Identification and comparative analysis of the epidermal differentiation complex in snakes
Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2017-01-01
The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
DEFF Research Database (Denmark)
Lichtensteiger, Walter; Bassetti-Gaille, Catherine; Faass, Oliver
2013-01-01
Sexual brain differentiation is a potential EDC target. It depends on a combination of estrogen receptor- and androgen receptor-mediated effects in males and on estrogens in females. It is not known how these processes are affected by real-world mixtures of EDCs. We investigated the effect of three...... EDC mixtures on gene expression in developing brain. Amix (8 anti-androgenic chemicals), Emix (4 estrogenic chemicals) and Tmix (Amix + Emix + paracetamol recently identified as anti-androgenic) were administered by oral gavage to rat dams from gestational day 7 until weaning, at doses corresponding...... to 450×, 200× and 100× high end human intakes (S. Christiansen et al., 2012. International Journal of Andrology 35, 303). At postnatal day 6, during the last part of sexual brain differentiation, exon microarray analyses were performed in medial preoptic area (MPO) in the highest dose group, and real...
EDCs Mixtures: A Stealthy Hazard for Human Health?
Directory of Open Access Journals (Sweden)
Edna Ribeiro
2017-02-01
Full Text Available Endocrine disrupting chemicals (EDCs are exogenous chemicals that may occur naturally (e.g., phytoestrogens, while others are industrial substances and plasticizers commonly utilized worldwide to which human exposure, particularly at low-doses, is omnipresent, persistent and occurs in complex mixtures. EDCs can interfere with/or mimic estrogenic hormones and, consequently, can simultaneously trigger diverse signaling pathways which result in diverse and divergent biological responses. Additionally, EDCs can also bioaccumulate in lipid compartments of the organism forming a mixed “body burden” of contaminants. Although the independent action of chemicals has been considered the main principle in EDCs mixture toxicity, recent studies have demonstrated that numerous effects cannot be predicted when analyzing single compounds independently. Co-exposure to these agents, particularly in critical windows of exposure, may induce hazardous health effects potentially associated with a complex “body burden” of different origins. Here, we performed an exhaustive review of the available literature regarding EDCs mixtures exposure, toxicity mechanisms and effects, particularly at the most vulnerable human life stages. Although the assessment of potential risks to human health due to exposure to EDCs mixtures is a major topic for consumer safety, information regarding effective mixtures effects is still scarce.
Endocrine Disrupting Chemicals (EDCs)
... Center Pacientes y Cuidadores Hormones and Health The Endocrine System Hormones Endocrine Disrupting Chemicals (EDCs) Steroid and Hormone ... Hormones and Health › Endocrine Disrupting Chemicals (EDCs) The Endocrine System Hormones Endocrine Disrupting Chemicals (EDCs) EDCs Myth vs. ...
In vitro evidence for endocrine-disrupting chemical (EDC)'s ...
African Journals Online (AJOL)
docrine-disrupting chemical (EDC)'s inhibition of drug metabolism. Materials .... serotonin (5-HT) and 4-methylumbelliferone (4-MU) as the probe substrates ... Hu CM, et al. Structure-. 16. inhibition relationship of ginsenosides towards UDP-.
Lichtensteiger, Walter; Bassetti-Gaille, Catherine; Faass, Oliver; Axelstad, Marta; Boberg, Julie; Christiansen, Sofie; Rehrauer, Hubert; Georgijevic, Jelena Kühn; Hass, Ulla; Kortenkamp, Andreas; Schlumpf, Margret
2015-04-01
The study addressed the question whether gene expression patterns induced by different mixtures of endocrine disrupting chemicals (EDCs) administered in a higher dose range, corresponding to 450×, 200×, and 100× high-end human exposure levels, could be characterized in developing brain with respect to endocrine activity of mixture components, and which developmental processes were preferentially targeted. Three EDC mixtures, A-Mix (anti-androgenic mixture) with 8 antiandrogenic chemicals (di-n-butylphthalate, diethylhexylphthalate, vinclozolin, prochloraz, procymidone, linuron, epoxiconazole, and DDE), E-Mix (estrogenic mixture) with 4 estrogenic chemicals (bisphenol A, 4-methylbenzylidene camphor, 2-ethylhexyl 4-methoxycinnamate, and butylparaben), a complex mixture, AEP-Mix, containing the components of A-Mix and E-Mix plus paracetamol, and paracetamol alone, were administered by oral gavage to rat dams from gestation day 7 until weaning. General developmental endpoints were not affected by EDC mixtures or paracetamol. Gene expression was analyzed on postnatal day 6, during sexual brain differentiation, by exon microarray in medial preoptic area in the high-dose group, and by real-time RT-PCR in medial preoptic area and ventromedial hypothalamus in all dose groups. Expression patterns were mixture, sex, and region specific. Effects of the analgesic drug paracetamol, which exhibits antiandrogenic activity in peripheral systems, differed from those of A-Mix. All mixtures had a strong, mixture-specific impact on genes encoding for components of excitatory glutamatergic synapses and genes controlling migration and pathfinding of glutamatergic and GABAergic neurons, as well as genes linked with increased risk of autism spectrum disorders. Because development of glutamatergic synapses is regulated by sex steroids also in hippocampus, this may represent a general target of ECD mixtures.
Directory of Open Access Journals (Sweden)
Krzysztof Poterlowicz
2017-09-01
Full Text Available Mammalian genomes contain several dozens of large (>0.5 Mbp lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene
Gene expression patterns of oxidative phosphorylation complex I subunits are organized in clusters.
Directory of Open Access Journals (Sweden)
Yael Garbian
Full Text Available After the radiation of eukaryotes, the NUO operon, controlling the transcription of the NADH dehydrogenase complex of the oxidative phosphorylation system (OXPHOS complex I, was broken down and genes encoding this protein complex were dispersed across the nuclear genome. Seven genes, however, were retained in the genome of the mitochondrion, the ancient symbiote of eukaryotes. This division, in combination with the three-fold increase in subunit number from bacteria (N = approximately 14 to man (N = 45, renders the transcription regulation of OXPHOS complex I a challenge. Recently bioinformatics analysis of the promoter regions of all OXPHOS genes in mammals supported patterns of co-regulation, suggesting that natural selection favored a mechanism facilitating the transcriptional regulatory control of genes encoding subunits of these large protein complexes. Here, using real time PCR of mitochondrial (mtDNA- and nuclear DNA (nDNA-encoded transcripts in a panel of 13 different human tissues, we show that the expression pattern of OXPHOS complex I genes is regulated in several clusters. Firstly, all mtDNA-encoded complex I subunits (N = 7 share a similar expression pattern, distinct from all tested nDNA-encoded subunits (N = 10. Secondly, two sub-clusters of nDNA-encoded transcripts with significantly different expression patterns were observed. Thirdly, the expression patterns of two nDNA-encoded genes, NDUFA4 and NDUFA5, notably diverged from the rest of the nDNA-encoded subunits, suggesting a certain degree of tissue specificity. Finally, the expression pattern of the mtDNA-encoded ND4L gene diverged from the rest of the tested mtDNA-encoded transcripts that are regulated by the same promoter, consistent with post-transcriptional regulation. These findings suggest, for the first time, that the regulation of complex I subunits expression in humans is complex rather than reflecting global co-regulation.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Encoding of coordination complexes with XML.
Vinoth, P; Sankar, P
2017-09-01
An in-silico system to encode structure, bonding and properties of coordination complexes is developed. The encoding is achieved through a semantic XML markup frame. Composition of the coordination complexes is captured in terms of central atom and ligands. Structural information of central atom is detailed in terms of electron status of valence electron orbitals. The ligands are encoded with specific reference to the electron environment of ligand centre atoms. Behaviour of ligands to form low or high spin complexes is accomplished by assigning a Ligand Centre Value to every ligand based on the electronic environment of ligand centre atom. Chemical ontologies are used for categorization purpose and to control different hybridization schemes. Complexes formed by the central atoms of transition metal, non-transition elements belonging to s-block, p-block and f-block are encoded with a generic encoding platform. Complexes of homoleptic, heteroleptic and bridged types are also covered by this encoding system. Utility of the encoded system to predict redox electron transfer reaction in the coordination complexes is demonstrated with a simple application. Copyright © 2017 Elsevier Inc. All rights reserved.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Low Complexity HEVC Encoder for Visual Sensor Networks
Directory of Open Access Journals (Sweden)
Zhaoqing Pan
2015-12-01
Full Text Available Visual sensor networks (VSNs can be widely applied in security surveillance, environmental monitoring, smart rooms, etc. However, with the increased number of camera nodes in VSNs, the volume of the visual information data increases significantly, which becomes a challenge for storage, processing and transmitting the visual data. The state-of-the-art video compression standard, high efficiency video coding (HEVC, can effectively compress the raw visual data, while the higher compression rate comes at the cost of heavy computational complexity. Hence, reducing the encoding complexity becomes vital for the HEVC encoder to be used in VSNs. In this paper, we propose a fast coding unit (CU depth decision method to reduce the encoding complexity of the HEVC encoder for VSNs. Firstly, the content property of the CU is analyzed. Then, an early CU depth decision method and a low complexity distortion calculation method are proposed for the CUs with homogenous content. Experimental results show that the proposed method achieves 71.91% on average encoding time savings for the HEVC encoder for VSNs.
Effect of transpiration on plant accumulation and translocation of PPCP/EDCs
International Nuclear Information System (INIS)
Dodgen, Laurel K.; Ueda, Aiko; Wu, Xiaoqin; Parker, David R.; Gan, Jay
2015-01-01
The reuse of treated wastewater for agricultural irrigation in arid and hot climates where plant transpiration is high may affect plant accumulation of pharmaceutical and personal care products (PPCPs) and endocrine disrupting chemicals (EDCs). In this study, carrot, lettuce, and tomato plants were grown in solution containing 16 PPCP/EDCs in either a cool-humid or a warm-dry environment. Leaf bioconcentration factors (BCF) were positively correlated with transpiration for chemical groups of different ionized states (p < 0.05). However, root BCFs were correlated with transpiration only for neutral PPCP/EDCs (p < 0.05). Neutral and cationic PPCP/EDCs showed similar accumulation, while anionic PPCP/EDCs had significantly higher accumulation in roots and significantly lower accumulation in leaves (p < 0.05). Results show that plant transpiration may play a significant role in the uptake and translocation of PPCP/EDCs, which may have a pronounced effect in arid and hot climates where irrigation with treated wastewater is common. - Highlights: • Leaf accumulation of PPCP/EDCs is related on plant transpiration. • Cationic and neutral PPCP/EDCs have similar leaf and root accumulation. • Anionic PPCP/EDCs have greater root accumulation and lesser leaf accumulation. • PPCP/EDCs are extensively metabolized in plant tissue and hydroponic solution. - High plant transpiration in arid and hot areas may lead to increased foliar accumulation of PPCP/EDCs from treated wastewater irrigation
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2016-03-01
The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya
2008-11-01
A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
EDC-2: The Endocrine Society's Second Scientific Statement on Endocrine-Disrupting Chemicals
Chappell, V. A.; Fenton, S. E.; Flaws, J. A.; Nadal, A.; Prins, G. S.; Toppari, J.; Zoeller, R. T.
2015-01-01
The Endocrine Society's first Scientific Statement in 2009 provided a wake-up call to the scientific community about how environmental endocrine-disrupting chemicals (EDCs) affect health and disease. Five years later, a substantially larger body of literature has solidified our understanding of plausible mechanisms underlying EDC actions and how exposures in animals and humans—especially during development—may lay the foundations for disease later in life. At this point in history, we have much stronger knowledge about how EDCs alter gene-environment interactions via physiological, cellular, molecular, and epigenetic changes, thereby producing effects in exposed individuals as well as their descendants. Causal links between exposure and manifestation of disease are substantiated by experimental animal models and are consistent with correlative epidemiological data in humans. There are several caveats because differences in how experimental animal work is conducted can lead to difficulties in drawing broad conclusions, and we must continue to be cautious about inferring causality in humans. In this second Scientific Statement, we reviewed the literature on a subset of topics for which the translational evidence is strongest: 1) obesity and diabetes; 2) female reproduction; 3) male reproduction; 4) hormone-sensitive cancers in females; 5) prostate; 6) thyroid; and 7) neurodevelopment and neuroendocrine systems. Our inclusion criteria for studies were those conducted predominantly in the past 5 years deemed to be of high quality based on appropriate negative and positive control groups or populations, adequate sample size and experimental design, and mammalian animal studies with exposure levels in a range that was relevant to humans. We also focused on studies using the developmental origins of health and disease model. No report was excluded based on a positive or negative effect of the EDC exposure. The bulk of the results across the board strengthen the
Effect of Transpiration on Plant Accumulation and Translocation of PPCP/EDCs
Dodgen, Laurel K; Ueda, Aiko; Wu, Xiaoqin; Parker, David R; Gan, Jay
2015-01-01
The reuse of treated wastewater for agricultural irrigation in arid and hot climates where plant transpiration is high may affect plant accumulation of pharmaceutical and personal care products (PPCPs) and endocrine disrupting chemicals (EDCs). In this study, carrot, lettuce, and tomato plants were grown in solution containing 16 PPCP/EDCs in either a cool-humid or a warm-dry environment. Leaf bioconcentration factors (BCF) were positively correlated with transpiration for chemical groups of different ionized states (p < 0.05). However, root BCFs were correlated with transpiration only for neutral PPCP/EDCs (p < 0.05). Neutral and cationic PPCP/EDCs showed similar accumulation, while anionic PPCP/EDCs had significantly higher accumulation in roots and significantly lower accumulation in leaves (p < 0.05). Results show that plant transpiration may play a significant role in the uptake and translocation of PPCP/EDCs, which may have a pronounced effect in arid and hot climates where irrigation with treated wastewater is common. PMID:25594843
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
EDCs DataBank: 3D-Structure database of endocrine disrupting chemicals.
Montes-Grajales, Diana; Olivero-Verbel, Jesus
2015-01-02
Endocrine disrupting chemicals (EDCs) are a group of compounds that affect the endocrine system, frequently found in everyday products and epidemiologically associated with several diseases. The purpose of this work was to develop EDCs DataBank, the only database of EDCs with three-dimensional structures. This database was built on MySQL using the EU list of potential endocrine disruptors and TEDX list. It contains the three-dimensional structures available on PubChem, as well as a wide variety of information from different databases and text mining tools, useful for almost any kind of research regarding EDCs. The web platform was developed employing HTML, CSS and PHP languages, with dynamic contents in a graphic environment, facilitating information analysis. Currently EDCs DataBank has 615 molecules, including pesticides, natural and industrial products, cosmetics, drugs and food additives, among other low molecular weight xenobiotics. Therefore, this database can be used to study the toxicological effects of these molecules, or to develop pharmaceuticals targeting hormone receptors, through docking studies, high-throughput virtual screening and ligand-protein interaction analysis. EDCs DataBank is totally user-friendly and the 3D-structures of the molecules can be downloaded in several formats. This database is freely available at http://edcs.unicartagena.edu.co. Copyright © 2014. Published by Elsevier Ireland Ltd.
Endocrine disrupting chemicals (EDCs) and female cancer: Informing the patients
Racho?, Dominik
2016-01-01
Breast and uterine cancer are the most frequent female gender related neoplasms whose growth is mostly estrogen dependent. Therefore, any EDC exhibiting estrogenic effects may increase the risk of these two malignancies. This review focuses on the potential role of EDCs with estrogenic potential on the risk of breast and uterine neoplasms but also points to the possible role of the exposure to EDCs in the pathogenesis of ovarian and cervical cancer. It also underlines the necessity of informi...
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Interactions between Upf1 and the decapping factors Edc3 and Pat1 in Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Kylie D Swisher
Full Text Available In Saccharomyces cerevisiae, mRNA transcripts with premature termination codons are targeted for deadenylation independent decapping and 5' to 3' decay in a quality control pathway termed nonsense-mediated decay (NMD. Critical factors in NMD include Upf1, Upf2, and Upf3, as well as the decapping enzyme, Dcp2/Dcp1. Loss of Upf2 or Upf3 leads to the accumulation of not only Upf1 and Dcp2 in P-bodies, but also of the decapping-activators Pat1, Dhh1, and Lsm1. An interaction between Upf1 and Dcp2 has been identified, which might recruit Dcp2 to the NMD decapping complex. To determine the nature and significance of the Dcp2-Upf1 interaction, we utilized the yeast two-hybrid assay to assess Upf1 interactions with various mRNA decapping factors. We find that although Dcp2 can interact with Upf1, this interaction is indirect and is largely dependent on the Edc3 protein, which interacts with the N-terminal domain of Upf1 at an overlapping, but not identical, site as Upf2. We also found that Pat1 has an independent two-hybrid interaction with the N-terminus of Upf1. Assessment of both reporter and endogenous NMD transcripts suggest that the decapping stimulators, including Edc3 and Pat1, as well as Edc1 and Edc2, are not essential for NMD under normal conditions. This work defines a larger decapping complex involved in NMD, but indicates that components of that complex are not required for general NMD and might either regulate a subset of NMD transcripts or be essential for proper NMD under different environmental conditions.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Uptake and accumulation of four PPCP/EDCs in two leafy vegetables.
Dodgen, L K; Li, J; Parker, D; Gan, J J
2013-11-01
Many pharmaceutical and personal care products (PPCPs) and endocrine-disrupting chemicals (EDCs) are present in reclaimed water, leading to concerns of human health risks from the consumption of food crops irrigated with reclaimed water. This study evaluated the potential for plant uptake and accumulation of four commonly occurring PPCP/EDCs, i.e., bisphenol A (BPA), diclofenac sodium (DCL), naproxen (NPX), and 4-nonylphenol (NP), by lettuce (Lactuca sativa) and collards (Brassica oleracea) in hydroponic culture, using (14)C-labeled compounds. In both plant species, plant accumulation followed the order of BPA > NP > DCL > NPX and accumulation in roots was much greater than in leaves and stems. Concentrations of (14)C-PPCP/EDCs in plant tissues ranged from 0.22 ± 0.03 to 927 ± 213 ng/g, but nearly all (14)C-residue was non-extractable. PPCP/EDCs, particularly BPA and NP, were also extensively transformed in the nutrient solution. Dietary uptake of these PPCP/EDCs by humans was predicted to be negligible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
DEFF Research Database (Denmark)
Koene, S; Rodenburg, R J; van der Knaap, M S
2012-01-01
cases and 126 from literature) with mutations in nuclear genes encoding structural complex I proteins or those involved in its assembly. Complex I deficiency caused by a nuclear gene defect is usually a non-dysmorphic syndrome, characterized by severe multi-system organ involvement and a poor prognosis...
Uptake and accumulation of four PPCP/EDCs in two leafy vegetables
International Nuclear Information System (INIS)
Dodgen, L.K.; Li, J.; Parker, D.; Gan, J.J.
2013-01-01
Many pharmaceutical and personal care products (PPCPs) and endocrine-disrupting chemicals (EDCs) are present in reclaimed water, leading to concerns of human health risks from the consumption of food crops irrigated with reclaimed water. This study evaluated the potential for plant uptake and accumulation of four commonly occurring PPCP/EDCs, i.e., bisphenol A (BPA), diclofenac sodium (DCL), naproxen (NPX), and 4-nonylphenol (NP), by lettuce (Lactuca sativa) and collards (Brassica oleracea) in hydroponic culture, using 14 C-labeled compounds. In both plant species, plant accumulation followed the order of BPA > NP > DCL > NPX and accumulation in roots was much greater than in leaves and stems. Concentrations of 14 C-PPCP/EDCs in plant tissues ranged from 0.22 ± 0.03 to 927 ± 213 ng/g, but nearly all 14 C-residue was non-extractable. PPCP/EDCs, particularly BPA and NP, were also extensively transformed in the nutrient solution. Dietary uptake of these PPCP/EDCs by humans was predicted to be negligible. -- Highlights: •Accumulation of bisphenol A, diclofenac, naproxen, and 4-nonylphenol by lettuce and collards was examined. •Plant accumulation had the order of BPA > NP > DCL > NPX. •Accumulation in roots was greater than in new leaves, original leaves, and stems. •Nearly all accumulated analyte was non-extractable. -- Four commonly occurring PPCP/EDCs were taken up into roots of lettuce and collards, but translocation into edible leaves was limited and nearly all residue was non-extractable
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Resource-aware complexity scalability for mobile MPEG encoding
Mietens, S.O.; With, de P.H.N.; Hentschel, C.; Panchanatan, S.; Vasudev, B.
2004-01-01
Complexity scalability attempts to scale the required resources of an algorithm with the chose quality settings, in order to broaden the application range. In this paper, we present complexity-scalable MPEG encoding of which the core processing modules are modified for scalability. Scalability is
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Edgren, Tomas; Nordlund, Stefan
2004-04-01
In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.
Pinheiro, Pedro F.; Leitão, Jorge H.
2013-01-01
This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47). Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min−1.mg−1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis. PMID:23460819
Directory of Open Access Journals (Sweden)
Sílvia A Sousa
Full Text Available This work reports the biochemical and functional analysis of the Burkholderia cenocepacia J2315 bceN gene, encoding a protein with GDP-D-mannose 4,6-dehydratase enzyme activity (E.C.4.2.1.47. Data presented indicate that the protein is active when in the tetrameric form, catalyzing the conversion of GDP-D-mannose into GDP-4-keto-6-deoxy-D-mannose. This sugar nucleotide is the intermediary necessary for the biosynthesis of GDP-D-rhamnose, one of the sugar residues of cepacian, the major exopolysaccharide produced by environmental and human, animal and plant pathogenic isolates of the Burkholderia cepacia complex species. Vmax and Km values of 1.5±0.2 µmol.min(-1.mg(-1 and 1024±123 µM, respectively, were obtained from the kinetic characterization of the B. cenocepacia J2315 BceN protein by NMR spectroscopy, at 25°C and in the presence of 1 mol MgCl2 per mol of protein. The enzyme activity was strongly inhibited by the substrate, with an estimated Ki of 2913±350 µM. The lack of a functional bceN gene in a mutant derived from B. cepacia IST408 slightly reduced cepacian production. However, in the B. multivorans ATCC17616 with bceN as the single gene in its genome with predicted GMD activity, a bceN mutant did not produce cepacian, indicating that this gene product is required for cepacian biosynthesis.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Fast Coding Unit Encoding Mechanism for Low Complexity Video Coding
Gao, Yuan; Liu, Pengyu; Wu, Yueying; Jia, Kebin; Gao, Guandong
2016-01-01
In high efficiency video coding (HEVC), coding tree contributes to excellent compression performance. However, coding tree brings extremely high computational complexity. Innovative works for improving coding tree to further reduce encoding time are stated in this paper. A novel low complexity coding tree mechanism is proposed for HEVC fast coding unit (CU) encoding. Firstly, this paper makes an in-depth study of the relationship among CU distribution, quantization parameter (QP) and content ...
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
New Complexity Scalable MPEG Encoding Techniques for Mobile Applications
Directory of Open Access Journals (Sweden)
Stephan Mietens
2004-03-01
Full Text Available Complexity scalability offers the advantage of one-time design of video applications for a large product family, including mobile devices, without the need of redesigning the applications on the algorithmic level to meet the requirements of the different products. In this paper, we present complexity scalable MPEG encoding having core modules with modifications for scalability. The interdependencies of the scalable modules and the system performance are evaluated. Experimental results show scalability giving a smooth change in complexity and corresponding video quality. Scalability is basically achieved by varying the number of computed DCT coefficients and the number of evaluated motion vectors but other modules are designed such they scale with the previous parameters. In the experiments using the “Stefan” sequence, the elapsed execution time of the scalable encoder, reflecting the computational complexity, can be gradually reduced to roughly 50% of its original execution time. The video quality scales between 20 dB and 48 dB PSNR with unity quantizer setting, and between 21.5 dB and 38.5 dB PSNR for different sequences targeting 1500 kbps. The implemented encoder and the scalability techniques can be successfully applied in mobile systems based on MPEG video compression.
Bartl, S; Weissman, I L
1994-01-04
The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated.
Low-complexity video encoding method for wireless image transmission in capsule endoscope.
Takizawa, Kenichi; Hamaguchi, Kiyoshi
2010-01-01
This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Directory of Open Access Journals (Sweden)
Gunlög Rasmussen
Full Text Available Staphylococcus aureus encodes a remarkable number of virulence factors which may contribute to its pathogenicity and ability to cause invasive disease. The main objective of this study was to evaluate the association between S. aureus invasiveness and bacterial genotype, in terms of the presence of virulence genes and affiliation to clonal complexes. Also, the significance of different virulence genes, mainly adhesins, for the development of infective endocarditis was investigated. DNA microarray technology was used to analyze 134 S. aureus isolates, all methicillin-susceptible, derived from three groups of clinically well-characterized patients: nasal carriers (n=46, bacteremia (n=55, and bacteremia with infective endocarditis (n=33. Invasive isolates were dominant in four of the major clonal complexes: 5, 8, 15, and 25. Of the 170 virulence genes examined, those encoding accessory gene regulator group II (agr II, capsule polysaccharide serotype 5 (cap5, and adhesins such as S. aureus surface protein G (sasG and fibronectin-binding protein B (fnbB were found to be associated with invasive disease. The same was shown for the leukocidin genes lukD/lukE, as well as the genes encoding serine protease A and B (splA/splB, staphylococcal complement inhibitor (scn and the staphylococcal exotoxin-like protein (setC or selX. In addition, there was a trend of higher prevalence of certain genes or gene clusters (sasG, agr II, cap5 among isolates causing infective endocarditis compared to other invasive isolates. In most cases, the presence of virulence genes was linked to clonal complex affiliation. In conclusion, certain S. aureus clonal lineages harboring specific sets of virulence genes seem to be more successful in causing invasive disease.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Martin, Carol-Anne; Murray, Jennie E; Carroll, Paula; Leitch, Andrea; Mackenzie, Karen J; Halachev, Mihail; Fetit, Ahmed E; Keith, Charlotte; Bicknell, Louise S; Fluteau, Adeline; Gautier, Philippe; Hall, Emma A; Joss, Shelagh; Soares, Gabriela; Silva, João; Bober, Michael B; Duker, Angela; Wise, Carol A; Quigley, Alan J; Phadke, Shubha R; Wood, Andrew J; Vagnarelli, Paola; Jackson, Andrew P
2016-10-01
Compaction of chromosomes is essential for accurate segregation of the genome during mitosis. In vertebrates, two condensin complexes ensure timely chromosome condensation, sister chromatid disentanglement, and maintenance of mitotic chromosome structure. Here, we report that biallelic mutations in NCAPD2, NCAPH, or NCAPD3, encoding subunits of these complexes, cause microcephaly. In addition, hypomorphic Ncaph2 mice have significantly reduced brain size, with frequent anaphase chromatin bridge formation observed in apical neural progenitors during neurogenesis. Such DNA bridges also arise in condensin-deficient patient cells, where they are the consequence of failed sister chromatid disentanglement during chromosome compaction. This results in chromosome segregation errors, leading to micronucleus formation and increased aneuploidy in daughter cells. These findings establish "condensinopathies" as microcephalic disorders, with decatenation failure as an additional disease mechanism for microcephaly, implicating mitotic chromosome condensation as a key process ensuring mammalian cerebral cortex size. © 2016 Martin et al.; Published by Cold Spring Harbor Laboratory Press.
Influence of EDC on Dentin-Resin Shear Bond Strength and Demineralized Dentin Thermal Properties
Directory of Open Access Journals (Sweden)
Lin Tang
2016-11-01
Full Text Available This study aimed to evaluate the bonding strength and thermal properties of demineralized dentin with and without EDC treatment. Sound human molars were randomly divided into seven treatment groups (n = 20: control, 80% ethanol, and five EDC ethanol solutions (0.01–1.0 M. In each group, 16 samples were used for bond strength assessment and 4 samples were used for scanning electron microscopy (SEM analysis. A further 70 intact molars were used to obtain a fine demineralized dentin powder, treated with the same solutions and were evaluated the crosslink degree by ninhydrin test and denaturation temperature (Td by differential scanning calorimetry. EDC-treated specimens (<1.0 M had a higher bond strength, especially 0.3 and 0.5 M group, than the control counterpart. There was a significant drop in bond strength of 1.0 M EDC group. SEM revealed a homogeneous and regular interface under all treatments. EDC treatment significantly increased the demineralized dentin cross-link degree and Td compared with the control and ethanol treatments. The 0.3 and 0.5 M treatments showed the highest cross-link degree and Td. In terms of mechnical and theramal properties consideration, 0.3 and 0.5 M EDC solutions may be favorable for when applied with etch-and-rinse adhesives, but it is still needed further long-term study.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Directory of Open Access Journals (Sweden)
A. B. Levina
2016-03-01
Full Text Available Error detection codes are mechanisms that enable robust delivery of data in unreliable communication channels and devices. Unreliable channels and devices are error-prone objects. Respectively, error detection codes allow detecting such errors. There are two classes of error detecting codes - classical codes and security-oriented codes. The classical codes have high percentage of detected errors; however, they have a high probability to miss an error in algebraic manipulation. In order, security-oriented codes are codes with a small Hamming distance and high protection to algebraic manipulation. The probability of error masking is a fundamental parameter of security-oriented codes. A detailed study of this parameter allows analyzing the behavior of the error-correcting code in the case of error injection in the encoding device. In order, the complexity of the encoding function plays an important role in the security-oriented codes. Encoding functions with less computational complexity and a low probability of masking are the best protection of encoding device against malicious acts. This paper investigates the influence of encoding function complexity on the error masking probability distribution. It will be shownthat the more complex encoding function reduces the maximum of error masking probability. It is also shown in the paper that increasing of the function complexity changes the error masking probability distribution. In particular, increasing of computational complexity decreases the difference between the maximum and average value of the error masking probability. Our resultshave shown that functions with greater complexity have smoothed maximums of error masking probability, which significantly complicates the analysis of error-correcting code by attacker. As a result, in case of complex encoding function the probability of the algebraic manipulation is reduced. The paper discusses an approach how to measure the error masking
Region-specific expression of mitochondrial complex I genes during murine brain development.
Directory of Open Access Journals (Sweden)
Stefanie Wirtz
Full Text Available Mutations in the nuclear encoded subunits of mitochondrial complex I (NADH:ubiquinone oxidoreductase may cause circumscribed cerebral lesions ranging from degeneration of the striatal and brainstem gray matter (Leigh syndrome to leukodystrophy. We hypothesized that such pattern of regional pathology might be due to local differences in the dependence on complex I function. Using in situ hybridization we investigated the relative expression of 33 nuclear encoded complex I subunits in different brain regions of the mouse at E11.5, E17.5, P1, P11, P28 and adult (12 weeks. With respect to timing and relative intensity of complex I gene expression we found a highly variant pattern in different regions during development. High average expression levels were detected in periods of intense neurogenesis. In cerebellar Purkinje and in hippocampal CA1/CA3 pyramidal neurons we found a second even higher peak during the period of synaptogenesis and maturation. The extraordinary dependence of these structures on complex I gene expression during synaptogenesis is in accord with our recent findings that gamma oscillations--known to be associated with higher cognitive functions of the mammalian brain--strongly depend on the complex I activity. However, with the exception of the mesencephalon, we detected only average complex I expression levels in the striatum and basal ganglia, which does not explain the exquisite vulnerability of these structures in mitochondrial disorders.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Walther, Brigitte; Hossin, Safayet; Townend, John; Abernethy, Neil; Parker, David; Jeffries, David
2011-01-01
Background Traditionally, clinical research studies rely on collecting data with case report forms, which are subsequently entered into a database to create electronic records. Although well established, this method is time-consuming and error-prone. This study compares four electronic data capture (EDC) methods with the conventional approach with respect to duration of data capture and accuracy. It was performed in a West African setting, where clinical trials involve data collection from urban, rural and often remote locations. Methodology/Principal Findings Three types of commonly available EDC tools were assessed in face-to-face interviews; netbook, PDA, and tablet PC. EDC performance during telephone interviews via mobile phone was evaluated as a fourth method. The Graeco Latin square study design allowed comparison of all four methods to standard paper-based recording followed by data double entry while controlling simultaneously for possible confounding factors such as interview order, interviewer and interviewee. Over a study period of three weeks the error rates decreased considerably for all EDC methods. In the last week of the study the data accuracy for the netbook (5.1%, CI95%: 3.5–7.2%) and the tablet PC (5.2%, CI95%: 3.7–7.4%) was not significantly different from the accuracy of the conventional paper-based method (3.6%, CI95%: 2.2–5.5%), but error rates for the PDA (7.9%, CI95%: 6.0–10.5%) and telephone (6.3%, CI95% 4.6–8.6%) remained significantly higher. While EDC-interviews take slightly longer, data become readily available after download, making EDC more time effective. Free text and date fields were associated with higher error rates than numerical, single select and skip fields. Conclusions EDC solutions have the potential to produce similar data accuracy compared to paper-based methods. Given the considerable reduction in the time from data collection to database lock, EDC holds the promise to reduce research-associated costs
Directory of Open Access Journals (Sweden)
Brigitte Walther
Full Text Available BACKGROUND: Traditionally, clinical research studies rely on collecting data with case report forms, which are subsequently entered into a database to create electronic records. Although well established, this method is time-consuming and error-prone. This study compares four electronic data capture (EDC methods with the conventional approach with respect to duration of data capture and accuracy. It was performed in a West African setting, where clinical trials involve data collection from urban, rural and often remote locations. METHODOLOGY/PRINCIPAL FINDINGS: Three types of commonly available EDC tools were assessed in face-to-face interviews; netbook, PDA, and tablet PC. EDC performance during telephone interviews via mobile phone was evaluated as a fourth method. The Graeco Latin square study design allowed comparison of all four methods to standard paper-based recording followed by data double entry while controlling simultaneously for possible confounding factors such as interview order, interviewer and interviewee. Over a study period of three weeks the error rates decreased considerably for all EDC methods. In the last week of the study the data accuracy for the netbook (5.1%, CI95%: 3.5-7.2% and the tablet PC (5.2%, CI95%: 3.7-7.4% was not significantly different from the accuracy of the conventional paper-based method (3.6%, CI95%: 2.2-5.5%, but error rates for the PDA (7.9%, CI95%: 6.0-10.5% and telephone (6.3%, CI95% 4.6-8.6% remained significantly higher. While EDC-interviews take slightly longer, data become readily available after download, making EDC more time effective. Free text and date fields were associated with higher error rates than numerical, single select and skip fields. CONCLUSIONS: EDC solutions have the potential to produce similar data accuracy compared to paper-based methods. Given the considerable reduction in the time from data collection to database lock, EDC holds the promise to reduce research
Polish Society of Endocrinology Position statement on endocrine disrupting chemicals (EDCs).
Rutkowska, Aleksandra; Rachoń, Dominik; Milewicz, Andrzej; Ruchała, Marek; Bolanowski, Marek; Jędrzejuk, Diana; Bednarczuk, Tomasz; Górska, Maria; Hubalewska-Dydejczyk, Alicja; Kos-Kudła, Beata; Lewiński, Andrzej; Zgliczyński, Wojciech
2015-01-01
With the reference to the position statements of the Endocrine Society, the Paediatric Endocrine Society, and the European Society of Paediatric Endocrinology, the Polish Society of Endocrinology points out the adverse health effects caused by endocrine disrupting chemicals (EDCs) commonly used in daily life as components of plastics, food containers, pharmaceuticals, and cosmetics. The statement is based on the alarming data about the increase of the prevalence of many endocrine disorders such as: cryptorchidism, precocious puberty in girls and boys, and hormone-dependent cancers (endometrium, breast, prostate). In our opinion, it is of human benefit to conduct epidemiological studies that will enable the estimation of the risk factors of exposure to EDCs and the probability of endocrine disorders. Increasing consumerism and the industrial boom has led to severe pollution of the environment with a corresponding negative impact on human health; thus, there is great necessity for the biomonitoring of EDCs in Poland.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Ixodes ticks belonging to the Ixodes ricinus complex encode a family of anticomplement proteins.
Daix, V; Schroeder, H; Praet, N; Georgin, J-P; Chiappino, I; Gillet, L; de Fays, K; Decrem, Y; Leboulle, G; Godfroid, E; Bollen, A; Pastoret, P-P; Gern, L; Sharp, P M; Vanderplasschen, A
2007-04-01
The alternative pathway of complement is an important innate defence against pathogens including ticks. This component of the immune system has selected for pathogens that have evolved countermeasures. Recently, a salivary protein able to inhibit the alternative pathway was cloned from the American tick Ixodes scapularis (Valenzuela et al., 2000; J. Biol. Chem. 275, 18717-18723). Here, we isolated two different sequences, similar to Isac, from the transcriptome of I. ricinus salivary glands. Expression of these sequences revealed that they both encode secreted proteins able to inhibit the complement alternative pathway. These proteins, called I. ricinus anticomplement (IRAC) protein I and II, are coexpressed constitutively in I. ricinus salivary glands and are upregulated during blood feeding. Also, we demonstrated that they are the products of different genes and not of alleles of the same locus. Finally, phylogenetic analyses demonstrate that ticks belonging to the Ixodes ricinus complex encode a family of relatively small anticomplement molecules undergoing diversification by positive Darwinian selection.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Ahmed, Iltaf; Buchert, Rebecca; Zhou, Mi; Jiao, Xinfu; Mittal, Kirti; Sheikh, Taimoor I; Scheller, Ute; Vasli, Nasim; Rafiq, Muhammad Arshad; Brohi, M Qasim; Mikhailov, Anna; Ayaz, Muhammad; Bhatti, Attya; Sticht, Heinrich; Nasr, Tanveer; Carter, Melissa T; Uebe, Steffen; Reis, André; Ayub, Muhammad; John, Peter; Kiledjian, Megerditch; Vincent, John B; Jamra, Rami Abou
2015-06-01
There are two known mRNA degradation pathways, 3' to 5' and 5' to 3'. We identified likely pathogenic variants in two genes involved in these two pathways in individuals with intellectual disability. In a large family with multiple branches, we identified biallelic variants in DCPS in three affected individuals; a splice site variant (c.636+1G>A) that results in an in-frame insertion of 45 nucleotides and a missense variant (c.947C>T; p.Thr316Met). DCPS decaps the cap structure generated by 3' to 5' exonucleolytic degradation of mRNA. In vitro decapping assays showed an ablation of decapping function for both variants in DCPS. In another family, we identified a homozygous mutation (c.161T>C; p.Phe54Ser) in EDC3 in two affected children. EDC3 stimulates DCP2, which decaps mRNAs at the beginning of the 5' to 3' degradation pathway. In vitro decapping assays showed that altered EDC3 is unable to enhance DCP2 decapping at low concentrations and even inhibits DCP2 decapping at high concentration. We show that individuals with biallelic mutations in these genes of seemingly central functions are viable and that these possibly lead to impairment of neurological functions linking mRNA decapping to normal cognition. Our results further affirm an emerging theme linking aberrant mRNA metabolism to neurological defects. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Directory of Open Access Journals (Sweden)
Susanne Huch
2016-10-01
Full Text Available The rate and regulation of mRNA decay are major elements in the proper control of gene expression. Edc3 and Lsm4 are two decapping activator proteins that have previously been shown to function in the assembly of RNA granules termed P bodies. Here, we show that deletion of edc3, when combined with a removal of the glutamine/asparagine rich region of Lsm4 (edc3Δ lsm4ΔC reduces mRNA stability and alters pathways of mRNA degradation. Multiple tested mRNAs exhibited reduced stability in the edc3Δ lsm4ΔC mutant. The destabilization was linked to an increased dependence on Ccr4-mediated deadenylation and mRNA decapping. Unlike characterized mutations in decapping factors that either are neutral or are able to stabilize mRNA, the combined edc3Δ lsm4ΔC mutant reduced mRNA stability. We characterized the growth and activity of the major mRNA decay systems and translation in double mutant and wild-type yeast. In the edc3Δ lsm4ΔC mutant, we observed alterations in the levels of specific mRNA decay factors as well as nuclear accumulation of the catalytic subunit of the decapping enzyme Dcp2. Hence, we suggest that the effects on mRNA stability in the edc3Δ lsm4ΔC mutant may originate from mRNA decay protein abundance or changes in mRNPs, or alternatively may imply a role for P bodies in mRNA stabilization.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Bartl, S; Weissman, I L
1994-01-01
The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Directory of Open Access Journals (Sweden)
Xin Sun
2018-01-01
Full Text Available How chromatin-remodeling complexes modulate gene networks to control organ-specific properties is not well understood. For example, Baf60c (Smarcd3 encodes a cardiac-enriched subunit of the SWI/SNF-like BAF chromatin complex, but its role in heart development is not fully understood. We found that constitutive loss of Baf60c leads to embryonic cardiac hypoplasia and pronounced cardiac dysfunction. Conditional deletion of Baf60c in cardiomyocytes resulted in postnatal dilated cardiomyopathy with impaired contractile function. Baf60c regulates a gene expression program that includes genes encoding contractile proteins, modulators of sarcomere function, and cardiac metabolic genes. Many of the genes deregulated in Baf60c null embryos are targets of the MEF2/SRF co-factor Myocardin (MYOCD. In a yeast two-hybrid screen, we identified MYOCD as a BAF60c interacting factor; we showed that BAF60c and MYOCD directly and functionally interact. We conclude that Baf60c is essential for coordinating a program of gene expression that regulates the fundamental functional properties of cardiomyocytes.
Style, Sarah; Beard, B James; Harris-Fry, Helen; Sengupta, Aman; Jha, Sonali; Shrestha, Bhim P; Rai, Anjana; Paudel, Vikas; Thondoo, Meelan; Pulkki-Brannstrom, Anni-Maria; Skordis-Worrall, Jolene; Manandhar, Dharma S; Costello, Anthony; Saville, Naomi M
2017-01-01
The increasing availability and capabilities of mobile phones make them a feasible means of data collection. Electronic Data Capture (EDC) systems have been used widely for public health monitoring and surveillance activities, but documentation of their use in complicated research studies requiring multiple systems is limited. This paper shares our experiences of designing and implementing a complex multi-component EDC system for a community-based four-armed cluster-Randomised Controlled Trial in the rural plains of Nepal, to help other researchers planning to use EDC for complex studies in low-income settings. We designed and implemented three interrelated mobile phone data collection systems to enrol and follow-up pregnant women (trial participants), and to support the implementation of trial interventions (women's groups, food and cash transfers). 720 field staff used basic phones to send simple coded text messages, 539 women's group facilitators used Android smartphones with Open Data Kit Collect, and 112 Interviewers, Coordinators and Supervisors used smartphones with CommCare. Barcoded photo ID cards encoded with participant information were generated for each enrolled woman. Automated systems were developed to download, recode and merge data for nearly real-time access by researchers. The systems were successfully rolled out and used by 1371 staff. A total of 25,089 pregnant women were enrolled, and 17,839 follow-up forms completed. Women's group facilitators recorded 5717 women's groups and the distribution of 14,647 food and 13,482 cash transfers. Using EDC sped up data collection and processing, although time needed for programming and set-up delayed the study inception. EDC using three interlinked mobile data management systems (FrontlineSMS, ODK and CommCare) was a feasible and effective method of data capture in a complex large-scale trial in the plains of Nepal. Despite challenges including prolonged set-up times, the systems met multiple data
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Induction and inhibition of oocyte maturation by EDCs in zebrafish
Directory of Open Access Journals (Sweden)
Tokumoto Mika
2005-12-01
Full Text Available Abstract Background Oocyte maturation in lower vertebrates is triggered by maturation-inducing hormone (MIH, which acts on unidentified receptors on the oocyte surface and induces the activation of maturation-promoting factor (MPF in the oocyte cytoplasm. We previously described the induction of oocyte maturation in fish by an endocrine-disrupting chemical (EDC, diethylstilbestrol (DES, a nonsteroidal estrogen. Methods In this study, stimulatory and inhibitory effects of EDCs and natural steroids on oocyte maturation were examined in zebrafish. For effective agents, some details about the mechanism in induction or inhibition of maturation were examined. Possible groups of DES interacting with the MIH receptor are discussed based on relative potency of steroids to induce maturation. Results Among agents tested, tamoxifen (TAM and its metabolite 4-hydroxytamoxifen (4-OHT showed stimulatory activity similar to DES. The time courses of the change in germinal vesicle breakdown and an intracellular molecular event (the synthesis of cyclin B induced by TAM were indistinguishable from those induced by MIH. In contrast, pentachlorophenol (PCP had a potent inhibitory effect on MIH-induced oocyte maturation. PCP inhibited not only MIH-induced maturation but also DES- and TAM-induced maturation. Methoxychlor also inhibited maturation when oocytes were pre-treated with this agent. Conclusion These results suggest that EDCs act as agonists or antagonists in the induction of oocyte maturation in fish.
Minimized state complexity of quantum-encoded cryptic processes
Riechers, Paul M.; Mahoney, John R.; Aghamohammadi, Cina; Crutchfield, James P.
2016-05-01
The predictive information required for proper trajectory sampling of a stochastic process can be more efficiently transmitted via a quantum channel than a classical one. This recent discovery allows quantum information processing to drastically reduce the memory necessary to simulate complex classical stochastic processes. It also points to a new perspective on the intrinsic complexity that nature must employ in generating the processes we observe. The quantum advantage increases with codeword length: the length of process sequences used in constructing the quantum communication scheme. In analogy with the classical complexity measure, statistical complexity, we use this reduced communication cost as an entropic measure of state complexity in the quantum representation. Previously difficult to compute, the quantum advantage is expressed here in closed form using spectral decomposition. This allows for efficient numerical computation of the quantum-reduced state complexity at all encoding lengths, including infinite. Additionally, it makes clear how finite-codeword reduction in state complexity is controlled by the classical process's cryptic order, and it allows asymptotic analysis of infinite-cryptic-order processes.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Directory of Open Access Journals (Sweden)
Jui-Yang Lai
2013-01-01
Full Text Available A nanoscale modification strategy that can incorporate chondroitin sulfate (CS into the cross-linked porous gelatin materials has previously been proposed to give superior performance for designed corneal keratocyte scaffolds. The purpose of this work was to further investigate the influence of carbodiimide chemistry on the characteristics and biofunctionalities of gelatin/CS scaffolds treated with varying N-hydroxysuccinimide (NHS/1-ethyl-3-(3-dimethyl aminopropyl carbodiimide hydrochloride (EDC molar ratios (0-1 at a constant EDC concentration of 10 mM. Results of Fourier transform infrared spectroscopy and dimethylmethylene blue assays consistently indicated that when the NHS to EDC molar ratio exceeds a critical level (i.e., 0.5, the efficiency of carbodiimide-mediated biomaterial modification is significantly reduced. With the optimum NHS/EDC molar ratio of 0.5, chemical treatment could achieve relatively high CS content in the gelatin scaffolds, thereby enhancing the water content, glucose permeation, and fibronectin adsorption. Live/Dead assays and interleukin-6 mRNA expression analyses demonstrated that all the test samples have good cytocompatibility without causing toxicity and inflammation. In the molar ratio range of NHS to EDC from 0 to 0.5, the cell adhesion ratio and proliferation activity on the chemically modified samples significantly increased, which is attributed to the increasing CS content. Additionally, the materials with highest CS content (0.143 ± 0.007 nmol/10 mg scaffold showed the greatest stimulatory effect on the biosynthetic activity of cultivated keratocytes. These findings suggest that a positive correlation is noticed between the NHS to EDC molar ratio and the CS content in the biopolymer matrices, thereby greatly affecting the corneal stromal cell growth.
Disentangling the Trichoderma viridescens complex
Jaklitsch, W.M.; Samuels, G.J.; Ismaiel, A.; Voglmayr, H.
2013-01-01
Trichoderma viridescens is recognised as a species complex. Multigene analyses based on the translation elongation factor 1-alpha encoding gene (tef1), a part of the rpb2 gene, encoding the second largest RNA polymerase subunit and the larger subunit of ATP citrate lyase (acl1) reveals 13
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Low Complexity Encoder of High Rate Irregular QC-LDPC Codes for Partial Response Channels
Directory of Open Access Journals (Sweden)
IMTAWIL, V.
2011-11-01
Full Text Available High rate irregular QC-LDPC codes based on circulant permutation matrices, for efficient encoder implementation, are proposed in this article. The structure of the code is an approximate lower triangular matrix. In addition, we present two novel efficient encoding techniques for generating redundant bits. The complexity of the encoder implementation depends on the number of parity bits of the code for the one-stage encoding and the length of the code for the two-stage encoding. The advantage of both encoding techniques is that few XOR-gates are used in the encoder implementation. Simulation results on partial response channels also show that the BER performance of the proposed code has gain over other QC-LDPC codes.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
Institute of Scientific and Technical Information of China (English)
孟顺龙; 宋超; 范立民; 裘丽萍; 陈家长; 徐跑
2013-01-01
越来越多的环境内分泌干扰物(EDCs)不断释放到环境,并通过大气沉降、地表径流、土壤淋溶和直接排放等方式进入水体,从而使水体成为EDCs存在的主要场所之一.为引起社会对水体EDCs污染的广泛关注,并积极采取EDCs危害防治措施,保护鱼类资源和水生态系统,本文介绍了EDCs的分类,详述了自然水体、饮用水源水以及自来水中EDCs污染情况,阐明了EDCs对鱼类的生殖危害.资料分析显示,EDCs能够扰乱生物体内分泌功能,导致生殖器官、生殖机能和生殖行为异常,引起生育力下降,甚至生物繁殖机能损害,并最终导致种群数量下降,以至物种灭绝.虽然国内外已经开展了一些关于EDCs对生物危害等方面的研究,但大都处于起步阶段,存在着基础研究薄弱、识别和鉴定困难或代价太大等问题,有关工作亟需全面、深入开展.%Environmental endocrine disrupting chemicals (EDCs) , commonly found in the environment, come from industry and agriculture, including pesticides, fungicides, insecticides, herbicides, and other chemicals. Nowadays, more and more EDCs were released into the environment. EDCs go into water body via atmosphere sedimentation, surface runoff, soil eluviation, etc, so water body becomes the main place existing. In order to attract a great deal of scientific and public attention worldwide, and to prevent EDCs pollution, the classification of EDCs and their concentrations in natural water bodies, drinking water source and tap water, and the reproductive toxicity of EDCs to fish were reviewed. EDCs could disturb the endocrine system and make reproductive organs and reproduction be abnormal, resulting in the fertility descending,reproduction function damage, community quantity decrease and even species extinction finally. EDCs could disrupt the homeostasis maintained by hormones and resulted in defects of neural development and abnormalities of the endocrine and
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
DEFF Research Database (Denmark)
Knudsen, K; Madsen, AS; Mygind, P
1999-01-01
Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Alibardi, Lorenzo; Holthaus, Karin Brigit; Sukseree, Supawadee; Hermann, Marcela; Tschachler, Erwin; Eckhart, Leopold
2016-01-01
The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC) encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine), which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs). Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP) and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
Directory of Open Access Journals (Sweden)
Lorenzo Alibardi
Full Text Available The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine, which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs. Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Gore, A C; Chappell, V A; Fenton, S E; Flaws, J A; Nadal, A; Prins, G S; Toppari, J; Zoeller, R T
2015-12-01
This Executive Summary to the Endocrine Society's second Scientific Statement on environmental endocrine-disrupting chemicals (EDCs) provides a synthesis of the key points of the complete statement. The full Scientific Statement represents a comprehensive review of the literature on seven topics for which there is strong mechanistic, experimental, animal, and epidemiological evidence for endocrine disruption, namely: obesity and diabetes, female reproduction, male reproduction, hormone-sensitive cancers in females, prostate cancer, thyroid, and neurodevelopment and neuroendocrine systems. EDCs such as bisphenol A, phthalates, pesticides, persistent organic pollutants such as polychlorinated biphenyls, polybrominated diethyl ethers, and dioxins were emphasized because these chemicals had the greatest depth and breadth of available information. The Statement also included thorough coverage of studies of developmental exposures to EDCs, especially in the fetus and infant, because these are critical life stages during which perturbations of hormones can increase the probability of a disease or dysfunction later in life. A conclusion of the Statement is that publications over the past 5 years have led to a much fuller understanding of the endocrine principles by which EDCs act, including nonmonotonic dose-responses, low-dose effects, and developmental vulnerability. These findings will prove useful to researchers, physicians, and other healthcare providers in translating the science of endocrine disruption to improved public health.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Directory of Open Access Journals (Sweden)
Guilherme Corrêa
2012-01-01
Full Text Available In H.264/AVC, the encoding process can occur according to one of the 13 intraframe coding modes or according to one of the 8 available interframes block sizes, besides the SKIP mode. In the Joint Model reference software, the choice of the best mode is performed through exhaustive executions of the entire encoding process, which significantly increases the encoder's computational complexity and sometimes even forbids its use in real-time applications. Considering this context, this work proposes a set of heuristic algorithms targeting hardware architectures that lead to earlier selection of one encoding mode. The amount of repetitions of the encoding process is reduced by 47 times, at the cost of a relatively small cost in compression performance. When compared to other works, the fast hierarchical mode decision results are expressively more satisfactory in terms of computational complexity reduction, quality, and bit rate. The low-complexity mode decision architecture proposed is thus a very good option for real-time coding of high-resolution videos. The solution is especially interesting for embedded and mobile applications with support to multimedia systems, since it yields good compression rates and image quality with a very high reduction in the encoder complexity.
Energy Technology Data Exchange (ETDEWEB)
Buoso, Erica; Galasso, Marilisa; Ronfani, Melania [Dipartimento di Scienze del Farmaco, Università degli Studi di Pavia, Viale Taramelli 12/14, 27100 Pavia (Italy); Papale, Angela; Galbiati, Valentina [Laboratory of Toxicology, Dipartimento di Scienze Farmacologiche e Biomolecolari, Università degli Studi di Milano, Via Balzaretti 9, 20133 Milano (Italy); Eberini, Ivano [Laboratorio di Biochimica e Biofisica Computazionale, Dipartimento di Scienze Farmacologiche e Biomolecolari, Università degli Studi di Milano, Milan (Italy); Marinovich, Marina [Laboratory of Toxicology, Dipartimento di Scienze Farmacologiche e Biomolecolari, Università degli Studi di Milano, Via Balzaretti 9, 20133 Milano (Italy); Racchi, Marco [Dipartimento di Scienze del Farmaco, Università degli Studi di Pavia, Viale Taramelli 12/14, 27100 Pavia (Italy); Corsini, Emanuela, E-mail: emanuela.corsini@unimi.it [Laboratory of Toxicology, Dipartimento di Scienze Farmacologiche e Biomolecolari, Università degli Studi di Milano, Via Balzaretti 9, 20133 Milano (Italy)
2017-06-15
We recently demonstrated the existence of a complex hormonal balance between steroid hormones in the control of RACK1 (Receptor for Activated C Kinase 1) expression and immune activation, suggesting that this scaffold protein may also be targeted by endocrine disrupting chemicals (EDCs). As a proof of concept, we investigated the effect of the doping agent nandrolone, an androgen receptor (AR) agonist, and of p,p′DDT (dichlorodiphenyltrichloroethane) and its main metabolite p,p′DDE (dichlorodiphenyldichloroethylene), a weak and strong AR antagonist, respectively, on RACK1 expression and innate immune response. In analogy to endogenous androgens, nandrolone induced a dose-related increase in RACK1 transcriptional activity and protein expression, resulting in increased LPS-induced IL-8 and TNF-α production and proliferation in THP-1 cells. Conversely, p,p′DDT and p,p′DDE significantly decrease RACK1 expression, LPS-induced cytokine production and CD86 expression; with p,p′DDE exerting a stronger repressor effect than p,p′DDT, consistent with its stronger AR antagonistic effect. These results indicate that RACK1 could be a relevant target of EDCs, responding in opposite ways to agonist or antagonist of AR, representing a bridge between the endocrine system and the innate immune system. - Highlights: • RACK1 expression can be induced by AR agonists with a consequent enhancement of the response to LPS. • RACK1 can be negatively modulated by the AR antagonists DDT and its main metabolite p,p′DDE. • RACK1 can be a relevant target of EDCs, representing a bridge between the endocrine system and the immune system.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Directory of Open Access Journals (Sweden)
Sara Ramezani
2012-01-01
Full Text Available Objective: Stuttering is a fairly common speech disorder. However, the etiology is poorly understood and is likely to be heterogeneous. The aim of this research is to investigate phonological encoding complexity on speech fluency in 6-9 year old stuttering children in comparison with non-stutterers in Tehran. Materials & Methods: This cross-sectional, descriptive analytic research was done on 18 stuttering children with profound and severe level and 18 non-stuttering children. The stuttering subjects were selected by convenience and normal subjects were matched to stuttering subjects by gender, age and geographics. A non-word test comprising 87 non-words was used to investigate phonological encoding and phonological complexity effects on speech fluency. Stimuli were presented in random order with approximately 5 seconds between items, using a computer via external Toshiba SOMIC SM-818 headphone and requested subject was asked to repeat them. Results: The results indicated that speech fluency decreased significantly (P<0.05 by increasing phonological complexity comparing to controls. Conclusion: The findings of the present research seem to suggest that, stuttering children may have deficits in phonological encoding. The deficit has been increased with phonological encoding complexity. Based on covert repair hypothesis, phonological difficulty may cause covert self- repair and leads to different patterns of stuttering.
Talmadge, J E; Talmadge, C B; Zbar, B; McEwen, R; Meeker, A K; Tribble, H
1987-06-01
The mechanism by which tumor allografts escape host immunologic attack was investigated. B16-BL6 cells (the bladder 6 subline of the B16 melanoma) (H-2b) were transfected with a gene (Dd) encoding an allogeneic class I major histocompatibility complex antigen. Clones that expressed Dd antigen were injected into the footpads of nonimmune syngeneic mice, syngeneic immune mice, and nude mice. Under conditions of immunologic selection a clone that contained multiple copies of the transfected gene formed variants that lacked the transfected gene. Primary tumors and pulmonary metastases of immunized mice and pulmonary metastases of nonimmunized mice had lost the Dd gene and, in most cases, all of the associated plasmid. In contrast, in immunodeficient nude mice, primary tumors and pulmonary metastases retained the Dd gene and the associated plasmid. Deletion of genes encoding cell surface antigens may be one of the mechanisms by which allogeneic tumors escape immunologic attack.
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex
Directory of Open Access Journals (Sweden)
Susanne Sattler
2012-01-01
Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.
Garcia, Nelson; Messing, Joachim
2017-01-01
The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90) to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs). Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.
Directory of Open Access Journals (Sweden)
Nelson Garcia
2017-11-01
Full Text Available The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90 to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs. Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Gribble, Kristin E; Mark Welch, David B
2012-08-01
Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Isolates of the B. plicatilis species complex have 1-4 copies of mmr-b, each composed of 2-9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in
Directory of Open Access Journals (Sweden)
Gribble Kristin E
2012-08-01
Full Text Available Abstract Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP, a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
Cocci, Paolo; Capriotti, Martina; Mosconi, Gilberto; Campanelli, Alessandra; Frapiccini, Emanuela; Marini, Mauro; Caprioli, Giovanni; Sagratini, Gianni; Aretusi, Graziano; Palermo, Francesco Alessandro
2017-02-01
Recent evidences suggest that the toxicological effects of endocrine disrupting chemicals (EDCs) involve multiple nuclear receptor-mediated pathways, including estrogen receptor (ER) and peroxisome proliferator-activated receptor (PPAR) signaling systems. Thus, our objective in this study was to detect the summated endocrine effects of EDCs with metabolic activity in coastal waters of the central Adriatic Sea by means of a toxicogenomic approach using seabream hepatocytes. Gene expression patterns were also correlated with seawater levels of polychlorinated biphenyls (PCBs) and polycyclic aromatic hydrocarbons (PAHs). We found that seawater extracts taken at certain areas induced gene expression profiles of ERα/vitellogenin, PPARα/Stearoyl-CoA desaturase 1A, cytochrome P4501A (CYP1A) and metallothionein. These increased levels of biomarkers responses correlated with spatial distribution of PAHs/PCBs concentrations observed by chemical analysis in the different study areas. Collectively, our data give a snapshot of the presence of complex EDC mixtures that are able to perturb metabolic signaling in coastal marine waters. Copyright © 2016 Elsevier Ltd. All rights reserved.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
Synchronisation of the EDML and EDC ice cores for the last 52 kyr by volcanic signature matching
DEFF Research Database (Denmark)
Severi, M.; Becagli, S.; Castellano, E.
2007-01-01
stratigraphic link between EDML and EDC, which was dated by a simpler 1D ice-flow model. The synchronisation between the two EPICA ice cores was done through the identification of several common volcanic signatures. This paper describes the rigorous method, using the signature of volcanic sulfate, which...... to find out which of the models is affected by errors, but assuming that the thinning function at both sites and accumulation history at Dome C (which was drilled on a dome) are correct, this anomaly can be ascribed to a complex spatial accumulation variability (which may be different in the past compared...
Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L
2003-02-01
Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Energy Technology Data Exchange (ETDEWEB)
Ali, G.; Cai, Xingang; Sheu, Kwan-Fu R.; Blass, J.P. (Cornell Univ. Medical College, White Plains, NY (United States)); Wasco, W.; Gaston, S.M.; Tanzi, R.E.; Cooper, A.J.L.; Gusella, J.F. (Massachusetts General Hospital, Charleston, MA (United States)); Szabo, P. (Cornell Univ. Medical College, New York, NY (United States))
1994-03-01
The authors have isolated and sequenced cDNAs representing the full-length (2987-bp) gene for dihydrolipoyl succinyltransferase (E2k component) of the human [alpha]-ketoglutarate dehydrogenase complex (KHDHC) from a human fetal brain cDNA library. The E2k cDNA was mapped to human chromosome 14 using a somatic cell hybrid panel, and more precisely to band 14q24.3 by in situ hybridization. This cDNA also cross-hybridized to an apparent E2k pseudogene on chromosome 1p31. Northern analysis revealed the E2k gene to be ubiquitously expressed in peripheral tissues and brain. Interestingly, chromosome 14q24.3 has recently been reported to contain gene defects for an early-onset form of familial Alzheimer's disease and for Machado-Joseph disease. Future studies will be necessary to determine whether the E2K gene plays a role in either of these two disorders.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Papareddy, Praveen; Kalle, Martina; Sørensen, Ole E; Lundqvist, Katarina; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur
2012-01-01
Tissue factor pathway inhibitor 2 (TFPI-2) is a matrix-associated serine protease inhibitor with an enigmatic function in vivo. Here, we describe that TFPI-2 is present in fibrin of wounds and also expressed in skin, where it is up-regulated upon wounding. Neutrophil elastase cleaved TFPI-2, and a C-terminal fragment was found to bind to bacteria. Similarly, a prototypic peptide representing this C-terminal part, EDC34, bound to bacteria and bacterial lipopolysaccharide, and induced bacterial permeabilization. The peptide also induced leakage in artificial liposomes, and displayed a random coil conformation upon interactions with liposomes as well as lipopolysaccharide. EDC34 was antibacterial against both Gram-negative and Gram-positive bacteria in physiological buffer conditions. The results demonstrate that the C-terminus of TFPI-2 encodes for antimicrobial activity, and may be released during wounding.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Meena, Mukesh Kumar; Ghawana, Sanjay; Sardar, Atish; Dwivedi, Vikas; Khandal, Hitaishi; Roy, Riti; Chattopadhyay, Debasis
2015-01-01
Calcium ion (Ca2+) is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs) are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea) genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS) suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL) were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA) at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Energy Technology Data Exchange (ETDEWEB)
Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.
2010-03-18
The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.
The EDC3 chronology for the EPICA Dome C ice core
Directory of Open Access Journals (Sweden)
F. Parrenin
2007-08-01
Full Text Available The EPICA (European Project for Ice Coring in Antarctica Dome C drilling in East Antarctica has now been completed to a depth of 3260 m, at only a few meters above bedrock. Here we present the new EDC3 chronology, which is based on the use of 1 a snow accumulation and mechanical flow model, and 2 a set of independent age markers along the core. These are obtained by pattern matching of recorded parameters to either absolutely dated paleoclimatic records, or to insolation variations. We show that this new time scale is in excellent agreement with the Dome Fuji and Vostok ice core time scales back to 100 kyr within 1 kyr. Discrepancies larger than 3 kyr arise during MIS 5.4, 5.5 and 6, which points to anomalies in either snow accumulation or mechanical flow during these time periods. We estimate that EDC3 gives accurate event durations within 20% (2σ back to MIS11 and accurate absolute ages with a maximum uncertainty of 6 kyr back to 800 kyr.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Numerous BAF complex genes are mutated in Coffin-Siris syndrome.
Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi
2014-09-01
Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N
2016-03-12
Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
The selfish Segregation Distorter gene complex of Drosophila melanogaster.
Larracuente, Amanda M; Presgraves, Daven C
2012-09-01
Segregation Distorter (SD) is an autosomal meiotic drive gene complex found worldwide in natural populations of Drosophila melanogaster. During spermatogenesis, SD induces dysfunction of SD(+) spermatids so that SD/SD(+) males sire almost exclusively SD-bearing progeny rather than the expected 1:1 Mendelian ratio. SD is thus evolutionarily "selfish," enhancing its own transmission at the expense of its bearers. Here we review the molecular and evolutionary genetics of SD. Genetic analyses show that the SD is a multilocus gene complex involving two key loci--the driver, Segregation distorter (Sd), and the target of drive, Responder (Rsp)--and at least three upward modifiers of distortion. Molecular analyses show that Sd encodes a truncated duplication of the gene RanGAP, whereas Rsp is a large pericentromeric block of satellite DNA. The Sd-RanGAP protein is enzymatically wild type but mislocalized within cells and, for reasons that remain unclear, appears to disrupt the histone-to-protamine transition in drive-sensitive spermatids bearing many Rsp satellite repeats but not drive-insensitive spermatids bearing few or no Rsp satellite repeats. Evolutionary analyses show that the Sd-RanGAP duplication arose recently within the D. melanogaster lineage, exploiting the preexisting and considerably older Rsp satellite locus. Once established, the SD haplotype collected enhancers of distortion and suppressors of recombination. Further dissection of the molecular genetic and cellular basis of SD-mediated distortion seems likely to provide insights into several important areas currently understudied, including the genetic control of spermatogenesis, the maintenance and evolution of satellite DNAs, the possible roles of small interfering RNAs in the germline, and the molecular population genetics of the interaction of genetic linkage and natural selection.
Directory of Open Access Journals (Sweden)
Mukesh Kumar Meena
Full Text Available Calcium ion (Ca2+ is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.
Kajiyama, Yusuke; Otagiri, Masato; Sekiguchi, Junichi; Kosono, Saori; Kudo, Toshiaki
2007-01-01
The Bacillus subtilis Mrp (also referred to as Sha) is a particularly unusual Na+/H+ antiporter encoded by mrpABCDEFG. Using His tagging of Mrp proteins, we showed complex formation by the mrpABCDEFG gene products by pull-down and blue native polyacrylamide gel electrophoresis analyses. This is the first molecular evidence that the Mrp is a multicomponent antiporter in the cation-proton antiporter 3 family.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Immobilization of heparin to EDC/NHS-crosslinked collagen. Characterization and in vitro evaluation
Wissink, M.J.B.; Beernink, R.; Pieper, J.S.; Poot, Andreas A.; Engbers, G.H.M.; Beugeling, T.; Beugeling, T.; van Aken, W.G.; Feijen, Jan
2001-01-01
In the present study, heparin immobilization to a non-cytotoxic crosslinked collagen substrate for endothelial cell seeding was investigated. Crosslinking of collagen using N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) resulted in a material containing 14 free
International Nuclear Information System (INIS)
Bahram, S.; Arnold, D.; Bresnahan, M.; Strominger, J.L.; Spies, T.
1991-01-01
The class 2 region of the human major histocompatibility complex (MHC) may encode several genes controlling the processing of endogenous antigen and the presentation of peptide epitopes by MHC class 1 molecules to cytotoxic T lymphocytes. A previously described peptide supply factor (PSF1) is a member of the multidrug-resistance family of transporters and may pump cytosolic peptides into the membrane-bound compartment where class 1 molecules assemble. A second transporter gene, PSF2, was identified 10 kilobases (kb) from PSF1, near the class 2 DOB gene. The complete sequences of PSF1 and PSF2 were determined from cDNA clones. The translation products are closely related in sequence and predicted secondary structure. Both contain a highly conserved ATP-binding fold and share 25% homology in a hydrophobic domain with a tentative number of eight membrane-spanning segments. Based on the principle dimeric organization of these two domains in other transporters, PSF1 and PSF2 may function as complementary subunits, independently as homodimers, or both. Taken together with previous genetic evidence, the coregulation of PSF1 and PSF2 by γ interferon and the to-some-degree coordinate transcription of these genes suggest a common role in peptide-loading of class 1 molecules, although a distinct function of PSF2 cannot be ruled out
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-10-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.
Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation
African Journals Online (AJOL)
The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...
Directory of Open Access Journals (Sweden)
Eduardo JM Nascimento
2007-02-01
Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Genome complexity in the coelacanth is reflected in its adaptive immune system
Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.
2014-01-01
We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
DEFF Research Database (Denmark)
Bross, Peter; Li, Zhijie; Hansen, Jakob
2007-01-01
for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Directory of Open Access Journals (Sweden)
Raynald eCossard
2015-06-01
Full Text Available Isolated complex I deficiencies are one of the most commonly observed biochemical features in patients suffering from mitochondrial disorders. In the majority of these clinical cases the molecular bases of the diseases remain unknown suggesting the involvement of unidentified factors that are critical for complex I function.The Saccharomyces cerevisiae NDI1 gene, encoding the mitochondrial internal NADH dehydrogenase was previously shown to complement a complex I deficient strain in Caenorhabitis elegans with notable improvements in reproduction, whole organism respiration. These features indicate that Ndi1p can functionally integrate the respiratory chain, allowing complex I deficiency complementation. Taking into account the Ndi1p ability to bypass complex I, we evaluate the possibility to extend the range of defects/mutations causing complex I deficiencies that can be alleviated by NDI1 expression.We report here that NDI1 expressing animals unexpectedly exhibit a slightly shortened lifespan, a reduction in the progeny and a depletion of the mitochondrial genome. However, Ndi1p is expressed and targeted to the mitochondria as a functional protein that confers rotenone resistance to those animals and without affecting their respiration rate and ATP content.We show that the severe embryonic lethality level caused by the RNAi knockdowns of complex I structural subunit encoding genes (e.g. NDUFV1, NDUFS1, NDUFS6, NDUFS8 or GRIM-19 human orthologs in wild type animals is significantly reduced in the Ndi1p expressing worm.All together these results open up the perspective to identify new genes involved in complex I function, assembly or regulation by screening an RNAi library of genes leading to embryonic lethality that should be rescued by NDI1 expression.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
The TFPI-2 derived peptide EDC34 improves outcome of gram-negative sepsis.
Directory of Open Access Journals (Sweden)
Praveen Papareddy
Full Text Available Sepsis is characterized by a dysregulated host-pathogen response, leading to high cytokine levels, excessive coagulation and failure to eradicate invasive bacteria. Novel therapeutic strategies that address crucial pathogenetic steps during infection are urgently needed. Here, we describe novel bioactive roles and therapeutic anti-infective potential of the peptide EDC34, derived from the C-terminus of tissue factor pathway inhibitor-2 (TFPI-2. This peptide exerted direct bactericidal effects and boosted activation of the classical complement pathway including formation of antimicrobial C3a, but inhibited bacteria-induced activation of the contact system. Correspondingly, in mouse models of severe Escherichia coli and Pseudomonas aeruginosa infection, treatment with EDC34 reduced bacterial levels and lung damage. In combination with the antibiotic ceftazidime, the peptide significantly prolonged survival and reduced mortality in mice. The peptide's boosting effect on bacterial clearance paired with its inhibiting effect on excessive coagulation makes it a promising therapeutic candidate for invasive Gram-negative infections.
The TFPI-2 derived peptide EDC34 improves outcome of gram-negative sepsis.
Papareddy, Praveen; Kalle, Martina; Sørensen, Ole E; Malmsten, Martin; Mörgelin, Matthias; Schmidtchen, Artur
2013-01-01
Sepsis is characterized by a dysregulated host-pathogen response, leading to high cytokine levels, excessive coagulation and failure to eradicate invasive bacteria. Novel therapeutic strategies that address crucial pathogenetic steps during infection are urgently needed. Here, we describe novel bioactive roles and therapeutic anti-infective potential of the peptide EDC34, derived from the C-terminus of tissue factor pathway inhibitor-2 (TFPI-2). This peptide exerted direct bactericidal effects and boosted activation of the classical complement pathway including formation of antimicrobial C3a, but inhibited bacteria-induced activation of the contact system. Correspondingly, in mouse models of severe Escherichia coli and Pseudomonas aeruginosa infection, treatment with EDC34 reduced bacterial levels and lung damage. In combination with the antibiotic ceftazidime, the peptide significantly prolonged survival and reduced mortality in mice. The peptide's boosting effect on bacterial clearance paired with its inhibiting effect on excessive coagulation makes it a promising therapeutic candidate for invasive Gram-negative infections.
Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H
2014-10-01
Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
LENUS (Irish Health Repository)
Whan, Vicki
2010-11-23
Abstract Background About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine (poly-Q) tracts in proteins. Polymorphic repeat length variation is also apparent in human poly-Q encoding genes from normal individuals. As these coding sequence repeats are subject to selection in mammals, it has been suggested that normal variations in some of these typically highly conserved genes are implicated in morphological differences between species and phenotypic variations within species. At present, poly-Q encoding genes in non-human mammalian species are poorly documented, as are their functions and propensities for polymorphic variation. Results The current investigation identified 178 bovine poly-Q encoding genes (Q ≥ 5) and within this group, 26 genes with orthologs in both human and mouse that did not contain poly-Q repeats. The bovine poly-Q encoding genes typically had ubiquitous expression patterns although there was bias towards expression in epithelia, brain and testes. They were also characterised by unusually large sizes. Analysis of gene ontology terms revealed that the encoded proteins were strongly enriched for functions associated with transcriptional regulation and many contributed to physical interaction networks in the nucleus where they presumably act cooperatively in transcriptional regulatory complexes. In addition, the coding sequence CAG repeats in some bovine genes impacted mRNA splicing thereby generating unusual transcriptional diversity, which in at least one instance was tissue-specific. The poly-Q encoding genes were prioritised using multiple criteria for their likelihood of being polymorphic and then the highest ranking group was experimentally tested for polymorphic variation within a cattle diversity panel. Extensive and meiotically stable variation was identified
Directory of Open Access Journals (Sweden)
Shuyun Dong
2010-04-01
Full Text Available Intron-containing pre-mRNAs are normally retained and processed in the nucleus but are sometimes exported to the cytoplasm and degraded by the nonsense-mediated mRNA decay (NMD pathway as a consequence of their inclusion of intronic in-frame termination codons. When shunted to the cytoplasm by autoregulated nuclear export, the intron-containing yeast YRA1 pre-mRNA evades NMD and is targeted by a cytoplasmic decay pathway mediated by the decapping activator Edc3p. Here, we have elucidated this transcript-specific decay mechanism, showing that Edc3p-mediated YRA1 pre-mRNA degradation occurs independently of translation and is controlled through five structurally distinct but functionally interdependent modular elements in the YRA1 intron. Two of these elements target the pre-mRNA as an Edc3p substrate and the other three mediate transcript-specific translational repression. Translational repression of YRA1 pre-mRNA also requires the heterodimeric Mex67p/Mtr2p general mRNA export receptor, but not Edc3p, and serves to enhance Edc3p substrate specificity by inhibiting the susceptibility of this pre-mRNA to NMD. Collectively, our data indicate that YRA1 pre-mRNA degradation is a highly regulated process that proceeds through translational repression, substrate recognition by Edc3p, recruitment of the Dcp1p/Dcp2p decapping enzyme, and activation of decapping.
Lane, Amanda Kelly; Hayashi, Cheryl Y; Whitworth, Gregg B; Ayoub, Nadia A
2013-12-02
Orb-web and cob-web weaving spiders spin dragline silk fibers that are among the strongest materials known. Draglines are primarily composed of MaSp1 and MaSp2, two spidroins (spider fibrous proteins) expressed in the major ampullate (MA) silk glands. Prior genetic studies of dragline silk have focused mostly on determining the sequence of these spidroins, leaving other genetic aspects of silk synthesis largely uncharacterized. Here, we used deep sequencing to profile gene expression patterns in the Western black widow, Latrodectus hesperus. We sequenced millions of 3'-anchored "tags" of cDNAs derived either from MA glands or control tissue (cephalothorax) mRNAs, then associated the tags with genes by compiling a reference database from our newly constructed normalized L. hesperus cDNA library and published L. hesperus sequences. We were able to determine transcript abundance and alternative polyadenylation of each of three loci encoding MaSp1. The ratio of MaSp1:MaSp2 transcripts varied between individuals, but on average was similar to the estimated ratio of MaSp1:MaSp2 in dragline fibers. We also identified transcription of TuSp1 in MA glands, another spidroin family member that encodes the primary component of egg-sac silk, synthesized in tubuliform glands. In addition to the spidroin paralogs, we identified 30 genes that are more abundantly represented in MA glands than cephalothoraxes and represent new candidates for involvement in spider silk synthesis. Modulating expression rates of MaSp1 variants as well as MaSp2 and TuSp1 could lead to differences in mechanical properties of dragline fibers. Many of the newly identified candidate genes likely encode secreted proteins, suggesting they could be incorporated into dragline fibers or assist in protein processing and fiber assembly. Our results demonstrate previously unrecognized transcript complexity in spider silk glands.
Li, Bo-Chao; Chang, Hao; Ren, Ke-Feng; Ji, Jian
2016-11-01
Substrate-mediated delivery of functional plasmid DNA (pDNA) has been proven to be a promising strategy to promote competitiveness of endothelial cells (ECs) over smooth muscle cells (SMCs), which is beneficial to inducing fast endothelialization of implanted vascular devices. Thus, it is of great importance to develop universal approaches with simplicity and easiness to immobilize DNA complex nanoparticles on substrates. In this study, the bioinspired polydopamine (PDA) coating was employed in immobilization of DNA complex nanoparticles, which were composed of protamine (PrS) and plasmid DNA encoding with hepatocyte growth factor (HGF-pDNA) gene. We demonstrated that the DNA complex nanoparticles can be successfully immobilized onto the PDA surface. Consequently, the HGF expression of both ECs and SMCs were significantly improved when they cultured on the DNA complex nanoparticles-immobilized substrates. Furthermore, EC proliferation was specifically promoted due to bioactivity of HGF, leading to an enhancement of EC competitiveness over SMCs. Our findings demonstrated the substrate-mediated functional gene nanoparticle delivery through PDA coating as a simple and efficient approach. It may hold great potential in the field of interventional cardiovascular implants. Copyright © 2016 Elsevier B.V. All rights reserved.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Zoeller, R Thomas; Vandenberg, Laura N
2015-05-15
The fundamental principle in regulatory toxicology is that all chemicals are toxic and that the severity of effect is proportional to the exposure level. An ancillary assumption is that there are no effects at exposures below the lowest observed adverse effect level (LOAEL), either because no effects exist or because they are not statistically resolvable, implying that they would not be adverse. Chemicals that interfere with hormones violate these principles in two important ways: dose-response relationships can be non-monotonic, which have been reported in hundreds of studies of endocrine disrupting chemicals (EDCs); and effects are often observed below the LOAEL, including all environmental epidemiological studies examining EDCs. In recognition of the importance of this issue, Lagarde et al. have published the first proposal to qualitatively assess non-monotonic dose response (NMDR) relationships for use in risk assessments. Their proposal represents a significant step forward in the evaluation of complex datasets for use in risk assessments. Here, we comment on three elements of the Lagarde proposal that we feel need to be assessed more critically and present our arguments: 1) the use of Klimisch scores to evaluate study quality, 2) the concept of evaluating study quality without topical experts' knowledge and opinions, and 3) the requirement of establishing the biological plausibility of an NMDR before consideration for use in risk assessment. We present evidence-based logical arguments that 1) the use of the Klimisch score should be abandoned for assessing study quality; 2) evaluating study quality requires experts in the specific field; and 3) an understanding of mechanisms should not be required to accept observable, statistically valid phenomena. It is our hope to contribute to the important and ongoing debate about the impact of NMDRs on risk assessment with positive suggestions.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
The NSL Complex Regulates Housekeeping Genes in Drosophila
Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa
2012-01-01
MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Duffy, Michael F.; Whithear, Kevin G.; Noormohammadi, Amir H.; Markham, Philip F.; Catton, Michael; Leydon, Jennie; Browning, Glenn F.
1999-01-01
Serology remains the method of choice for laboratory diagnosis of Mycoplasma pneumoniae infection. Currently available serological tests employ complex cellular fractions of M. pneumoniae as antigen. To improve the specificity of M. pneumoniae diagnosis, a recombinant protein was assessed as a serodiagnostic reagent. A panel of recombinant proteins were expressed from a cloned M. pneumoniae gene that encodes a 116-kDa surface protein antigen. The recombinant proteins were assessed for reactiv...
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Encoding of complexity, shape and curvature by macaque infero-temporal neurons
Directory of Open Access Journals (Sweden)
Greet eKayaert
2011-07-01
Full Text Available We recorded responses of macaque infero-temporal (IT neurons to a stimulus set of Fourier Boundary Descriptor shapes wherein complexity, general shape and curvature were systematically varied. We analyzed the response patterns of the neurons to the different stimuli using multi-dimensional scaling. The resulting neural shape space differed in important ways from the physical, image-based shape space. We found a particular sensitivity for the presence of curved versus straight contours that existed only for the simple but not for the medium and highly complex shapes. Also, IT neurons could linearly separate the simple and the complex shapes within a low-dimensional neural shape space, but no distinction was found between the medium and high levels of complexity. None of these effects could be derived from physical image metrics, either directly or by comparing the neural data with similarities yielded by two models of low-level visual processing (one using wavelet-based filters and one that models position and size invariant object selectivity through four hierarchically organized neural layers. This study highlights the relevance of complexity to IT neural encoding, both as a neurally independently represented shape property and through its influence on curvature detection.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
International Nuclear Information System (INIS)
Wens, B.; De Boever, P.; Verbeke, M.; Hollanders, K.; Schoeters, G.
2013-01-01
Endocrine disrupting chemicals (EDCs) have the potential to interfere with the hormonal system and may negatively influence human health. Microarray analysis was used in this study to investigate differential gene expression in human peripheral blood cells (PBMCs) after in vitro exposure to EDCs. PBMCs, isolated from blood samples of four male and four female healthy individuals, were exposed in vitro for 18 h to either a dioxin-like polychlorinated biphenyl (PCB126, 1 μM), a non-dioxin-like polychlorinated biphenyl (PCB153, 10 μM), a brominated flame retardant (BDE47, 10 μM), a perfluorinated alkyl acid (PFOA, 10 μM) or bisphenol (BPA, 10 μM). ANOVA analysis revealed a significant change in the expression of 862 genes as a result of EDC exposure. The gender of the donors did not affect gene expression. Hierarchical cluster analysis created three groups and clustered: (1) PCB126-exposed samples, (2) PCB153 and BDE47, (3) PFOA and BPA. The number of differentially expressed genes varied per compound and ranged from 60 to 192 when using fold change and multiplicity corrected p-value as filtering criteria. Exposure to PCB126 induced the AhR signaling pathway. BDE47 and PCB153 are known to disrupt thyroid metabolism and exposure influenced the expression of the nuclear receptors PPARγ and ESR2, respectively. BPA and PFOA did not induce significant changes in the expression of known nuclear receptors. Overall, each compound produced a unique gene expression signature affecting pathways and GO processes linked to metabolism and inflammation. Twenty-nine genes were significantly altered in expression under all experimental conditions. Six of these genes (HSD11B2, MMP11, ADIPOQ, CEL, DUSP9 and TUB) could be associated with obesity and metabolic syndrome. In conclusion, microarray analysis identified that PBMCs altered their gene expression response in vitro when challenged with EDCs. Our screening approach has identified a number of gene candidates that warrant
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Oberauer, Klaus; Lewandowsky, Stephan
2016-11-01
The article reports four experiments with complex-span tasks in which encoding of memory items alternates with processing of distractors. The experiments test two assumptions of a computational model of complex span, SOB-CS: (1) distractor processing impairs memory because distractors are encoded into working memory, thereby interfering with memoranda; and (2) free time following distractors is used to remove them from working memory by unbinding their representations from list context. Experiment 1 shows that distractors are erroneously chosen for recall more often than not-presented stimuli, demonstrating that distractors are encoded into memory. Distractor intrusions declined with longer free time, as predicted by distractor removal. Experiment 2 shows these effects even when distractors precede the memory list, ruling out an account based on selective rehearsal of memoranda during free time. Experiments 3 and 4 test the notion that distractors decay over time. Both experiments show that, contrary to the notion of distractor decay, the chance of a distractor intruding at test does not decline with increasing time since encoding of that distractor. Experiment 4 provides additional evidence against the prediction from distractor decay that distractor intrusions decline over an unfilled retention interval. Taken together, the results support SOB-CS and rule out alternative explanations. Data and simulation code are available on Open Science Framework: osf.io/3ewh7. Copyright © 2016 Elsevier B.V. All rights reserved.
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein
International Nuclear Information System (INIS)
Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.
2006-01-01
The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions
Serrot, Patricia H; Sabater, Bartolomé; Martín, Mercedes
2012-09-01
Three evergreen (Laurus nobilis, Viburnum tinus and Thuja plicata) and two autumnal abscission deciduous trees (Cydonia oblonga and Prunus domestica) have been investigated for the presence (zymogram and immunodetection) and functionality (post-illumination chlorophyll fluorescence) of the thylakoid Ndh complex. The presence of encoding ndh genes has also been investigated in T. plicata. Western assays allowed tentative identification of zymogram NADH dehydrogenase bands corresponding to the Ndh complex after native electrophoresis of solubilized fractions from L. nobilis, V. tinus, C. oblonga and P. domestica leaves, but not in those of T. plicata. However, Ndh subunits were detected after SDS-PAGE of thylakoid solubilized proteins of T. plicata. The leaves of the five plants showed the post-illumination chlorophyll fluorescence increase dependent on the presence of active Ndh complex. The fluorescence increase was higher in autumn in deciduous, but not in evergreen trees, which suggests that the thylakoid Ndh complex could be involved in autumnal leaf senescence. Two ndhB genes were sequenced from T. plicata that differ at the 350 bp 3' end sequence. Comparison with the mRNA revealed that ndhB genes have a 707-bp type II intron between exons 1 (723 bp) and 2 (729 bp) and that the UCA 259th codon is edited to UUA in mRNA. Phylogenetically, the ndhB genes of T. plicata group close to those of Metasequoia, Cryptomeria, Taxodium, Juniperus and Widdringtonia in the cupresaceae branch and are 5' end shortened by 18 codons with respect to that of angiosperms. Copyright © Physiologia Plantarum 2012.
Artificial neural networks using complex numbers and phase encoded weights.
Michel, Howard E; Awwal, Abdul Ahad S
2010-04-01
The model of a simple perceptron using phase-encoded inputs and complex-valued weights is proposed. The aggregation function, activation function, and learning rule for the proposed neuron are derived and applied to Boolean logic functions and simple computer vision tasks. The complex-valued neuron (CVN) is shown to be superior to traditional perceptrons. An improvement of 135% over the theoretical maximum of 104 linearly separable problems (of three variables) solvable by conventional perceptrons is achieved without additional logic, neuron stages, or higher order terms such as those required in polynomial logic gates. The application of CVN in distortion invariant character recognition and image segmentation is demonstrated. Implementation details are discussed, and the CVN is shown to be very attractive for optical implementation since optical computations are naturally complex. The cost of the CVN is less in all cases than the traditional neuron when implemented optically. Therefore, all the benefits of the CVN can be obtained without additional cost. However, on those implementations dependent on standard serial computers, CVN will be more cost effective only in those applications where its increased power can offset the requirement for additional neurons.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Mutations affecting components of the SWI/SNF complex cause Coffin-Siris syndrome.
Tsurusaki, Yoshinori; Okamoto, Nobuhiko; Ohashi, Hirofumi; Kosho, Tomoki; Imai, Yoko; Hibi-Ko, Yumiko; Kaname, Tadashi; Naritomi, Kenji; Kawame, Hiroshi; Wakui, Keiko; Fukushima, Yoshimitsu; Homma, Tomomi; Kato, Mitsuhiro; Hiraki, Yoko; Yamagata, Takanori; Yano, Shoji; Mizuno, Seiji; Sakazume, Satoru; Ishii, Takuma; Nagai, Toshiro; Shiina, Masaaki; Ogata, Kazuhiro; Ohta, Tohru; Niikawa, Norio; Miyatake, Satoko; Okada, Ippei; Mizuguchi, Takeshi; Doi, Hiroshi; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi
2012-03-18
By exome sequencing, we found de novo SMARCB1 mutations in two of five individuals with typical Coffin-Siris syndrome (CSS), a rare autosomal dominant anomaly syndrome. As SMARCB1 encodes a subunit of the SWItch/Sucrose NonFermenting (SWI/SNF) complex, we screened 15 other genes encoding subunits of this complex in 23 individuals with CSS. Twenty affected individuals (87%) each had a germline mutation in one of six SWI/SNF subunit genes, including SMARCB1, SMARCA4, SMARCA2, SMARCE1, ARID1A and ARID1B.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Discussions on the experimental data covering (EDC) procedure
International Nuclear Information System (INIS)
Lee, S.Y.; Ban, C.H.
2004-01-01
In describing step-9 of TRAC-CSAU, there is a statement that there is no clear guide with which one can determine the code uncertainty parameters and their statistics using the integral and/or separate effects tests. On the other hand, there is an important requirement, stating that the code uncertainty should be evaluated through direct data comparison with the relevant integral systems and separate-effects experiments at different scales. There are some efforts, in the best-estimate LOCA methodologies, to use the IET and SET data for determining the code uncertainty parameters and their statistics. But it is hard to find a systematic way to relate the code uncertainty parameters and/or their statistics with the results of the direct data comparison, especially in the case of the components with multiple code uncertainty parameters. It is essential to develop a procedure to implement the requirement of the direct data comparison with SETs and IETs in determining the code uncertainty. In this paper, Code Accuracy Based Uncertainty Estimation (CABUE) technique is introduced with an emphasis on the role of Experimental Data Coverings to connect the code accuracy with the overall uncertainty for a code prediction. Contrasting to the fact that the code accuracy is used only for confirmation of the conservatism in TRACCSAU, in CABUE, it can be represented by the scalable code parameters and their statistics through the EDC extensive calculations, it gives several benefits. Since the code accuracy becomes the measure of the determination of the statistics of code parameters, a code with better accuracy naturally provide smaller overall calculational uncertainty. This is the full implementation of the requirement of 'direct data comparison'. Adopting EDC procedure in CABUE where uniform application of distribution-free percentile estimation technique with simple random sampling calculations is used in various levels, makes it easy to chose the number of code uncertainty
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Encoding entanglement-assisted quantum stabilizer codes
International Nuclear Information System (INIS)
Wang Yun-Jiang; Bai Bao-Ming; Li Zhuo; Xiao He-Ling; Peng Jin-Ye
2012-01-01
We address the problem of encoding entanglement-assisted (EA) quantum error-correcting codes (QECCs) and of the corresponding complexity. We present an iterative algorithm from which a quantum circuit composed of CNOT, H, and S gates can be derived directly with complexity O(n 2 ) to encode the qubits being sent. Moreover, we derive the number of each gate consumed in our algorithm according to which we can design EA QECCs with low encoding complexity. Another advantage brought by our algorithm is the easiness and efficiency of programming on classical computers. (general)
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Directory of Open Access Journals (Sweden)
Amelie T van der Ven
Full Text Available Congenital anomalies of the kidney and urinary tract (CAKUT are the most common cause (40-50% of chronic kidney disease (CKD in children. About 40 monogenic causes of CAKUT have so far been discovered. To date less than 20% of CAKUT cases can be explained by mutations in these 40 genes. To identify additional monogenic causes of CAKUT, we performed whole exome sequencing (WES and homozygosity mapping (HM in a patient with CAKUT from Indian origin and consanguineous descent. We identified a homozygous missense mutation (c.1336C>T, p.Arg446Cys in the gene Von Willebrand factor A domain containing 2 (VWA2. With immunohistochemistry studies on kidneys of newborn (P1 mice, we show that Vwa2 and Fraser extracellular matrix complex subunit 1 (Fras1 co-localize in the nephrogenic zone of the renal cortex. We identified a pronounced expression of Vwa2 in the basement membrane of the ureteric bud (UB and derivatives of the metanephric mesenchyme (MM. By applying in vitro assays, we demonstrate that the Arg446Cys mutation decreases translocation of monomeric VWA2 protein and increases translocation of aggregated VWA2 protein into the extracellular space. This is potentially due to the additional, unpaired cysteine residue in the mutated protein that is used for intermolecular disulfide bond formation. VWA2 is a known, direct interactor of FRAS1 of the Fraser-Complex (FC. FC-encoding genes and interacting proteins have previously been implicated in the pathogenesis of syndromic and/or isolated CAKUT phenotypes in humans. VWA2 therefore constitutes a very strong candidate in the search for novel CAKUT-causing genes. Our results from in vitro experiments indicate a dose-dependent neomorphic effect of the Arg446Cys homozygous mutation in VWA2.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Exploring the potential relevance of human-specific genes to complex disease
Directory of Open Access Journals (Sweden)
Cooper David N
2011-01-01
Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.
Lee, Hye-Rim; Hwang, Kyung-A; Park, Min-Ah; Yi, Bo-Rim; Jeung, Eui-Bae; Choi, Kyung-Chul
2012-05-01
Various endocrine disrupting chemicals (EDCs) are exogenous compounds found in the environment and have the potential to interfere with the endocrine system and hormonal regulation. Among EDCs, bisphenol A (BPA) and 1,1,1-trichloro-2,2-bis(4-methoxyphenol)-ethane [methoxychlor (MXC)] have estrogenic activity resulting in a variety of dysfunctions in the E2-mediated response by binding to estrogen receptors (ERs), causing human health problems such as abnormal reproduction and carcinogenesis. In this study, we investigated the effects of BPA and MXC on cell proliferation facilitated by ER signaling in human breast cancer cells. MCF-7 cells are known to be ERα-positive and to be a highly E2-responsive cancer cell line; these cells are, therefore, a useful in vitro model for detecting estrogenic activity in response to EDCs. We evaluated cancer cell proliferation following BPA and MXC treatment using an MTT assay. We analyzed alterations in the expression of genes associated with the cell cycle in MCF-7 cells by semi-quantitative reverse-transcription PCR following treatment with BPA or MXC compared to EtOH. To determine whether BPA and MXC stimulate cancer cell growth though ER signaling, we co-treated the cells with agonists (propyl pyrazoletriol, PPT; and diarylpropionitrile, DPN) or an antagonist (ICI 182,780) of ER signaling and reduced ERα gene expression via siRNA in MCF-7 cells before treatment with EDCs. These studies confirmed the carcinogenicity of EDCs in vitro. As a result, BPA and MXC induced the cancer cell proliferation by the upregulation of genes that promote the cell cycle and the downregulation of anti-proliferative genes, especially ones affecting the G1/S transition via ERα signaling. These collective results confirm the carcinogenicity of these EDCs in vitro. Further studies are required to determine whether EDCs promote carcinogenesis in vivo.
Durnford Dion, G; McKim, Sarah M; Sarchfield, Michelle L
2003-01-01
To compensate for increases in photon flux density (PFD), photosynthetic organisms possess mechanisms for reversibly modulating their photosynthetic apparatus to minimize photodamage. The photoacclimation response in Chlamydomonas reinhardtii was assessed following a 10-fold increase in PFD over 24h. In addition to a 50% reduction in the amount of chlorophyll and light-harvesting complexes (LHC) per cell, the expression of genes encoding polypeptides of the light-harvesting antenna were also affected. The abundance of Lhcb (a LHCH gene), Lhcb4 (a CP29-like gene), and Lhca (a LHCI gene) transcripts were reduced by 65 to 80%, within 1-2 h; however, the RNA levels of all three genes recovered to their low-light (LL) concentrations within 6-8 h. To determine the role of transcript turnover in this transient decline in abundance, the stability of all transcripts was measured. Although there was no change in the Lhcb or Lhca transcript turnover time, the Lhcb4 mRNA stability decreased 2.5-fold immediately following...
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C
2017-01-01
Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.
Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C
2010-01-01
Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Twenty-five years after "Wingspread"- Environmental endocrine disruptors (EDCs) and human health.
Gray, Leon Earl
2017-04-01
The aim of this paper is to provide the reader with a view of the Endocrine Disruptor Chemical (EDC) research field and its relevance to human health. My perspective is from working on the effects of EDCs that act via the androgen (A) or estrogen (E) signaling pathways in a regulatory agency for the last four decades with the objective of producing data that risk assessors could use to reduce the uncertainty in risk assessment. In vitro and in vivo data from our studies has contributed to regulatory agencies decision-making since the 1990s (https://www3.epa.gov/pesticides/chem_search/cleared_reviews/csr_PC-113201_7-Apr-98_238.pdf). From the start, we were evaluating the utility of in vitro and short-term in vivo effects to predict the adverse effects in developing animals [1; 2]. This approach has expanded greatly to include what is now known as Adverse Outcome Pathways (AOP) and networks (AOPn) [3; 4]. The AOP framework for the effects of chemicals that disrupt androgen signaling during sexual differentiation of the fetal male rat provides biological context for extrapolating mechanistic information from in vitro and in vivo assays in rodents to other species including humans. Such an approach has biological validity because the E and A pathways are highly conserved in vertebrates, including humans and laboratory animals.
Lee, Young-Mi; Seo, Jung Soo; Kim, Il-Chan; Yoon, Yong-Dal; Lee, Jae-Seong
2006-06-30
To understand the effect of endocrine-disrupting chemicals (EDCs) on cytochrome P450 aromatase (rm-cyp19) gene expression between gender types in the hermaphroditic fish Rivulus marmoratus, we cloned two distinct rm-cyp19 genes using RT-PCR with degenerative primers, obtained full-length cDNAs using 5'- and 3'-RACE-PCR methods, and completely sequenced them. The brain aromatase (rm-cyp19b) cDNA consisted of 2,124 bp including the open reading frame (ORF), which encoded a putative protein of 505 amino acids. The ovarian aromatase (rm-cyp19a) cDNA consisted of 2,075 bp, including the ORF encoding a putative protein of 516 amino acids. Expression patterns of rm-cyp19b and rm-cyp19a mRNAs were investigated in embryos of different developmental stages and in seven different tissues of adult fish. The rm-cyp19b gene in hermaphrodite and secondary male R. marmoratus was predominantly expressed in the brain, while the rm-cyp19a gene was expressed gender-specifically in the gonad. The expression of rm-cyp19b mRNA increased from stage 1 (2 d post fertilization) to stage 4 (12 d post fertilization) in a developmental stage-dependent manner but steeply decreased in the hatching stage. Compared to the rm-cyp19b gene, the abundance of ovarian aromatase rm-cyp19a transcripts was very low, and its expression was first detected at stage 3 and then decreased gradually to the hatching stage. Alteration of rm-cyp19b and rm-cyp19a gene expression was further analyzed in the brain and gonad by real-time RT-PCR 96 h after EDC exposure in hermaphrodites and secondary males. The brain aromatase rm-cyp19b gene was up-regulated in the brain after 4-nonylphenol (4-NP)-exposure, while the ovarian aromatase rm-cyp19a gene was significantly down-regulated in the gonad. In 300 microg/L 4-tert octylphenol (4-tert-OP), or 600 microg/L bisphenol A-exposed brain and gonad, both rm-cyp19b and rm-cyp19a genes were up-regulated. In the case of secondary males, the rm-cyp19b gene was highly expressed in
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Renkema, G H; Visser, G; Baertling, F; Wintjes, L T; Wolters, V M; van Montfrans, J; de Kort, G A P; Nikkels, P G J; van Hasselt, P M; van der Crabben, S N; Rodenburg, R J T
2017-06-01
The genetic basis of the many progressive, multi systemic, mitochondrial diseases that cause a lack of cellular ATP production is heterogeneous, with defects found both in the mitochondrial genome as well as in the nuclear genome. Many different mutations have been found in the genes encoding subunits of the enzyme complexes of the oxidative phosphorylation system. In addition, mutations in genes encoding proteins involved in the assembly of these complexes are known to cause mitochondrial disorders. Here we describe two sisters with a mitochondrial disease characterized by lesions in the medulla oblongata, as demonstrated by brain magnetic resonance imaging, and an isolated complex IV deficiency and reduced levels of individual complex IV subunits. Whole exome sequencing revealed a homozygous nonsense mutation resulting in a premature stop codon in the gene encoding Pet117, a small protein that has previously been predicted to be a complex IV assembly factor. PET117 has not been identified as a mitochondrial disease gene before. Lentiviral complementation of patient fibroblasts with wild-type PET117 restored the complex IV deficiency, proving that the gene defect is responsible for the complex IV deficiency in the patients, and indicating a pivotal role of this protein in the proper functioning of complex IV. Although previous studies had suggested a possible role of this protein in the insertion of copper into complex IV, studies in patient fibroblasts could not confirm this. This case presentation thus implicates mutations in PET117 as a novel cause of mitochondrial disease.
International Nuclear Information System (INIS)
Kim, Youngji; Joo, Hyunku; Her, Namguk; Yoon, Yeomin; Sohn, Jinsik; Kim, Sungpyo; Yoon, Jaekyung
2015-01-01
Highlights: • Self-rotating reactor including TiO 2 NTs is applied under solar irradiation. • Simultaneously photocatalysis of Cr(VI) and EDCs is observed to be up to 95%. • Photocatalytic reactions of Cr(VI) and EDCs are favorable under acidic pH. • Charge interaction and hole scavenge between TiO 2 and pollutants are synergy factors. - Abstract: In this study, simultaneous treatments, reduction of hexavalent chromium (Cr(VI)) and oxidation of endocrine disrupting compounds (EDCs), such as bisphenol A (BPA), 17α-ethinyl estradiol (EE2) and 17β-estradiol (E2), were investigated with a rotating photocatalytic reactor including TiO 2 nanotubes formed on titanium mesh substrates under solar UV irradiation. In the laboratory tests with a rotating type I reactor, synergy effects of the simultaneous photocatalytic reduction and oxidation of inorganic (Cr(VI)) and organic (BPA) pollutants were achieved. Particularly, the concurrent photocatalytic reduction of Cr(VI) and oxidation of BPA was higher under acidic conditions. The enhanced reaction efficiency of both pollutants was attributed to a stronger charge interaction between TiO 2 nanotubes (positive charge) and the anionic form of Cr(VI) (negative charge), which are prevented recombination (electron–hole pair) by the hole scavenging effect of BPA. In the extended outdoor tests with a rotating type II reactor under solar irradiation, the experiment was extended to examine the simultaneous reduction of Cr(VI) in the presence of additional EDCs, such as EE2 and E2 as well as BPA. The findings showed that synergic effect of both photocatalytic reduction and oxidation was confirmed with single-component (Cr(VI) only), two-components (Cr(VI)/BPA, Cr(VI)/EE2, and Cr(VI)/E2), and four-components (Cr(VI)/BPA/EE2/E2) under various solar irradiation conditions
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela
2015-12-01
Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Systems-level analysis of risk genes reveals the modular nature of schizophrenia.
Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing
2018-05-19
Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.
Tuberous sclerosis complex in a child: diagnosis and management
Directory of Open Access Journals (Sweden)
Prastiya Indra Gunawan
2010-06-01
Full Text Available Tuberous sclerosis complex (TSC is a multisystem, autosomal dominant disorder affecting children and adults, resulted from mutations in one of two genes, TSC1 (encoding hamartin or TSC2 (encoding tuberin genes located on chromosomes 9 and 16 respectively.1,2 Synonyms of TSC are Bourneville Pringle syndrome, epiloia, or tuberosclerosis. This disorder is characterized by seizures, mental disability, and small noncancerous tumors on the skin and other body tissues, such as brain, eye, lung, and kidney. The classic triad are seizures, mental retardation, and cutaneous angiofibromas.3
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Min Kyung Sung
2014-12-01
Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...
Directory of Open Access Journals (Sweden)
Min-Chao He
2012-06-01
Full Text Available Two artificial intelligence techniques, namely artificial neural network (ANN and genetic algorithm (GA were combined to be used as a tool for optimizing the covalent immobilization of cellulase on a smart polymer, Eudragit L-100. 1-Ethyl-3-(3-dimethyllaminopropyl carbodiimide (EDC concentration, N-hydroxysuccinimide (NHS concentration and coupling time were taken as independent variables, and immobilization efficiency was taken as the response. The data of the central composite design were used to train ANN by back-propagation algorithm, and the result showed that the trained ANN fitted the data accurately (correlation coefficient R2 = 0.99. Then a maximum immobilization efficiency of 88.76% was searched by genetic algorithm at a EDC concentration of 0.44%, NHS concentration of 0.37% and a coupling time of 2.22 h, where the experimental value was 87.97 ± 6.45%. The application of ANN based optimization by GA is quite successful.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen
2015-07-10
Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Encoder power consumption comparison of Distributed Video Codec and H.264/AVC in low-complexity mode
DEFF Research Database (Denmark)
Ukhanova, Ann; Belyaev, Evgeny; Forchhammer, Søren
2010-01-01
(ME) and CABAC entropy coder consume much power so we eliminate ME from the codec and use CAVLC instead of CABAC. Some investigations show that low-complexity DVC outperforms other algorithms in terms of encoder side energy consumption . However, estimations of power consumption for H.264/AVC and DVC...
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Drosophila olfactory memory: single genes to complex neural circuits.
Keene, Alex C; Waddell, Scott
2007-05-01
A central goal of neuroscience is to understand how neural circuits encode memory and guide behaviour. Studying simple, genetically tractable organisms, such as Drosophila melanogaster, can illuminate principles of neural circuit organization and function. Early genetic dissection of D. melanogaster olfactory memory focused on individual genes and molecules. These molecular tags subsequently revealed key neural circuits for memory. Recent advances in genetic technology have allowed us to manipulate and observe activity in these circuits, and even individual neurons, in live animals. The studies have transformed D. melanogaster from a useful organism for gene discovery to an ideal model to understand neural circuit function in memory.
Shamseldin, Hanan E; Bennett, Alexis H; Alfadhel, Majid; Gupta, Vandana; Alkuraya, Fowzan S
2016-01-01
Golgi apparatus (GA) is a membrane-bound organelle that serves a multitude of critical cellular functions including protein secretion and sorting, and cellular polarity. Many Mendelian diseases are caused by mutations in genes encoding various components of GA. GOLGA2 encodes GM130, a necessary component for the assembly of GA as a single complex, and its deficiency has been found to result in severe cellular phenotypes. We describe the first human patient with a homozygous apparently loss of...
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Li, Fengling; Li, Zhaoxin; Wang, Qingyin; Zhai, Yuxiu
2013-05-01
Endocrine disrupting chemicals (EDCs) are increasingly viewed as persistent pollutants, similar to natural hormones in function. This paper describes the expression profiles of 7 genes ( DMRT, VTG GnRHR FSHR CYP17A CYP19A, and CYP19B) involved in sex steroid synthesis and action as well as sexual development in adult male and female Cynoglossus semilaevis, after exposure to different concentrations of Bisphenol A (BPA) and 17β-estradiol (E2). Both BPA (1, 10, 50, 125, and 250 mg/kg) and E2 (0.5, 5, and 10 mg/kg) induced changes in target gene expression, although the estrogenic effects of E2 as a model estrogen were stronger. Among the 7 genes, VTG CYP17A and CYP19 responded strongly to BPA or E2 exposure and can thus serve as reference biomarkers for estrogenic EDCs exposure in marine teleosts. These data will provide a window to establish a hypothalamic-pituitary-gonadal model in C. semilaevis to better understand the effect pathways of EDCs.
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-01-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS
Directory of Open Access Journals (Sweden)
Jenny U Johansson
2008-11-01
Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Institute of Scientific and Technical Information of China (English)
孟顺龙; 宋超; 范立民; 裘丽萍; 陈家长; 徐跑
2014-01-01
Environmental endocrine disrupting chemicals (EDCs), commonly found in the environment, come from industry and agriculture, including pesticides, fungicides, insecticides, herbicides, and other chemicals. Nowadays, more and more EDCs were released into the environment. EDCs go into water body via atmosphere sedi-mentation, surface runoff, soil eluviation, etc., so water body becomes the main place for existing. In order to attract scientific and public attention worldwide and to prevent EDCs pol ution, in this study we reviewed the classification of EDCs and their concentrations in natural water bodies, drinking water sources and water plants, and the reproductive toxicity of EDCs to fish were reviewed. EDCs could disturb the endocrine system and make reproductive organs and reproduction abnor-mal, resulting in fertility descending, reproduction function damage, community quan-tity decrease and even species extinction. In addition, EDCs could disrupt the homeostasis maintained by hormones, which would result in defects of neural de-velopment and abnormalities of the endocrine and reproductive systems. The exact molecular mechanisms have not been completely reported, but researches have suggested that multiple mechanisms were involved in the action of EDCs. Although there have been researches on the biohazard of EDCs, there stil exist problems of weakness in fundamental researches, difficulties in recognizing and identifying EDCs and high cost, which restraint the knowledge on them.%越来越多的环境内分泌干扰物( EDCs)不断释放到环境,并通过大气沉降、地表径流、土壤淋溶和直接排放等方式进入水体,从而使水体成为 EDCs 存在的主要场所之一。为引起社会对水体 EDCs 污染的广泛关注,并积极采取EDCs 危害防治措施,保护鱼类资源和水生态系统,本文介绍了 EDCs 的分类,详述了自然水体、饮用水源水以及自来水中EDCs 污染情况,阐明了 EDCs 对鱼类的生殖危害。资料分析显示,EDCs
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Dissecting the function of Cullin-RING ubiquitin ligase complex genes in planarian regeneration.
Strand, Nicholas S; Allen, John M; Ghulam, Mahjoobah; Taylor, Matthew R; Munday, Roma K; Carrillo, Melissa; Movsesyan, Artem; Zayas, Ricardo M
2018-01-15
The ubiquitin system plays a role in nearly every aspect of eukaryotic cell biology. The enzymes responsible for transferring ubiquitin onto specific substrates are the E3 ubiquitin ligases, a large and diverse family of proteins, for which biological roles and target substrates remain largely undefined. Studies using model organisms indicate that ubiquitin signaling mediates key steps in developmental processes and tissue regeneration. Here, we used the freshwater planarian, Schmidtea mediterranea, to investigate the role of Cullin-RING ubiquitin ligase (CRL) complexes in stem cell regulation during regeneration. We identified six S. mediterranea cullin genes, and used RNAi to uncover roles for homologs of Cullin-1, -3 and -4 in planarian regeneration. The cullin-1 RNAi phenotype included defects in blastema formation, organ regeneration, lesions, and lysis. To further investigate the function of cullin-1-mediated cellular processes in planarians, we examined genes encoding the adaptor protein Skp1 and F-box substrate-recognition proteins that are predicted to partner with Cullin-1. RNAi against skp1 resulted in phenotypes similar to cullin-1 RNAi, and an RNAi screen of the F-box genes identified 19 genes that recapitulated aspects of cullin-1 RNAi, including ones that in mammals are involved in stem cell regulation and cancer biology. Our data provides evidence that CRLs play discrete roles in regenerative processes and provide a platform to investigate how CRLs regulate stem cells in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hongyu Chen
2018-02-01
Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Maria Elisabeth Street
2018-06-01
Full Text Available Wildlife has often presented and suggested the effects of endocrine disrupting chemicals (EDCs. Animal studies have given us an important opportunity to understand the mechanisms of action of many chemicals on the endocrine system and on neurodevelopment and behaviour, and to evaluate the effects of doses, time and duration of exposure. Although results are sometimes conflicting because of confounding factors, epidemiological studies in humans suggest effects of EDCs on prenatal growth, thyroid function, glucose metabolism and obesity, puberty, fertility, and on carcinogenesis mainly through epigenetic mechanisms. This manuscript reviews the reports of a multidisciplinary national meeting on this topic.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
International Nuclear Information System (INIS)
Spies, T.; Bresnahan, M.; Strominger, J.L.
1989-01-01
A 600-kilobase (kb) DNA segment from the human major histocompatibility complex (MHC) class III region was isolated by extension of a previous 435-kb chromosome walk. The contiguous series of cloned overlapping cosmids contains the entire 555-kb interval between C2 in the complement gene cluster and HLA-B. This region is known to encode the tumor necrosis factors (TNFs) α and β, B144, and the major heat shock protein HSP70. Moreover, a cluster of genes, BAT1-BAT5 (HLA-B-associated transcripts) have been localized in the vicinity of the genes for TNFα and TNFβ. An additional four genes were identified by isolation of corresponding cDNA clones with cosmid DNA probes. These genes for BAT6-BAT9 were mapped near the gene for C2 within a 120-kb region that includes a HSP70 gene pair. These results, together with complementary data from a similar recent study, indicated the presence of a minimum of 19 genes within the C2-HLA-B interval of the MHC class III region. Although the functional properties of most of these genes are yet unknown, they may be involved in some aspects of immunity. This idea is supported by the genetic mapping of the hematopoietic histocompatibility locus-1 (Hh-1) in recombinant mice between TNFα and H-2S, which is homologous to the complement gene cluster in humans
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A
1999-09-01
Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.
Directory of Open Access Journals (Sweden)
Rosner William
2009-05-01
Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Directory of Open Access Journals (Sweden)
Chen Yuan
2005-05-01
Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Nonlinear inversion of potential-field data using a hybrid-encoding genetic algorithm
Chen, C.; Xia, J.; Liu, J.; Feng, G.
2006-01-01
Using a genetic algorithm to solve an inverse problem of complex nonlinear geophysical equations is advantageous because it does not require computer gradients of models or "good" initial models. The multi-point search of a genetic algorithm makes it easier to find the globally optimal solution while avoiding falling into a local extremum. As is the case in other optimization approaches, the search efficiency for a genetic algorithm is vital in finding desired solutions successfully in a multi-dimensional model space. A binary-encoding genetic algorithm is hardly ever used to resolve an optimization problem such as a simple geophysical inversion with only three unknowns. The encoding mechanism, genetic operators, and population size of the genetic algorithm greatly affect search processes in the evolution. It is clear that improved operators and proper population size promote the convergence. Nevertheless, not all genetic operations perform perfectly while searching under either a uniform binary or a decimal encoding system. With the binary encoding mechanism, the crossover scheme may produce more new individuals than with the decimal encoding. On the other hand, the mutation scheme in a decimal encoding system will create new genes larger in scope than those in the binary encoding. This paper discusses approaches of exploiting the search potential of genetic operations in the two encoding systems and presents an approach with a hybrid-encoding mechanism, multi-point crossover, and dynamic population size for geophysical inversion. We present a method that is based on the routine in which the mutation operation is conducted in the decimal code and multi-point crossover operation in the binary code. The mix-encoding algorithm is called the hybrid-encoding genetic algorithm (HEGA). HEGA provides better genes with a higher probability by a mutation operator and improves genetic algorithms in resolving complicated geophysical inverse problems. Another significant
CCHCR1 interacts with EDC4, suggesting its localization in P-bodies
Energy Technology Data Exchange (ETDEWEB)
Ling, Y.H.; Wong, C.C. [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, N.T., Hong Kong (China); Li, K.W. [Department of Molecular and Cellular Neurobiology, Center for Neurogenomics and Cognitive Research, Neuroscience Campus Amsterdam, VU University, 1081 HV Amsterdam (Netherlands); Chan, K.M. [School of Life Sciences, Faculty of Science, The Chinese University of Hong Kong, Shatin, N.T., Hong Kong (China); Boukamp, P. [Division of Genetics of Skin Carcinogenesis, A110 German Cancer Research Center, Im Neuenheimer Feld 280, D-69120 Heidelberg (Germany); Liu, W.K., E-mail: ken-liu@cuhk.edu.hk [School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, N.T., Hong Kong (China)
2014-09-10
Coiled‐coil alpha‐helical rod protein 1 (CCHCR1) is suggested as a candidate biomarker for psoriasis for more than a decade but its function remains poorly understood because of the inconsistent findings in the literature. CCHCR1 protein is suggested to be localized in the cytoplasm, nucleus, mitochondria, or centrosome and to regulate various cellular functions, including steroidogenesis, proliferation, differentiation, and cytoskeleton organization. In this study, we attempted to find a consensus between these findings by identifying the interaction partners of CCHCR1 using co-immunoprecipiation with a stable cell line expressing EGFP-tagged CCHCR1. Out of more than 100 co-immunoprecipitants identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS), the enhancer of mRNA-decapping protein 4 (EDC4), which is a processing body (P-body) component, was particularly found to be the major interacting partner of CCHCR1. Confocal imaging confirmed the localization of CCHCR1 in P-bodies and its N-terminus is required for this subcellular localization, suggesting that CCHCR1 is a novel P-body component. As P-bodies are the site for mRNA metabolism, our findings provide a molecular basis for the function of CCHCR1, any disruption of which may affect the transcriptome of the cell, and causing abnormal cell functions. - Highlights: • We identified CCHCR1 as a novel P-body component. • We identified EDC4 as the major interacting partner of CCHCR1. • N-terminus of CCHCR1 protein is required for its P-bodies localization.
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Duplicability of self-interacting human genes.
LENUS (Irish Health Repository)
Pérez-Bercoff, Asa
2010-01-01
BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Isolation and characterization of the human parathyroid hormone-like peptide gene
International Nuclear Information System (INIS)
Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.
1989-01-01
A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors
Complex single gene disorders and epilepsy.
LENUS (Irish Health Repository)
Merwick, Aine
2012-09-01
Epilepsy is a heterogeneous group of disorders, often associated with significant comorbidity, such as intellectual disability and skin disorder. The genetic underpinnings of many epilepsies are still being elucidated, and we expect further advances over the coming 5 years, as genetic technology improves and prices fall for whole exome and whole genome sequencing. At present, there are several well-characterized complex epilepsies associated with single gene disorders; we review some of these here. They include well-recognized syndromes such as tuberous sclerosis complex, epilepsy associated with Rett syndrome, some of the progressive myoclonic epilepsies, and novel disorders such as epilepsy associated with mutations in the PCDH 19 gene. These disorders are important in informing genetic testing to confirm a diagnosis and to permit better understanding of the variability in phenotype-genotype correlation.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Style, S.; Beard, B. J.; Harris-Fry, H.; Sengupta, A.; Jha, S.; Shrestha, B. P.; Rai, A.; Paudel, V.; Thondoo, M.; Pulkki-Brannstrom, A-M; Skordis-Worrall, J.; Manandhar, D. S.; Costello, A.; Saville, N. M.
2017-01-01
The increasing availability and capabilities of mobile phones make them a feasible means of data collection. Electronic Data Capture (EDC) systems have been used widely for public health monitoring and surveillance activities, but documentation of their use in complicated research studies requiring multiple systems is limited. This paper shares our experiences of designing and implementing a complex multi-component EDC system for a community-based four-armed cluster-Randomised Controlled Tria...
Style, Sarah; Beard, B. James; Harris-Fry, Helen; Sengupta, Aman; Jha, Sonali; Shrestha, Bhim P.; Rai, Anjana; Paudel, Vikas; Thondoo, Meelan; Pulkki-Brannstrom, Anni-Maria; Skordis-Worrall, Jolene; Manandhar, Dharma S.; Costello, Anthony; Saville, Naomi M.
2017-01-01
ABSTRACT The increasing availability and capabilities of mobile phones make them a feasible means of data collection. Electronic Data Capture (EDC) systems have been used widely for public health monitoring and surveillance activities, but documentation of their use in complicated research studies requiring multiple systems is limited. This paper shares our experiences of designing and implementing a complex multi-component EDC system for a community-based four-armed cluster-Randomised Contro...
Directory of Open Access Journals (Sweden)
Yan Hao
2011-05-01
Full Text Available Elevation of the second messenger cGMP by nitric oxide (NO activates the cGMP-dependent protein kinase PKG, which is key in regulating cardiovascular, intestinal, and neuronal functions in mammals. The NO-cGMP-PKG signaling pathway is also a major therapeutic target for cardiovascular and male reproductive diseases. Despite widespread effects of PKG activation, few molecular targets of PKG are known. We study how EGL-4, the Caenorhabditis elegans PKG ortholog, modulates foraging behavior and egg-laying and seeks the downstream effectors of EGL-4 activity. Using a combination of unbiased forward genetic screen and proteomic analysis, we have identified a conserved SAEG-1/SAEG-2/HDA-2 histone deacetylase complex that is specifically recruited by activated nuclear EGL-4. Gene expression profiling by microarrays revealed >40 genes that are sensitive to EGL-4 activity in a SAEG-1-dependent manner. We present evidence that EGL-4 controls egg laying via one of these genes, Y45F10C.2, which encodes a novel protein that is expressed exclusively in the uterine epithelium. Our results indicate that, in addition to cytoplasmic functions, active EGL-4/PKG acts in the nucleus via a conserved Class I histone deacetylase complex to regulate gene expression pertinent to behavioral and physiological responses to cGMP. We also identify transcriptional targets of EGL-4 that carry out discrete components of the physiological response.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas
2014-01-01
Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Bowman, Barry J; Abreu, Stephen; Johl, Jessica K; Bowman, Emma Jean
2012-11-01
The pmr gene is predicted to encode a Ca(2+)-ATPase in the secretory pathway. We examined two strains of Neurospora crassa that lacked PMR: the Δpmr strain, in which pmr was completely deleted, and pmr(RIP), in which the gene was extensively mutated. Both strains had identical, complex phenotypes. Compared to the wild type, these strains required high concentrations of calcium or manganese for optimal growth and had highly branched, slow-growing hyphae. They conidiated poorly, and the shape and size of the conidia were abnormal. Calcium accumulated in the Δpmr strains to only 20% of the wild-type level. High concentrations of MnCl(2) (1 to 5 mM) in growth medium partially suppressed the morphological defects but did not alter the defect in calcium accumulation. The Δpmr Δnca-2 double mutant (nca-2 encodes a Ca(2+)-ATPase in the plasma membrane) accumulated 8-fold more calcium than the wild type, and the morphology of the hyphae was more similar to that of wild-type hyphae. Previous experiments failed to show a function for nca-1, which encodes a SERCA-type Ca(2+)-ATPase in the endoplasmic reticulum (B. J. Bowman, S. Abreu, E. Margolles-Clark, M. Draskovic, and E. J. Bowman, Eukaryot. Cell 10:654-661, 2011). The pmr(RIP) Δnca-1 double mutant accumulated small amounts of calcium, like the Δpmr strain, but exhibited even more extreme morphological defects. Thus, PMR can apparently replace NCA-1 in the endoplasmic reticulum, but NCA-1 cannot replace PMR. The morphological defects in the Δpmr strain are likely caused, in part, by insufficient concentrations of calcium and manganese in the Golgi compartment; however, PMR is also needed to accumulate normal levels of calcium in the whole cell.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Rossin, Elizabeth J.; Lage, Kasper; Raychaudhuri, Soumya; Xavier, Ramnik J.; Tatar, Diana; Benita, Yair
2011-01-01
Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these risk variants. It has previously been observed that different genes harboring causal mutations for the same Mendelian disease often physically interact. We sought to evaluate the degree to which this is true of genes within strongly associated loci in complex disease. Using sets of loci defined in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein–protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more densely connected than chance expectation. To confirm biological relevance, we show that the components of the networks tend to be expressed in similar tissues relevant to the phenotypes in question, suggesting the network indicates common underlying processes perturbed by risk loci. Furthermore, we show that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non-immune traits to assess its applicability to complex traits in general. We find that genes in loci associated to height and lipid levels assemble into significantly connected networks but did not detect excess connectivity among Type 2 Diabetes (T2D) loci beyond chance. Taken together, our results constitute evidence that, for many of the complex diseases studied here, common genetic associations implicate regions encoding proteins that physically interact in a preferential manner, in
Autism genes keep turning up chromatin.
Lasalle, Janine M
2013-06-19
Autism-spectrum disorders (ASD) are complex genetic disorders collectively characterized by impaired social interactions and language as well as repetitive and restrictive behaviors. Of the hundreds of genes implicated in ASD, those encoding proteins acting at neuronal synapses have been most characterized by candidate gene studies. However, recent unbiased genome-wide analyses have turned up a multitude of novel candidate genes encoding nuclear factors implicated in chromatin remodeling, histone demethylation, histone variants, and the recognition of DNA methylation. Furthermore, the chromatin landscape of the human genome has been shown to influence the location of de novo mutations observed in ASD as well as the landscape of DNA methylation underlying neurodevelopmental and synaptic processes. Understanding the interactions of nuclear chromatin proteins and DNA with signal transduction pathways and environmental influences in the developing brain will be critical to understanding the relevance of these ASD candidate genes and continued uncovering of the "roots" of autism etiology.
Method for data compression by associating complex numbers with files of data values
Feo, John Thomas; Hanks, David Carlton; Kraay, Thomas Arthur
1998-02-10
A method for compressing data for storage or transmission. Given a complex polynomial and a value assigned to each root, a root generated data file (RGDF) is created, one entry at a time. Each entry is mapped to a point in a complex plane. An iterative root finding technique is used to map the coordinates of the point to the coordinates of one of the roots of the polynomial. The value associated with that root is assigned to the entry. An equational data compression (EDC) method reverses this procedure. Given a target data file, the EDC method uses a search algorithm to calculate a set of m complex numbers and a value map that will generate the target data file. The error between a simple target data file and generated data file is typically less than 10%. Data files can be transmitted or stored without loss by transmitting the m complex numbers, their associated values, and an error file whose size is at most one-tenth of the size of the input data file.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Directory of Open Access Journals (Sweden)
Han Sung Kim
2016-01-01
Full Text Available 2-DG triggers glucose deprivation without altering other nutrients or metabolic pathways and then activates autophagy via activation of AMPK and endoplasmic reticulum (ER stress. We investigated whether 2-DG reduced intracellular insulin increased by melatonin via autophagy/EDC3 in insulinoma INS-1E cells. p-AMPK and GRP78/BiP level were significantly increased by 2-DG in the presence/absence of melatonin, but IRE1α level was reduced in 2-DG treatment. Levels of p85α, p110, p-Akt (Ser473, Thr308, and p-mTOR (Ser2481 were also significantly reduced by 2-DG in the presence/absence of melatonin. Mn-SOD increased with 2-DG plus melatonin compared to groups treated with/without melatonin alone. Bcl-2 was decreased and Bax increased with 2-DG plus melatonin. LC3II level increased with 2-DG treatment in the presence/absence of melatonin. Intracellular insulin production increased in melatonin plus 2-DG but reduced in treatment with 2-DG with/without melatonin. EDC3 was increased by 2-DG in the presence/absence of melatonin. Rapamycin, an mTOR inhibitor, increased GRP78/BiP and EDC3 levels in a dose-dependent manner and subsequently resulted in a decrease in intracellular production of insulin. These results suggest that melatonin-mediated insulin synthesis during 2-DG treatment involves autophagy and EDC3 protein in rat insulinoma INS-1E cells and subsequently results in a decrease in intracellular production of insulin.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Directory of Open Access Journals (Sweden)
Z. Guler
2016-02-01
Full Text Available Electrochemical impedance spectroscopy (EIS and spectroscopy was applied to investigate the surface activation of carboxyl group (–COOH containing nanofibers by the reaction of 1-ethyl-3-(dimethyl-aminopropyl carbodiimide hydrochloride (EDC/N-hydroxyl succinimide (NHS in different concentrations. Poly(!-caprolactone/poly(m-anthranilic acid (PCL/P3ANA nanofibers were fabricated by electrospinning and were activated with 5/0.5, 0.5/5, 5/5 and 50/50 mM of EDC/NHS. The surface activation was investigated by Attenuated Total Reflectance Fourier transform infrared spectroscopy (FTIR-ATR and activation yield was estimated. Albumin was immobilized after surface activation and the amount of covalently immobilized protein was determined by bicinchoninic acid (BCA assay. Morphology and composition of albumin immobilized nanofibers were characterized by Scanning Electron Microscopy/Energy-Dispersive X-ray Spectroscopy (SEM/EDX and Atomic force microscope (AFM. EIS measurements indicated that nanofibers become resistant after albumin immobilization. The obtained data revealed that the highest amount of albumin bound to nanofibers activated with 50/50 mM of EDC/NHS which was found to be the optimum concentration for the activation of PCL/P3ANA nanofibers.
International Nuclear Information System (INIS)
Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.
2013-01-01
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species
Energy Technology Data Exchange (ETDEWEB)
Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)
2013-10-15
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
John Paul SanGiovanni
Full Text Available Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs and use of peroxisome proliferator activator receptor (PPAR-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG co-activator 1 alpha (PPARGC1A, a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR transcription complex, may influence neovascularization (NV in age-related macular degeneration (AMD.We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A.A DNA coding variant (rs3736265 and a 3'UTR-resident regulatory variant (rs3774923 in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs. SNP-SNP interactions existed for NV AMD (P<0.005 with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559. PPARGC1A influences activation of the AMD-associated complement component 3 (C3 promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003 of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033, a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678 showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003. C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice
SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M; Stahl, Andreas; Clemons, Traci E; Chew, Emily Y; Smith, Lois E H
2013-01-01
Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (Pcomplement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice - these animals also showed 70% reduction in retinal NV (P
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
The occurrence of Photorhabdus-like toxin complexes in Bacillus thuringiensis
Recently, genomic sequencing of a Bacillus thuringiensis (Bt) isolate from our collection revealed the presence of an apparent operon encoding an insecticidal toxin complex (Tca) similar to that first described from the entomopathogen Photorhabdus luminescens. To determine whether these genes are w...
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin
2011-05-01
Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.
Directory of Open Access Journals (Sweden)
Anna Galicka
2012-06-01
Full Text Available Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
International Nuclear Information System (INIS)
Deveaux, Yves
1999-01-01
DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Germline variants in MRE11/RAD50/NBN complex genes in childhood leukemia
International Nuclear Information System (INIS)
Mosor, Maria; Ziółkowska-Suchanek, Iwona; Nowicka, Karina; Dzikiewicz-Krawczyk, Agnieszka; Januszkiewicz–Lewandowska, Danuta; Nowak, Jerzy
2013-01-01
The MRE11, RAD50, and NBN genes encode proteins of the MRE11-RAD50-NBN (MRN) complex involved in cellular response to DNA damage and the maintenance of genome stability. In our previous study we showed that the germline p.I171V mutation in NBN may be considered as a risk factor in the development of childhood acute lymphoblastic leukemia (ALL) and some specific haplotypes of that gene may be associated with childhood leukemia. These findings raise important questions about the role of mutations in others genes of the MRN complex in childhood leukemia. The aim of this study was to answer the question whether MRE11 and RAD50 alterations may be associated with childhood ALL or AML. We estimated the frequency of constitutional mutations and polymorphisms in selected regions of MRE11, RAD50, and NBN in the group of 220 children diagnosed with childhood leukemias and controls (n=504/2200). The analysis was performed by specific amplification of region of interest by PCR and followed by multi-temperature single-strand conformation polymorphism (PCR-MSSCP) technique. We performed two molecular tests to examine any potential function of the detected the c.551+19G>A SNP in RAD50 gene. To our knowledge, this is the first analysis of the MRE11, RAD50 and NBN genes in childhood leukemia. The frequency of either the AA genotype or A allele of RAD50-rs17166050 were significantly different in controls compared to leukemia group (ALL+AML) (p<0.0019 and p<0.0019, respectively). The cDNA analysis of AA or GA genotypes carriers has not revealed evidence of splicing abnormality of RAD50 pre-mRNA. We measured the allelic-specific expression of G and A alleles at c.551+19G>A and the statistically significant overexpression of the G allele has been observed. Additionally we confirmed the higher incidence of the p.I171V mutation in the leukemia group (7/220) than among controls (12/2400) (p<0.0001). The formerly reported sequence variants in the RAD50 and MRE11 gene may not constitute a
Studying the Complex Expression Dependences between Sets of Coexpressed Genes
Directory of Open Access Journals (Sweden)
Mario Huerta
2014-01-01
Full Text Available Organisms simplify the orchestration of gene expression by coregulating genes whose products function together in the cell. The use of clustering methods to obtain sets of coexpressed genes from expression arrays is very common; nevertheless there are no appropriate tools to study the expression networks among these sets of coexpressed genes. The aim of the developed tools is to allow studying the complex expression dependences that exist between sets of coexpressed genes. For this purpose, we start detecting the nonlinear expression relationships between pairs of genes, plus the coexpressed genes. Next, we form networks among sets of coexpressed genes that maintain nonlinear expression dependences between all of them. The expression relationship between the sets of coexpressed genes is defined by the expression relationship between the skeletons of these sets, where this skeleton represents the coexpressed genes with a well-defined nonlinear expression relationship with the skeleton of the other sets. As a result, we can study the nonlinear expression relationships between a target gene and other sets of coexpressed genes, or start the study from the skeleton of the sets, to study the complex relationships of activation and deactivation between the sets of coexpressed genes that carry out the different cellular processes present in the expression experiments.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink
Directory of Open Access Journals (Sweden)
Salemi Eric
2008-01-01
Full Text Available Realizing high-quality digital image transmission via a satellite link, while optimizing resource distribution and minimizing battery consumption, is a challenging task. This paper describes a methodology to optimize a turbo-encoded wavelet-based satellite downlink progressive image transmission system with unequal error protection (UEP techniques. To achieve that goal, we instantiate a generic UEP methodology onto the system, and demonstrate that the proposed solution has little impact on the average performance, while greatly reducing the run-time complexity. Based on a simple design-time distortion model and a low-complexity run-time algorithm, the provided solution can dynamically tune the system's configuration to any bitrate constraint or channel condition. The resulting system outperforms in terms of peak signal-to-noise ratio (PSNR, a state-of-the-art, fine-tuned equal error protection (EEP solution by as much as 2 dB.
A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink
Directory of Open Access Journals (Sweden)
Eric Salemi
2008-01-01
Full Text Available Realizing high-quality digital image transmission via a satellite link, while optimizing resource distribution and minimizing battery consumption, is a challenging task. This paper describes a methodology to optimize a turbo-encoded wavelet-based satellite downlink progressive image transmission system with unequal error protection (UEP techniques. To achieve that goal, we instantiate a generic UEP methodology onto the system, and demonstrate that the proposed solution has little impact on the average performance, while greatly reducing the run-time complexity. Based on a simple design-time distortion model and a low-complexity run-time algorithm, the provided solution can dynamically tune the system's configuration to any bitrate constraint or channel condition. The resulting system outperforms in terms of peak signal-to-noise ratio (PSNR, a state-of-the-art, fine-tuned equal error protection (EEP solution by as much as 2 dB.
Cloning and homologic analysis of Tpn I gene in silkworm Bombyx ...
African Journals Online (AJOL)
Cloning and homologic analysis of Tpn I gene in silkworm Bombyx mori. Y Zhao, Yao Q, X Tang, Q Wang, H Yin, Z Hu, J Lu, K Chen. Abstract. The troponin complex is composed of three subunits, Troponin C (the calcium sensor component) and Troponin T and I (structural proteins). Tpn C is encoded by multiple genes in ...
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
The method of measurement and synchronization control for large-scale complex loading system
International Nuclear Information System (INIS)
Liao Min; Li Pengyuan; Hou Binglin; Chi Chengfang; Zhang Bo
2012-01-01
With the development of modern industrial technology, measurement and control system was widely used in high precision, complex industrial control equipment and large-tonnage loading device. The measurement and control system is often used to analyze the distribution of stress and displacement in the complex bearing load or the complex nature of the mechanical structure itself. In ITER GS mock-up with 5 flexible plates, for each load combination, detect and measure potential slippage between the central flexible plate and the neighboring spacers is necessary as well as the potential slippage between each pre-stressing bar and its neighboring plate. The measurement and control system consists of seven sets of EDC controller and board, computer system, 16-channel quasi-dynamic strain gauge, 25 sets of displacement sensors, 7 sets of load and displacement sensors in the cylinders. This paper demonstrates the principles and methods of EDC220 digital controller to achieve synchronization control, and R and D process of multi-channel loading control software and measurement software. (authors)
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
Keleştemur, Seda; Altunbek, Mine; Culha, Mustafa
2017-05-01
The toxicity of ZnO nanoparticles (NPs) is a growing concern due to its increasing use in several products including sunscreens, paints, pigments and ceramics for its antibacterial, antifungal, anti-corrosive and UV filtering properties. The toxicity of ZnO NPs is mostly attributed to the Zn2+ release causing an increase in the intracellular reactive oxygen species (ROS) level. The surface modification with a biocompatible ligand or a polymer can be a good strategy to reduce dissolution based toxicity. In two previous studies, the conflicting results with EDC/NHS coupling chemistry for ZnO NPs were reported. In this study, the same surface modification strategy with an emphasis on the stability of ZnO NPs is clarified. First, the density of -OH groups on the ZnO NPs is increased with hydrogen peroxide (H2O2) treatment, and then a silica coating on the ZnO NPs (Si-ZnO) surface is performed. Finally, a covalent attachment of bovine serum albumin (BSA) on three different concentrations of ZnO-Si is carried out by EDC/NHS coupling chemistry. ZnO NPs have a very high dissolution rate under acidic conditions of EDC/NHS coupling chemistry as determined from the ICP-MS analysis. In addition, the amount of ZnO NPs in coupling reaction has an important effect on the dissolution rate of Zn2+ and dependently BSA attached on the ZnO NP surfaces. Finally, the cytotoxicity of the BSA modified Si-ZnO NPs on human lung cancer (A549) and human skin fibroblast (HSF) is evaluated. Although an increased association of BSA modified ZnO NPs with cells was observed, the modification significantly decreased their cytotoxicity. This can be explained with the decreased active surface area of ZnO NPs with the surface modification. However, an increase in the mitochondrial depolarization and ROS production was observed depending on the amount of BSA coverage.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Complex chloroplast RNA metabolism: just debugging the genetic programme?
Directory of Open Access Journals (Sweden)
Schmitz-Linneweber Christian
2008-08-01
Full Text Available Abstract Background The gene expression system of chloroplasts is far more complex than that of their cyanobacterial progenitor. This gain in complexity affects in particular RNA metabolism, specifically the transcription and maturation of RNA. Mature chloroplast RNA is generated by a plethora of nuclear-encoded proteins acquired or recruited during plant evolution, comprising additional RNA polymerases and sigma factors, and sequence-specific RNA maturation factors promoting RNA splicing, editing, end formation and translatability. Despite years of intensive research, we still lack a comprehensive explanation for this complexity. Results We inspected the available literature and genome databases for information on components of RNA metabolism in land plant chloroplasts. In particular, new inventions of chloroplast-specific mechanisms and the expansion of some gene/protein families detected in land plants lead us to suggest that the primary function of the additional nuclear-encoded components found in chloroplasts is the transgenomic suppression of point mutations, fixation of which occurred due to an enhanced genetic drift exhibited by chloroplast genomes. We further speculate that a fast evolution of transgenomic suppressors occurred after the water-to-land transition of plants. Conclusion Our inspections indicate that several chloroplast-specific mechanisms evolved in land plants to remedy point mutations that occurred after the water-to-land transition. Thus, the complexity of chloroplast gene expression evolved to guarantee the functionality of chloroplast genetic information and may not, with some exceptions, be involved in regulatory functions.
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Jedeon, Katia; Loiodice, Sophia; Salhi, Khaled; Le Normand, Manon; Houari, Sophia; Chaloyard, Jessica; Berdal, Ariane; Babajko, Sylvie
2016-11-01
Endocrine-disrupting chemicals (EDCs) that interfere with the steroid axis can affect amelogenesis, leading to enamel hypomineralization similar to that of molar incisor hypomineralization, a recently described enamel disease. We investigated the sex steroid receptors that may mediate the effects of EDCs during rat amelogenesis. The expression of androgen receptor (AR), estrogen receptor (ER)-α, and progesterone receptor was dependent on the stage of ameloblast differentiation, whereas ERβ remained undetectable. AR was the only receptor selectively expressed in ameloblasts involved in final enamel mineralization. AR nuclear translocation and induction of androgen-responsive element-containing promoter activity upon T treatment, demonstrated ameloblast responsiveness to androgens. T regulated the expression of genes involved in enamel mineralization such as KLK4, amelotin, SLC26A4, and SLC5A8 but not the expression of genes encoding matrix proteins, which determine enamel thickness. Vinclozolin and to a lesser extent bisphenol A, two antiandrogenic EDCs that cause enamel defects, counteracted the actions of T. In conclusion, we show, for the first time, the following: 1) ameloblasts express AR; 2) the androgen signaling pathway is involved in the enamel mineralization process; and 3) EDCs with antiandrogenic effects inhibit AR activity and preferentially affect amelogenesis in male rats. Their action, through the AR pathway, may specifically and irreversibly affect enamel, potentially leading to the use of dental defects as a biomarker of exposure to environmental pollutants. These results are consistent with the steroid hormones affecting ameloblasts, raising the issue of the hormonal influence on amelogenesis and possible sexual dimorphism in enamel quality.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
Disentangling the Trichoderma viridescens complex.
Jaklitsch, W M; Samuels, G J; Ismaiel, A; Voglmayr, H
2013-12-01
Trichoderma viridescens is recognised as a species complex. Multigene analyses based on the translation elongation factor 1-alpha encoding gene (tef1), a part of the rpb2 gene, encoding the second largest RNA polymerase subunit and the larger subunit of ATP citrate lyase (acl1) reveals 13 phylogenetic species with little or no phenotypic differentiation. This is the first use of acl1 in Trichoderma phylogenetics. The typification of T. viridescens s.str. is clarified and Hypocrea viridescens is replaced by the new name T. paraviridescens. Besides these two species, eleven are phylogenetically recognised and T. olivascens, T. viridarium, T. virilente, T. trixiae, T. viridialbum, T. appalachiense, T. neosinense, T. composticola, T. nothescens and T. sempervirentis are formally described and illustrated. Several species produce yellow diffusing pigment on cornmeal dextrose agar, particularly after storage at 15 °C, while T. olivascens is characterised by the formation of an olivaceous pigment. The results are compared with earlier publications on this group of species.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Hybrid Nanomaterial Complexes for Advanced Phage-guided Gene Delivery
Directory of Open Access Journals (Sweden)
Teerapong Yata
2014-01-01
Full Text Available Developing nanomaterials that are effective, safe, and selective for gene transfer applications is challenging. Bacteriophages (phage, viruses that infect bacteria only, have shown promise for targeted gene transfer applications. Unfortunately, limited progress has been achieved in improving their potential to overcome mammalian cellular barriers. We hypothesized that chemical modification of the bacteriophage capsid could be applied to improve targeted gene delivery by phage vectors into mammalian cells. Here, we introduce a novel hybrid system consisting of two classes of nanomaterial systems, cationic polymers and M13 bacteriophage virus particles genetically engineered to display a tumor-targeting ligand and carry a transgene cassette. We demonstrate that the phage complex with cationic polymers generates positively charged phage and large aggregates that show enhanced cell surface attachment, buffering capacity, and improved transgene expression while retaining cell type specificity. Moreover, phage/polymer complexes carrying a therapeutic gene achieve greater cancer cell killing than phage alone. This new class of hybrid nanomaterial platform can advance targeted gene delivery applications by bacteriophage.
Schwindt, Adam R
2015-08-01
The effects of endocrine disrupting compounds (EDCs) on aquatic wildlife are increasingly being recognized for their complexity. Investigators have detected alterations at multiple levels of biological organization in offspring exposed to EDCs through the blood or germ line of the parents, suggesting that generational consequences of EDCs are evident. Exposure to EDCs through the parents is concerning because if the resulting phenotype of the offspring is heritable and affects fitness, then evolutionary consequences may be evident. This review summarizes the evidence for transgenerational effects of EDCs in aquatic wildlife and illustrates cases where alterations appear to be transmitted maternally, paternally, or parentally. The literature indicates that EDC exposure to the parents induces developmental, physiological, endocrinological, and behavioral changes as well as increased mortality of offspring raised in clean environments. What is lacking, however, is a clear demonstration of heritable transgenerational effects in aquatic wildlife. Therefore, it is not known if the parental effects are the result of developmental or phenotypic plasticity or if the altered phenotypes are durably passed to subsequent generations. Epigenetic changes to gene regulation are discussed as a possible mechanism responsible for EDC induced parental effects. Additional research is needed to evaluate if heritable effects of EDCs are evident in aquatic wildlife, as has been demonstrated for terrestrial mammals. Copyright © 2015 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Radjabova, Valeria; Mastroeni, Piero; Skjødt, Karsten
2015-01-01
We identified a novel, evolutionarily conserved receptor encoded within the human leukocyte receptor complex and syntenic region of mouse chromosome 7, named T cell-interacting, activating receptor on myeloid cells-1 (TARM1). The transmembrane region of TARM1 contained a conserved arginine residu...
Leopold, Philip L; Wendland, Rebecca L; Vincent, Theresa; Crystal, Ronald G
2006-10-01
Neutralization of adenovirus (Ad) by anti-Ad neutralizing antibodies in serum involves formation of Ad-immune complexes that prevent the virus from interacting with target cells. We hypothesized that Ad-immune complexes likely contain viable Ad vectors which, although no longer capable of gaining access to receptors on target cells, may be able to express transgenes in cells bearing Fc receptors for immunoglobulins, i.e., that antibody-based "neutralization" of Ad vectors may be circumvented by the Fc receptor pathway. To test this hypothesis, we expressed the Fcgamma receptor IIA (FcgammaR) in A549 lung epithelial cells or human dermal fibroblasts and evaluated gene transfer in the presence of human neutralizing anti-Ad serum. FcgammaR-expressing cells bound and internalized copious amounts of Ad, with a distinct population of internalized Ad trafficking to the nucleus. The dose-response curves for inhibition of gene transfer revealed that FcgammaR-expressing cells required a more-than-10-fold higher concentration of anti-Ad serum to achieve 50% inhibition of Ad-encoded beta-galactosidase expression compared with non-FcgammaR-expressing cells. The discrepancy between neutralization of Ad during infection of FcgammaR-expressing cells and neutralization of Ad during infection of non-FcgammaR-expressing cells occurred with either heat-inactivated or non-heat-inactivated sera, was blocked by addition of purified Fc domain protein, and did not require the cytoplasmic domain of FcgammaR, suggesting that immune complex internalization proceeded via endocytosis rather than phagocytosis. FcgammaR-mediated infection by Ad-immune complexes did not require expression of the coxsackie virus-Ad receptor (CAR) since similar data were obtained when CAR-deficient human dermal fibroblasts were engineered to express FcgammaR. However, interaction of the Ad penton base with cell surface integrins contributed to the difference in neutralization between FcgammaR-expressing and non
Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie
2015-11-27
The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
DEFF Research Database (Denmark)
Kabisch, Maria; Lorenzo Bermejo, Justo; Dünnebier, Thomas
2015-01-01
The chromosomal passenger complex (CPC) plays a pivotal role in the regulation of cell division. Therefore, inherited CPC variability could influence tumor development. The present candidate gene approach investigates the relationship between single nucleotide polymorphisms (SNPs) in genes encoding......% CI 1.02-1.10, P = 0.0002). Two genotyped SNPs in BIRC5 were associated with familial breast cancer risk (top SNP rs2071214: per G allele OR 1.12, 95% CI 1.04-1.21, P = 0.002). The data suggest that INCENP in the CPC pathway contributes to ER-negative breast cancer susceptibility in the European...... population. In spite of a modest contribution of CPC-inherited variants to the total burden of sporadic and familial breast cancer, their potential as novel targets for breast cancer treatment should be further investigated....
Energy Technology Data Exchange (ETDEWEB)
Hua, Jiachuan [Key Laboratory of Advanced Textile Composites, Tianjin Polytechnic University, Ministry of Education, Tianjin 300387 (China); School of Textiles, Tianjin Polytechnic University, Tianjin 300387 (China); Li, Zheng, E-mail: lizheng_nx@163.com [Key Laboratory of Advanced Textile Composites, Tianjin Polytechnic University, Ministry of Education, Tianjin 300387 (China); School of Textiles, Tianjin Polytechnic University, Tianjin 300387 (China); Xia, Wen; Yang, Ning; Gong, Jixian [Key Laboratory of Advanced Textile Composites, Tianjin Polytechnic University, Ministry of Education, Tianjin 300387 (China); School of Textiles, Tianjin Polytechnic University, Tianjin 300387 (China); Zhang, Jianfei, E-mail: zhangjianfei1960@126.com [Key Laboratory of Advanced Textile Composites, Tianjin Polytechnic University, Ministry of Education, Tianjin 300387 (China); School of Textiles, Tianjin Polytechnic University, Tianjin 300387 (China); Qiao, Changsheng [Key Laboratory of Industrial Microbiology, Tianjin University of Science and Technology, Ministry of Education, Tianjin 300457 (China)
2016-04-01
In this paper, a novel pH-sensitive poly (amino acid) hydrogel based on poly γ-glutamic acid (γ-PGA) and ε-polylysine (ε-PL) was prepared by carbodiimide (EDC) and N-hydroxysuccinimide (NHS) mediated polymerization. The influence of PGA/PL molar ratio and EDC/NHS concentration on the structure and properties was studied. Fourier transform infrared spectroscopy (FT-IR) and X-ray photoelectron spectroscopy (XPS) proved that hydrogels were crosslinked through amide bond linkage, and the conversion rate of a carboxyl group could reach 96%. Scanning electron microscopy (SEM) results showed a regularly porous structure with 20 μm pore size in average. The gelation time in the crosslink process of PGA/PL hydrogels was within less than 5 min. PGA/PL hydrogels had excellent optical performance that was evaluated by a novel optotype method. Furthermore, PGA/PL hydrogels were found to be pH-sensitive, which could be adjusted to the pH of swelling media intelligently. The terminal pH of swelling medium could be controlled at 5 ± 1 after equilibrium when the initial pH was within 3–11. The swelling kinetics was found to follow a Voigt model in deionized water but a pseudo-second-order model in normal saline and phosphate buffer solution, respectively. The differential swelling degrees were attributed to the swelling theory based on the different ratio of –COOH/–NH{sub 2} and pore size in hydrogels. The results of mechanical property indicated that PGA/PL hydrogels were soft and elastic. Moreover, PGA/PL hydrogels exhibited excellent biocompatibility by cell proliferation experiment. PGA/PL hydrogels could be degraded in PBS solution and the degradation rate was decreased with the increase of the molar ratio of PL. Considering the simple preparation process and pH-sensitive property, these PGA/PL hydrogels might have high potential for use in medical and clinical fields. - Highlights: • We prepared a biocompatible and degradable poly amino acids hydrogel via EDC
Park, Kiyun; Kwak, Ihn-Sil
2014-01-01
Heat shock protein 90 (HSP90) is a highly conserved molecular chaperone important in the maturation of a broad spectrum of protein. In this study, an HSP90 gene was isolated from Asian paddle crab, Charybdis japonica, as a bio-indicator to monitor the marine ecosystem. This work reports the responses of C. japonica HSP90 mRNA expression to cellular stress by endocrine disrupting chemicals (EDCs), such as bisphenol A (BPA) and 4-nonylphenol (NP) using real-time. reverse transcription polymerase chain reaction. The deduced amino acid sequence of HSP90 from C. japonica shared a high degree of homology with their homologues in other species. In a phylogenetic analysis, C. japonica HSP90 is evolutionally related with an ortholog of the other crustacean species. The expression of HSP90 gene was almost distributed in all the examined tissues of the C. japonica crab but expression levels varied among the different body parts of the crabs. We examined HSP90 mRNA expression pattern in C. japonica crabs exposed to EDCs for various exposure times. The expression of HSP90 transcripts was significantly increased in C. japonica crabs exposed to BPA and NP at different concentrations for 12, 24, 48 and 96 hours. The mRNA expression of HSP90 gene was significantly induced in a concentration- and time-dependent manner after BPA or NP exposures for 96 hours. Taken together, expression analysis of Asian paddle crab HSP90 gene provided useful molecular information about crab responses in stress conditions and potential ways to monitor the EDCs stressors in marine environments.
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Detecting coordinated regulation of multi-protein complexes using logic analysis of gene expression
Directory of Open Access Journals (Sweden)
Yeates Todd O
2009-12-01
Full Text Available Abstract Background Many of the functional units in cells are multi-protein complexes such as RNA polymerase, the ribosome, and the proteasome. For such units to work together, one might expect a high level of regulation to enable co-appearance or repression of sets of complexes at the required time. However, this type of coordinated regulation between whole complexes is difficult to detect by existing methods for analyzing mRNA co-expression. We propose a new methodology that is able to detect such higher order relationships. Results We detect coordinated regulation of multiple protein complexes using logic analysis of gene expression data. Specifically, we identify gene triplets composed of genes whose expression profiles are found to be related by various types of logic functions. In order to focus on complexes, we associate the members of a gene triplet with the distinct protein complexes to which they belong. In this way, we identify complexes related by specific kinds of regulatory relationships. For example, we may find that the transcription of complex C is increased only if the transcription of both complex A AND complex B is repressed. We identify hundreds of examples of coordinated regulation among complexes under various stress conditions. Many of these examples involve the ribosome. Some of our examples have been previously identified in the literature, while others are novel. One notable example is the relationship between the transcription of the ribosome, RNA polymerase and mannosyltransferase II, which is involved in N-linked glycan processing in the Golgi. Conclusions The analysis proposed here focuses on relationships among triplets of genes that are not evident when genes are examined in a pairwise fashion as in typical clustering methods. By grouping gene triplets, we are able to decipher coordinated regulation among sets of three complexes. Moreover, using all triplets that involve coordinated regulation with the ribosome
Braun, Daniela A.; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A.; Schanze, Denny; Ashraf, Shazia; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I. Chiara; Sanchez-Ferras, Oraly; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E.; Pabst, Werner L.; Warejko, Jillian; Daga, Ankana; LeBerre, Tamara Basta; Matejas, Verena; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T.; Gipson, Patrick E.; Hsu, Chyong-Hsin; Kari, Jameela A.; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okasha; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth; Rump, Patrick; Schnur, Rhonda E.; Shiihara, Takashi; Sinha, Manish; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A.; Tsai, Wen-Hui; Tsai, Jeng-Daw; Vester, Udo; Viskochil, David H.; Vatanavicharn, Nithiwat; Waxler, Jessica L.; Wolf, Matthias T.F.; Wong, Sik-Nin; Poduri, Annapurna; Truglio, Gessica; Mane, Shrikant; Lifton, Richard P.; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Calleweart, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2018-01-01
Galloway-Mowat syndrome (GAMOS) is a severe autosomal-recessive disease characterized by the combination of early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly with brain anomalies. To date, mutations of WDR73 are the only known monogenic cause of GAMOS and in most affected individuals the molecular diagnosis remains elusive. We here identify recessive mutations of OSGEP, TP53RK, TPRKB, or LAGE3, encoding the 4 subunits of the KEOPS complex in 33 individuals of 30 families with GAMOS. CRISPR/Cas9 knockout in zebrafish and mice recapitulates the human phenotype of microcephaly and results in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibits cell proliferation, which human mutations fail to rescue, and knockdown of either gene activates DNA damage response signaling and induces apoptosis. OSGEP and TP53RK molecularly interact and co-localize with the actin-regulating ARP2/3 complex. Furthermore, knockdown of OSGEP and TP53RK induces defects of the actin cytoskeleton and reduces migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identify 4 novel monogenic causes of GAMOS, describe the first link between KEOPS function and human disease, and delineate potential pathogenic mechanisms. PMID:28805828
The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels
Directory of Open Access Journals (Sweden)
Miguel A. Hernández-Prieto
2017-02-01
Full Text Available Ancient oxygenic photosynthetic prokaryotes produced oxygen as a waste product, but existed for a long time under an oxygen-free (anoxic atmosphere, before an oxic atmosphere emerged. The change in oxygen levels in the atmosphere influenced the chemistry and structure of many enzymes that contained prosthetic groups that were inactivated by oxygen. In the genome of Acaryochloris marina, multiple gene copies exist for proteins that are normally encoded by a single gene copy in other cyanobacteria. Using high throughput RNA sequencing to profile transcriptome responses from cells grown under microoxic and hyperoxic conditions, we detected 8446 transcripts out of the 8462 annotated genes in the Cyanobase database. Two-thirds of the 50 most abundant transcripts are key proteins in photosynthesis. Microoxic conditions negatively affected the levels of expression of genes encoding photosynthetic complexes, with the exception of some subunits. In addition to the known regulation of the multiple copies of psbA, we detected a similar transcriptional pattern for psbJ and psbU, which might play a key role in the altered components of photosystem II. Furthermore, regulation of genes encoding proteins important for reactive oxygen species-scavenging is discussed at genome level, including, for the first time, specific small RNAs having possible regulatory roles under varying oxygen levels.
The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels
Hernández-Prieto, Miguel A.; Lin, Yuankui; Chen, Min
2016-01-01
Ancient oxygenic photosynthetic prokaryotes produced oxygen as a waste product, but existed for a long time under an oxygen-free (anoxic) atmosphere, before an oxic atmosphere emerged. The change in oxygen levels in the atmosphere influenced the chemistry and structure of many enzymes that contained prosthetic groups that were inactivated by oxygen. In the genome of Acaryochloris marina, multiple gene copies exist for proteins that are normally encoded by a single gene copy in other cyanobacteria. Using high throughput RNA sequencing to profile transcriptome responses from cells grown under microoxic and hyperoxic conditions, we detected 8446 transcripts out of the 8462 annotated genes in the Cyanobase database. Two-thirds of the 50 most abundant transcripts are key proteins in photosynthesis. Microoxic conditions negatively affected the levels of expression of genes encoding photosynthetic complexes, with the exception of some subunits. In addition to the known regulation of the multiple copies of psbA, we detected a similar transcriptional pattern for psbJ and psbU, which might play a key role in the altered components of photosystem II. Furthermore, regulation of genes encoding proteins important for reactive oxygen species-scavenging is discussed at genome level, including, for the first time, specific small RNAs having possible regulatory roles under varying oxygen levels. PMID:27974439
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
Simulating evolution of protein complexes through gene duplication and co-option.
Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter
2016-06-21
We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Passas, Georgios; Freear, Steven; Fawcett, Darren
2010-01-01
Space-time coding (STC) is an important milestone in modern wireless communications. In this technique, more copies of the same signal are transmitted through different antennas (space) and different symbol periods (time), to improve the robustness of a wireless system by increasing its diversity gain. STCs are channel coding algorithms that can be readily implemented on a field programmable gate array (FPGA) device. This work provides some figures for the amount of required FPGA hardware resources, the speed that the algorithms can operate and the power consumption requirements of a space-time block code (STBC) encoder. Seven encoder very high-speed integrated circuit hardware description language (VHDL) designs have been coded, synthesised and tested. Each design realises a complex orthogonal space-time block code with a different transmission matrix. All VHDL designs are parameterisable in terms of sample precision. Precisions ranging from 4 bits to 32 bits have been synthesised. Alamouti's STBC encoder design [Alamouti, S.M. (1998), 'A Simple Transmit Diversity Technique for Wireless Communications', IEEE Journal on Selected Areas in Communications, 16:55-108.] proved to be the best trade-off, since it is on average 3.2 times smaller, 1.5 times faster and requires slightly less power than the next best trade-off in the comparison, which is a 3/4-rate full-diversity 3Tx-antenna STBC.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
DEFF Research Database (Denmark)
Salomonsen, J; Dunon, D; Skjødt, K
1991-01-01
B-G antigens are a polymorphic multigene family of cell surface molecules encoded by the chicken major histocompatibility complex (MHC). They have previously been described only on cells of the erythroid lineage. By using flow cytometry, section staining, and immunoprecipitation with monoclonal a...
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
β-Cyclodextrin-curcumin complex inhibit telomerase gene ...
African Journals Online (AJOL)
Yomi
2011-12-21
Dec 21, 2011 ... have various applications in cancer therapy. But, its low water solubility and bioavailability is possible for poor drug delivery of curcumin. In this study, we prepared β-cyclodextrin-curcumin complex to determine the inhibitory effect of this drug on telomerase gene expression. Curcumin was encapsulated.
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Park, Sunchung; Oh, Sookyung; Ek-Ramos, Julissa; van Nocker, Steven
2010-06-01
The human Paf1 complex (Paf1C) subunit Parafibromin assists in mediating output from the Wingless/Int signaling pathway, and dysfunction of the encoding gene HRPT2 conditions specific cancer-related disease phenotypes. Here, we characterize the organismal and molecular roles of PLANT HOMOLOGOUS TO PARAFIBROMIN (PHP), the Arabidopsis (Arabidopsis thaliana) homolog of Parafibromin. PHP resides in an approximately 670-kD protein complex in nuclear extracts, and physically interacts with other known Paf1C-related proteins in vivo. In striking contrast to the developmental pleiotropy conferred by mutation in other plant Paf1C component genes in Arabidopsis, loss of PHP specifically conditioned accelerated phase transition from vegetative growth to flowering and resulted in misregulation of a very limited subset of genes that included the flowering repressor FLOWERING LOCUS C. Those genes targeted by PHP were distinguished from the bulk of Arabidopsis genes and other plant Paf1C targets by strong enrichment for trimethylation of lysine-27 on histone H3 (H3K27me3) within chromatin. These findings suggest that PHP is a component of a plant Paf1C protein in Arabidopsis, but has a more specialized role in modulating expression of a subset of Paf1C targets.
Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M
1998-04-01
Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.
Lee, Bumshik; Kim, Munchurl
2016-08-01
In this paper, a low complexity coding unit (CU)-level rate and distortion estimation scheme is proposed for High Efficiency Video Coding (HEVC) hardware-friendly implementation where a Walsh-Hadamard transform (WHT)-based low-complexity integer discrete cosine transform (DCT) is employed for distortion estimation. Since HEVC adopts quadtree structures of coding blocks with hierarchical coding depths, it becomes more difficult to estimate accurate rate and distortion values without actually performing transform, quantization, inverse transform, de-quantization, and entropy coding. Furthermore, DCT for rate-distortion optimization (RDO) is computationally high, because it requires a number of multiplication and addition operations for various transform block sizes of 4-, 8-, 16-, and 32-orders and requires recursive computations to decide the optimal depths of CU or transform unit. Therefore, full RDO-based encoding is highly complex, especially for low-power implementation of HEVC encoders. In this paper, a rate and distortion estimation scheme is proposed in CU levels based on a low-complexity integer DCT that can be computed in terms of WHT whose coefficients are produced in prediction stages. For rate and distortion estimation in CU levels, two orthogonal matrices of 4×4 and 8×8 , which are applied to WHT that are newly designed in a butterfly structure only with addition and shift operations. By applying the integer DCT based on the WHT and newly designed transforms in each CU block, the texture rate can precisely be estimated after quantization using the number of non-zero quantized coefficients and the distortion can also be precisely estimated in transform domain without de-quantization and inverse transform required. In addition, a non-texture rate estimation is proposed by using a pseudoentropy code to obtain accurate total rate estimates. The proposed rate and the distortion estimation scheme can effectively be used for HW-friendly implementation of
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
A functional TOC complex contributes to gravity signal transduction in Arabidopsis.
Strohm, Allison K; Barrett-Wilt, Greg A; Masson, Patrick H
2014-01-01
Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism.
Directory of Open Access Journals (Sweden)
Meehan Conor J
2012-11-01
Full Text Available Abstract Background Several links have been established between the human gut microbiome and conditions such as obesity and inflammatory bowel syndrome. This highlights the importance of understanding what properties of the gut microbiome can affect the health of the human host. Studies have been undertaken to determine the species composition of this microbiome and infer functional profiles associated with such host properties. However, lateral gene transfer (LGT between community members may result in misleading taxonomic attributions for the recipient organisms, thus making species-function links difficult to establish. Results We identified a peptides/nickel transport complex whose components differed in abundance based upon levels of host obesity, and assigned the encoded proteins to members of the microbial community. Each protein was assigned to several distinct taxonomic groups, with moderate levels of agreement observed among different proteins in the complex. Phylogenetic trees of these proteins produced clusters that differed greatly from taxonomic attributions and indicated that habitat-directed LGT of this complex is likely to have occurred, though not always between the same partners. Conclusions These findings demonstrate that certain membrane transport systems may be an important factor within an obese-associated gut microbiome and that such complexes may be acquired several times by different strains of the same species. Additionally, an example of individual proteins from different organisms being transferred into one operon was observed, potentially demonstrating a functional complex despite the donors of the subunits being taxonomically disparate. Our results also highlight the potential impact of habitat-directed LGT on the resident microbiota.
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Kenyon, Johanna J; Shneider, Mikhail M; Senchenkova, Sofya N; Shashkov, Alexander S; Siniagina, Maria N; Malanin, Sergey Y; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2016-08-01
Polymerization of the oligosaccharides (K units) of complex capsular polysaccharides (CPSs) requires a Wzy polymerase, which is usually encoded in the gene cluster that directs K unit synthesis. Here, a gene cluster at the Acinetobacter K locus (KL) that lacks a wzy gene, KL19, was found in Acinetobacter baumannii ST111 isolates 28 and RBH2 recovered from hospitals in the Russian Federation and Australia, respectively. However, these isolates produced long-chain capsule, and a wzy gene was found in a 6.1 kb genomic island (GI) located adjacent to the cpn60 gene. The GI also includes an acetyltransferase gene, atr25, which is interrupted by an insertion sequence (IS) in RBH2. The capsule structure from both strains was →3)-α-d-GalpNAc-(1→4)-α-d-GalpNAcA-(1→3)-β-d-QuipNAc4NAc-(1→, determined using NMR spectroscopy. Biosynthesis of the K unit was inferred to be initiated with QuiNAc4NAc, and hence the Wzy forms the β-(1→3) linkage between QuipNAc4NAc and GalpNAc. The GalpNAc residue is 6-O-acetylated in isolate 28 only, showing that atr25 is responsible for this acetylation. The same GI with or without an IS in atr25 was found in draft genomes of other KL19 isolates, as well as ones carrying a closely related CPS gene cluster, KL39, which differs from KL19 only in a gene for an acyltransferase in the QuiNAc4NR synthesis pathway. Isolates carrying a KL1 variant with the wzy and atr genes each interrupted by an ISAba125 also have this GI. To our knowledge, this study is the first report of genes involved in capsule biosynthesis normally found at the KL located elsewhere in A. baumannii genomes.
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry
The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
An Intensional Concurrent Faithful Encoding of Turing Machines
Directory of Open Access Journals (Sweden)
Thomas Given-Wilson
2014-10-01
Full Text Available The benchmark for computation is typically given as Turing computability; the ability for a computation to be performed by a Turing Machine. Many languages exploit (indirect encodings of Turing Machines to demonstrate their ability to support arbitrary computation. However, these encodings are usually by simulating the entire Turing Machine within the language, or by encoding a language that does an encoding or simulation itself. This second category is typical for process calculi that show an encoding of lambda-calculus (often with restrictions that in turn simulates a Turing Machine. Such approaches lead to indirect encodings of Turing Machines that are complex, unclear, and only weakly equivalent after computation. This paper presents an approach to encoding Turing Machines into intensional process calculi that is faithful, reduction preserving, and structurally equivalent. The encoding is demonstrated in a simple asymmetric concurrent pattern calculus before generalised to simplify infinite terms, and to show encodings into Concurrent Pattern Calculus and Psi Calculi.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
Photorhabdus luminescens genes induced upon insect infection
Directory of Open Access Journals (Sweden)
Jung Kirsten
2008-05-01
to regulate the expression of toxin genes, including tccC1 (encoding an insecticidal toxin complex, and others encoding putative toxins. A comparably high number of metabolic genes or operons were observed to be induced upon infection; among these were eutABC, hutUH, and agaZSVCD, which encode proteins involved in ethanolamine, histidine and tagatose degradation, respectively. The results reflect rearrangements in metabolism and the use of other metabolites available from the insect. Furthermore, enhanced activity of promoters controlling the expression of genes encoding enzymes linked to antibiotic production and/or resistance was observed. Antibiotic production and resistance may influence competition with other bacteria, and thus might be important for a successful infection. Lastly, several genes of unknown function were identified that may represent novel pathogenicity factors. Conclusion We show that a DFI screen is useful for identifying genes or operons induced by chemical stimuli, such as diluted insect homogenate. A bioinformatics comparison of motifs similar to known promoters is a powerful tool for identifying regulated genes or operons. We conclude that signals for the regulation of those genes or operons induced in P. luminescens upon insect infection may represent a wide variety of compounds that make up the insect host. Our results provide insight into the complex response to the host that occurs in a bacterial pathogen, particularly reflecting the potential for metabolic shifts and other specific changes associated with virulence.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410