two HD-ZIPIII and two ZPR molecules, rather than heterodimers as described in the current model. This surprising result raises new questions about the regulation of these key developmental factors and is illustrative of the unique contribution SiMPull is poised to make to in planta protein interaction studies. © 2016 American Society of Plant Biologists. All rights reserved.

  19. MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW

    Directory of Open Access Journals (Sweden)

    Tobias von der Haar

    2012-04-01

    Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

  20. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  1. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  2. Linking Complex Problem Solving and General Mental Ability to Career Advancement: Does a Transversal Skill Reveal Incremental Predictive Validity?

    Science.gov (United States)

    Mainert, Jakob; Kretzschmar, André; Neubert, Jonas C.; Greiff, Samuel

    2015-01-01

    Transversal skills, such as complex problem solving (CPS) are viewed as central twenty-first-century skills. Recent empirical findings have already supported the importance of CPS for early academic advancement. We wanted to determine whether CPS could also contribute to the understanding of career advancement later in life. Towards this end, we…

  3. Human insulin analogues modified at the B26 site reveal a hormone conformation that is undetected in the receptor complex

    Czech Academy of Sciences Publication Activity Database

    Žáková, Lenka; Kletvíková, Emília; Lepšík, Martin; Collinsová, Michaela; Watson, C. J.; Turkenburg, J. P.; Jiráček, Jiří; Brzozowski, A. M.

    2014-01-01

    Roč. 70, č. 10 (2014), s. 2765-2774 ISSN 0907-4449 R&D Projects: GA ČR GPP207/11/P430; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : insulin * insulin receptor * complex * active form * analog * structure Subject RIV: CE - Biochemistry Impact factor: 7.232, year: 2013

  4. fMRI Reveals Distinct CNS Processing during Symptomatic and Recovered Complex Regional Pain Syndrome in Children

    Science.gov (United States)

    Lebel, A.; Becerra, L.; Wallin, D.; Moulton, E. A.; Morris, S.; Pendse, G.; Jasciewicz, J.; Stein, M.; Aiello-Lammens, M.; Grant, E.; Berde, C.; Borsook, D.

    2008-01-01

    Complex regional pain syndrome (CRPS) in paediatric patients is clinically distinct from the adult condition in which there is often complete resolution of its signs and symptoms within several months to a few years. The ability to compare the symptomatic and asymptomatic condition in the same individuals makes this population interesting for the…

  5. Defining Translational Reprogramming in Tuberous Sclerosis Complex

    Science.gov (United States)

    2015-07-01

    ribosomes revealed discontinuous electron density of nascent chains after ~4 amino acids below the PTC [24], a strong indication of ribosome plasticity... plasm ids and co llected before heat shock (HS) or 2.5 h after heat shock (43 •c, 1 h). Top bands are uncleaved MRPL18 precursors. )3-actin is a I

  6. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a stu...

  7. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  8. Subtle spectral effects accompanying the assembly of bacteriochlorophylls into cyclic light harvesting complexes revealed by high-resolution fluorescence spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Rätsep, Margus, E-mail: margus.ratsep@ut.ee; Pajusalu, Mihkel, E-mail: mihkel.pajusalu@ut.ee; Linnanto, Juha Matti, E-mail: juha.matti.linnanto@ut.ee [Institute of Physics, University of Tartu, Riia 142, 51014 Tartu (Estonia); Freiberg, Arvi, E-mail: arvi.freiberg@ut.ee [Institute of Physics, University of Tartu, Riia 142, 51014 Tartu, Estonia and Institute of Molecular and Cell Biology, University of Tartu, Riia 23, 51010 Tartu (Estonia)

    2014-10-21

    We have observed that an assembly of the bacteriochloropyll a molecules into B850 and B875 groups of cyclic bacterial light-harvesting complexes LH2 and LH1, respectively, results an almost total loss of the intra-molecular vibronic structure in the fluorescence spectrum, and simultaneously, an essential enhancement of its phonon sideband due to electron-phonon coupling. While the suppression of the vibronic coupling in delocalized (excitonic) molecular systems is predictable, as also confirmed by our model calculations, a boost of the electron-phonon coupling is rather unexpected. The latter phenomenon is explained by exciton self-trapping, promoted by mixing the molecular exciton states with charge transfer states between the adjacent chromophores in the tightly packed B850 and B875 arrangements. Similar, although less dramatic trends were noted for the light-harvesting complexes containing chlorophyll pigments.

  9. The Proteome of the Isolated Chlamydia trachomatis Containing Vacuole Reveals a Complex Trafficking Platform Enriched for Retromer Components.

    Directory of Open Access Journals (Sweden)

    Lukas Aeberhard

    2015-06-01

    Full Text Available Chlamydia trachomatis is an important human pathogen that replicates inside the infected host cell in a unique vacuole, the inclusion. The formation of this intracellular bacterial niche is essential for productive Chlamydia infections. Despite its importance for Chlamydia biology, a holistic view on the protein composition of the inclusion, including its membrane, is currently missing. Here we describe the host cell-derived proteome of isolated C. trachomatis inclusions by quantitative proteomics. Computational analysis indicated that the inclusion is a complex intracellular trafficking platform that interacts with host cells' antero- and retrograde trafficking pathways. Furthermore, the inclusion is highly enriched for sorting nexins of the SNX-BAR retromer, a complex essential for retrograde trafficking. Functional studies showed that in particular, SNX5 controls the C. trachomatis infection and that retrograde trafficking is essential for infectious progeny formation. In summary, these findings suggest that C. trachomatis hijacks retrograde pathways for effective infection.

  10. Crystal structure of a TAPBPR–MHC I complex reveals the mechanism of peptide editing in antigen presentation

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Jiansheng; Natarajan, Kannan; Boyd, Lisa F.; Morozov, Giora I.; Mage, Michael G.; Margulies, David H. (NIH); (Hebrew)

    2017-10-12

    Central to CD8+ T cell–mediated immunity is the recognition of peptide–major histocompatibility complex class I (p–MHC I) proteins displayed by antigen-presenting cells. Chaperone-mediated loading of high-affinity peptides onto MHC I is a key step in the MHC I antigen presentation pathway. However, the structure of MHC I with a chaperone that facilitates peptide loading has not been determined. We report the crystal structure of MHC I in complex with the peptide editor TAPBPR (TAP-binding protein–related), a tapasin homolog. TAPBPR remodels the peptide-binding groove of MHC I, resulting in the release of low-affinity peptide. Changes include groove relaxation, modifications of key binding pockets, and domain adjustments. This structure captures a peptide-receptive state of MHC I and provides insights into the mechanism of peptide editing by TAPBPR and, by analogy, tapasin.

  11. Crystal structure of tabtoxin resistance protein complexed with acetyl coenzyme A reveals the mechanism for beta-lactam acetylation.

    Science.gov (United States)

    He, Hongzhen; Ding, Yi; Bartlam, Mark; Sun, Fei; Le, Yi; Qin, Xincheng; Tang, Hong; Zhang, Rongguang; Joachimiak, Andrzej; Liu, Jinyuan; Zhao, Nanming; Rao, Zihe

    2003-01-31

    Tabtoxin resistance protein (TTR) is an enzyme that renders tabtoxin-producing pathogens, such as Pseudomonas syringae, tolerant to their own phytotoxins. Here, we report the crystal structure of TTR complexed with its natural cofactor, acetyl coenzyme A (AcCoA), to 1.55A resolution. The binary complex forms a characteristic "V" shape for substrate binding and contains the four motifs conserved in the GCN5-related N-acetyltransferase (GNAT) superfamily, which also includes the histone acetyltransferases (HATs). A single-step mechanism is proposed to explain the function of three conserved residues, Glu92, Asp130 and Tyr141, in catalyzing the acetyl group transfer to its substrate. We also report that TTR possesses HAT activity and suggest an evolutionary relationship between TTR and other GNAT members.

  12. Crystal structure of tabtoxin resistance protein complexed with acetyl coenzyme A reveals the mechanism for {beta}-lactam acetylation.

    Energy Technology Data Exchange (ETDEWEB)

    He, H.; Ding, Y.; Bartlam, M.; Sun, F.; Le, Y.; Qin, X.; Tang, H.; Zhang, R.; Joachimiak, A.; Liu, J.; Zhao, N.; Rao, Z.; Biosciences Division; Tsinghua Univ.; Chinese Academy of Science

    2003-01-31

    Tabtoxin resistance protein (TTR) is an enzyme that renders tabtoxin-producing pathogens, such as Pseudomonas syringae, tolerant to their own phytotoxins. Here, we report the crystal structure of TTR complexed with its natural cofactor, acetyl coenzyme A (AcCoA), to 1.55 {angstrom} resolution. The binary complex forms a characteristic 'V' shape for substrate binding and contains the four motifs conserved in the GCN5-related N-acetyltransferase (GNAT) superfamily, which also includes the histone acetyltransferases (HATs). A single-step mechanism is proposed to explain the function of three conserved residues, Glu92, Asp130 and Tyr141, in catalyzing the acetyl group transfer to its substrate. We also report that TTR possesses HAT activity and suggest an evolutionary relationship between TTR and other GNAT members.

  13. High-resolution crystal structure of Streptococcus pyogenes β-NAD{sup +} glycohydrolase in complex with its endogenous inhibitor IFS reveals a highly water-rich interface

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Young; An, Doo Ri; Yoon, Hye-Jin [Seoul National University, Seoul 151-747 (Korea, Republic of); Kim, Hyoun Sook [Seoul National University, Seoul 151-747 (Korea, Republic of); Seoul National University, Seoul 151-742 (Korea, Republic of); Lee, Sang Jae [Seoul National University, Seoul 151-742 (Korea, Republic of); Im, Ha Na; Jang, Jun Young [Seoul National University, Seoul 151-747 (Korea, Republic of); Suh, Se Won, E-mail: sewonsuh@snu.ac.kr [Seoul National University, Seoul 151-747 (Korea, Republic of); Seoul National University, Seoul 151-747 (Korea, Republic of)

    2013-11-01

    The crystal structure of the complex between the C-terminal domain of Streptococcus pyogenes β-NAD{sup +} glycohydrolase and an endogenous inhibitor for SPN was determined at 1.70 Å. It reveals that the interface between the two proteins is highly rich in water molecules. One of the virulence factors produced by Streptococcus pyogenes is β-NAD{sup +} glycohydrolase (SPN). S. pyogenes injects SPN into the cytosol of an infected host cell using the cytolysin-mediated translocation pathway. As SPN is toxic to bacterial cells themselves, S. pyogenes possesses the ifs gene that encodes an endogenous inhibitor for SPN (IFS). IFS is localized intracellularly and forms a complex with SPN. This intracellular complex must be dissociated during export through the cell envelope. To provide a structural basis for understanding the interactions between SPN and IFS, the complex was overexpressed between the mature SPN (residues 38–451) and the full-length IFS (residues 1–161), but it could not be crystallized. Therefore, limited proteolysis was used to isolate a crystallizable SPN{sub ct}–IFS complex, which consists of the SPN C-terminal domain (SPN{sub ct}; residues 193–451) and the full-length IFS. Its crystal structure has been determined by single anomalous diffraction and the model refined at 1.70 Å resolution. Interestingly, our high-resolution structure of the complex reveals that the interface between SPN{sub ct} and IFS is highly rich in water molecules and many of the interactions are water-mediated. The wet interface may facilitate the dissociation of the complex for translocation across the cell envelope.

  14. High-resolution crystal structure of Streptococcus pyogenes β-NAD+ glycohydrolase in complex with its endogenous inhibitor IFS reveals a highly water-rich interface

    International Nuclear Information System (INIS)

    Yoon, Ji Young; An, Doo Ri; Yoon, Hye-Jin; Kim, Hyoun Sook; Lee, Sang Jae; Im, Ha Na; Jang, Jun Young; Suh, Se Won

    2013-01-01

    The crystal structure of the complex between the C-terminal domain of Streptococcus pyogenes β-NAD + glycohydrolase and an endogenous inhibitor for SPN was determined at 1.70 Å. It reveals that the interface between the two proteins is highly rich in water molecules. One of the virulence factors produced by Streptococcus pyogenes is β-NAD + glycohydrolase (SPN). S. pyogenes injects SPN into the cytosol of an infected host cell using the cytolysin-mediated translocation pathway. As SPN is toxic to bacterial cells themselves, S. pyogenes possesses the ifs gene that encodes an endogenous inhibitor for SPN (IFS). IFS is localized intracellularly and forms a complex with SPN. This intracellular complex must be dissociated during export through the cell envelope. To provide a structural basis for understanding the interactions between SPN and IFS, the complex was overexpressed between the mature SPN (residues 38–451) and the full-length IFS (residues 1–161), but it could not be crystallized. Therefore, limited proteolysis was used to isolate a crystallizable SPN ct –IFS complex, which consists of the SPN C-terminal domain (SPN ct ; residues 193–451) and the full-length IFS. Its crystal structure has been determined by single anomalous diffraction and the model refined at 1.70 Å resolution. Interestingly, our high-resolution structure of the complex reveals that the interface between SPN ct and IFS is highly rich in water molecules and many of the interactions are water-mediated. The wet interface may facilitate the dissociation of the complex for translocation across the cell envelope

  15. Chemical genetics analysis of an aniline mustard anticancer agent reveals complex I of the electron transport chain as a target.

    Science.gov (United States)

    Fedeles, Bogdan I; Zhu, Angela Y; Young, Kellie S; Hillier, Shawn M; Proffitt, Kyle D; Essigmann, John M; Croy, Robert G

    2011-09-30

    The antitumor agent 11β (CAS 865070-37-7), consisting of a DNA-damaging aniline mustard linked to an androgen receptor (AR) ligand, is known to form covalent DNA adducts and to induce apoptosis potently in AR-positive prostate cancer cells in vitro; it also strongly prevents growth of LNCaP xenografts in mice. The present study describes the unexpectedly strong activity of 11β against the AR-negative HeLa cells, both in cell culture and tumor xenografts, and uncovers a new mechanism of action that likely explains this activity. Cellular fractionation experiments indicated that mitochondria are the major intracellular sink for 11β; flow cytometry studies showed that 11β exposure rapidly induced oxidative stress, mitochondria being an important source of reactive oxygen species (ROS). Additionally, 11β inhibited oxygen consumption both in intact HeLa cells and in isolated mitochondria. Specifically, 11β blocked uncoupled oxygen consumption when mitochondria were incubated with complex I substrates, but it had no effect on oxygen consumption driven by substrates acting downstream of complex I in the mitochondrial electron transport chain. Moreover, 11β enhanced ROS generation in isolated mitochondria, suggesting that complex I inhibition is responsible for ROS production. At the cellular level, the presence of antioxidants (N-acetylcysteine or vitamin E) significantly reduced the toxicity of 11β, implicating ROS production as an important contributor to cytotoxicity. Collectively, our findings establish complex I inhibition and ROS generation as a new mechanism of action for 11β, which supplements conventional DNA adduct formation to promote cancer cell death.

  16. Chess players' eye movements reveal rapid recognition of complex visual patterns: Evidence from a chess-related visual search task.

    Science.gov (United States)

    Sheridan, Heather; Reingold, Eyal M

    2017-03-01

    To explore the perceptual component of chess expertise, we monitored the eye movements of expert and novice chess players during a chess-related visual search task that tested anecdotal reports that a key differentiator of chess skill is the ability to visualize the complex moves of the knight piece. Specifically, chess players viewed an array of four minimized chessboards, and they rapidly searched for the target board that allowed a knight piece to reach a target square in three moves. On each trial, there was only one target board (i.e., the "Yes" board), and for the remaining "lure" boards, the knight's path was blocked on either the first move (the "Easy No" board) or the second move (i.e., "the Difficult No" board). As evidence that chess experts can rapidly differentiate complex chess-related visual patterns, the experts (but not the novices) showed longer first-fixation durations on the "Yes" board relative to the "Difficult No" board. Moreover, as hypothesized, the task strongly differentiated chess skill: Reaction times were more than four times faster for the experts relative to novices, and reaction times were correlated with within-group measures of expertise (i.e., official chess ratings, number of hours of practice). These results indicate that a key component of chess expertise is the ability to rapidly recognize complex visual patterns.

  17. Neurog1 Genetic Inducible Fate Mapping (GIFM) Reveals the Existence of Complex Spatiotemporal Cyto-Architectures in the Developing Cerebellum.

    Science.gov (United States)

    Obana, Edwin A; Lundell, Travis G; Yi, Kevin J; Radomski, Kryslaine L; Zhou, Qiong; Doughty, Martin L

    2015-06-01

    Neurog1 is a pro-neural basic helix-loop-helix (bHLH) transcription factor expressed in progenitor cells located in the ventricular zone and subsequently the presumptive white matter tracts of the developing mouse cerebellum. We used genetic inducible fate mapping (GIFM) with a transgenic Neurog1-CreER allele to characterize the contributions of Neurog1 lineages to cerebellar circuit formation in mice. GIFM reveals Neurog1-expressing progenitors are fate-mapped to become Purkinje cells and all GABAergic interneuron cell types of the cerebellar cortex but not glia. The spatiotemporal sequence of GIFM is unique to each neuronal cell type. GIFM on embryonic days (E) 10.5 to E12.5 labels Purkinje cells with different medial-lateral settling patterns depending on the day of tamoxifen delivery. GIFM on E11.5 to P7 labels interneurons and the timing of tamoxifen administration correlates with the final inside-to-outside resting position of GABAergic interneurons in the cerebellar cortex. Proliferative status and long-term BrdU retention of GIFM lineages reveals Purkinje cells express Neurog1 around the time they become post-mitotic. In contrast, GIFM labels mitotic and post-mitotic interneurons. Neurog1-CreER GIFM reveals a correlation between the timing of Neurog1 expression and the spatial organization of GABAergic neurons in the cerebellar cortex with possible implications for cerebellar circuit assembly.

  18. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  19. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  20. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  1. Ribosomal DNA, heterochromatin, and correlation with genome size in diploid and polyploid North American endemic sagebrushes (Artemisia, Asteraceae)

    Science.gov (United States)

    Sonia Garcia; Teresa Garnatje; Jaume Pellicer; E. Durant McArthur; Sonja Siljak-Yakovlev; Joan Valles

    2009-01-01

    Subgenus Tridentatae (Artemisia, Asteraceae) can be considered a polyploid complex. Both polyploidy and hybridization have been documented in the Tridentatae. Fluorescent in situ hybridization (FISH) and fluorochrome banding were used to detect and analyze ribosomal DNA changes linked to polyploidization in this group by studying four diploidpolyploid species pairs. In...

  2. Crystal structure of equine serum albumin in complex with cetirizine reveals a novel drug-binding site

    OpenAIRE

    Handing, Katarzyna B.; Shabalin, Ivan G.; Szlachta, Karol; Majorek, Karolina A.; Minor, Wladek

    2016-01-01

    Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1 ?. Cetirizine is bound in two sites ? a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizi...

  3. Two conformational states of the membrane-associated Bacillus thuringiensis Cry4Ba δ-endotoxin complex revealed by electron crystallography: Implications for toxin-pore formation

    International Nuclear Information System (INIS)

    Ounjai, Puey; Unger, Vinzenz M.; Sigworth, Fred J.; Angsuthanasombat, Chanan

    2007-01-01

    The insecticidal nature of Cry δ-endotoxins produced by Bacillus thuringiensis is generally believed to be caused by their ability to form lytic pores in the midgut cell membrane of susceptible insect larvae. Here we have analyzed membrane-associated structures of the 65-kDa dipteran-active Cry4Ba toxin by electron crystallography. The membrane-associated toxin complex was crystallized in the presence of DMPC via detergent dialysis. Depending upon the charge of the adsorbed surface, 2D crystals of the oligomeric toxin complex have been captured in two distinct conformations. The projection maps of those crystals have been generated at 17 A resolution. Both complexes appeared to be trimeric; as in one crystal form, its projection structure revealed a symmetrical pinwheel-like shape with virtually no depression in the middle of the complex. The other form revealed a propeller-like conformation displaying an obvious hole in the center region, presumably representing the toxin-induced pore. These crystallographic data thus demonstrate for the first time that the 65-kDa activated Cry4Ba toxin in association with lipid membranes could exist in at least two different trimeric conformations, conceivably implying the closed and open states of the pore

  4. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  5. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  6. Phosphoproteome analysis of functional mitochondria isolated from resting human muscle reveals extensive phosphorylation of inner membrane protein complexes and enzymes

    DEFF Research Database (Denmark)

    Zhao, Xiaolu; Leon, Ileana R; Bak, Steffen

    2011-01-01

    . In skeletal muscle, mitochondrial dysfunction is linked to insulin resistance in humans with obesity and type 2 diabetes. We performed a phosphoproteomic study of functional mitochondria isolated from human muscle biopsies with the aim to obtain a comprehensive overview of mitochondrial phosphoproteins...... in insulin resistance. We also assigned phosphorylation sites in mitochondrial proteins involved in amino acid degradation, importers and transporters, calcium homeostasis, and apoptosis. Bioinformatics analysis of kinase motifs revealed that many of these mitochondrial phosphoproteins are substrates....... Future comparative phosphoproteome analysis of mitochondria from healthy and diseased individuals will provide insights into the role of abnormal phosphorylation in pathologies, such as type 2 diabetes....

  7. Complex network models reveal correlations among network metrics, exercise intensity and role of body changes in the fatigue process

    Science.gov (United States)

    Pereira, Vanessa Helena; Gama, Maria Carolina Traina; Sousa, Filipe Antônio Barros; Lewis, Theodore Gyle; Gobatto, Claudio Alexandre; Manchado-Gobatto, Fúlvia Barros

    2015-05-01

    The aims of the present study were analyze the fatigue process at distinct intensity efforts and to investigate its occurrence as interactions at distinct body changes during exercise, using complex network models. For this, participants were submitted to four different running intensities until exhaustion, accomplished in a non-motorized treadmill using a tethered system. The intensities were selected according to critical power model. Mechanical (force, peak power, mean power, velocity and work) and physiological related parameters (heart rate, blood lactate, time until peak blood lactate concentration (lactate time), lean mass, anaerobic and aerobic capacities) and IPAQ score were obtained during exercises and it was used to construction of four complex network models. Such models have both, theoretical and mathematical value, and enables us to perceive new insights that go beyond conventional analysis. From these, we ranked the influences of each node at the fatigue process. Our results shows that nodes, links and network metrics are sensibility according to increase of efforts intensities, been the velocity a key factor to exercise maintenance at models/intensities 1 and 2 (higher time efforts) and force and power at models 3 and 4, highlighting mechanical variables in the exhaustion occurrence and even training prescription applications.

  8. Quantitative FLIM-FRET Microscopy to Monitor Nanoscale Chromatin Compaction In Vivo Reveals Structural Roles of Condensin Complexes

    Directory of Open Access Journals (Sweden)

    David Llères

    2017-02-01

    Full Text Available How metazoan genomes are structured at the nanoscale in living cells and tissues remains unknown. Here, we adapted a quantitative FRET (Förster resonance energy transfer-based fluorescence lifetime imaging microscopy (FLIM approach to assay nanoscale chromatin compaction in living organisms. Caenorhabditis elegans was chosen as a model system. By measuring FRET between histone-tagged fluorescent proteins, we visualized distinct chromosomal regions and quantified the different levels of nanoscale compaction in meiotic cells. Using RNAi and repetitive extrachromosomal array approaches, we defined the heterochromatin state and showed that its architecture presents a nanoscale-compacted organization controlled by Heterochromatin Protein-1 (HP1 and SETDB1 H3-lysine-9 methyltransferase homologs in vivo. Next, we functionally explored condensin complexes. We found that condensin I and condensin II are essential for heterochromatin compaction and that condensin I additionally controls lowly compacted regions. Our data show that, in living animals, nanoscale chromatin compaction is controlled not only by histone modifiers and readers but also by condensin complexes.

  9. Joint cross-correlation analysis reveals complex, time-dependent functional relationship between cortical neurons and arm electromyograms

    Science.gov (United States)

    Zhuang, Katie Z.; Lebedev, Mikhail A.

    2014-01-01

    Correlation between cortical activity and electromyographic (EMG) activity of limb muscles has long been a subject of neurophysiological studies, especially in terms of corticospinal connectivity. Interest in this issue has recently increased due to the development of brain-machine interfaces with output signals that mimic muscle force. For this study, three monkeys were implanted with multielectrode arrays in multiple cortical areas. One monkey performed self-timed touch pad presses, whereas the other two executed arm reaching movements. We analyzed the dynamic relationship between cortical neuronal activity and arm EMGs using a joint cross-correlation (JCC) analysis that evaluated trial-by-trial correlation as a function of time intervals within a trial. JCCs revealed transient correlations between the EMGs of multiple muscles and neural activity in motor, premotor and somatosensory cortical areas. Matching results were obtained using spike-triggered averages corrected by subtracting trial-shuffled data. Compared with spike-triggered averages, JCCs more readily revealed dynamic changes in cortico-EMG correlations. JCCs showed that correlation peaks often sharpened around movement times and broadened during delay intervals. Furthermore, JCC patterns were directionally selective for the arm-reaching task. We propose that such highly dynamic, task-dependent and distributed relationships between cortical activity and EMGs should be taken into consideration for future brain-machine interfaces that generate EMG-like signals. PMID:25210153

  10. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  11. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  12. The cognitive complexity of concurrent cognitive-motor tasks reveals age-related deficits in motor performance

    DEFF Research Database (Denmark)

    Oliveira, Anderson Souza; Reiche, Mikkel Staall; Vinescu, Cristina Ioana

    2018-01-01

    Aging reduces cognitive functions, and such impairments have implications in mental and motor performance. Cognitive function has been recently linked to the risk of falls in older adults. Physical activities have been used to attenuate the declines in cognitive functions and reduce fall incidence......, but little is known whether a physically active lifestyle can maintain physical performance under cognitively demanding conditions. The aim of this study was to verify whether physically active older adults present similar performance deficits during upper limb response time and precision stepping walking...... tasks when compared to younger adults. Both upper limb and walking tasks involved simple and complex cognitive demands through decision-making. For both tasks, decision-making was assessed by including a distracting factor to the execution. The results showed that older adults were substantially slower...

  13. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui.

    Science.gov (United States)

    Hatakeyama, T; Kimura, M

    1988-03-15

    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  14. Long non-coding RNA discovery across the genus anopheles reveals conserved secondary structures within and beyond the Gambiae complex.

    Science.gov (United States)

    Jenkins, Adam M; Waterhouse, Robert M; Muskavitch, Marc A T

    2015-04-23

    Long non-coding RNAs (lncRNAs) have been defined as mRNA-like transcripts longer than 200 nucleotides that lack significant protein-coding potential, and many of them constitute scaffolds for ribonucleoprotein complexes with critical roles in epigenetic regulation. Various lncRNAs have been implicated in the modulation of chromatin structure, transcriptional and post-transcriptional gene regulation, and regulation of genomic stability in mammals, Caenorhabditis elegans, and Drosophila melanogaster. The purpose of this study is to identify the lncRNA landscape in the malaria vector An. gambiae and assess the evolutionary conservation of lncRNAs and their secondary structures across the Anopheles genus. Using deep RNA sequencing of multiple Anopheles gambiae life stages, we have identified 2,949 lncRNAs and more than 300 previously unannotated putative protein-coding genes. The lncRNAs exhibit differential expression profiles across life stages and adult genders. We find that across the genus Anopheles, lncRNAs display much lower sequence conservation than protein-coding genes. Additionally, we find that lncRNA secondary structure is highly conserved within the Gambiae complex, but diverges rapidly across the rest of the genus Anopheles. This study offers one of the first lncRNA secondary structure analyses in vector insects. Our description of lncRNAs in An. gambiae offers the most comprehensive genome-wide insights to date into lncRNAs in this vector mosquito, and defines a set of potential targets for the development of vector-based interventions that may further curb the human malaria burden in disease-endemic countries.

  15. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  16. A Polychaete’s Powerful Punch: Venom Gland Transcriptomics of Glycera Reveals a Complex Cocktail of Toxin Homologs

    Science.gov (United States)

    von Reumont, Björn M.; Richter, Sandy; Hering, Lars; Sykes, Dan; Hetmank, Jörg; Jenner, Ronald A.; Bleidorn, Christoph

    2014-01-01

    Glycerids are marine annelids commonly known as bloodworms. Bloodworms have an eversible proboscis adorned with jaws connected to venom glands. Bloodworms prey on invertebrates, and it is known that the venom glands produce compounds that can induce toxic effects in animals. Yet, none of these putative toxins has been characterized on a molecular basis. Here we present the transcriptomic profiles of the venom glands of three species of bloodworm, Glycera dibranchiata, Glycera fallax and Glycera tridactyla, as well as the body tissue of G. tridactyla. The venom glands express a complex mixture of transcripts coding for putative toxin precursors. These transcripts represent 20 known toxin classes that have been convergently recruited into animal venoms, as well as transcripts potentially coding for Glycera-specific toxins. The toxins represent five functional categories: Pore-forming and membrane-disrupting toxins, neurotoxins, protease inhibitors, other enzymes, and CAP domain toxins. Many of the transcripts coding for putative Glycera toxins belong to classes that have been widely recruited into venoms, but some are homologs of toxins previously only known from the venoms of scorpaeniform fish and monotremes (stonustoxin-like toxin), turrid gastropods (turripeptide-like peptides), and sea anemones (gigantoxin I-like neurotoxin). This complex mixture of toxin homologs suggests that bloodworms employ venom while predating on macroscopic prey, casting doubt on the previously widespread opinion that G. dibranchiata is a detritivore. Our results further show that researchers should be aware that different assembly methods, as well as different methods of homology prediction, can influence the transcriptomic profiling of venom glands. PMID:25193302

  17. Dissection of the complex phenotype in cuticular mutants of Arabidopsis reveals a role of SERRATE as a mediator.

    Directory of Open Access Journals (Sweden)

    Derry Voisin

    2009-10-01

    Full Text Available Mutations in LACERATA (LCR, FIDDLEHEAD (FDH, and BODYGUARD (BDG cause a complex developmental syndrome that is consistent with an important role for these Arabidopsis genes in cuticle biogenesis. The genesis of their pleiotropic phenotypes is, however, poorly understood. We provide evidence that neither distorted depositions of cutin, nor deficiencies in the chemical composition of cuticular lipids, account for these features, instead suggesting that the mutants alleviate the functional disorder of the cuticle by reinforcing their defenses. To better understand how plants adapt to these mutations, we performed a genome-wide gene expression analysis. We found that apparent compensatory transcriptional responses in these mutants involve the induction of wax, cutin, cell wall, and defense genes. To gain greater insight into the mechanism by which cuticular mutations trigger this response in the plants, we performed an overlap meta-analysis, which is termed MASTA (MicroArray overlap Search Tool and Analysis, of differentially expressed genes. This suggested that different cell integrity pathways are recruited in cesA cellulose synthase and cuticular mutants. Using MASTA for an in silico suppressor/enhancer screen, we identified SERRATE (SE, which encodes a protein of RNA-processing multi-protein complexes, as a likely enhancer. In confirmation of this notion, the se lcr and se bdg double mutants eradicate severe leaf deformations as well as the organ fusions that are typical of lcr and bdg and other cuticular mutants. Also, lcr does not confer resistance to Botrytis cinerea in a se mutant background. We propose that there is a role for SERRATE-mediated RNA signaling in the cuticle integrity pathway.

  18. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    Science.gov (United States)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.

    2017-02-01

    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  19. Dynamics of metal-humate complexation equilibria as revealed by isotope exchange studies - a matter of concentration and time

    Science.gov (United States)

    Lippold, Holger; Eidner, Sascha; Kumke, Michael U.; Lippmann-Pipke, Johanna

    2017-01-01

    Complexation with dissolved humic matter can be crucial in controlling the mobility of toxic or radioactive contaminant metals. For speciation and transport modelling, a dynamic equilibrium process is commonly assumed, where association and dissociation run permanently. This is, however, questionable in view of reported observations of a growing resistance to dissociation over time. In this study, the isotope exchange principle was employed to gain direct insight into the dynamics of the complexation equilibrium, including kinetic inertisation phenomena. Terbium(III), an analogue of trivalent actinides, was used as a representative of higher-valent metals. Isotherms of binding to (flocculated) humic acid, determined by means of 160Tb as a radiotracer, were found to be identical regardless of whether the radioisotope was introduced together with the bulk of stable 159Tb or subsequently after pre-equilibration for up to 3 months. Consequently, there is a permanent exchange of free and humic-bound Tb since all available binding sites are occupied in the plateau region of the isotherm. The existence of a dynamic equilibrium was thus evidenced. There was no indication of an inertisation under these experimental conditions. If the small amount of 160Tb was introduced prior to saturation with 159Tb, the expected partial desorption of 160Tb occurred at much lower rates than observed for the equilibration process in the reverse procedure. In addition, the rates decreased with time of pre-equilibration. Inertisation phenomena are thus confined to the stronger sites of humic molecules (occupied at low metal concentrations). Analysing the time-dependent course of isotope exchange according to first-order kinetics indicated that up to 3 years are needed to attain equilibrium. Since, however, metal-humic interaction remains reversible, exchange of metals between humic carriers and mineral surfaces cannot be neglected on the long time scale to be considered in predictive

  20. Catch and Release: A dense, longitudinal array of water quality sondes reveals spatial and temporal complexities in suspended sediment flux

    Science.gov (United States)

    Guilinger, J. J.; Crosby, B. T.

    2017-12-01

    Excessive suspended sediment in streams is one of the most common causes for industrial, ecological and recreational stream impairment in the US. Identifying the primary geomorphic or anthropogenic sources of sediment is a key step in the effective mitigation of impairment. This study seeks to identify sources of suspended sediment in an agriculturally impaired watershed, Marsh Creek, in southeast Idaho. We employ thirteen multi-parameter water quality sensors to simultaneously measure stage, turbidity, temperature and conductivity every 15 minutes over a full calendar year. Examined at both the event and annual scale, these data enable mass balance calculations for mainstem and tributary contributions. Revealed in this monitoring is an approximately eight-fold longitudinal increase in sediment flux over 74 km that is largely augmented by eroding mainstem banks in reaches with higher stream power in the lower 30 km, with less than 20% contributed from tributaries. Independent data confirming the bank source were acquired through cost-effective sediment fingerprinting using 15N and C:N signatures from potential soil endmembers. Additionally, Google Street View-type longitudinal imagery of banks was collected via a kayak survey to confirm the spatial extent and magnitude of bank erosion along Marsh Creek. These data converge on bank erosion as the primary source of fine sediment. Sediment load at various hierarchical temporal and spatial scales is impacted by in-stream storage and remobilization, especially over shorter timescales ranging from daily to seasonal periods. Once averaged over the annual scale, local, temporary in-channel storage is overcome and these data reveal source reaches that can be prioritized for restoration and mitigation projects.

  1. Comparative sequence analyses of the major quantitative trait locus phosphorus uptake 1 (Pup1) reveal a complex genetic structure.

    Science.gov (United States)

    Heuer, Sigrid; Lu, Xiaochun; Chin, Joong Hyoun; Tanaka, Juan Pariasca; Kanamori, Hiroyuki; Matsumoto, Takashi; De Leon, Teresa; Ulat, Victor Jun; Ismail, Abdelbagi M; Yano, Masahiro; Wissuwa, Matthias

    2009-06-01

    The phosphorus uptake 1 (Pup1) locus was identified as a major quantitative trait locus (QTL) for tolerance of phosphorus deficiency in rice. Near-isogenic lines with the Pup1 region from tolerant donor parent Kasalath typically show threefold higher phosphorus uptake and grain yield in phosphorus-deficient field trials than the intolerant parent Nipponbare. In this study, we report the fine mapping of the Pup1 locus to the long arm of chromosome 12 (15.31-15.47 Mb). Genes in the region were initially identified on the basis of the Nipponbare reference genome, but did not reveal any obvious candidate genes related to phosphorus uptake. Kasalath BAC clones were therefore sequenced and revealed a 278-kbp sequence significantly different from the syntenic regions in Nipponbare (145 kb) and in the indica reference genome of 93-11 (742 kbp). Size differences are caused by large insertions or deletions (INDELs), and an exceptionally large number of retrotransposon and transposon-related elements (TEs) present in all three sequences (45%-54%). About 46 kb of the Kasalath sequence did not align with the entire Nipponbare genome, and only three Nipponbare genes (fatty acid alpha-dioxygenase, dirigent protein and aspartic proteinase) are highly conserved in Kasalath. Two Nipponbare genes (expressed proteins) might have evolved by at least three TE integrations in an ancestor gene that is still present in Kasalath. Several predicted Kasalath genes are novel or unknown genes that are mainly located within INDEL regions. Our results highlight the importance of sequencing QTL regions in the respective donor parent, as important genes might not be present in the current reference genomes.

  2. 13C ENDOR Spectroscopy of Lipoxygenase-Substrate Complexes Reveals the Structural Basis for C-H Activation by Tunneling.

    Science.gov (United States)

    Horitani, Masaki; Offenbacher, Adam R; Carr, Cody A Marcus; Yu, Tao; Hoeke, Veronika; Cutsail, George E; Hammes-Schiffer, Sharon; Klinman, Judith P; Hoffman, Brian M

    2017-02-08

    In enzymatic C-H activation by hydrogen tunneling, reduced barrier width is important for efficient hydrogen wave function overlap during catalysis. For native enzymes displaying nonadiabatic tunneling, the dominant reactive hydrogen donor-acceptor distance (DAD) is typically ca. 2.7 Å, considerably shorter than normal van der Waals distances. Without a ground state substrate-bound structure for the prototypical nonadiabatic tunneling system, soybean lipoxygenase (SLO), it has remained unclear whether the requisite close tunneling distance occurs through an unusual ground state active site arrangement or by thermally sampling conformational substates. Herein, we introduce Mn 2+ as a spin-probe surrogate for the SLO Fe ion; X-ray diffraction shows Mn-SLO is structurally faithful to the native enzyme. 13 C ENDOR then reveals the locations of 13 C10 and reactive 13 C11 of linoleic acid relative to the metal; 1 H ENDOR and molecular dynamics simulations of the fully solvated SLO model using ENDOR-derived restraints give additional metrical information. The resulting three-dimensional representation of the SLO active site ground state contains a reactive (a) conformer with hydrogen DAD of ∼3.1 Å, approximately van der Waals contact, plus an inactive (b) conformer with even longer DAD, establishing that stochastic conformational sampling is required to achieve reactive tunneling geometries. Tunneling-impaired SLO variants show increased DADs and variations in substrate positioning and rigidity, confirming previous kinetic and theoretical predictions of such behavior. Overall, this investigation highlights the (i) predictive power of nonadiabatic quantum treatments of proton-coupled electron transfer in SLO and (ii) sensitivity of ENDOR probes to test, detect, and corroborate kinetically predicted trends in active site reactivity and to reveal unexpected features of active site architecture.

  3. Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep.

    Science.gov (United States)

    Harbison, Susan T; Serrano Negron, Yazmin L; Hansen, Nancy F; Lobell, Amanda S

    2017-12-01

    Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways-EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive.

  4. Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep.

    Directory of Open Access Journals (Sweden)

    Susan T Harbison

    2017-12-01

    Full Text Available Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways-EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive.

  5. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  6. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  7. Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

    Science.gov (United States)

    Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

    2017-01-01

    Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

  8. Structure of UreG/UreF/UreH Complex Reveals How Urease Accessory Proteins Facilitate Maturation of Helicobacter pylori Urease

    Science.gov (United States)

    Fong, Yu Hang; Wong, Ho Chun; Yuen, Man Hon; Lau, Pak Ho; Chen, Yu Wai; Wong, Kam-Bo

    2013-01-01

    Urease is a metalloenzyme essential for the survival of Helicobacter pylori in acidic gastric environment. Maturation of urease involves carbamylation of Lys219 and insertion of two nickel ions at its active site. This process requires GTP hydrolysis and the formation of a preactivation complex consisting of apo-urease and urease accessory proteins UreF, UreH, and UreG. UreF and UreH form a complex to recruit UreG, which is a SIMIBI class GTPase, to the preactivation complex. We report here the crystal structure of the UreG/UreF/UreH complex, which illustrates how UreF and UreH facilitate dimerization of UreG, and assembles its metal binding site by juxtaposing two invariant Cys66-Pro67-His68 metal binding motif at the interface to form the (UreG/UreF/UreH)2 complex. Interaction studies revealed that addition of nickel and GTP to the UreG/UreF/UreH complex releases a UreG dimer that binds a nickel ion at the dimeric interface. Substitution of Cys66 and His68 with alanine abolishes the formation of the nickel-charged UreG dimer. This nickel-charged UreG dimer can activate urease in vitro in the presence of the UreF/UreH complex. Static light scattering and atomic absorption spectroscopy measurements demonstrated that the nickel-charged UreG dimer, upon GTP hydrolysis, reverts to its monomeric form and releases nickel to urease. Based on our results, we propose a mechanism on how urease accessory proteins facilitate maturation of urease. PMID:24115911

  9. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  10. Proteomic analysis of HIV-1 Nef cellular binding partners reveals a role for exocyst complex proteins in mediating enhancement of intercellular nanotube formation

    Directory of Open Access Journals (Sweden)

    Mukerji Joya

    2012-06-01

    Full Text Available Abstract Background HIV-1 Nef protein contributes to pathogenesis via multiple functions that include enhancement of viral replication and infectivity, alteration of intracellular trafficking, and modulation of cellular signaling pathways. Nef stimulates formation of tunneling nanotubes and virological synapses, and is transferred to bystander cells via these intercellular contacts and secreted microvesicles. Nef associates with and activates Pak2, a kinase that regulates T-cell signaling and actin cytoskeleton dynamics, but how Nef promotes nanotube formation is unknown. Results To identify Nef binding partners involved in Pak2-association dependent Nef functions, we employed tandem mass spectrometry analysis of Nef immunocomplexes from Jurkat cells expressing wild-type Nef or Nef mutants defective for the ability to associate with Pak2 (F85L, F89H, H191F and A72P, A75P in NL4-3. We report that wild-type, but not mutant Nef, was associated with 5 components of the exocyst complex (EXOC1, EXOC2, EXOC3, EXOC4, and EXOC6, an octameric complex that tethers vesicles at the plasma membrane, regulates polarized exocytosis, and recruits membranes and proteins required for nanotube formation. Additionally, Pak2 kinase was associated exclusively with wild-type Nef. Association of EXOC1, EXOC2, EXOC3, and EXOC4 with wild-type, but not mutant Nef, was verified by co-immunoprecipitation assays in Jurkat cells. Furthermore, shRNA-mediated depletion of EXOC2 in Jurkat cells abrogated Nef-mediated enhancement of nanotube formation. Using bioinformatic tools, we visualized protein interaction networks that reveal functional linkages between Nef, the exocyst complex, and the cellular endocytic and exocytic trafficking machinery. Conclusions Exocyst complex proteins are likely a key effector of Nef-mediated enhancement of nanotube formation, and possibly microvesicle secretion. Linkages revealed between Nef and the exocyst complex suggest a new paradigm of

  11. Meiosis gene inventory of four ciliates reveals the prevalence of a synaptonemal complex-independent crossover pathway.

    Science.gov (United States)

    Chi, Jingyun; Mahé, Frédéric; Loidl, Josef; Logsdon, John; Dunthorn, Micah

    2014-03-01

    To establish which meiosis genes are present in ciliates, and to look for clues as to which recombination pathways may be treaded by them, four genomes were inventoried for 11 meiosis-specific and 40 meiosis-related genes. We found that the set of meiosis genes shared by Tetrahymena thermophila, Paramecium tetraurelia, Ichthyophthirius multifiliis, and Oxytricha trifallax is consistent with the prevalence of a Mus81-dependent class II crossover pathway that is considered secondary in most model eukaryotes. There is little evidence for a canonical class I crossover pathway that requires the formation of a synaptonemal complex (SC). This gene inventory suggests that meiotic processes in ciliates largely depend on mitotic repair proteins for executing meiotic recombination. We propose that class I crossovers and SCs were reduced sometime during the evolution of ciliates. Consistent with this reduction, we provide microscopic evidence for the presence only of degenerate SCs in Stylonychia mytilus. In addition, lower nonsynonymous to synonymous mutation rates of some of the meiosis genes suggest that, in contrast to most other nuclear genes analyzed so far, meiosis genes in ciliates are largely evolving at a slower rate than those genes in fungi and animals.

  12. Genomewide effects of peroxisome proliferator-activated receptor gamma in macrophages and dendritic cells--revealing complexity through systems biology.

    Science.gov (United States)

    Cuaranta-Monroy, Ixchelt; Kiss, Mate; Simandi, Zoltan; Nagy, Laszlo

    2015-09-01

    Systems biology approaches have become indispensable tools in biomedical and basic research. These data integrating bioinformatic methods gained prominence after high-throughput technologies became available to investigate complex cellular processes, such as transcriptional regulation and protein-protein interactions, on a scale that had not been studied before. Immunology is one of the medical fields that systems biology impacted profoundly due to the plasticity of cell types involved and the accessibility of a wide range of experimental models. In this review, we summarize the most important recent genomewide studies exploring the function of peroxisome proliferator-activated receptor γ in macrophages and dendritic cells. PPARγ ChIP-seq experiments were performed in adipocytes derived from embryonic stem cells to complement the existing data sets and to provide comparators to macrophage data. Finally, lists of regulated genes generated from such experiments were analysed with bioinformatics and system biology approaches. We show that genomewide studies utilizing high-throughput data acquisition methods made it possible to gain deeper insights into the role of PPARγ in these immune cell types. We also demonstrate that analysis and visualization of data using network-based approaches can be used to identify novel genes and functions regulated by the receptor. The example of PPARγ in macrophages and dendritic cells highlights the crucial importance of systems biology approaches in establishing novel cellular functions for long-known signaling pathways. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.

  13. Analyses of Dynein Heavy Chain Mutations Reveal Complex Interactions Between Dynein Motor Domains and Cellular Dynein Functions

    Science.gov (United States)

    Sivagurunathan, Senthilkumar; Schnittker, Robert R.; Razafsky, David S.; Nandini, Swaran; Plamann, Michael D.; King, Stephen J.

    2012-01-01

    Cytoplasmic dynein transports cargoes for a variety of crucial cellular functions. However, since dynein is essential in most eukaryotic organisms, the in-depth study of the cellular function of dynein via genetic analysis of dynein mutations has not been practical. Here, we identify and characterize 34 different dynein heavy chain mutations using a genetic screen of the ascomycete fungus Neurospora crassa, in which dynein is nonessential. Interestingly, our studies show that these mutations segregate into five different classes based on the in vivo localization of the mutated dynein motors. Furthermore, we have determined that the different classes of dynein mutations alter vesicle trafficking, microtubule organization, and nuclear distribution in distinct ways and require dynactin to different extents. In addition, biochemical analyses of dynein from one mutant strain show a strong correlation between its in vitro biochemical properties and the aberrant intracellular function of that altered dynein. When the mutations were mapped to the published dynein crystal structure, we found that the three-dimensional structural locations of the heavy chain mutations were linked to particular classes of altered dynein functions observed in cells. Together, our data indicate that the five classes of dynein mutations represent the entrapment of dynein at five separate points in the dynein mechanochemical and transport cycles. We have developed N. crassa as a model system where we can dissect the complexities of dynein structure, function, and interaction with other proteins with genetic, biochemical, and cell biological studies. PMID:22649085

  14. Trans-Binding Mechanism of Ubiquitin-like Protein Activation Revealed by a UBA5-UFM1 Complex

    Directory of Open Access Journals (Sweden)

    Walaa Oweis

    2016-09-01

    Full Text Available Modification of proteins by ubiquitin or ubiquitin-like proteins (UBLs is a critical cellular process implicated in a variety of cellular states and outcomes. A prerequisite for target protein modification by a UBL is the activation of the latter by activating enzymes (E1s. Here, we present the crystal structure of the non-canonical homodimeric E1, UBA5, in complex with its cognate UBL, UFM1, and supporting biochemical experiments. We find that UBA5 binds to UFM1 via a trans-binding mechanism in which UFM1 interacts with distinct sites in both subunits of the UBA5 dimer. This binding mechanism requires a region C-terminal to the adenylation domain that brings UFM1 to the active site of the adjacent UBA5 subunit. We also find that transfer of UFM1 from UBA5 to the E2, UFC1, occurs via a trans mechanism, thereby requiring a homodimer of UBA5. These findings explicitly elucidate the role of UBA5 dimerization in UFM1 activation.

  15. Crystal structures of PRK1 in complex with the clinical compounds lestaurtinib and tofacitinib reveal ligand induced conformational changes.

    Directory of Open Access Journals (Sweden)

    Philip Chamberlain

    Full Text Available Protein kinase C related kinase 1 (PRK1 is a component of Rho-GTPase, androgen receptor, histone demethylase and histone deacetylase signaling pathways implicated in prostate and ovarian cancer. Herein we describe the crystal structure of PRK1 in apo form, and also in complex with a panel of literature inhibitors including the clinical candidates lestaurtinib and tofacitinib, as well as the staurosporine analog Ro-31-8220. PRK1 is a member of the AGC-kinase class, and as such exhibits the characteristic regulatory sequence at the C-terminus of the catalytic domain--the 'C-tail'. The C-tail fully encircles the catalytic domain placing a phenylalanine in the ATP-binding site. Our inhibitor structures include examples of molecules which both interact with, and displace the C-tail from the active site. This information may assist in the design of inhibitors targeting both PRK and other members of the AGC kinase family.

  16. A novel 3-D bio-microfluidic system mimicking in vivo heterogeneous tumour microstructures reveals complex tumour–stroma interactions

    KAUST Repository

    Fan, Qihui

    2017-07-10

    A 3-D microfluidic system consisting of microchamber arrays embedded in a collagen hydrogel with tuneable biochemical gradients that mimics the tumour microenvironment of mammary glands was constructed for the investigation on the interactions between invasive breast cancer cells and stromal cells. The hollow microchambers in collagen provide a very similar 3-D environment to that in vivo that regulates collective cellular dynamics and behaviour, while the microfluidic channels surrounding the collagen microchamber arrays allow one to impose complex concentration gradients of specific biological molecules or drugs. We found that breast epithelial cells (MCF-10A) seeded in the microchambers formed lumen-like structures similar to those in epithelial layers. When MCF-10A cells were co-cultured with invasive breast cancer cells (MDA-MB-231), the formation of lumen-like structures in the microchambers was inhibited, indicating the capability of cancer cells to disrupt the structures formed by surrounding cells for further invasion and metastasis. Subsequent mechanism studies showed that down regulation of E-cad expression due to MMPs produced by the cancer cells plays a dominant role in determining the cellular behaviour. Our microfluidic system offers a robust platform for high throughput studies that aim to understand combinatorial effects of multiple biochemical and microenvironmental factors.

  17. Structures of Orf Virus Chemokine Binding Protein in Complex with Host Chemokines Reveal Clues to Broad Binding Specificity.

    Science.gov (United States)

    Couñago, Rafael M; Knapp, Karen M; Nakatani, Yoshio; Fleming, Stephen B; Corbett, Michael; Wise, Lyn M; Mercer, Andrew A; Krause, Kurt L

    2015-07-07

    The chemokine binding protein (CKBP) from orf virus (ORFV) binds with high affinity to chemokines from three classes, C, CC, and CXC, making it unique among poxvirus CKBPs described to date. We present its crystal structure alone and in complex with three CC chemokines, CCL2, CCL3, and CCL7. ORFV CKBP possesses a β-sandwich fold that is electrostatically and sterically complementary to its binding partners. Chemokines bind primarily through interactions involving the N-terminal loop and a hydrophobic recess on the ORFV CKBP β-sheet II surface, and largely polar interactions between the chemokine 20s loop and a negatively charged surface groove located at one end of the CKBP β-sheet II surface. ORFV CKBP interacts with leukocyte receptor and glycosaminoglycan binding sites found on the surface of bound chemokines. SEC-MALLS and chromatographic evidence is presented supporting that ORFV CKBP is a dimer in solution over a broad range of protein concentrations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. A new inhibitor of the β-arrestin/AP2 endocytic complex reveals interplay between GPCR internalization and signalling

    Science.gov (United States)

    Beautrait, Alexandre; Paradis, Justine S.; Zimmerman, Brandon; Giubilaro, Jenna; Nikolajev, Ljiljana; Armando, Sylvain; Kobayashi, Hiroyuki; Yamani, Lama; Namkung, Yoon; Heydenreich, Franziska M.; Khoury, Etienne; Audet, Martin; Roux, Philippe P.; Veprintsev, Dmitry B.; Laporte, Stéphane A.; Bouvier, Michel

    2017-04-01

    In addition to G protein-coupled receptor (GPCR) desensitization and endocytosis, β-arrestin recruitment to ligand-stimulated GPCRs promotes non-canonical signalling cascades. Distinguishing the respective contributions of β-arrestin recruitment to the receptor and β-arrestin-promoted endocytosis in propagating receptor signalling has been limited by the lack of selective analytical tools. Here, using a combination of virtual screening and cell-based assays, we have identified a small molecule that selectively inhibits the interaction between β-arrestin and the β2-adaptin subunit of the clathrin adaptor protein AP2 without interfering with the formation of receptor/β-arrestin complexes. This selective β-arrestin/β2-adaptin inhibitor (Barbadin) blocks agonist-promoted endocytosis of the prototypical β2-adrenergic (β2AR), V2-vasopressin (V2R) and angiotensin-II type-1 (AT1R) receptors, but does not affect β-arrestin-independent (transferrin) or AP2-independent (endothelin-A) receptor internalization. Interestingly, Barbadin fully blocks V2R-stimulated ERK1/2 activation and blunts cAMP accumulation promoted by both V2R and β2AR, supporting the concept of β-arrestin/AP2-dependent signalling for both G protein-dependent and -independent pathways.

  19. Evaluation of Automated Ribosomal Intergenic Spacer Analysis for Bacterial Fingerprinting of Rumen Microbiome Compared to Pyrosequencing Technology

    Directory of Open Access Journals (Sweden)

    Elie Jami

    2014-01-01

    Full Text Available The mammalian gut houses a complex microbial community which is believed to play a significant role in host physiology. In recent years, several microbial community analysis methods have been implemented to study the whole gut microbial environment, in contrast to classical microbiological methods focusing on bacteria which can be cultivated. One of these is automated ribosomal intergenic spacer analysis (ARISA, an inexpensive and popular way of analyzing bacterial diversity and community fingerprinting in ecological samples. ARISA uses the natural variability in length of the DNA fragment found between the 16S and 23S genes in different bacterial lineages to infer diversity. This method is now being supplanted by affordable next-generation sequencing technologies that can also simultaneously annotate operational taxonomic units for taxonomic identification. We compared ARISA and pyrosequencing of samples from the rumen microbiome of cows, previously sampled at different stages of development and varying in microbial complexity using several ecological parameters. We revealed close agreement between ARISA and pyrosequencing outputs, especially in their ability to discriminate samples from different ecological niches. In contrast, the ARISA method seemed to underestimate sample richness. The good performance of the relatively inexpensive ARISA makes it relevant for straightforward use in bacterial fingerprinting analysis as well as for quick cross-validation of pyrosequencing data.

  20. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    Science.gov (United States)

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  1. Comparative interactomics: analysis of arabidopsis 14-3-3 complexes reveals highly conserved 14-3-3 interactions between humans and plants.

    Science.gov (United States)

    Paul, Anna-Lisa; Liu, Li; McClung, Scott; Laughner, Beth; Chen, Sixue; Ferl, Robert J

    2009-04-01

    As a first step in the broad characterization of plant 14-3-3 multiprotein complexes in vivo, stringent and specific antibody affinity purification was used to capture 14-3-3s together with their interacting proteins from extracts of Arabidopsis cell suspension cultures. Approximately 120 proteins were identified as potential in vivo 14-3-3 interacting proteins by mass spectrometry of the recovered complexes. Comparison of the proteins in this data set with the 14-3-3 interacting proteins from a similar study in human embryonic kidney cell cultures revealed eight interacting proteins that likely represent reasonably abundant, fundamental 14-3-3 interaction complexes that are highly conserved across all eukaryotes. The Arabidopsis 14-3-3 interaction data set was also compared to a yeast in vivo 14-3-3 interaction data set. Four 14-3-3 interacting proteins are conserved in yeast, humans, and Arabidopsis. Comparisons of the data sets based on biochemical function revealed many additional similarities in the human and Arabidopsis data sets that represent conserved functional interactions, while also leaving many proteins uniquely identified in either Arabidopsis or human cells. In particular, the Arabidopsis interaction data set is enriched for proteins involved in metabolism.

  2. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  3. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  4. Zebrafish model of tuberous sclerosis complex reveals cell-autonomous and non-cell-autonomous functions of mutant tuberin

    Directory of Open Access Journals (Sweden)

    Seok-Hyung Kim

    2011-03-01

    Tuberous sclerosis complex (TSC is an autosomal dominant disease caused by mutations in either the TSC1 (encodes hamartin or TSC2 (encodes tuberin genes. Patients with TSC have hamartomas in various organs throughout the whole body, most notably in the brain, skin, eye, heart, kidney and lung. To study the development of hamartomas, we generated a zebrafish model of TSC featuring a nonsense mutation (vu242 in the tsc2 gene. This tsc2vu242 allele encodes a truncated Tuberin protein lacking the GAP domain, which is required for inhibition of Rheb and of the TOR kinase within TORC1. We show that tsc2vu242 is a recessive larval-lethal mutation that causes increased cell size in the brain and liver. Greatly elevated TORC1 signaling is observed in tsc2vu242/vu242 homozygous zebrafish, and is moderately increased in tsc2vu242/+ heterozygotes. Forebrain neurons are poorly organized in tsc2vu242/vu242 homozygous mutants, which have extensive gray and white matter disorganization and ectopically positioned cells. Genetic mosaic analyses demonstrate that tsc2 limits TORC1 signaling in a cell-autonomous manner. However, in chimeric animals, tsc2vu242/vu242 mutant cells also mislocalize wild-type host cells in the forebrain in a non-cell-autonomous manner. These results demonstrate a highly conserved role of tsc2 in zebrafish and establish a new animal model for studies of TSC. The finding of a non-cell-autonomous function of mutant cells might help explain the formation of brain hamartomas and cortical malformations in human TSC.

  5. THE COMPLEX CIRCUMNUCLEAR ENVIRONMENT OF THE BROAD-LINE RADIO GALAXY 3C 390.3 REVEALED BY CHANDRA HETG

    Energy Technology Data Exchange (ETDEWEB)

    Tombesi, F.; Kallman, T.; Leutenegger, M. A. [X-ray Astrophysics Laboratory, NASA/Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Reeves, J. N. [Center for Space Science and Technology, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 (United States); Reynolds, C. S.; Mushotzky, R. F.; Behar, E. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Braito, V. [INAF—Osservatorio Astronomico di Brera, Via Bianchi 46, I-23807 Merate (Italy); Cappi, M., E-mail: francesco.tombesi@nasa.gov, E-mail: ftombesi@astro.umd.edu [Department of Physics, Technion 32000, Haifa 32000 (Israel)

    2016-10-20

    We present the first high spectral resolution X-ray observation of the broad-line radio galaxy 3C 390.3 obtained with the high-energy transmission grating spectrometer on board the Chandra X-ray Observatory . The spectrum shows complex emission and absorption features in both the soft X-rays and Fe K band. We detect emission and absorption lines in the energy range E = 700–1000 eV associated with ionized Fe L transitions (Fe XVII–XX). An emission line at the energy of E ≃ 6.4 keV consistent with the Fe K α is also observed. Our best-fit model requires at least three different components: (i) a hot emission component likely associated with the hot interstellar medium in this elliptical galaxy with temperature kT = 0.5 ± 0.1 keV; (ii) a warm absorber with ionization parameter log ξ = 2.3 ± 0.5 erg s{sup −1} cm, column density log N {sub H} = 20.7 ± 0.1 cm{sup −2}, and outflow velocity v {sub out} < 150 km s{sup −1}; and (iii) a lowly ionized reflection component in the Fe K band likely associated with the optical broad-line region or the outer accretion disk. These evidences suggest the possibility that we are looking directly down the ionization cone of this active galaxy and that the central X-ray source only photoionizes along the unobscured cone. This is overall consistent with the angle-dependent unified picture of active galactic nuclei.

  6. Tandem differential mobility analysis-mass spectrometry reveals partial gas-phase collapse of the GroEL complex.

    Science.gov (United States)

    Hogan, Christopher J; Ruotolo, Brandon T; Robinson, Carol V; Fernandez de la Mora, Juan

    2011-04-07

    A parallel-plate differential mobility analyzer and a time-of-flight mass spectrometer (DMA-MS) are used in series to measure true mobility in dry atmospheric pressure air for mass-resolved electrosprayed GroEL tetradecamers (14-mers; ~800 kDa). Narrow mobility peaks are found (2.6-2.9% fwhm); hence, precise mobilities can be obtained for these ions without collisional activation, just following their generation by electrospray ionization. In contrast to previous studies, two conformers are found with mobilities (Z) differing by ~5% at charge state z ~ 79. By extrapolating to small z, a common mobility/charge ratio Z(0)/z = 0.0117 cm(2) V(-1) s(-1) is found for both conformers. When interpreted as if the GroEL ion surface were smooth and the gas molecule-protein collisions were perfectly elastic and specular, this mobility yields an experimental collision cross section, Ω, 11% smaller than in an earlier measurement, and close to the cross section, A(C,crystal), expected for the crystal structure (determined by a geometric approximation). However, the similarity between Ω and A(C,crystal) does not imply a coincidence between the native and gas-phase structures. The nonideal nature of protein-gas molecule collisions introduces a drag enhancement factor, ξ = 1.36, with which the true cross section A(C) is related to Ω via A(C) = Ω/ξ. Therefore, A(C) for GroEL 14-mer ions determined by DMA measurements is 0.69A(C,crystal). The factor 1.36 used here is based on the experimental Stokes-Millikan equation, as well as on prior and new numerical modeling accounting for multiple scattering events via exact hard-sphere scattering calculations. Therefore, we conclude that the gas-phase structure of the GroEL complex as electrosprayed is substantially more compact than the corresponding X-ray crystal structure.

  7. Phylogenetic analysis of glycerol 3-phosphate acyltransferases in opisthokonts reveals unexpected ancestral complexity and novel modern biosynthetic components.

    Directory of Open Access Journals (Sweden)

    Heather C Smart

    Full Text Available Glycerolipid synthesis represents a central metabolic process of all forms of life. In the last decade multiple genes coding for enzymes responsible for the first step of the pathway, catalyzed by glycerol 3-phosphate acyltransferase (GPAT, have been described, and characterized primarily in model organisms like Saccharomyces cerevisiae and mice. Notoriously, the fungal enzymes share low sequence identity with their known animal counterparts, and the nature of their homology is unclear. Furthermore, two mitochondrial GPAT isoforms have been described in animal cells, while no such enzymes have been identified in Fungi. In order to determine if the yeast and mammalian GPATs are representative of the set of enzymes present in their respective groups, and to test the hypothesis that metazoan orthologues are indeed absent from the fungal clade, a comparative genomic and phylogenetic analysis was performed including organisms spanning the breadth of the Opisthokonta supergroup. Surprisingly, our study unveiled the presence of 'fungal' orthologs in the basal taxa of the holozoa and 'animal' orthologues in the basal holomycetes. This includes a novel clade of fungal homologues, with putative peroxisomal targeting signals, of the mitochondrial/peroxisomal acyltransferases in Metazoa, thus potentially representing an undescribed metabolic capacity in the Fungi. The overall distribution of GPAT homologues is suggestive of high relative complexity in the ancestors of the opisthokont clade, followed by loss and sculpting of the complement in the descendent lineages. Divergence from a general versatile metabolic model, present in ancestrally deduced GPAT complements, points to distinctive contributions of each GPAT isoform to lipid metabolism and homeostasis in contemporary organisms like humans and their fungal pathogens.

  8. Multiple correlation analyses revealed complex relationship between DNA methylation and mRNA expression in human peripheral blood mononuclear cells.

    Science.gov (United States)

    Xie, Fang-Fei; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Hong; Wu, Jian; Guo, Yu-Fan; Zeng, Ke-Qin; Wang, Ming-Jun; Zhu, Xiao-Wei; Xia, Wei; Wang, Lan; He, Pei; Bing, Peng-Fei; Lu, Xin; Zhang, Yong-Hong; Lei, Shu-Feng

    2018-01-01

    DNA methylation is an important regulator on the mRNA expression. However, a genome-wide correlation pattern between DNA methylation and mRNA expression in human peripheral blood mononuclear cells (PBMCs) is largely unknown. The comprehensive relationship between mRNA and DNA methylation was explored by using four types of correlation analyses and a genome-wide methylation-mRNA expression quantitative trait locus (eQTL) analysis in PBMCs in 46 unrelated female subjects. An enrichment analysis was performed to detect biological function for the detected genes. Single pair correlation coefficient (r T1 ) between methylation level and mRNA is moderate (-0.63-0.62) in intensity, and the negative and positive correlations are nearly equal in quantity. Correlation analysis on each gene (T4) found 60.1% genes showed correlations between mRNA and gene-based methylation at P correlation (R T4  > 0.8). Methylation sites have regulation effects on mRNA expression in eQTL analysis, with more often observations in region of transcription start site (TSS). The genes under significant methylation regulation both in correlation analysis and eQTL analysis tend to cluster to the categories (e.g., transcription, translation, regulation of transcription) that are essential for maintaining the basic life activities of cells. Our findings indicated that DNA methylation has predictive regulation effect on mRNA with a very complex pattern in PBMCs. The results increased our understanding on correlation of methylation and mRNA and also provided useful clues for future epigenetic studies in exploring biological and disease-related regulatory mechanisms in PBMC.

  9. Structural characterization of the bacterial proteasome homolog BPH reveals a tetradecameric double-ring complex with unique inner cavity properties.

    Science.gov (United States)

    Fuchs, Adrian C D; Maldoner, Lorena; Hipp, Katharina; Hartmann, Marcus D; Martin, Jörg

    2018-01-19

    Eukaryotic and archaeal proteasomes are paradigms for self-compartmentalizing proteases. To a large extent, their function requires interplay with hexameric ATPases associated with diverse cellular activities (AAA+) that act as substrate unfoldases. Bacteria have various types of self-compartmentalizing proteases; in addition to the proteasome itself, these include the proteasome homolog HslV, which functions together with the AAA+ HslU; the ClpP protease with its partner AAA+ ClpX; and Anbu, a recently characterized ancestral proteasome variant. Previous bioinformatic analysis has revealed a novel bacterial member of the proteasome family Betaproteobacteria proteasome homolog (BPH). Using cluster analysis, we here affirmed that BPH evolutionarily descends from HslV. Crystal structures of the Thiobacillus denitrificans and Cupriavidus metallidurans BPHs disclosed a homo-oligomeric double-ring architecture in which the active sites face the interior of the cylinder. Using small-angle X-ray scattering (SAXS) and electron microscopy averaging, we found that BPH forms tetradecamers in solution, unlike the dodecamers seen in HslV. Although the highly acidic inner surface of BPH was in striking contrast to the cavity characteristics of the proteasome and HslV, a classical proteasomal reaction mechanism could be inferred from the covalent binding of the proteasome-specific inhibitor epoxomicin to BPH. A ligand-bound structure implied that the elongated BPH inner pore loop may be involved in substrate recognition. The apparent lack of a partner unfoldase and other unique features, such as Ser replacing Thr as the catalytic residue in certain BPH subfamilies, suggest a proteolytic function for BPH distinct from those of known bacterial self-compartmentalizing proteases. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Phylogenetic analysis of nitrite, nitric oxide, and nitrous oxide respiratory enzymes reveal a complex evolutionary history for denitrification.

    Science.gov (United States)

    Jones, Christopher M; Stres, Blaz; Rosenquist, Magnus; Hallin, Sara

    2008-09-01

    Denitrification is a facultative respiratory pathway in which nitrite (NO2(-)), nitric oxide (NO), and nitrous oxide (N2O) are successively reduced to nitrogen gas (N(2)), effectively closing the nitrogen cycle. The ability to denitrify is widely dispersed among prokaryotes, and this polyphyletic distribution has raised the possibility of horizontal gene transfer (HGT) having a substantial role in the evolution of denitrification. Comparisons of 16S rRNA and denitrification gene phylogenies in recent studies support this possibility; however, these results remain speculative as they are based on visual comparisons of phylogenies from partial sequences. We reanalyzed publicly available nirS, nirK, norB, and nosZ partial sequences using Bayesian and maximum likelihood phylogenetic inference. Concomitant analysis of denitrification genes with 16S rRNA sequences from the same organisms showed substantial differences between the trees, which were supported by examining the posterior probability of monophyletic constraints at different taxonomic levels. Although these differences suggest HGT of denitrification genes, the presence of structural variants for nirK, norB, and nosZ makes it difficult to determine HGT from other evolutionary events. Additional analysis using phylogenetic networks and likelihood ratio tests of phylogenies based on full-length sequences retrieved from genomes also revealed significant differences in tree topologies among denitrification and 16S rRNA gene phylogenies, with the exception of the nosZ gene phylogeny within the data set of the nirK-harboring genomes. However, inspection of codon usage and G + C content plots from complete genomes gave no evidence for recent HGT. Instead, the close proximity of denitrification gene copies in the genomes of several denitrifying bacteria suggests duplication. Although HGT cannot be ruled out as a factor in the evolution of denitrification genes, our analysis suggests that other phenomena, such gene

  11. Genetics of hybrid male sterility between drosophila sibling species: a complex web of epistasis is revealed in interspecific studies.

    Science.gov (United States)

    Palopoli, M F; Wu, C I

    1994-10-01

    To study the genetic differences responsible for the sterility of their male hybrids, we introgressed small segments of an X chromosome from Drosophila simulans into a pure Drosophila mauritiana genetic background, then assessed the fertility of males carrying heterospecific introgressions of varying size. Although this analysis examined less than 20% of the X chromosome (roughly 5% of the euchromatic portion of the D. simulans genome), and the segments were introgressed in only one direction, a minimum of four factors that contribute to hybrid male sterility were revealed. At least two of the factors exhibited strong epistasis: males carrying either factor alone were consistently fertile, whereas males carrying both factors together were always sterile. Distinct spermatogenic phenotypes were observed for sterile introgressions of different lengths, and it appeared that an interaction between introgressed segments also influenced the stage of spermatogenic defect. Males with one category of introgression often produced large quantities of motile sperm and were observed copulating, but never inseminated females. Evidently these two species have diverged at a large number of loci which have varied effects on hybrid male fertility. By extrapolation, we estimate that there are at least 40 such loci on the X chromosome alone. Because these species exhibit little DNA-sequence divergence at arbitrarily chosen loci, it seems unlikely that the extensive functional divergence observed could be due mainly to random genetic drift. Significant epistasis between conspecific genes appears to be a common component of hybrid sterility between recently diverged species of Drosophila. The linkage relationships of interacting factors could shed light on the role played by epistatic selection in the dynamics of the allele substitutions responsible for reproductive barriers between species.

  12. The Genotypic Population Structure of Mycobacterium tuberculosis Complex from Moroccan Patients Reveals a Predominance of Euro-American Lineages

    Science.gov (United States)

    Lahlou, Ouafae; Millet, Julie; Chaoui, Imane; Sabouni, Radia; Filali-Maltouf, Abdelkarim; Akrim, Mohammed; El Mzibri, Mohammed; Rastogi, Nalin; El Aouad, Rajae

    2012-01-01

    Background Tuberculosis (TB) remains a major health problem in Morocco. Characterization of circulating Mycobacterium tuberculosis genotypic lineages, important to understand the dynamic of the disease, was hereby addressed for the first time at a national level. Methodology/Principal Findings Spoligotyping was performed on a panel of 592 M. tuberculosis complex strains covering a 2-year period (2004–2006). It identified 129 patterns: 105 (n = 568 strains) corresponded to a SIT number in the SITVIT2 database, while 24 patterns were labeled as orphan. A total of 523 (88.3%) strains were clustered vs. 69 or 11.7% unclustered. Classification of strains within 3 large phylogenetical groups was as follows: group 1– ancestral/TbD1+/PGG1 (EAI, Bovis, Africanum), group 2– modern/TbD1−/PGG1 group (Beijing, CAS), group 3– evolutionary recent/TbD1−/PGG2/3 (Haarlem, X, S, T, LAM; alternatively designated as the Euro-American lineage). As opposed to group 3 strains (namely LAM, Haarlem, and T) that predominated (86.5% of all isolates), 6 strains belonged to group 2 (Beijing n = 5, CAS n = 1), and 3 strains (BOV_1 n = 2, BOV_4-CAPRAE) belonged to ancestral group 1 (EAI and AFRI lineage strains were absent). 12-loci MIRU-VNTR typing of the Casablanca subgroup (n = 114 strains) identified 71 patterns: 48 MITs and 23 orphan patterns; it allowed to reduce the clustering rate from 72.8% to 29.8% and the recent transmission rate from 64% to 20.2%. Conclusion The M. tuberculosis population structure in Morocco is highly homogeneous, and is characterized by the predominance of the Euro-American lineages, namely LAM, Haarlem, and T, which belong to the “evolutionary recent” TbD1−/PGG2/3 phylogenetic group. The combination of spoligotyping and MIRUs decreased the clustering rate significantly, and should now be systematically applied in larger studies. The methods used in this study appear well suited to monitor the M. tuberculosis population

  13. Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network.

    Science.gov (United States)

    Wei, Shu; Gruber, Margaret Y; Yu, Bianyun; Gao, Ming-Jun; Khachatourians, George G; Hegedus, Dwayne D; Parkin, Isobel A P; Hannoufa, Abdelali

    2012-09-18

    The Arabidopsis microRNA156 (miR156) regulates 11 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) family by base pairing to complementary target mRNAs. Each SPL gene further regulates a set of other genes; thus, miR156 controls numerous genes through a complex gene regulation network. Increased axillary branching occurs in transgenic Arabidopsis overexpressing miR156b, similar to that observed in loss-of-function max3 and max4 mutants with lesions in carotenoid cleavage dioxygenases. Arabidopsis miR156b was found to enhance carotenoid levels and reproductive shoot branching when expressed in Brassica napus, suggesting a link between miR156b expression and carotenoid metabolism. However, details of the miR156 regulatory network of SPL genes related to carotenoid metabolism are not known. In this study, an Arabidopsis T-DNA enhancer mutant, sk156, was identified due to its altered branching and trichome morphology and increased seed carotenoid levels compared to wild type (WT) ecovar Columbia. Enhanced miR156b expression due to the 35S enhancers present on the T-DNA insert was responsible for these phenotypes. Constitutive and leaf primodium-specific expression of a miR156-insensitive (mutated) SPL15 (SPL15m) largely restored WT seed carotenoid levels and plant morphology when expressed in sk156. The Arabidopsis native miR156-sensitive SPL15 (SPL15n) and SPL15m driven by a native SPL15 promoter did not restore the WT phenotype in sk156. Our findings suggest that SPL15 function is somewhat redundant with other SPL family members, which collectively affect plant phenotypes. Moreover, substantially decreased miR156b transcript levels in sk156 expressing SPL15m, together with the presence of multiple repeats of SPL-binding GTAC core sequence close to the miR156b transcription start site, suggested feedback regulation of miR156b expression by SPL15. This was supported by the demonstration of specific in vitro interaction between DNA-binding SBP domain of SPL15

  14. Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network

    Directory of Open Access Journals (Sweden)

    Wei Shu

    2012-09-01

    Full Text Available Abstract Background The Arabidopsis microRNA156 (miR156 regulates 11 members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL family by base pairing to complementary target mRNAs. Each SPL gene further regulates a set of other genes; thus, miR156 controls numerous genes through a complex gene regulation network. Increased axillary branching occurs in transgenic Arabidopsis overexpressing miR156b, similar to that observed in loss-of-function max3 and max4 mutants with lesions in carotenoid cleavage dioxygenases. Arabidopsis miR156b was found to enhance carotenoid levels and reproductive shoot branching when expressed in Brassica napus, suggesting a link between miR156b expression and carotenoid metabolism. However, details of the miR156 regulatory network of SPL genes related to carotenoid metabolism are not known. Results In this study, an Arabidopsis T-DNA enhancer mutant, sk156, was identified due to its altered branching and trichome morphology and increased seed carotenoid levels compared to wild type (WT ecovar Columbia. Enhanced miR156b expression due to the 35S enhancers present on the T-DNA insert was responsible for these phenotypes. Constitutive and leaf primodium-specific expression of a miR156-insensitive (mutated SPL15 (SPL15m largely restored WT seed carotenoid levels and plant morphology when expressed in sk156. The Arabidopsis native miR156-sensitive SPL15 (SPL15n and SPL15m driven by a native SPL15 promoter did not restore the WT phenotype in sk156. Our findings suggest that SPL15 function is somewhat redundant with other SPL family members, which collectively affect plant phenotypes. Moreover, substantially decreased miR156b transcript levels in sk156 expressing SPL15m, together with the presence of multiple repeats of SPL-binding GTAC core sequence close to the miR156b transcription start site, suggested feedback regulation of miR156b expression by SPL15. This was supported by the demonstration of specific in vitro

  15. Electron microscopy and in vitro deneddylation reveal similar architectures and biochemistry of isolated human and Flag-mouse COP9 signalosome complexes

    International Nuclear Information System (INIS)

    Rockel, Beate; Schmaler, Tilo; Huang, Xiaohua; Dubiel, Wolfgang

    2014-01-01

    Highlights: • Deneddylation rates of human erythrocyte and mouse fibroblast CSN are very similar. • 3D models of native human and mouse CSN reveal common architectures. • The cryo-structure of native mammalian CSN shows a horseshoe subunit arrangement. - Abstract: The COP9 signalosome (CSN) is a regulator of the ubiquitin (Ub) proteasome system (UPS). In the UPS, proteins are Ub-labeled for degradation by Ub ligases conferring substrate specificity. The CSN controls a large family of Ub ligases called cullin-RING ligases (CRLs), which ubiquitinate cell cycle regulators, transcription factors and DNA damage response proteins. The CSN possesses structural similarities with the 26S proteasome Lid complex and the translation initiation complex 3 (eIF3) indicating similar ancestry and function. Initial structures were obtained 14 years ago by 2D electron microscopy (EM). Recently, first 3D molecular models of the CSN were created on the basis of negative-stain EM and single-particle analysis, mostly with recombinant complexes. Here, we compare deneddylating activity and structural features of CSN complexes purified in an elaborate procedure from human erythrocytes and efficiently pulled down from mouse Flag-CSN2 B8 fibroblasts. In an in vitro deneddylation assay both the human and the mouse CSN complexes deneddylated Nedd8-Cul1 with comparable rates. 3D structural models of the erythrocyte CSN as well as of the mouse Flag-CSN were generated by negative stain EM and by cryo-EM. Both complexes show a central U-shaped segment from which several arms emanate. This structure, called the horseshoe, is formed by the PCI domain subunits. CSN5 and CSN6 point away from the horseshoe. Compared to 3D models of negatively stained CSN complexes, densities assigned to CSN2 and CSN4 are better defined in the cryo-map. Because biochemical and structural results obtained with CSN complexes isolated from human erythrocytes and purified by Flag-CSN pulldown from mouse B8 fibroblasts

  16. Electron microscopy and in vitro deneddylation reveal similar architectures and biochemistry of isolated human and Flag-mouse COP9 signalosome complexes

    Energy Technology Data Exchange (ETDEWEB)

    Rockel, Beate [Department of Molecular Structural Biology, Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); Schmaler, Tilo; Huang, Xiaohua [Division of Molecular Biology, Department of General, Visceral, Vascular and Thoracic Surgery, Charité – Universitätsmedizin Berlin, Charitéplatz 1, 10117 Berlin (Germany); Dubiel, Wolfgang, E-mail: Wolfgang.dubiel@charite.de [Division of Molecular Biology, Department of General, Visceral, Vascular and Thoracic Surgery, Charité – Universitätsmedizin Berlin, Charitéplatz 1, 10117 Berlin (Germany)

    2014-07-25

    Highlights: • Deneddylation rates of human erythrocyte and mouse fibroblast CSN are very similar. • 3D models of native human and mouse CSN reveal common architectures. • The cryo-structure of native mammalian CSN shows a horseshoe subunit arrangement. - Abstract: The COP9 signalosome (CSN) is a regulator of the ubiquitin (Ub) proteasome system (UPS). In the UPS, proteins are Ub-labeled for degradation by Ub ligases conferring substrate specificity. The CSN controls a large family of Ub ligases called cullin-RING ligases (CRLs), which ubiquitinate cell cycle regulators, transcription factors and DNA damage response proteins. The CSN possesses structural similarities with the 26S proteasome Lid complex and the translation initiation complex 3 (eIF3) indicating similar ancestry and function. Initial structures were obtained 14 years ago by 2D electron microscopy (EM). Recently, first 3D molecular models of the CSN were created on the basis of negative-stain EM and single-particle analysis, mostly with recombinant complexes. Here, we compare deneddylating activity and structural features of CSN complexes purified in an elaborate procedure from human erythrocytes and efficiently pulled down from mouse Flag-CSN2 B8 fibroblasts. In an in vitro deneddylation assay both the human and the mouse CSN complexes deneddylated Nedd8-Cul1 with comparable rates. 3D structural models of the erythrocyte CSN as well as of the mouse Flag-CSN were generated by negative stain EM and by cryo-EM. Both complexes show a central U-shaped segment from which several arms emanate. This structure, called the horseshoe, is formed by the PCI domain subunits. CSN5 and CSN6 point away from the horseshoe. Compared to 3D models of negatively stained CSN complexes, densities assigned to CSN2 and CSN4 are better defined in the cryo-map. Because biochemical and structural results obtained with CSN complexes isolated from human erythrocytes and purified by Flag-CSN pulldown from mouse B8 fibroblasts

  17. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  18. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  19. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  20. MD simulation of the Tat/Cyclin T1/CDK9 complex revealing the hidden catalytic cavity within the CDK9 molecule upon Tat binding.

    Directory of Open Access Journals (Sweden)

    Kaori Asamitsu

    Full Text Available In this study, we applied molecular dynamics (MD simulation to analyze the dynamic behavior of the Tat/CycT1/CDK9 tri-molecular complex and revealed the structural changes of P-TEFb upon Tat binding. We found that Tat could deliberately change the local flexibility of CycT1. Although the structural coordinates of the H1 and H2 helices did not substantially change, H1', H2', and H3' exhibited significant changes en masse. Consequently, the CycT1 residues involved in Tat binding, namely Tat-recognition residues (TRRs, lost their flexibility with the addition of Tat to P-TEFb. In addition, we clarified the structural variation of CDK9 in complex with CycT1 in the presence or absence of Tat. Interestingly, Tat addition significantly reduced the structural variability of the T-loop, thus consolidating the structural integrity of P-TEFb. Finally, we deciphered the formation of the hidden catalytic cavity of CDK9 upon Tat binding. MD simulation revealed that the PITALRE signature sequence of CDK9 flips the inactive kinase cavity of CDK9 into the active form by connecting with Thr186, which is crucial for its activity, thus presumably recruiting the substrate peptide such as the C-terminal domain of RNA pol II. These findings provide vital information for the development of effective novel anti-HIV drugs with CDK9 catalytic activity as the target.

  1. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  2. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  3. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  4. Terbutaline causes immobilization of single β2-adrenergic receptor-ligand complexes in the plasma membrane of living A549 cells as revealed by single-molecule microscopy

    Science.gov (United States)

    Sieben, Anne; Kaminski, Tim; Kubitscheck, Ulrich; Häberlein, Hanns

    2011-02-01

    G-protein-coupled receptors are important targets for various drugs. After signal transduction, regulatory processes, such as receptor desensitization and internalization, change the lateral receptor mobility. In order to study the lateral diffusion of β2-adrenergic receptors (β2AR) complexed with fluorescently labeled noradrenaline (Alexa-NA) in plasma membranes of A549 cells, trajectories of single receptor-ligand complexes were monitored using single-particle tracking. We found that a fraction of 18% of all β2ARs are constitutively immobile. About 2/3 of the β2ARs moved with a diffusion constant of D2 = 0.03+/-0.001 μm2/s and about 17% were diffusing five-fold faster (D3 = 0.15+/-0.02 μm2/s). The mobile receptors moved within restricted domains and also showed a discontinuous diffusion behavior. Analysis of the trajectory lengths revealed two different binding durations with τ1 = 77+/-1 ms and τ2 = 388+/-11 ms. Agonistic stimulation of the β2AR-Alexa-NA complexes with 1 μM terbutaline caused immobilization of almost 50% of the receptors within 35 min. Simultaneously, the mean area covered by the mobile receptors decreased significantly. Thus, we demonstrated that agonistic stimulation followed by cell regulatory processes results in a change in β2AR mobility suggesting that different receptor dynamics characterize different receptor states.

  5. X-ray structure of a transition state analog complex reveals the molecular origins of the catalytic power and substrate specificity of acetylcholinesterase

    Energy Technology Data Exchange (ETDEWEB)

    Harel, M.; Silman, I. [Weizmann Inst. of Science, Rehovot (Israel); Quinn, D.M.; Nair, H.K. [Univ. of Iowa, Iowa City, IA (United States); Sussman, J.L. [Weizmann Inst. of Science, Rehovot (Israel)]|[Brookhaven National Lab., Upton, NY (United States)

    1996-03-13

    The structure of a complex of Torpedo californica acetylcholinesterase with the transition state analog inhibitor m-(N, N,N-trimethylammonio)-2,2,2-trifluoroacetophenone has been solved by X-ray crystallographic methods to 2.8 A resolution. Since the inhibitor binds to the enzyme about 10{sup 10}-fold more tightly than the substrate acetylcholine, this complex provides a visual accounting of the enzyme-ligand interactions that provide the molecular basis for the catalytic power of acetylcholinesterase. The acetyl ester hydrolytic specificity of the enzyme is revealed by the interaction of the CF{sub 3} function of the transition state analog with a concave binding site comprised of the residues G119, W233, F288, F290, and F331. The highly geometrically convergent array of enzyme-ligand interactions visualized in the complex described herein envelopes the acylation transition state and sequesters it from solvent, this being consistent with the location of the active site at the bottom of a deep and narrow gorge. 82 refs., 5 figs.

  6. Crystal structure of the enzyme-product complex reveals sugar ring distortion during catalysis by family 63 inverting α-glycosidase.

    Science.gov (United States)

    Miyazaki, Takatsugu; Nishikawa, Atsushi; Tonozuka, Takashi

    2016-12-01

    Glycoside hydrolases are divided into two groups, known as inverting and retaining enzymes, based on their hydrolytic mechanisms. Glycoside hydrolase family 63 (GH63) is composed of inverting α-glycosidases, which act mainly on α-glucosides. We previously found that Escherichia coli GH63 enzyme, YgjK, can hydrolyze 2-O-α-d-glucosyl-d-galactose. Two constructed glycosynthase mutants, D324N and E727A, which catalyze the transfer of a β-glucosyl fluoride donor to galactose, lactose, and melibiose. Here, we determined the crystal structures of D324N and E727A soaked with a mixture of glucose and lactose at 1.8- and 2.1-Å resolutions, respectively. Because glucose and lactose molecules are found at the active sites in both structures, it is possible that these structures mimic the enzyme-product complex of YgjK. A glucose molecule found at subsite -1 in both structures adopts an unusual 1 S 3 skew-boat conformation. Comparison between these structures and the previously determined enzyme-substrate complex structure reveals that the glucose pyranose ring might be distorted immediately after nucleophilic attack by a water molecule. These structures represent the first enzyme-product complex for the GH63 family, as well as the structurally-related glycosidases, and it may provide insight into the catalytic mechanism of these enzymes. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  8. Novel binding motif and new flexibility revealed by structural analyses of a pyruvate dehydrogenase-dihydrolipoyl acetyltransferase subcomplex from the Escherichia coli pyruvate dehydrogenase multienzyme complex.

    Science.gov (United States)

    Arjunan, Palaniappa; Wang, Junjie; Nemeria, Natalia S; Reynolds, Shelley; Brown, Ian; Chandrasekhar, Krishnamoorthy; Calero, Guillermo; Jordan, Frank; Furey, William

    2014-10-24

    The Escherichia coli pyruvate dehydrogenase multienzyme complex contains multiple copies of three enzymatic components, E1p, E2p, and E3, that sequentially carry out distinct steps in the overall reaction converting pyruvate to acetyl-CoA. Efficient functioning requires the enzymatic components to assemble into a large complex, the integrity of which is maintained by tethering of the displaced, peripheral E1p and E3 components to the E2p core through non-covalent binding. We here report the crystal structure of a subcomplex between E1p and an E2p didomain containing a hybrid lipoyl domain along with the peripheral subunit-binding domain responsible for tethering to the core. In the structure, a region at the N terminus of each subunit in the E1p homodimer previously unseen due to crystallographic disorder was observed, revealing a new folding motif involved in E1p-E2p didomain interactions, and an additional, unexpected, flexibility was discovered in the E1p-E2p didomain subcomplex, both of which probably have consequences in the overall multienzyme complex assembly. This represents the first structure of an E1p-E2p didomain subcomplex involving a homodimeric E1p, and the results may be applicable to a large range of complexes with homodimeric E1 components. Results of HD exchange mass spectrometric experiments using the intact, wild type 3-lipoyl E2p and E1p are consistent with the crystallographic data obtained from the E1p-E2p didomain subcomplex as well as with other biochemical and NMR data reported from our groups, confirming that our findings are applicable to the entire E1p-E2p assembly. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Novel Binding Motif and New Flexibility Revealed by Structural Analyses of a Pyruvate Dehydrogenase-Dihydrolipoyl Acetyltransferase Subcomplex from the Escherichia coli Pyruvate Dehydrogenase Multienzyme Complex*

    Science.gov (United States)

    Arjunan, Palaniappa; Wang, Junjie; Nemeria, Natalia S.; Reynolds, Shelley; Brown, Ian; Chandrasekhar, Krishnamoorthy; Calero, Guillermo; Jordan, Frank; Furey, William

    2014-01-01

    The Escherichia coli pyruvate dehydrogenase multienzyme complex contains multiple copies of three enzymatic components, E1p, E2p, and E3, that sequentially carry out distinct steps in the overall reaction converting pyruvate to acetyl-CoA. Efficient functioning requires the enzymatic components to assemble into a large complex, the integrity of which is maintained by tethering of the displaced, peripheral E1p and E3 components to the E2p core through non-covalent binding. We here report the crystal structure of a subcomplex between E1p and an E2p didomain containing a hybrid lipoyl domain along with the peripheral subunit-binding domain responsible for tethering to the core. In the structure, a region at the N terminus of each subunit in the E1p homodimer previously unseen due to crystallographic disorder was observed, revealing a new folding motif involved in E1p-E2p didomain interactions, and an additional, unexpected, flexibility was discovered in the E1p-E2p didomain subcomplex, both of which probably have consequences in the overall multienzyme complex assembly. This represents the first structure of an E1p-E2p didomain subcomplex involving a homodimeric E1p, and the results may be applicable to a large range of complexes with homodimeric E1 components. Results of HD exchange mass spectrometric experiments using the intact, wild type 3-lipoyl E2p and E1p are consistent with the crystallographic data obtained from the E1p-E2p didomain subcomplex as well as with other biochemical and NMR data reported from our groups, confirming that our findings are applicable to the entire E1p-E2p assembly. PMID:25210042

  10. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  11. Clinical array-based karyotyping of breast cancer with equivocal HER2 status resolves gene copy number and reveals chromosome 17 complexity

    International Nuclear Information System (INIS)

    Gunn, Shelly; Gorre, Mercedes; Mohammed, Mansoor; Yeh, I-Tien; Lytvak, Irina; Tirtorahardjo, Budi; Dzidic, Natasha; Zadeh, Soheila; Kim, Jaeweon; McCaskill, Chris; Lim, Lony

    2010-01-01

    HER2 gene copy status, and concomitant administration of trastuzumab (Herceptin), remains one of the best examples of targeted cancer therapy based on understanding the genomic etiology of disease. However, newly diagnosed breast cancer cases with equivocal HER2 results present a challenge for the oncologist who must make treatment decisions despite the patient's unresolved HER2 status. In some cases both immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are reported as equivocal, whereas in other cases IHC results and FISH are discordant for positive versus negative results. The recent validation of array-based, molecular karyotyping for clinical oncology testing provides an alternative method for determination of HER2 gene copy number status in cases remaining unresolved by traditional methods. In the current study, DNA extracted from 20 formalin fixed paraffin embedded (FFPE) tissue samples from newly diagnosed cases of invasive ductal carcinoma referred to our laboratory with unresolved HER2 status, were analyzed using a clinically validated genomic array containing 127 probes covering the HER2 amplicon, the pericentromeric regions, and both chromosome 17 arms. Array-based comparative genomic hybridization (array CGH) analysis of chromosome 17 resolved HER2 gene status in [20/20] (100%) of cases and revealed additional chromosome 17 copy number changes in [18/20] (90%) of cases. Array CGH analysis also revealed two false positives and one false negative by FISH due to 'ratio skewing' caused by chromosomal gains and losses in the centromeric region. All cases with complex rearrangements of chromosome 17 showed genome-wide chromosomal instability. These results illustrate the analytical power of array-based genomic analysis as a clinical laboratory technique for resolution of HER2 status in breast cancer cases with equivocal results. The frequency of complex chromosome 17 abnormalities in these cases suggests that the two

  12. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  13. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  14. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Porse, B T; Leviev, I; Mankin, A S

    1998-01-01

    A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...

  15. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  16. Dynamic studies of H-Ras•GTPγS interactions with nucleotide exchange factor Sos reveal a transient ternary complex formation in solution.

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Embrey, Kevin J; Golovanov, Alexander P

    2016-07-14

    The cycling between GDP- and GTP- bound forms of the Ras protein is partly regulated by the binding of Sos. The structural/dynamic behavior of the complex formed between activated Sos and Ras at the point of the functional cycle where the nucleotide exchange is completed has not been described to date. Here we show that solution NMR spectra of H-Ras∙GTPγS mixed with a functional fragment of Sos (Sos(Cat)) at a 2:1 ratio are consistent with the formation of a rather dynamic assembly. H-Ras∙GTPγS binding was in fast exchange on the NMR timescale and retained a significant degree of molecular tumbling independent of Sos(Cat), while Sos(Cat) also tumbled largely independently of H-Ras. Estimates of apparent molecular weight from both NMR data and SEC-MALS revealed that, at most, only one H-Ras∙GTPγS molecule appears stably bound to Sos. The weak transient interaction between Sos and the second H-Ras∙GTPγS may provide a necessary mechanism for complex dissociation upon the completion of the native GDP → GTP exchange reaction, but also explains measurable GTP → GTP exchange activity of Sos routinely observed in in vitro assays that use fluorescently-labelled analogs of GTP. Overall, the data presents the first dynamic snapshot of Ras functional cycle as controlled by Sos.

  17. Musical rhythm and pitch: A differential effect on auditory dynamics as revealed by the N1/MMN/P3a complex.

    Science.gov (United States)

    Lelo-de-Larrea-Mancera, E Sebastian; Rodríguez-Agudelo, Yaneth; Solís-Vivanco, Rodolfo

    2017-06-01

    Music represents a complex form of human cognition. To what extent our auditory system is attuned to music is yet to be clearly understood. Our principal aim was to determine whether the neurophysiological operations underlying pre-attentive auditory change detection (N1 enhancement (N1e)/Mismatch Negativity (MMN)) and the subsequent involuntary attentional reallocation (P3a) towards infrequent sound omissions, are influenced by differences in musical content. Specifically, we intended to explore any interaction effects that rhythmic and pitch dimensions of musical organization may have over these processes. Results showed that both the N1e and MMN amplitudes were differentially influenced by rhythm and pitch dimensions. MMN latencies were shorter for musical structures containing both features. This suggests some neurocognitive independence between pitch and rhythm domains, but also calls for further address on possible interactions between both of them at the level of early, automatic auditory detection. Furthermore, results demonstrate that the N1e reflects basic sensory memory processes. Lastly, we show that the involuntary switch of attention associated with the P3a reflects a general-purpose mechanism not modulated by musical features. Altogether, the N1e/MMN/P3a complex elicited by infrequent sound omissions revealed evidence of musical influence over early stages of auditory perception. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. SUMO modification through rapamycin-mediated heterodimerization reveals a dual role for Ubc9 in targeting RanGAP1 to nuclear pore complexes

    International Nuclear Information System (INIS)

    Zhu Shanshan; Zhang Hong; Matunis, Michael J.

    2006-01-01

    SUMOs (small ubiquitin-related modifiers) are eukaryotic proteins that are covalently conjugated to other proteins and thereby regulate a wide range of important cellular processes. The molecular mechanisms by which SUMO modification influences the functions of most target proteins and cellular processes, however, remain poorly defined. A major obstacle to investigating the effects of SUMO modification is the availability of a system for selectively inducing the modification or demodification of an individual protein. To address this problem, we have developed a procedure using the rapamycin heterodimerizer system. This procedure involves co-expression of rapamycin-binding domain fusion proteins of SUMO and candidate SUMO substrates in living cells. Treating cells with rapamycin induces a tight association between SUMO and a single SUMO substrate, thereby allowing specific downstream effects to be analyzed. Using RanGAP1 as a model SUMO substrate, the heterodimerizer system was used to investigate the molecular mechanism by which SUMO modification targets RanGAP1 from the cytoplasm to nuclear pore complexes (NPCs). Our results revealed a dual role for Ubc9 in targeting RanGAP1 to NPCs: In addition to conjugating SUMO-1 to RanGAP1, Ubc9 is also required to form a stable ternary complex with SUMO-1 modified RanGAP1 and Nup358. As illustrated by our studies, the rapamycin heterodimerizer system represents a novel tool for studying the molecular effects of SUMO modification

  19. Structures of the APC–ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners

    Science.gov (United States)

    Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

    2015-01-01

    The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC–Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC–ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC–ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC–ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC–ARM binding partners. PMID:27462415

  20. Structures of the APC-ARM domain in complexes with discrete Amer1/WTX fragments reveal that it uses a consensus mode to recognize its binding partners.

    Science.gov (United States)

    Zhang, Zhenyi; Akyildiz, Senem; Xiao, Yafei; Gai, Zhongchao; An, Ying; Behrens, Jürgen; Wu, Geng

    2015-01-01

    The tumor suppressor APC employs its conserved armadillo repeat (ARM) domain to recognize many of its binding partners, including Amer1/WTX, which is mutated in Wilms' tumor and bone overgrowth syndrome. The APC-Amer1 complex has important roles in regulating Wnt signaling and cell adhesion. Three sites A1, A2, and A3 of Amer1 have been reported to mediate its interaction with APC-ARM. In this study, crystal structures of APC-ARM in complexes with Amer1-A1, -A2, and -A4, which is newly identified in this work, were determined. Combined with our GST pull-down, yeast two-hybrid, and isothermal titration calorimetry (ITC) assay results using mutants of APC and Amer1 interface residues, our structures demonstrate that Amer1-A1, -A2, and -A4, as well as other APC-binding proteins such as Asef and Sam68, all employ a common recognition pattern to associate with APC-ARM. In contrast, Amer1-A3 binds to the C-terminal side of APC-ARM through a bipartite interaction mode. Composite mutations on either APC or Amer1 disrupting all four interfaces abrogated their association in cultured cells and impaired the membrane recruitment of APC by Amer1. Our study thus comprehensively elucidated the recognition mechanism between APC and Amer1, and revealed a consensus recognition sequence employed by various APC-ARM binding partners.

  1. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  2. Structures of human Golgi-resident glutaminyl cyclase and its complexes with inhibitors reveal a large loop movement upon inhibitor binding.

    Science.gov (United States)

    Huang, Kai-Fa; Liaw, Su-Sen; Huang, Wei-Lin; Chia, Cho-Yun; Lo, Yan-Chung; Chen, Yi-Ling; Wang, Andrew H-J

    2011-04-08

    Aberrant pyroglutamate formation at the N terminus of certain peptides and proteins, catalyzed by glutaminyl cyclases (QCs), is linked to some pathological conditions, such as Alzheimer disease. Recently, a glutaminyl cyclase (QC) inhibitor, PBD150, was shown to be able to reduce the deposition of pyroglutamate-modified amyloid-β peptides in brain of transgenic mouse models of Alzheimer disease, leading to a significant improvement of learning and memory in those transgenic animals. Here, we report the 1.05-1.40 Å resolution structures, solved by the sulfur single-wavelength anomalous dispersion phasing method, of the Golgi-luminal catalytic domain of the recently identified Golgi-resident QC (gQC) and its complex with PBD150. We also describe the high-resolution structures of secretory QC (sQC)-PBD150 complex and two other gQC-inhibitor complexes. gQC structure has a scaffold similar to that of sQC but with a relatively wider and negatively charged active site, suggesting a distinct substrate specificity from sQC. Upon binding to PBD150, a large loop movement in gQC allows the inhibitor to be tightly held in its active site primarily by hydrophobic interactions. Further comparisons of the inhibitor-bound structures revealed distinct interactions of the inhibitors with gQC and sQC, which are consistent with the results from our inhibitor assays reported here. Because gQC and sQC may play different biological roles in vivo, the different inhibitor binding modes allow the design of specific inhibitors toward gQC and sQC.

  3. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  4. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  5. A Comprehensive Analysis of Chromoplast Differentiation Reveals Complex Protein Changes Associated with Plastoglobule Biogenesis and Remodeling of Protein Systems in Sweet Orange Flesh1[OPEN

    Science.gov (United States)

    Wang, Lun; Deng, Xiuxin

    2015-01-01

    Globular and crystalloid chromoplasts were observed to be region specifically formed in sweet orange (Citrus sinensis) flesh and converted from amyloplasts during fruit maturation, which was associated with the composition of specific carotenoids and the expression of carotenogenic genes. Subsequent isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomic analyses of purified plastids from the flesh during chromoplast